Establishment of an Animal Model for Chronic Renal Injury Induced by Nutcracker Syndrome and Analysis of Potential Mechanisms

Establishment of an Animal Model for Chronic Renal Injury Induced by Nutcracker Syndrome and Analysis of Potential Mechanisms | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Establishment of an Animal Model for Chronic Renal Injury Induced by Nutcracker Syndrome and Analysis of Potential Mechanisms Wensong Wu, Aisha Awuti·Aisha, Fan Chang, Zhang Jianghui, Tang Shuai, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4517670/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Oct, 2024 Read the published version in International Urology and Nephrology → Version 1 posted You are reading this latest preprint version Abstract Background Although the conservative treatment duration for Nutcracker Syndrome (NCS) has been recommended by experts, it lacks supporting literature from basic experiments. This study aims to construct an animal model of NCS to investigate the kidney damage under different congestion durations in rats. Method We innovatively established a rat model of NCS and relieved renal congestion through secondary surgery, with renal vein reperfusion confirmed by animal ultrasound. Histopathological changes in congested kidneys at 3, 6, and 9 days were evaluated using HE and Masson staining, and the expression of renal injury factors was determined using q-PCR. Additionally, we preliminarily explored the molecular mechanisms of NCS using bioinformatics techniques. Results Renal tissue pathology changes were evident with prolonged obstruction time. Compared to the sham-operated group, no apparent fibrosis was observed in the kidneys at 3 days post-congestion, whereas fibrosis was most severe at 9 days post-congestion, with no significant improvement even after blood flow restoration. 6 days post-congestion relief, there was some alleviation of renal fibrosis. q-PCR results indicated a significant reduction in fibrosis markers' expression after 3 or 6 days of renal vein ligation release. Following restoration of blood flow on the 9th day post-congestion, there were no significant changes in fibrosis markers. Five hub genes, including MMP2, CD4, CD44, COL1A1, and FN1, were identified as key genes associated with NCS. We screened 86 compounds related to these hub genes as potential therapeutic drugs for NCS. Conclusion By matching the lifespan of rats with human lifespan, we conclude that patients with mild NCS symptoms can receive conservative treatment for six months; if conservative treatment is ineffective, surgical intervention should be considered. Nutcracker Syndrome Renal congestion Fibrosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Nutcracker Syndrome (NCS), also known as left renal vein entrapment syndrome, is a vascular compression disorder characterized by compression of the left renal vein between the abdominal aorta and the superior mesenteric artery[1]. Despite being relatively rare, the epidemiological features of Nutcracker Syndrome have not been extensively studied, and prevalence rates vary due to geographical, ethnic, and population heterogeneity[2]. Some studies, however, suggest a higher risk of occurrence in female patients. Nutcracker Syndrome can occur at any age, but it is more prevalent among young individuals aged 20 to 30[3]. Common clinical symptoms include hematuria, which can be microscopic or gross, originating from the rupture of thin-walled veins in the renal pelvis; orthostatic proteinuria, often accompanied by pelvic and flank pain, as well as varicosities in the gonadal veins[4]. The diagnosis of NCS primarily relies on imaging results, including ultrasound, CT scans, venography, and intravascular ultrasound (IVUS). Confirming the diagnosis of NCS solely through imaging remains challenging[5]. Clinical signs and symptoms presented by the patient are crucial in formulating treatment plans. The treatment standards for NCS are currently a subject of controversy, both in terms of choosing appropriate treatments based on the severity of the condition and devising optimal treatment plans for specific individuals. Literature suggests conservative treatment for mild hematuria or tolerable symptoms[6]. However, for patients with gross hematuria (especially recurrent cases), surgical intervention may be considered, particularly for those experiencing severe symptoms such as flank pain, anemia, and renal dysfunction. Consensus on when to treat NCS is still lacking, with some literature suggesting surgery may be considered after 24 months of conservative treatment for patients under 18 years old or 6 months for adults when conservative measures prove ineffective[2, 7]. Although the conservative treatment duration for NCS has been recommended by experts, it lacks supporting literature from basic experiments. Given the rare occurrence of NCS as a chronic congestion disorder, researchers face challenges in obtaining relevant pathological tissue samples. Therefore, there is an urgent need to establish animal models to study the chronic congestion damage of the kidneys in NCS and explore its underlying mechanisms. Bioinformatics is an interdisciplinary field that applies principles from computer science, mathematics, and statistics to the field of biology[8]. Researchers employ bioinformatics to analyze large volumes of biological data, such as genomics, transcriptomics, proteomics, and metabolomics, to explore the underlying mechanisms of diseases[9]. This study aims to construct an animal model of NCS to investigate the kidney damage under different congestion durations in rats and to observe whether kidney injury is reversible by restoring renal venous blood flow through secondary surgery. Additionally, we utilized bioinformatics techniques to preliminarily explore the molecular mechanisms of NCS. Method Animal model We selected male Sprague-Dawley (SD) rats weighing between 150 grams and 200 grams, randomly dividing them into the Sham group (sham surgery group), Renal Congestion 3 days group, Renal Congestion 3 days relief group, Renal Congestion 6 days group, and Renal Congestion 6 days relief group, Renal Congestion 9 days group, Renal Congestion 9 days relief group with 6 rats in each group. In the Sham group, a midline incision was made along the rat's abdominal white line, and a sham surgery procedure was performed, where the rat underwent the liberation of the left renal vein followed by closure of the abdomen. To meet the diagnostic criteria for human NCS (the ratio of the dilated to obstructed renal vein diameter greater than 3), we measured the left renal vein diameter of rats weighing between 150 grams and 200 grams to be approximately 2.5 millimeters. After loosening the left renal vein, a 0.7-millimeter fine needle was placed parallel to the renal vein. Subsequently, the left renal vein was ligated using surgical suture along with the fine needle, and the needle was finally withdrawn, resulting in partial ligation of the left renal vein. The diameter of the ligated portion of the renal vein decreased to 0.7 millimeters, and dilation of the vein near the renal end fulfilled the diagnostic criteria for NCS. Rats in the Renal Congestion group were euthanized at 3 and 5 days postoperatively, and the left kidneys were removed. Rats in the loosening group underwent re-opening of the abdomen at 3 and 5 days postoperatively, the original ligation site was identified, and careful dissection and release of the obstruction were performed. These rats were euthanized again two weeks after the release, and the left renal tissues were collected. Pathological experiments The renal tissues underwent a 24-hour fixation period in 10% paraformaldehyde. Subsequently, the fixed tissues underwent dehydration in varying concentrations of ethanol and clarification in xylene. Following this, the prepared tissue specimens were immersed in liquid paraffin for another 24 hours, ensuring comprehensive impregnation and solidification within the paraffin. The embedded tissues were then precision-cut into thin sections utilizing a microtome, and these sections were carefully transferred onto glass slides. The slides underwent a xylene treatment to eliminate excess paraffin, followed by a dehydration process with gradually increasing ethanol concentrations. Finally, the sections underwent staining with the hematoxylin and eosin (HE) staining solution, producing blue-stained cell nuclei and pink-stained cytoplasm and cellular structures. Masson's staining solution was additionally applied for the visualization of collagen fibers in the sections. Ultimately, the sections were mounted on glass slides and sealed with a transparent adhesive, facilitating observation under a microscope. Real-time PCR RNA was extracted from renal tissues using the Trizol method, and subsequently, the obtained RNA was reverse transcribed into cDNA using a reverse transcription kit. For the qPCR amplification reaction, a PCR reaction mixture comprising cDNA, primers, and either SYBR Green or probes was meticulously prepared. The qPCR amplification reaction underwent multiple cycles in a PCR instrument, facilitating the exponential growth of DNA through a stepwise process of heating and cooling. Fluorescence signals were detected after each cycle, with SYBR Green emitting fluorescence signals and the probe method precisely measuring the quantity of DNA by detecting fluorescence signals from the probes. This process ensures reliable quantitative data on the expression levels of the target genes. The gene primer sequences involved were: KIM-1-F: TCCTGTGGGATTCATGCAGT; KIM-1-R: GCAGGAGGCCTGAAATGAAG; Col1a1-R: AAGTTCCGGTGTGACTCGTG; α-SMA-F: GTCCCAGACATCAGGGAGTAA, α-SMA-R: TCGGATACTTCAGCGTCAGGA; fibronectin-F: ATGTGGACCCCTCCTGATAGT, fibronectin-R: GCCCAGTGATTTCAGCAAAGG; GAPDH-F: CCGCATCTTCTTGTGCAGTG, GAPDH-R: CGATACGGCCAAATCCGTTC. Animal ultrasound To demonstrate the restoration of renal venous blood flow after the release of ligatures, we utilized small animal ultrasound to measure the blood flow in the left kidney. Bioinformatics analysis We retrieved mRNA expression matrices of congested kidney tissue and normal kidney tissue from the GEO database. Subsequently, we used |logFC|>1 and p < 0.01 as a threshold to screen out differentially expressed genes (DEGs), which are considered to be potential molecules of renal damage caused by NCS. We constructed a PPI network of the DEGs using the STRING database and visualized it using Cytoscape software. Physiological processes and pathways associated with the DEGs were analyzed using the ClueGO plugin. Then, we identified hub genes related to NCS using the cytoHubba plugin and searched for potential drugs related to these hub genes in the DGIdb database as potential therapeutic approaches for treating NCS in the future. Statistics The difference of gene expression in this study was conducted using paired t-tests, with p < 0.05 considered statistically significant. Results Construction of rat renal congestion model Figure 1 illustrates the surgical procedure for constructing the renal congestion model. Following the ligation of the left renal vein, the diameter of the distal renal vein expands due to increased venous pressure ( Fig. 2 A ) . We compared the renal vein blood flow between the relief group and the sham operation group, revealing ample blood flow in both groups ( Fig. 2 B and C) . The average flow velocity of renal vein in sham group was 9.57cm/s, and that in relief group was 9.87cm/s, with no significant differences. Animal ultrasound revealed abundant blood flow in the left renal veins. These results indicated that the renal vein is unobstructed after releasing the ligation site. HE and Masson The results of HE staining showed that compared with the sham operation group, the tubular epithelium in the congestion group exhibited compression, shrinkage, and evident detachment and necrosis of epithelial cells, indicating structural damage ( Fig. 3 ) . The pathological changes in renal tissue became more pronounced with prolonged obstruction time, and severe rupture of tubular epithelial cells was observed at 9 days of congestion. Two weeks after restoring renal venous blood flow, significant tissue recovery was observed in the 3-day congestion group. Some degree of improvement was also noted after restoring blood flow at 6 days of obstruction, with a notable reduction in necrotic and detached epithelium in the tubules, although the structural disorder persisted compared to normal tubules. However, no significant changes in the pathological structure of renal tissue were observed 2 weeks after blood flow restoration following 9 days of congestion. Masson staining results revealed fibrosis in the renal interstitium and around the tubules in the congestion group compared to the sham operation group ( Fig. 4 ) . The arrow in the picture refers to the fibrous tissue that appears in the kidney tissue. No significant fibrosis was observed in the kidneys at 3 days of congestion. The fibrotic response was most severe after 9 days of congestion, and there was no significant improvement in renal fibrosis even after blood flow restoration. It is noteworthy that after 6 days of congestion and subsequent blood flow restoration, there was some alleviation in the degree of renal fibrosis, although a small amount of fibrous tissue persisted. Expression of renal damage-related factors We compared the expression levels of KIM-1 in the kidneys of rats from different groups ( Fig. 5 A ) . The results revealed that there was no significant change in KIM-1 expression in the kidneys after 3 days of congestion, but a significant increase was observed after 6 days of congestion. Following the restoration of renal venous blood flow after 6 days of congestion, KIM-1 expression was significantly downregulated, whereas there was no significant change in KIM-1 expression after the restoration of blood flow following 9 days of congestion. We also investigated the expression of markers associated with renal fibrosis, including α-SMA, COL1A1, and fibronectin ( Fig. 5 B-D ) . The results showed that with prolonged congestion, the expression of fibrosis-related markers in the kidneys gradually increased. Importantly, after the renal vein ligation was released on the 3rd or 6th day, the renal blood flow was completely recanalized for 2 weeks, and the expression of these fibrosis markers decreased significantly, which was consistent with the previous pathological results. However, after restoring blood flow on the 9th day of congestion, there was no significant change in the fibrotic indicators. This suggests that if renal blood flow in congested kidneys is restored within 6 days, ischemic kidney injury can be alleviated. This underscores the importance of actively treating NCS. Potential molecular mechanism and therapeutic drugs of NCS We identified 264 DEGs in NCS, which exhibit close associations among them. Functional enrichment analysis using the ClueGO plugin revealed that these DEGs may be involved in biological processes such as extracellular matrix structural constituent, metanephric glomerular capillary formation, and negative regulation of autophagic cell death ( Fig. 6 A ) . Additionally, enrichment was observed in pathways including complement and coagulation cascades, ECM-receptor interaction, and focal adhesion ( Fig. 6 B ) . Five hub genes, including MMP2, CD4, CD44, COL1A1, and FN1, were identified as key genes associated with NCS using the CytoHubba plugin ( Fig. 7 ) . Furthermore, we screened 86 compounds associated with these hub genes as potential therapeutic drugs for NCS. Detailed information can be found in Supplementary material . Discussion NCS is currently facing several limitations in research, especially the difficulty in obtaining human renal tissue samples from NCS patients for detailed histopathological analysis. The limited availability of such samples hinders in-depth exploration of the structural and molecular changes occurring in the affected kidneys. To address this challenge, the development of reliable animal models to simulate the pathophysiology of NCS is crucial for experimental studies. In this study, we simulated NCS by partially ligating the left renal vein in rats, inducing partial congestion in the left kidney. To assess the impact of congestion duration on renal damage, we set two groups with congestion periods of 3, 6, and 9 days, followed by the release of left renal vein obstruction. All rats were euthanized two weeks after obstruction release to observe histopathological changes in the kidneys and measure fibrosis indicators. Our results indicated that renal pathological changes were more severe after 9 days of congestion. Masson staining results revealed fibrosis in the renal interstitium and around the tubules in the congestion group compared to the sham operation group. No significant fibrosis was observed in the kidneys at 3 days of congestion. The fibrotic response was most severe after 9 days of congestion. This suggests that congestion leads to more severe renal damage, which becomes more apparent with prolonged duration. Surprisingly, after relieving vein obstruction, there was no significant alleviation in renal fibrosis during the two-week recovery period, indicating that congestion-induced renal fibrosis may be irreversible after 9 days of congestion. As a marker of renal injury, KIM-1 showed no significant changes in the early stages of renal congestion. However, after 6 days of congestion, there was a notable decrease in KIM-1 expression upon restoration of blood flow. Conversely, following 9 days of congestion and subsequent blood flow restoration, there were no significant alterations in KIM-1 expression, indicating the presence of sustained and irreversible renal damage with prolonged congestion. Previous studies have shown that chronic and persistent increases in KIM-1 can lead to renal fibrosis, but it is unclear whether renal fibrosis caused by NCS is related to KIM-1. Previous studies have indicated that the progression of renal fibrosis does not continue after the relief of ureteral obstruction[10]. However, the renal damage induced by the obstruction persists, aligning with consistent findings from prior research[11]. Therefore, considering the kidney's strong compensatory capacity, it is insufficient to rely solely on the presence or absence of renal functional impairment and the severity of clinical symptoms to determine whether active intervention for NCS is necessary. Long-term chronic congestion-induced renal ischemia and hypoxia lead to irreversible fibrotic damage to the kidneys, posing a potential threat to the future renal status of patients. Given that chronic kidney disease has become a major global burden, future management of chronic kidney diseases will focus more on early intervention. The molecular mechanisms involved in NCS remain unclear and may include chronic inflammation, cell apoptosis, and emerging research focuses such as ferroptosis and cuproptosis, which require further investigation by researchers. We further explored the potential molecular mechanisms underlying renal congestion using bioinformatics techniques. We identified that complement and coagulation cascades, ECM-receptor interaction, and focal adhesion may be involved in renal injury induced by renal congestion. There exists a close interaction and cross-regulation between the complement system and the coagulation system, which contributes to maintaining the balance of immune and hemostatic functions in the body[12]. Additionally, in certain disease states such as inflammatory diseases, autoimmune diseases, and thrombotic diseases, the complement and coagulation cascades also play crucial roles. The involvement of the complement and coagulation systems in the process of fibrosis is also noteworthy. Fibrosis, characterized by increased deposition of fibrillar proteins in damaged tissues, leads to abnormal changes in tissue structure and function[13]. The complement and coagulation systems are implicated in the development and progression of various fibrotic diseases, including liver cirrhosis, renal fibrosis, and pulmonary fibrosis[14, 15]. The hallmark of NCS is a series of symptoms caused by the obstruction of venous return[16]. We hypothesize that obstructed venous blood flow may induce abnormal coagulation function, leading to the activation of complement and coagulation cascades, triggering interstitial inflammation, increased deposition of interstitial fibrillar proteins, and ultimately inducing macrophages and vascular smooth muscle cells to cause renal fibrosis. However, this is only our speculation, and further exploration is required to elucidate the molecular mechanisms behind renal congestion induced by NCS. This study represents the first basic research endeavor focusing on NCS. We innovatively constructed a straightforward and practical animal model for NCS. Additionally, we preliminarily demonstrated, through a surgical procedure resembling human NCS operation, that prolonged renal congestion leads to seemingly irreversible renal fibrosis. Our findings suggest that rats exhibit irreversible conditions after 9 days of renal congestion, with noticeable fibrosis appearing as early as the 6th day, despite the potential reversibility of this process upon restoration of blood flow. Given that the lifespan of 6 days in rats is approximately equivalent to six months in humans[17], our conclusions from fundamental experiments confirm the viewpoint that patients with mild NCS symptoms may undergo conservative treatment for six months; surgical intervention should be considered if conservative treatment proves ineffective[2, 7, 18]. The development of kidney disease is complex. Inflammation, ischemia and hypoxia, oxidative stress, apoptosis, or the crosstalk of multiple mechanisms may be the causes of kidney injury caused by NCS. This study only revealed the appearance of kidney damage caused by NCS at different time periods. The underlying molecular mechanism is still unclear, which requires follow-up research to prove. However, this study has its limitations. Firstly, it is a preliminary experiment, and many shortcomings that we did not consider may still exist. Secondly, although the lifespan of rats can roughly correspond to that of humans, it remains an approximation. Lastly, the molecular mechanisms underlying NCS have not been fully elucidated in our study; we only conducted preliminary analyses using bioinformatics techniques. Therefore, further experiments are warranted to validate our findings. Conclusion Prolonged renal congestion leads to irreversible renal fibrosis. Our conclusions from fundamental experiments confirm the viewpoint that patients with mild NCS symptoms may undergo conservative treatment for six months; surgical intervention should be considered if conservative treatment proves ineffective. The molecular mechanisms underlying NCS have not been fully elucidated in our study, further experiments are warranted to validate our findings. Declarations Authors’ contributions The provided concept and study objective were created by Wu Wensong. Chang Fan and Wu Wensong created the study and wrote the article. Zhang Jianghui collected the information. Chang Fan, Wu Wensong, Tang Shuai, Lv Zheng and Liu Xuehui carried out the analysis. The results of this study were overseen by Chen Fangmin. The paper has been read and approved by all authors. Funding: This study was supported by the Tianjin Health Science and Technology Project (ZC20130). Data availability All relevant data during this study are within the paper. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interest. Ethics approval and consent to participate: This study was approved by the Ethics Committee of the Third Central Hospital of Tianjin (2023-SYDWLL-000214). References Kolber MK, Cui Z, Chen CK, Habibollahi P, Kalva SP: Nutcracker syndrome: diagnosis and therapy . Cardiovasc Diagn Ther , 11 (5):1140-1149. Ananthan K, Onida S, Davies AH: Nutcracker Syndrome: An Update on Current Diagnostic Criteria and Mana gement Guidelines . Eur J Vasc Endovasc Surg , 53 (6):886-894. Wang L, Yi L, Yang L, Liu Z, Rao J, Liu L, Yang J: Diagnosis and surgical treatment of nutcracker syndrome: a single-cent er experience . Urology , 73 (4):871-876. Nastasi DR, Fraser AR, Williams AB, Bhamidi V: A systematic review on nutcracker syndrome and proposed diagnostic alg orithm . J Vasc Surg Venous Lymphat Disord , 10 (6):1410-1416. Kim SH: Doppler US and CT Diagnosis of Nutcracker Syndrome . Korean J Radiol , 20 (12):1627-1637. Kurklinsky AK, Rooke TW: Nutcracker phenomenon and nutcracker syndrome . Mayo Clin Proc , 85 (6):552-559. Venkatachalam S, Bumpus K, Kapadia SR, Gray B, Lyden S, Shishehbor MH: The nutcracker syndrome . Ann Vasc Surg , 25 (8):1154-1164. Uesaka K, Oka H, Kato R, Kanie K, Kojima T, Tsugawa H, Toda Y, Horinouchi T: Bioinformatics in bioscience and bioengineering: Recent advances, appl ications, and perspectives . J Biosci Bioeng , 134 (5):363-373. Johnson CH, Ivanisevic J, Benton HP, Siuzdak G: Bioinformatics: the next frontier of metabolomics . Anal Chem , 87 (1):147-156. Yin C, Wang N: Kidney injury molecule-1 in kidney disease . Ren Fail , 38 (10):1567-1573. Ito K, Chen J, El Chaar M, Stern JM, Seshan SV, Khodadadian JJ, Richardson I, Hyman MJ, Vaughan ED, Jr., Poppas DP et al : Renal damage progresses despite improvement of renal function after re lief of unilateral ureteral obstruction in adult rats . Am J Physiol Renal Physiol , 287 (6):F1283-1293. de Bont CM, Boelens WC, Pruijn GJM: NETosis, complement, and coagulation: a triangular relationship . Cell Mol Immunol 2019, 16 (1):19-27. Henderson NC, Rieder F, Wynn TA: Fibrosis: from mechanisms to medicines . Nature , 587 (7835):555-566. Stallone G, Pontrelli P, Rascio F, Castellano G, Gesualdo L, Grandaliano G: Coagulation and Fibrinolysis in Kidney Graft Rejection . Front Immunol , 11 :1807. Lo MW, Kemper C, Woodruff TM: COVID-19: Complement, Coagulation, and Collateral Damage . J Immunol , 205 (6):1488-1495. Granata A, Distefano G, Sturiale A, Figuera M, Foti PV, Palmucci S, Basile A: From Nutcracker Phenomenon to Nutcracker Syndrome: A Pictorial Review . Diagnostics (Basel) , 11 (1):101. Dutta S, Sengupta P: Men and mice: Relating their ages . Life Sci , 152 :244-248. Yun SJ, Lee JM, Nam DH, Ryu JK, Lee SH: Discriminating renal nutcracker syndrome from asymptomatic nutcracker phenomenon using multidetector computed tomography . Abdom Radiol (NY) , 41 (8):1580-1588. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.xlsx Cite Share Download PDF Status: Published Journal Publication published 18 Oct, 2024 Read the published version in International Urology and Nephrology → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4517670","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":311224311,"identity":"c7608b91-0742-4445-a0a1-4dca7560ac8e","order_by":0,"name":"Wensong Wu","email":"","orcid":"","institution":"The Third Central Clinical College of Tianjin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wensong","middleName":"","lastName":"Wu","suffix":""},{"id":311224312,"identity":"4024a188-75af-4366-a1b8-d77c19777642","order_by":1,"name":"Aisha Awuti·Aisha","email":"","orcid":"","institution":"The Third Central Clinical College of Tianjin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Aisha","middleName":"","lastName":"Awuti·Aisha","suffix":""},{"id":311224313,"identity":"b662ba3b-3573-4602-bbd1-fb4aae095671","order_by":2,"name":"Fan Chang","email":"","orcid":"","institution":"The Third Central Hospital of Tianjin","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fan","middleName":"","lastName":"Chang","suffix":""},{"id":311224314,"identity":"e83110fd-6737-41c6-b4bd-e8b6505880a0","order_by":3,"name":"Zhang Jianghui","email":"","orcid":"","institution":"The Third Central Hospital of Tianjin","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhang","middleName":"","lastName":"Jianghui","suffix":""},{"id":311224315,"identity":"c415d8d5-2033-47d2-9228-ec6474ecbefe","order_by":4,"name":"Tang Shuai","email":"","orcid":"","institution":"The Third Central Hospital of Tianjin","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tang","middleName":"","lastName":"Shuai","suffix":""},{"id":311224316,"identity":"19dbaf30-da2c-4913-b875-79f56dc2747b","order_by":5,"name":"Zheng Lv","email":"","orcid":"","institution":"The Third Central Hospital of Tianjin","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zheng","middleName":"","lastName":"Lv","suffix":""},{"id":311224321,"identity":"e64069eb-eb5b-466a-be27-2da4ed5685e3","order_by":6,"name":"Fangmin Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABE0lEQVRIie3PMUvDQBTA8RcOzuVq1ncE7Ve4EIgWsf0qCYFMwcXlJg0EXqfiGkHwKzip40mh032AgotB6KTQqSAoGLqWxI4O9+M4OLg/7w7Acf6hScWMWSs89ofvpj0nwNsd+xJ1QGlT69NIlnmyZyJsFAmr0wdTqG0CfyUnmMQ4IPRuS7t5+3rOh4fAXl4FjC+6klGd5CgJme/NnsKZLUICnp0JyC47xyyTBYaEXFaDx3ac9ghEHAgwadmZpITtEmohVvKH9ITA3/Qmys6ZMhZRWcGDARVpO4X3JnJKXlNqVLLmcXBEeUaMR6M7lXUmPvPX8291dX2DbCU/KTu/n1bN8kOPu/+yi20fvP99x3EcZ9cvEZxUcQ0dt8sAAAAASUVORK5CYII=","orcid":"","institution":"The Third Central Hospital of Tianjin","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Fangmin","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2024-06-02 15:52:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4517670/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4517670/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11255-024-04245-9","type":"published","date":"2024-10-18T15:57:02+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":58751535,"identity":"132b8995-8ef9-4917-99e3-9ab363b07f15","added_by":"auto","created_at":"2024-06-20 16:10:16","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":47691,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental flow chart\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4517670/v1/7fa5820870e04e53c85f1720.jpeg"},{"id":58751541,"identity":"f9c10a49-8a9a-4949-bba7-36545dfe879d","added_by":"auto","created_at":"2024-06-20 16:10:17","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":978653,"visible":true,"origin":"","legend":"\u003cp\u003eKidney condition after left renal vein obstruction and relief of obstruction. (A) Left renal congestion. (B) Left renal vein obstruction relief. (C) Renal blood flow after left renal vein obstruction relief.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4517670/v1/1aaf3b8496f1d85fd3018ec5.jpeg"},{"id":58751540,"identity":"2cc89d70-3493-4a8b-b690-2cd8e9027125","added_by":"auto","created_at":"2024-06-20 16:10:17","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":740798,"visible":true,"origin":"","legend":"\u003cp\u003eHE staining.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4517670/v1/7571d5f42f8be3efe1fcd4d3.jpeg"},{"id":58753392,"identity":"1d0f6a37-ed00-4443-9516-722a147b1653","added_by":"auto","created_at":"2024-06-20 16:18:17","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":795242,"visible":true,"origin":"","legend":"\u003cp\u003eMasson staining.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4517670/v1/6e4abd8009c70c1218f7530a.jpeg"},{"id":58751538,"identity":"d1260e0c-1ad5-455a-9652-308208e103bb","added_by":"auto","created_at":"2024-06-20 16:10:17","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":161224,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of renal damage-related factors. (A)KIM-1, (B) α-SMA, (C) fibronectin, (D)COL1A1.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4517670/v1/7decbd1cf46d86d35e8fec21.jpeg"},{"id":58751543,"identity":"1e717578-8a3f-4ffb-814b-9d9379db846d","added_by":"auto","created_at":"2024-06-20 16:10:17","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":269863,"visible":true,"origin":"","legend":"\u003cp\u003eFunctional enrichment analysis of DEGs. (A) GO analysis, (B) KEGG analysis.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4517670/v1/c907c69f1ee0ba131f6ebabb.jpeg"},{"id":58751542,"identity":"e60ba710-2de8-4671-8d3c-0ff013bc9c16","added_by":"auto","created_at":"2024-06-20 16:10:17","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":271350,"visible":true,"origin":"","legend":"\u003cp\u003eThe relationship between hub genes and potential drugs\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4517670/v1/7fb89e78d309b093b4053168.jpeg"},{"id":67149120,"identity":"cfe81b48-112c-4394-ad6b-3d9395d91c6a","added_by":"auto","created_at":"2024-10-21 16:12:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3983142,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4517670/v1/64ab0171-2f6d-4270-bcd2-044c03b4c32c.pdf"},{"id":58751536,"identity":"a97c0042-5073-4bae-910c-6c8c7f317e63","added_by":"auto","created_at":"2024-06-20 16:10:17","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":137191,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4517670/v1/00c88919c329f20d481127ae.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Establishment of an Animal Model for Chronic Renal Injury Induced by Nutcracker Syndrome and Analysis of Potential Mechanisms","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNutcracker Syndrome (NCS), also known as left renal vein entrapment syndrome, is a vascular compression disorder characterized by compression of the left renal vein between the abdominal aorta and the superior mesenteric artery[1]. Despite being relatively rare, the epidemiological features of Nutcracker Syndrome have not been extensively studied, and prevalence rates vary due to geographical, ethnic, and population heterogeneity[2]. Some studies, however, suggest a higher risk of occurrence in female patients. Nutcracker Syndrome can occur at any age, but it is more prevalent among young individuals aged 20 to 30[3]. Common clinical symptoms include hematuria, which can be microscopic or gross, originating from the rupture of thin-walled veins in the renal pelvis; orthostatic proteinuria, often accompanied by pelvic and flank pain, as well as varicosities in the gonadal veins[4]. The diagnosis of NCS primarily relies on imaging results, including ultrasound, CT scans, venography, and intravascular ultrasound (IVUS). Confirming the diagnosis of NCS solely through imaging remains challenging[5].\u003c/p\u003e \u003cp\u003eClinical signs and symptoms presented by the patient are crucial in formulating treatment plans. The treatment standards for NCS are currently a subject of controversy, both in terms of choosing appropriate treatments based on the severity of the condition and devising optimal treatment plans for specific individuals. Literature suggests conservative treatment for mild hematuria or tolerable symptoms[6]. However, for patients with gross hematuria (especially recurrent cases), surgical intervention may be considered, particularly for those experiencing severe symptoms such as flank pain, anemia, and renal dysfunction. Consensus on when to treat NCS is still lacking, with some literature suggesting surgery may be considered after 24 months of conservative treatment for patients under 18 years old or 6 months for adults when conservative measures prove ineffective[2, 7]. Although the conservative treatment duration for NCS has been recommended by experts, it lacks supporting literature from basic experiments. Given the rare occurrence of NCS as a chronic congestion disorder, researchers face challenges in obtaining relevant pathological tissue samples. Therefore, there is an urgent need to establish animal models to study the chronic congestion damage of the kidneys in NCS and explore its underlying mechanisms. Bioinformatics is an interdisciplinary field that applies principles from computer science, mathematics, and statistics to the field of biology[8]. Researchers employ bioinformatics to analyze large volumes of biological data, such as genomics, transcriptomics, proteomics, and metabolomics, to explore the underlying mechanisms of diseases[9].\u003c/p\u003e \u003cp\u003eThis study aims to construct an animal model of NCS to investigate the kidney damage under different congestion durations in rats and to observe whether kidney injury is reversible by restoring renal venous blood flow through secondary surgery. Additionally, we utilized bioinformatics techniques to preliminarily explore the molecular mechanisms of NCS.\u003c/p\u003e"},{"header":"Method","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimal model\u003c/h2\u003e \u003cp\u003eWe selected male Sprague-Dawley (SD) rats weighing between 150 grams and 200 grams, randomly dividing them into the Sham group (sham surgery group), Renal Congestion 3 days group, Renal Congestion 3 days relief group, Renal Congestion 6 days group, and Renal Congestion 6 days relief group, Renal Congestion 9 days group, Renal Congestion 9 days relief group with 6 rats in each group. In the Sham group, a midline incision was made along the rat's abdominal white line, and a sham surgery procedure was performed, where the rat underwent the liberation of the left renal vein followed by closure of the abdomen. To meet the diagnostic criteria for human NCS (the ratio of the dilated to obstructed renal vein diameter greater than 3), we measured the left renal vein diameter of rats weighing between 150 grams and 200 grams to be approximately 2.5 millimeters. After loosening the left renal vein, a 0.7-millimeter fine needle was placed parallel to the renal vein. Subsequently, the left renal vein was ligated using surgical suture along with the fine needle, and the needle was finally withdrawn, resulting in partial ligation of the left renal vein. The diameter of the ligated portion of the renal vein decreased to 0.7 millimeters, and dilation of the vein near the renal end fulfilled the diagnostic criteria for NCS. Rats in the Renal Congestion group were euthanized at 3 and 5 days postoperatively, and the left kidneys were removed. Rats in the loosening group underwent re-opening of the abdomen at 3 and 5 days postoperatively, the original ligation site was identified, and careful dissection and release of the obstruction were performed. These rats were euthanized again two weeks after the release, and the left renal tissues were collected.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePathological experiments\u003c/h2\u003e \u003cp\u003eThe renal tissues underwent a 24-hour fixation period in 10% paraformaldehyde. Subsequently, the fixed tissues underwent dehydration in varying concentrations of ethanol and clarification in xylene. Following this, the prepared tissue specimens were immersed in liquid paraffin for another 24 hours, ensuring comprehensive impregnation and solidification within the paraffin. The embedded tissues were then precision-cut into thin sections utilizing a microtome, and these sections were carefully transferred onto glass slides. The slides underwent a xylene treatment to eliminate excess paraffin, followed by a dehydration process with gradually increasing ethanol concentrations. Finally, the sections underwent staining with the hematoxylin and eosin (HE) staining solution, producing blue-stained cell nuclei and pink-stained cytoplasm and cellular structures. Masson's staining solution was additionally applied for the visualization of collagen fibers in the sections. Ultimately, the sections were mounted on glass slides and sealed with a transparent adhesive, facilitating observation under a microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eReal-time PCR\u003c/h2\u003e \u003cp\u003eRNA was extracted from renal tissues using the Trizol method, and subsequently, the obtained RNA was reverse transcribed into cDNA using a reverse transcription kit. For the qPCR amplification reaction, a PCR reaction mixture comprising cDNA, primers, and either SYBR Green or probes was meticulously prepared. The qPCR amplification reaction underwent multiple cycles in a PCR instrument, facilitating the exponential growth of DNA through a stepwise process of heating and cooling. Fluorescence signals were detected after each cycle, with SYBR Green emitting fluorescence signals and the probe method precisely measuring the quantity of DNA by detecting fluorescence signals from the probes. This process ensures reliable quantitative data on the expression levels of the target genes.\u003c/p\u003e \u003cp\u003eThe gene primer sequences involved were: KIM-1-F: TCCTGTGGGATTCATGCAGT; KIM-1-R: GCAGGAGGCCTGAAATGAAG; Col1a1-R: AAGTTCCGGTGTGACTCGTG; α-SMA-F: GTCCCAGACATCAGGGAGTAA, α-SMA-R: TCGGATACTTCAGCGTCAGGA; fibronectin-F: ATGTGGACCCCTCCTGATAGT, fibronectin-R: GCCCAGTGATTTCAGCAAAGG; GAPDH-F: CCGCATCTTCTTGTGCAGTG, GAPDH-R: CGATACGGCCAAATCCGTTC.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAnimal ultrasound\u003c/h2\u003e \u003cp\u003eTo demonstrate the restoration of renal venous blood flow after the release of ligatures, we utilized small animal ultrasound to measure the blood flow in the left kidney.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analysis\u003c/h2\u003e \u003cp\u003eWe retrieved mRNA expression matrices of congested kidney tissue and normal kidney tissue from the GEO database. Subsequently, we used |logFC|\u0026gt;1 and p\u0026thinsp;\u0026lt;\u0026thinsp;0.01 as a threshold to screen out differentially expressed genes (DEGs), which are considered to be potential molecules of renal damage caused by NCS. We constructed a PPI network of the DEGs using the STRING database and visualized it using Cytoscape software. Physiological processes and pathways associated with the DEGs were analyzed using the ClueGO plugin. Then, we identified hub genes related to NCS using the cytoHubba plugin and searched for potential drugs related to these hub genes in the DGIdb database as potential therapeutic approaches for treating NCS in the future.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistics\u003c/h2\u003e \u003cp\u003eThe difference of gene expression in this study was conducted using paired t-tests, with p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of rat renal congestion model\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e illustrates the surgical procedure for constructing the renal congestion model. Following the ligation of the left renal vein, the diameter of the distal renal vein expands due to increased venous pressure \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. We compared the renal vein blood flow between the relief group and the sham operation group, revealing ample blood flow in both groups \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB \u003cb\u003eand C)\u003c/b\u003e. The average flow velocity of renal vein in sham group was 9.57cm/s, and that in relief group was 9.87cm/s, with no significant differences. Animal ultrasound revealed abundant blood flow in the left renal veins. These results indicated that the renal vein is unobstructed after releasing the ligation site.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eHE and Masson\u003c/h2\u003e \u003cp\u003eThe results of HE staining showed that compared with the sham operation group, the tubular epithelium in the congestion group exhibited compression, shrinkage, and evident detachment and necrosis of epithelial cells, indicating structural damage \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. The pathological changes in renal tissue became more pronounced with prolonged obstruction time, and severe rupture of tubular epithelial cells was observed at 9 days of congestion. Two weeks after restoring renal venous blood flow, significant tissue recovery was observed in the 3-day congestion group. Some degree of improvement was also noted after restoring blood flow at 6 days of obstruction, with a notable reduction in necrotic and detached epithelium in the tubules, although the structural disorder persisted compared to normal tubules. However, no significant changes in the pathological structure of renal tissue were observed 2 weeks after blood flow restoration following 9 days of congestion. Masson staining results revealed fibrosis in the renal interstitium and around the tubules in the congestion group compared to the sham operation group \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. The arrow in the picture refers to the fibrous tissue that appears in the kidney tissue. No significant fibrosis was observed in the kidneys at 3 days of congestion. The fibrotic response was most severe after 9 days of congestion, and there was no significant improvement in renal fibrosis even after blood flow restoration. It is noteworthy that after 6 days of congestion and subsequent blood flow restoration, there was some alleviation in the degree of renal fibrosis, although a small amount of fibrous tissue persisted.\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eExpression of renal damage-related factors\u003c/h2\u003e \u003cp\u003eWe compared the expression levels of KIM-1 in the kidneys of rats from different groups \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. The results revealed that there was no significant change in KIM-1 expression in the kidneys after 3 days of congestion, but a significant increase was observed after 6 days of congestion. Following the restoration of renal venous blood flow after 6 days of congestion, KIM-1 expression was significantly downregulated, whereas there was no significant change in KIM-1 expression after the restoration of blood flow following 9 days of congestion. We also investigated the expression of markers associated with renal fibrosis, including α-SMA, COL1A1, and fibronectin \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-D\u003cb\u003e)\u003c/b\u003e. The results showed that with prolonged congestion, the expression of fibrosis-related markers in the kidneys gradually increased. Importantly, after the renal vein ligation was released on the 3rd or 6th day, the renal blood flow was completely recanalized for 2 weeks, and the expression of these fibrosis markers decreased significantly, which was consistent with the previous pathological results. However, after restoring blood flow on the 9th day of congestion, there was no significant change in the fibrotic indicators. This suggests that if renal blood flow in congested kidneys is restored within 6 days, ischemic kidney injury can be alleviated. This underscores the importance of actively treating NCS.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePotential molecular mechanism and therapeutic drugs of NCS\u003c/h2\u003e \u003cp\u003eWe identified 264 DEGs in NCS, which exhibit close associations among them. Functional enrichment analysis using the ClueGO plugin revealed that these DEGs may be involved in biological processes such as extracellular matrix structural constituent, metanephric glomerular capillary formation, and negative regulation of autophagic cell death \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. Additionally, enrichment was observed in pathways including complement and coagulation cascades, ECM-receptor interaction, and focal adhesion \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. Five hub genes, including MMP2, CD4, CD44, COL1A1, and FN1, were identified as key genes associated with NCS using the CytoHubba plugin \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Furthermore, we screened 86 compounds associated with these hub genes as potential therapeutic drugs for NCS. Detailed information can be found in \u003cb\u003eSupplementary material\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eNCS is currently facing several limitations in research, especially the difficulty in obtaining human renal tissue samples from NCS patients for detailed histopathological analysis. The limited availability of such samples hinders in-depth exploration of the structural and molecular changes occurring in the affected kidneys. To address this challenge, the development of reliable animal models to simulate the pathophysiology of NCS is crucial for experimental studies. In this study, we simulated NCS by partially ligating the left renal vein in rats, inducing partial congestion in the left kidney. To assess the impact of congestion duration on renal damage, we set two groups with congestion periods of 3, 6, and 9 days, followed by the release of left renal vein obstruction. All rats were euthanized two weeks after obstruction release to observe histopathological changes in the kidneys and measure fibrosis indicators. Our results indicated that renal pathological changes were more severe after 9 days of congestion. Masson staining results revealed fibrosis in the renal interstitium and around the tubules in the congestion group compared to the sham operation group. No significant fibrosis was observed in the kidneys at 3 days of congestion. The fibrotic response was most severe after 9 days of congestion. This suggests that congestion leads to more severe renal damage, which becomes more apparent with prolonged duration. Surprisingly, after relieving vein obstruction, there was no significant alleviation in renal fibrosis during the two-week recovery period, indicating that congestion-induced renal fibrosis may be irreversible after 9 days of congestion. As a marker of renal injury, KIM-1 showed no significant changes in the early stages of renal congestion. However, after 6 days of congestion, there was a notable decrease in KIM-1 expression upon restoration of blood flow. Conversely, following 9 days of congestion and subsequent blood flow restoration, there were no significant alterations in KIM-1 expression, indicating the presence of sustained and irreversible renal damage with prolonged congestion. Previous studies have shown that chronic and persistent increases in KIM-1 can lead to renal fibrosis, but it is unclear whether renal fibrosis caused by NCS is related to KIM-1. Previous studies have indicated that the progression of renal fibrosis does not continue after the relief of ureteral obstruction[10]. However, the renal damage induced by the obstruction persists, aligning with consistent findings from prior research[11]. Therefore, considering the kidney's strong compensatory capacity, it is insufficient to rely solely on the presence or absence of renal functional impairment and the severity of clinical symptoms to determine whether active intervention for NCS is necessary. Long-term chronic congestion-induced renal ischemia and hypoxia lead to irreversible fibrotic damage to the kidneys, posing a potential threat to the future renal status of patients. Given that chronic kidney disease has become a major global burden, future management of chronic kidney diseases will focus more on early intervention. The molecular mechanisms involved in NCS remain unclear and may include chronic inflammation, cell apoptosis, and emerging research focuses such as ferroptosis and cuproptosis, which require further investigation by researchers. We further explored the potential molecular mechanisms underlying renal congestion using bioinformatics techniques. We identified that complement and coagulation cascades, ECM-receptor interaction, and focal adhesion may be involved in renal injury induced by renal congestion. There exists a close interaction and cross-regulation between the complement system and the coagulation system, which contributes to maintaining the balance of immune and hemostatic functions in the body[12]. Additionally, in certain disease states such as inflammatory diseases, autoimmune diseases, and thrombotic diseases, the complement and coagulation cascades also play crucial roles. The involvement of the complement and coagulation systems in the process of fibrosis is also noteworthy. Fibrosis, characterized by increased deposition of fibrillar proteins in damaged tissues, leads to abnormal changes in tissue structure and function[13]. The complement and coagulation systems are implicated in the development and progression of various fibrotic diseases, including liver cirrhosis, renal fibrosis, and pulmonary fibrosis[14, 15]. The hallmark of NCS is a series of symptoms caused by the obstruction of venous return[16]. We hypothesize that obstructed venous blood flow may induce abnormal coagulation function, leading to the activation of complement and coagulation cascades, triggering interstitial inflammation, increased deposition of interstitial fibrillar proteins, and ultimately inducing macrophages and vascular smooth muscle cells to cause renal fibrosis. However, this is only our speculation, and further exploration is required to elucidate the molecular mechanisms behind renal congestion induced by NCS.\u003c/p\u003e \u003cp\u003eThis study represents the first basic research endeavor focusing on NCS. We innovatively constructed a straightforward and practical animal model for NCS. Additionally, we preliminarily demonstrated, through a surgical procedure resembling human NCS operation, that prolonged renal congestion leads to seemingly irreversible renal fibrosis. Our findings suggest that rats exhibit irreversible conditions after 9 days of renal congestion, with noticeable fibrosis appearing as early as the 6th day, despite the potential reversibility of this process upon restoration of blood flow. Given that the lifespan of 6 days in rats is approximately equivalent to six months in humans[17], our conclusions from fundamental experiments confirm the viewpoint that patients with mild NCS symptoms may undergo conservative treatment for six months; surgical intervention should be considered if conservative treatment proves ineffective[2, 7, 18]. The development of kidney disease is complex. Inflammation, ischemia and hypoxia, oxidative stress, apoptosis, or the crosstalk of multiple mechanisms may be the causes of kidney injury caused by NCS. This study only revealed the appearance of kidney damage caused by NCS at different time periods. The underlying molecular mechanism is still unclear, which requires follow-up research to prove.\u003c/p\u003e \u003cp\u003eHowever, this study has its limitations. Firstly, it is a preliminary experiment, and many shortcomings that we did not consider may still exist. Secondly, although the lifespan of rats can roughly correspond to that of humans, it remains an approximation. Lastly, the molecular mechanisms underlying NCS have not been fully elucidated in our study; we only conducted preliminary analyses using bioinformatics techniques. Therefore, further experiments are warranted to validate our findings.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eProlonged renal congestion leads to irreversible renal fibrosis. Our conclusions from fundamental experiments confirm the viewpoint that patients with mild NCS symptoms may undergo conservative treatment for six months; surgical intervention should be considered if conservative treatment proves ineffective. The molecular mechanisms underlying NCS have not been fully elucidated in our study, further experiments are warranted to validate our findings.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe provided concept and study objective were created by Wu Wensong. Chang Fan and Wu Wensong created the study and wrote the article. Zhang Jianghui collected the information. Chang Fan, Wu Wensong, Tang Shuai, Lv Zheng and Liu Xuehui carried out the analysis. The results of this study were overseen by Chen Fangmin. The paper has been read and approved by all authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This study was supported by the Tianjin Health Science and Technology Project (ZC20130).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll relevant data during this study are within the paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u0026nbsp;\u003c/strong\u003eThis study was approved by the Ethics Committee of the Third Central Hospital of Tianjin (2023-SYDWLL-000214).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eKolber MK, Cui Z, Chen CK, Habibollahi P, Kalva SP: \u003cstrong\u003eNutcracker syndrome: diagnosis and therapy\u003c/strong\u003e. \u003cem\u003eCardiovasc Diagn Ther\u003c/em\u003e, \u003cstrong\u003e11\u003c/strong\u003e(5):1140-1149.\u003c/li\u003e\n \u003cli\u003eAnanthan K, Onida S, Davies AH: \u003cstrong\u003eNutcracker Syndrome: An Update on Current Diagnostic Criteria and Mana gement Guidelines\u003c/strong\u003e. \u003cem\u003eEur J Vasc Endovasc Surg\u003c/em\u003e, \u003cstrong\u003e53\u003c/strong\u003e(6):886-894.\u003c/li\u003e\n \u003cli\u003eWang L, Yi L, Yang L, Liu Z, Rao J, Liu L, Yang J: \u003cstrong\u003eDiagnosis and surgical treatment of nutcracker syndrome: a single-cent er experience\u003c/strong\u003e. \u003cem\u003eUrology\u003c/em\u003e, \u003cstrong\u003e73\u003c/strong\u003e(4):871-876.\u003c/li\u003e\n \u003cli\u003eNastasi DR, Fraser AR, Williams AB, Bhamidi V: \u003cstrong\u003eA systematic review on nutcracker syndrome and proposed diagnostic alg orithm\u003c/strong\u003e. \u003cem\u003eJ Vasc Surg Venous Lymphat Disord\u003c/em\u003e, \u003cstrong\u003e10\u003c/strong\u003e(6):1410-1416.\u003c/li\u003e\n \u003cli\u003eKim SH: \u003cstrong\u003eDoppler US and CT Diagnosis of Nutcracker Syndrome\u003c/strong\u003e. \u003cem\u003eKorean J Radiol\u003c/em\u003e, \u003cstrong\u003e20\u003c/strong\u003e(12):1627-1637.\u003c/li\u003e\n \u003cli\u003eKurklinsky AK, Rooke TW: \u003cstrong\u003eNutcracker phenomenon and nutcracker syndrome\u003c/strong\u003e. \u003cem\u003eMayo Clin Proc\u003c/em\u003e, \u003cstrong\u003e85\u003c/strong\u003e(6):552-559.\u003c/li\u003e\n \u003cli\u003eVenkatachalam S, Bumpus K, Kapadia SR, Gray B, Lyden S, Shishehbor MH: \u003cstrong\u003eThe nutcracker syndrome\u003c/strong\u003e. \u003cem\u003eAnn Vasc Surg\u003c/em\u003e, \u003cstrong\u003e25\u003c/strong\u003e(8):1154-1164.\u003c/li\u003e\n \u003cli\u003eUesaka K, Oka H, Kato R, Kanie K, Kojima T, Tsugawa H, Toda Y, Horinouchi T: \u003cstrong\u003eBioinformatics in bioscience and bioengineering: Recent advances, appl ications, and perspectives\u003c/strong\u003e. \u003cem\u003eJ Biosci Bioeng\u003c/em\u003e, \u003cstrong\u003e134\u003c/strong\u003e(5):363-373.\u003c/li\u003e\n \u003cli\u003eJohnson CH, Ivanisevic J, Benton HP, Siuzdak G: \u003cstrong\u003eBioinformatics: the next frontier of metabolomics\u003c/strong\u003e. \u003cem\u003eAnal Chem\u003c/em\u003e, \u003cstrong\u003e87\u003c/strong\u003e(1):147-156.\u003c/li\u003e\n \u003cli\u003eYin C, Wang N: \u003cstrong\u003eKidney injury molecule-1 in kidney disease\u003c/strong\u003e. \u003cem\u003eRen Fail\u003c/em\u003e, \u003cstrong\u003e38\u003c/strong\u003e(10):1567-1573.\u003c/li\u003e\n \u003cli\u003eIto K, Chen J, El Chaar M, Stern JM, Seshan SV, Khodadadian JJ, Richardson I, Hyman MJ, Vaughan ED, Jr., Poppas DP\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eRenal damage progresses despite improvement of renal function after re lief of unilateral ureteral obstruction in adult rats\u003c/strong\u003e. \u003cem\u003eAm J Physiol Renal Physiol\u003c/em\u003e, \u003cstrong\u003e287\u003c/strong\u003e(6):F1283-1293.\u003c/li\u003e\n \u003cli\u003ede Bont CM, Boelens WC, Pruijn GJM: \u003cstrong\u003eNETosis, complement, and coagulation: a triangular relationship\u003c/strong\u003e. \u003cem\u003eCell Mol Immunol\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e16\u003c/strong\u003e(1):19-27.\u003c/li\u003e\n \u003cli\u003eHenderson NC, Rieder F, Wynn TA: \u003cstrong\u003eFibrosis: from mechanisms to medicines\u003c/strong\u003e. \u003cem\u003eNature\u003c/em\u003e, \u003cstrong\u003e587\u003c/strong\u003e(7835):555-566.\u003c/li\u003e\n \u003cli\u003eStallone G, Pontrelli P, Rascio F, Castellano G, Gesualdo L, Grandaliano G: \u003cstrong\u003eCoagulation and Fibrinolysis in Kidney Graft Rejection\u003c/strong\u003e. \u003cem\u003eFront Immunol\u003c/em\u003e, \u003cstrong\u003e11\u003c/strong\u003e:1807.\u003c/li\u003e\n \u003cli\u003eLo MW, Kemper C, Woodruff TM: \u003cstrong\u003eCOVID-19: Complement, Coagulation, and Collateral Damage\u003c/strong\u003e. \u003cem\u003eJ Immunol\u003c/em\u003e, \u003cstrong\u003e205\u003c/strong\u003e(6):1488-1495.\u003c/li\u003e\n \u003cli\u003eGranata A, Distefano G, Sturiale A, Figuera M, Foti PV, Palmucci S, Basile A: \u003cstrong\u003eFrom Nutcracker Phenomenon to Nutcracker Syndrome: A Pictorial Review\u003c/strong\u003e. \u003cem\u003eDiagnostics (Basel)\u003c/em\u003e, \u003cstrong\u003e11\u003c/strong\u003e(1):101.\u003c/li\u003e\n \u003cli\u003eDutta S, Sengupta P: \u003cstrong\u003eMen and mice: Relating their ages\u003c/strong\u003e. \u003cem\u003eLife Sci\u003c/em\u003e, \u003cstrong\u003e152\u003c/strong\u003e:244-248.\u003c/li\u003e\n \u003cli\u003eYun SJ, Lee JM, Nam DH, Ryu JK, Lee SH: \u003cstrong\u003eDiscriminating renal nutcracker syndrome from asymptomatic nutcracker phenomenon using multidetector computed tomography\u003c/strong\u003e. \u003cem\u003eAbdom Radiol (NY)\u003c/em\u003e, \u003cstrong\u003e41\u003c/strong\u003e(8):1580-1588.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Nutcracker Syndrome, Renal congestion, Fibrosis","lastPublishedDoi":"10.21203/rs.3.rs-4517670/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4517670/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eAlthough the conservative treatment duration for Nutcracker Syndrome (NCS) has been recommended by experts, it lacks supporting literature from basic experiments. This study aims to construct an animal model of NCS to investigate the kidney damage under different congestion durations in rats.\u003c/p\u003e\u003ch2\u003eMethod\u003c/h2\u003e \u003cp\u003eWe innovatively established a rat model of NCS and relieved renal congestion through secondary surgery, with renal vein reperfusion confirmed by animal ultrasound. Histopathological changes in congested kidneys at 3, 6, and 9 days were evaluated using HE and Masson staining, and the expression of renal injury factors was determined using q-PCR. Additionally, we preliminarily explored the molecular mechanisms of NCS using bioinformatics techniques.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eRenal tissue pathology changes were evident with prolonged obstruction time. Compared to the sham-operated group, no apparent fibrosis was observed in the kidneys at 3 days post-congestion, whereas fibrosis was most severe at 9 days post-congestion, with no significant improvement even after blood flow restoration. 6 days post-congestion relief, there was some alleviation of renal fibrosis. q-PCR results indicated a significant reduction in fibrosis markers' expression after 3 or 6 days of renal vein ligation release. Following restoration of blood flow on the 9th day post-congestion, there were no significant changes in fibrosis markers. Five hub genes, including MMP2, CD4, CD44, COL1A1, and FN1, were identified as key genes associated with NCS. We screened 86 compounds related to these hub genes as potential therapeutic drugs for NCS.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eBy matching the lifespan of rats with human lifespan, we conclude that patients with mild NCS symptoms can receive conservative treatment for six months; if conservative treatment is ineffective, surgical intervention should be considered.\u003c/p\u003e","manuscriptTitle":"Establishment of an Animal Model for Chronic Renal Injury Induced by Nutcracker Syndrome and Analysis of Potential Mechanisms","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-20 16:10:12","doi":"10.21203/rs.3.rs-4517670/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fe95b010-c6d2-4ce9-b32b-b57e490ff1d1","owner":[],"postedDate":"June 20th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-10-21T16:05:35+00:00","versionOfRecord":{"articleIdentity":"rs-4517670","link":"https://doi.org/10.1007/s11255-024-04245-9","journal":{"identity":"international-urology-and-nephrology","isVorOnly":false,"title":"International Urology and Nephrology"},"publishedOn":"2024-10-18 15:57:02","publishedOnDateReadable":"October 18th, 2024"},"versionCreatedAt":"2024-06-20 16:10:12","video":"","vorDoi":"10.1007/s11255-024-04245-9","vorDoiUrl":"https://doi.org/10.1007/s11255-024-04245-9","workflowStages":[]},"version":"v1","identity":"rs-4517670","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4517670","identity":"rs-4517670","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}