Impact of Lesinurad and Allopurinol on Experimental Hyperuricemia in mice: Biochemical, Molecular and Immunohistochemical Study

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-15

Lesinurad and allopurinol administration reduced uric acid and kidney damage in hyperuricemic mice by decreasing inflammatory markers and altering transporter expression.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-15 · read from full text

This paper examined whether the urate-lowering drugs lesinurad and allopurinol, alone or combined, ameliorate oxonate-induced hyperuricemia in male Swiss mice over seven days, using serum biochemistry (uric acid, BUN, xanthine oxidase activity, antioxidant enzymes), inflammatory cytokines (IL-1β, TNF-α), renal gene expression (mURAT-1, mGLUT-9, mOAT-1, mOAT-3 by qRT-PCR), and renal immunohistochemical TGF-β1. Both lesinurad and allopurinol significantly lowered serum uric acid and related biochemical and inflammatory measures and partially reversed renal transporter and TGF-β1 alterations, increasing renal uric acid secretion and excretion; combined treatment produced synergistic restoration of altered parameters and improved renal function. A major caveat is that the study relies on an oxonate-induced mouse model and focuses on biochemical/molecular readouts rather than directly assessing clinical manifestations. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

AbstractBackground : Hyperuricemia is an abnormal increase in uric acid levels in the blood. It is the cause of gout that manifested by inflammatory arthritis and painful disable. Therefore, current study evaluated the potential ameliorative impact of Lesinurad and Allopurinol on the kidneys of hyperuricemic mice at the biochemical, molecular and cellular levels. Methods : Lesinurad and allopurinol alone or in combination were orally administered to hyperuricemic and control mice for seven consecutive days. Levels of uric acid and blood urea nitrogen, along with antioxidants and inflammatory cytokines (IL-1β and TNF-a) were measured in the serum. The mRNA expression of mouse urate anion transporter-1, glucose transporter 9, organic anion transporters, in renal tissues were examined using quantitative real time PCR (qRT-PCR). Simultaneously, the immunoreactivity of transforming growth factor-beta 1 was examined immunohistochemically. Results : Lesinurad and allopurinol administration resulted in significant decrease in serum levels of uric acid, blood urea nitrogen, xanthine oxidase activity, catalase, glutathione peroxidase and inflammatory cytokines (IL-1β and TNF-a) reported in hyperuricemic mice. Both partially reversed oxonate-induced alterations in renal mURAT-1, mGLUT-9, mOAT-1 and mOAT-3 expressions, as well as alterations in the immunoreactivity of TGF- β1, resulting in the increase of renal uric acid secretion and excretion. The combined administration of lesinurad and ALP restored all altered parameters in a synergistic manner, improving renal function in the hyperuricemic mouse model employed. Conclusion : This study confirmed synergistic ameliorative hypouricemic impact of both lesinurad and allopurinol in the treatment of hyperuricemia in mice at the biochemical, molecular and cellular levels.
Full text 137,557 characters · extracted from preprint-html · click to expand
Impact of Lesinurad and Allopurinol on Experimental Hyperuricemia in mice: Biochemical, Molecular and Immunohistochemical Study | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article Impact of Lesinurad and Allopurinol on Experimental Hyperuricemia in mice: Biochemical, Molecular and Immunohistochemical Study Youseef Alghamdi, Mohamed Mohamed Soliman, Mohamed Nasan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.2.17096/v3 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 10 Feb, 2020 Read the published version in BMC Pharmacology and Toxicology → Version 3 posted 3 You are reading this latest preprint version Show more versions Abstract Background : Hyperuricemia is an abnormal increase in uric acid levels in the blood. It is the cause of gout that manifested by inflammatory arthritis and painful disable. Therefore, current study evaluated the potential ameliorative impact of Lesinurad and Allopurinol on the kidneys of hyperuricemic mice at the biochemical, molecular and cellular levels. Methods : Lesinurad and allopurinol alone or in combination were orally administered to hyperuricemic and control mice for seven consecutive days. Levels of uric acid and blood urea nitrogen, along with antioxidants and inflammatory cytokines (IL-1β and TNF-a) were measured in the serum. The mRNA expression of mouse urate anion transporter-1, glucose transporter 9, organic anion transporters, in renal tissues were examined using quantitative real time PCR (qRT-PCR). Simultaneously, the immunoreactivity of transforming growth factor-beta 1 was examined immunohistochemically. Results : Lesinurad and allopurinol administration resulted in significant decrease in serum levels of uric acid, blood urea nitrogen, xanthine oxidase activity, catalase, glutathione peroxidase and inflammatory cytokines (IL-1β and TNF-a) reported in hyperuricemic mice. Both partially reversed oxonate-induced alterations in renal mURAT-1, mGLUT-9, mOAT-1 and mOAT-3 expressions, as well as alterations in the immunoreactivity of TGF- β1, resulting in the increase of renal uric acid secretion and excretion. The combined administration of lesinurad and ALP restored all altered parameters in a synergistic manner, improving renal function in the hyperuricemic mouse model employed. Conclusion : This study confirmed synergistic ameliorative hypouricemic impact of both lesinurad and allopurinol in the treatment of hyperuricemia in mice at the biochemical, molecular and cellular levels. Clinical Pharmacology Lesinurad ameliorative effects hyperuricemia gene expression kidney affection XOD activity. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Background Uric acid (UA) is the end product of an exogenous and endogenous pool of purines metabolism. The exogenous pool is dependent on diet especially from animal proteins. The endogenous pool depends on the production of uric acid from the liver, intestines and other tissues [1]. Potential sources of the exogenous pool of hyperuricemia (HU) consists of food (i.e. purine rich products), glucose, and fructose [2], which is controlled by xanthine oxidase, that irreversibly oxidizes xanthine into uric acid (UA) [3, 4]. UA is primarily excreted through the kidneys in urine (65–75%) and to a lesser extent through the gastrointestinal tract (25–35%) [3, 5]. An increase in the level of uric acid in the blood is known as hyperuricemia , and is the cause of gout, which manifests in inflammatory arthritis and painful disabling with acute attacks [6]. HU is defined as an increase in UA levels over 7 mg/dL in men and 6 mg/dL in women [7]. HU is mainly associated with the following: (1) alcohol consumption; (2) a fructose rich diet; (3) excess consumption of seafood or meat; (4) diuretics; (5) some medications; and (6) angiotensin converting enzymes [8, 9]. Gout is associated with precipitation of monosodium urate (MSU) crystals in joints and soft tissues [10, 11]. Deposition of MSU crystals in the big toe, some joints and the ankle are associated with neutrophil infiltration, swelling and pain [12]. The first line of gout treatment is allopurinol (ALP), a xanthine oxidase inhibitor stimulating the renal secretion and excretion of UA [11]. Other anti-inflammatory non-steroidal drugs known to inhibit cyclooxygenase activity (i.e. cortisol, indomethacin and glucocorticoids) are beneficial for the treatment of gout [13]. However, these medications have severe side effects and interactions capable of harming human health [14]. A promising approach for the treatment of HU and its associated complications consists of alternative therapies, i.e. dietary flavonoids and hypouricemic curative agents with suboptimal doses devoid of undesirable ALP side effects. The need to identify safe drugs is therefore vital for both physicians and patients. A new medication used for treatment of HU is lesinurad, commonly named Zurampic (ZUR). ZUR was approved in December 2015 by the US Food and Drug Administration and works on the urate-anion exchanger transporter (URAT1) in combination with ALP [15]. Furthermore, URAT1 is a trans-membrane protein that acts as a urate-specific and organic anion exchanger, being localized in the luminal membrane of the proximal convoluted tubules [16]. URAT-1 action increased urate filtration and reabsorption from proximal convoluted tubules[17]. Lesinurad inhibits URAT1 and Organic Anion Transporters (OATs) controlling uric acid reabsorption, and increases the urinary excretion of uric acid [18]. A previous study postulate that the declined levels of serum uric acid levels takes place in response to the effect of lesinurad on renal urate. The current study therefore examined the ameliorative synergistic impact of lesinurad and ALP on oxonate-induced HU in mice at the biochemical, molecular and histopathological levels. Methods Chemicals and Kits Potassium Oxonate (PO), agarose, ALP and ethidium bromide were purchased from Sigma-Aldrich (St. Louis, MO, USA). Zurampic was purchased from Ironwood Pharmaceuticals, Inc., Cambridge, MA02142. 100 bp DNA ladder and reverse transcriptase enzymes were from MBI (Fermentas, Thermo Fisher Scientific, USA). Qiazol and Oligo dT were from QIAGEN (Valencia, CA, USA). The kits for catalase, MDA and glutathione peroxidase (GPx) were purchased from Biodiagnostic Co. (Dokki, Giza, Egypt). The kits for glutamate pyruvate transaminase (GPT), glutamate oxalate transaminase (GOT), blood urea nitrogen (BUN) and uric acid were from BIO-MED Diagnostics and EGY- CHEM for lab technology, Badr City, Egypt. Xanthine Oxidase kit (Catalog No: E-BC-K024), mouse IL-1 beta (Catalog No: E-EL-M0037) and mouse TNF-alpha (Catalog NO: E-EL-M0049) were obtained from Elabscience Biotechnology Inc. USA. In Vivo Animals and Design The Scientific Deanship of Taif University, Saudi Arabia, along with its Ethical Committee, approved all procedures used in this study for the project #1–439–6099, based on the NIH Guide for the care and use of laboratory animals. A total of forty-two male Swiss mice, ten weeks old, weighting 30-35 grams from college of pharmacy, King Abdel-Aziz University, Jeddah, Saudi Arabia were used for this study. To overcome stress and complete adaptation, the mice were handled manually for seven days. The animals were kept in a 12/12 hours day-dark cycle and were given free access to food and water. Seven groups (6 mice /group) were allocated to the following treatments: Group 1; negative control (CNT), gained free access to food and water. Group 2; positive hyperuricemic group (HU), received potassium oxonate (PO) intraperitoneally (250 mg/kg bw, once a day at 8:00 am). The dosages of PO and timing were determined as stated above [19]. Time of administration was fixed to avoid noctorinal and diurnal changes in biochemical measurements. Group 3 received orally allopurinol (ALP; 5 mg/kg body weight daily one hour after PO administration) for seven days [20]. Group 4 was administered orally ZUR in a dose of 80 mg/kg as stated by Wu et al. [21]. For seven days, groups 5 and 6 were administered PO at 8.00 am, followed by ALP for Group 5 and ZUR for Group 6 one hour later (9: 00 am). Group 7 was administered PO for seven days, followed by a combination of ALP and ZUR one hour later. For treatments in groups from 5 to 7, same doses given in group 3 and 4 were used. At the end of the experimental design (2 weeks), the mice inhaled dimethyl ether and were decapitated. Serum was extracted and stored at –20 ° C until biochemical measurements took place. Kidney and liver tissues were soaked in Qiazol for RNA extraction and in Bowan’s solution for histology and immunohistochemistry examination. Xanthine Oxidase activity Xanthine oxidase (XOD) catalyzes hypoxanthine, to form xanthine and superoxide anion free radicals, resulting in a purplish red substance in the presence of electronic receptors and a chromogenic agent. XOD activity can be calculated by measuring the OD value of the purplish red substance at 530 nm in serum samples. For liver tissues, following homogenization in normal saline on ice, in a ratio of one liver tissue and nine for normal saline, homogenate is centrifuged for ten minutes and supernatant used for assay. The XOD unite for serum values is U/l, and for liver homogenates is U/g protein tissue. The protocol employed was partially modified in accordance with the method of Haidari et al, [22]. Serum biochemistry, antioxidants, and cytokines assessments The serum levels of liver and kidney biomarkers were assayed calorimetrically, using specific commercial kits based on the manufacturer’s instruction manual. Antioxidants such as malondialdehyde (MDA), catalase and glutathione peroxidase as well as cytokines were measured spectrophotometrically using commercial ELISA kits explained in chemicals section based on kit attached description manual. RNA extraction, cDNA synthesis and quantitative real time PCR (qRT-PCR) Total RNA was extracted as described before [23] from the kidney tissues. Frozen samples were homogenized in a homogenizer. Chloroform (300 µL) was added to the homogenate, then centrifuged at 4 °C with 12000 rpm for ten minutes. The supernatant was separated and an equal volume of isopropyl alcohol was added then centrifuged at 4 °C with 12000 rpm for 15 minutes. The pellets of RNA were dissolved in Diethylpyrocarbonate (DEPC) water after washing with 70% alcohol and air drying. The integrity of RNA was confirmed [24]. 3 µg of extracted RNA and 0.5 ng oligo dT (Qiagen Valencia, CA, USA) was denatured following incubation in a Bio-Rad T100 TM Thermal Cycler at 70 °C for five minutes. Denatured RNA was reverse transcribed after the addition of 2 µL of 10 mM dNTPs, 100 U of M-MuLV (SibEnzyme, Ak, Novosibirsk, Russia) and 2 µL of 10X RT-buffer, before being incubated in a Bio-Rad T100 TM Thermal Cycler for one hour at 37 °C, then for ten minutes at 90 °C, to ensure enzyme inactivation. For quantitative real time PCR analysis (qRT-PCR), primers for the examined genes (Table 1) were designed using GenScript Real-time PCR (TaqMan) Primer Design ( https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool ). Each PCR reaction consisted of 1.5 μl of 1 μg/μl cDNA, 10 μl SYBR Green PCR Master Mix (Quanti Tect SYBR Green PCR Kit, Qiagen, Valencia, CA, USA), along with 1 μM of forward and reverse primer for each examined gene and nuclease free H 2 O to a final volume of 20 μl. Reactions were run and analyzed in Applied Biosystem 7500 Fast Real time PCR Detection system. qRT-PCR conditions are: 95°C for ten minutes (first denaturation) and forty cycles of 95°C for fifteen seconds (second denaturation stage) followed by 60 °C for one minute (annealing and extension stage). The critical threshold (Ct) of the target gene was normalized with quantities (Ct) of the housekeeping gene (β-actin), using the formula x = 2−ΔΔ Ct, where there is x = fold difference relative to the control. Histological and immunohistochemistry analyses of kidney The kidney tissue was dehydrated and embedded in paraffin, then sectioned at 5µm. The slides were subsequently stained with hematoxylin and eosin (H&E) and the morphological changes were examined using a microscope (Eclipse 80i, Nikon, Japan), with images being captured by a digital camera (Fuij Co., Sapporo, Japan). For immunohistochemistry, the paraffin-embedded renal sections were deparaffinized, rehydrated and immersed in H2O2 (3%) for ten minutes, in order to block any peroxidase activity. Following this, the slides were washed in phosphate buffer saline. Nonspecific binding sites were blocked by bovine serum albumin (5%) prior to the addition of TGF-β1 polyclonal antibody in a dilution of 1:300 overnight at 4 ₒ C. The slides were then washed in PBS and incubated with a secondary antibody, developed with 3.3’-diaminobezidine tetrahydrochloride and counterstained with hematoxyline. Statistical analysis Data are means ± standard error of six values collected from six different mice per each treatment. Data were analyzed using one-way ANOVA (analysis of variance) setting the probability level P<0.05, with the individual comparisons obtained by Duncan's multiple range tests for SPSS software version 11.5 for Windows (SPSS, IBM, Chicago, IL, USA). The probability level P<0.05 was considered statistically significant. Results The impact of Lesinurad and ALP on Liver and kidney biomarkers in hyperuricemic mice Hyperuricemic group showed an increase in serum levels of GPT, GOT, uric acid and BUN. HU group received either ALP or ZUR showed a decrease in GPT, GOT, uric acid and BUN levels [Figure 1A-B]. Co-administration of ALP and ZUR revealed an ameliorative and additive synergistic effect (P< 0.05) on the normalization of GPT, GOT, uric acid and BUN levels (Figure 1A). It should be noted that ZUR revealed same effect induced by ALP in hyperuricemic administered mice. The impact of Lesinurad and ALP on serum and hepatic XOD activity As shown in Figure 2, there was an increase of XOD activities in serum and liver of hyperuricemic mice. , This increase in XOD activity were significantly normalized to control levels in ALP and ZUR administered hyperuricemic mice. Combination treatment, using both ZUR and ALP, induced an additive and synergistic decrease in XOD activity compared to both hyperuricemic ALP and hyperuricemic ZUR treated groups. The impact of Lesinurad and ALP on antioxidant activities altered by hyperuricemia HU increased tissue degradation, represented by an increase in levels of MDA (Figure 3A), which was normalized in hyperuricemic mice by both ALP and ZUR treatment. HU decreased catalase and GPx levels that were readjusted following ALP administration, and to a lesser extent for ZUR administered groups (Figure 3B). Administration of ZUR to hyperuricemic mice, together with ALP, induced an additive ameliorative effect on the changes induced on MDA, catalase and GPx levels (Figure 3A, B). The impact of Lesinurad and ALP on changes in cytokines altered in hyperuricemic mice Figure 4 demonstrates the changes in serum levels of IL-1β and TNF-a. HU induced a state of inflammation, with a significant increase in serum levels of IL-1β and TNF-a (P< 0.05). Administration of ALP and ZUR to hyperuricemic mice normalized both IL-1β and TNF-a levels. Co-administration of ALP and ZUR induced a clear synergistic inhibitory effect on IL-1β and TNF-a ((P<0.05, Figure 4). The impact of Lesinurad and ALP on mRNA expression of renal genes associated with hyperuricemia This current study examined the expression levels of genes responsible for urate excretion and reabsorption in the kidneys (mOAT-1, mOAT-3, mURTA-1 and mGLUT9). As shown in Fig. 5, in comparison to the mice in the control group, oxonate administration induced a significant down-regulation of mRNA expression of mOAT-1 and mOAT-3 in mice kidneys, alongside a significant up-regulation of the mURAT-1 and mGlut-9 expressions (p< 0.05). The alteration in the mRNA expression of urate transporter-related genes was consistent with the elevation of serum uric acid and BUN levels. ALP and ZUR treatment alone showed a significant down-regulation in mURAT-1 and mGlut-9 mRNA levels, as well as up-regulation in mOAT-1 and mOAT-3 expression (Figure 5). The additive synergistic effect on altered genes could be clearly observed when ALP and ZUR were co-administered to the hyperuricemic group. The impact of Lesinurad and Allopurinol on renal histology and TGF- β1 immunoreactivity in hyperuricemic mice Histopathological examination revealed that the kidneys of the control group demonstrated a normal histological picture, including normal glomerular and tubular architecture (Figure 6A). However, the kidneys of the hyperuricemic group revealed shrinkage of glomerular tufts with periglomrular and interstitial round cells infiltration. Tubular lumina showed obvious urate crystals occluding the lumina (Figure 6B). The kidneys of the ALP administered group demonstrated no marked change in renal histology (Figure 6C), while the kidneys of the ZUR administered group revealed degeneration of renal tubules with a few interstitial round cells infiltration (Figure 6D). The kidneys of the hyperuricemic group treated with ALP showed restoration of normal glomerular and tubular architecture (Figure 6E), while those administered only with ZUR demonstrated a slight restoration of a normal picture, with the presence of interstitial oedema (Figure 6F). The kidneys of the hyperuricemic group treated with both ZUR and ALP demonstrated a normal histological picture of both glomerular and tubular tissue, including an absence of urate crystals (Figure 6G). Immunohistochemical examination of kidney for TGF-β1 immunoreactivity revealed ‎that the kidneys of hyperuricemic group showed a clear and strong expression for TGF-β1 ‎in kidney tissues‏ ‏‎(Figure 7B) in comparison to control group which showed no ‎immunoreactivity (Figure 7A). Same is reported for ALP administered group which showed no marked ‎expression of TGF-β1 in renal tissue (Figure 7C). The kidneys of the ZUR group revealed ‎a very faint expression of TGF-β1 in renal tubular tissue, having moderate intensity (Figure ‎‎7D). In addition, the kidneys of hyperuricemic group treated with ALP demonstrated an ‎absence of TGF-β1 expression in tubular tissues (Figure 7E). The kidneys of hyperuricemic ‎group treated with ZUR alone showed a moderate intensity for TGF-β1 in ‎kidney tissues (Figure 7F). However, the kidneys of the hyperuricemic group treated with ZUR and ALP showed glomerular and tubular tissue lacking of any TGF-β1 immunoreactivity ‎‎(Figure 7G). ‎ Discussion As noted above, hyperuricemia is a cause of gout, as well as a number of clinical disorders, including: chronic kidney disease; hypertension; diabetes; cardiovascular disorders; dyslipidemia; endothelial dysfunction; and atherosclerosis. HU is associated with an increase in the production of oxygen free radicals, oxidative stress and up-regulation of pro-inflammatory cytokines and mediators [13, 25]. The management of gout, cardiovascular and metabolic disorders depends on the activity of xanthine oxidase. The key for hyperuricemia control includes the inhibition of an overproduction of uric acid, along with inflammation and oxidative stress [26]. As previously discussed, uric acid induces a state of inflammation in the kidneys and causes an inflammatory reaction. This accords with a previous study reported relatively similar findings when employing Nuciferine [27]. A number of researchers have confirmed that gout shares many pathogenetic features associated with other inflammatory disorders, i.e. a rapid increase in the secretion of some pro-inflammatory cytokines (IL-1β, IL-6 and TNF-α) [28, 29]. The current study identified that the use of ALP or ZUR alone failed to reduce levels of IL-1β and TNF-α in hyperuricemic mice, suggesting that the co-administration of ALP and ZUR exerted their anti-inflammatory effect to prevent development of gout from HU. As known, catalases and peroxidases are oxidoreductases that are involved in the molecular defensive mechanisms against reactive oxygen species to counter act the harmful effect of H 2 O 2 [30]. The increased oxidative stress that occurs with cell damage and inflammation in mice is alleviated by an increase in catalase expression and or secretion [31]. In the parallel, the antioxidant enzyme; glutathione peroxidase (GPx); helps in scavenging cellular free radicals. GPx prevents lipid peroxidation and maintain intracellular homeostasis [32]. In current study, hyperuricemia increased ROS due to the increase in uric acid levels [33]. A significant decline was observed in the serum levels of catalase and GPx activities, accompanied by a significant increase in MDA levels in the hyperuricemic group compared to control. ALP (either alone, or in combination with ZUR) significantly normalized, and reversed, changes in the measured serum levels of antioxidants and the lipid peroxidation marker in hyperuricemic mice, thus suggesting that ALP and ZUR increased antioxidant enzyme activities through their impact on oxidative stress biomarkers. Xanthine oxidase inhibitors (ALP) are used as first-line therapy for patients with chronic gout, due to factors including availability, efficacy and low cost. However, ALP fails to lower the serum urate to the target level in a substantial subset of adherent patients. This results in the advice for Lesinurad therapy to be taken together with ALP. Lesinurad is a novel selective uricosuric, capable of overcoming the above limitations, while also proving effective in patients having an inadequate response to ALP monotherapy. Efforts have been made, over a number of decades, to find a wide range of sufficient and safe urate lowering drugs. The close association between HU, metabolic and cardiovascular comorbidities has raised further interest in the development of novel urate-lowering drugs [34]. Uricosurics remain the second choice for treatment of HU and gout, with all recent prescriptions supporting the combination of uricosurics and ALP once monotherapy of each has proved ineffective [35]. Lesinurad is a selective URAT-1 inhibitor approved for HU treatment associated with gout, in combination with ALP. Its exact molecular mechanism is not fully elucidated in animal models. In clinical trials using healthy volunteers, a single dose of ZUR significantly reduced serum UA [35-37], with its efficiency being due to approximately a third of the drug being excreted from the kidneys [36]. The drug should be taken for patients who are refractory to ALP therapy [38]. These current results prompted an investigation into the beneficial action of ZUR on genes capable of validating the excretion and secretion of uric acid [39]. Transporters play important roles in the pharmacology of xenobiotics that start with the recognition of the key contribution of P-glycoprotein to drug properties including biliary excretion, intestinal absorption, penetration the blood-brain barrier and drug-drug interactions [40]. Over 400 transporters expressed in various tissues throughout the body, comprising members of the solute carrier ATP binding cassette protein families have been reported [40]. OATs family comprises a group of over 10 trans-membrane proteins [41]. OAT1 to -5 are expressed mainly in the kidney, other members are expressed in remaining other tissues. OATs proteins act to maintain kidney homeostasis as urate efflux transporters [41]. Lesinurad has been reported to regulate OAT-1 and OAT-3 expression in in vitro studies [42]. That means, lesinurad and ALP interacts on the kidney to facilitate and increase urate excretion. The current study confirmed that lesinurad has the potential to act in synergistic way to control the expression of URAT-1, OAT 1 and -3 in kidney tissues to increase urate excretion and secretion. Serum BUN levels form the markers of renal dysfunction. In addition, mURAT-1 is the main regulator for urate reabsorption (50%), playing a key role in the homeostasis of urate [16]. The glucose transporter 9 (GLUT9) is a protein responsible for urate reabsorption [43], while OAT-1 and OAT-3 are responsible for renal primary urate excretion [44]. This suggests that abnormalities in renal urate transporters may have important implications for the impairment of uric acid excretion, along with HU. The findings of the current study indicate that HU up-regulated mURAT-1 and mGLUT-9 and down-regulated mOAT-1 and mOAT-3, while co-administration of Lesinurad and ALP induced ameliorative synergistic effects. In addition, ZUR and ALP induced up-regulation in mOAT1 and mOAT-3 mRNA, alongside down-regulation in mURAT1 and mGLUT9 in the kidneys of hyperuricemic mice, thus indicating an enhancement of urate excretion reducing serum UA levels. This study confirm that ZUR demonstrates additional uricosuric effects in the presence of ALP, which are mediated through renal mOAT1, mOAT-3, mURAT1 and mGLUT9 regulation in hyperuricemic mice. HU results in fibrosis and renal tissues injuries involving inflammation and fibroblast expansion with high levels of sodium in extracellular fluids due to an increase in uric acid levels resulting in tissue nucleation [45], thus leading to inflammation influencing the biology of renal interstitial cells [45]. The increase in UA causes the expansion of fibroblasts, as well as up-regulation in the immunoreactivity of profibrotic factors (TGF-β1), confirming the activation of fibrotic pathways in hyperuricemic patients [46]. As demonstrated in Figure 7, this alteration in TGF-β1 was confirmed during HU and normalization following co-administration of ZUR and ALP. Conclusions The present study confirmed that ALP and ZUR co-administration being capable of lowering serum UA. In addition, they led to an additive synergistic decrease in XOD activity in serum and liver tissues and ameliorated induced oxidative stress and changes in pro-inflammatory cytokines. Furthermore, ALP and ZUR co-administration synergistically down-regulated the mRNA expression of URAT1 and GLUT9, and up-regulated the mRNA expression of OAT1 and OAT-3 in hyperuricemic mice. Furthermore, both ALP and ZUR acted together to improve kidney pathomorphology. All ZUR and ALP effects are summarized in Figure 8. This study therefore suggests the advantages of the co-administration of ALP and ZUR for HU therapy for their beneficial effects on kidney at the biochemical, molecular and cellular levels. Abbreviations ALP: Allopurinol; BUN: Blood urea nitrogen; CNT: control; CT: cycle threshold; DEPC: diethylpyrocarbonate; GOT: glutamate oxalacetate transaminase; GPT: glutamate pyruvate transaminase; GPx: Glutathione peroxidase; H and E: Hematoxylin and eosin; HU: Hyperuricemia; IL-1b: Interleukin-1 beta; Malondialdehyde: MDA; mGLUT9: mouse glucose transporter 9; M-Mul V: moloney Murine Leukemia Virus; mURAT1: mouse urate anion transporter 1;MSU: monosodium urate; NF k B: Nuclear factor kappa-b; OATs: organic anion transporters; PBS: phosphate buffer saline; PO: Potassium oxonate; qRT-PCR: quantitative real time polymerase chain reaction; RNA: Ribonucleic acids; TBE: Tris-borate-EDTA; TGF-1b : transforming growth factor-1 beta; TNF-a: Tumor necrosis factor-alpha; UA: Uric acid; Xanthine Oxidase: XOD; ZUR: Zurampic. Declarations Ethics and Consent to participate This study was approved by The Scientific Deanship of Taif University, Saudi Arabia, along with its ethical committee approved this study, based on the NIH Guide for the care and use of laboratory animal. All precautions were followed to minimize animal suffering throughout the experiments. Consent to publish is not applicable’ in this section. Funding This study was completely supported by Taif university, Saudi Arabia for project number 1-439-6099. Acknowledgement We acknowledge Scientific Deanship of Taif University, Saudi Arabia, for financial support of current study. Availability of data and material Data are available up on request. Consent for publication Not applicable on this section Declaration Authors declare that no conflict of interest Author contributions All authors contributed equally to finish this finished work: YSA, MMS and MAN were responsible for the conception and design of the experiments; MAN, YSA and MMS undertook the experiments; MMS analyzed the data; MMS undertook the biochemical assays; MAN performed the histopathology; MMS was responsible for the gene expression; and YSA and MMS undertook the data interpretation. References Chaudhary K, Malhotra K, Sowers J, Aroor A: Uric Acid - key ingredient in the recipe for cardiorenal metabolic syndrome. Cardiorenal medicine 2013, 3: 208-220. Zgaga L, Theodoratou E, Kyle J, Farrington SM, Agakov F, Tenesa A, Walker M, McNeill G, Wright AF, Rudan I, et al: The association of dietary intake of purine-rich vegetables, sugar-sweetened beverages and dairy with plasma urate, in a cross-sectional study. PloS one 2012, 7: e38123. Rock KL, Kataoka H, Lai JJ: Uric acid as a danger signal in gout and its comorbidities. Nature reviews Rheumatology 2013, 9: 13-23. Jalal DI, Chonchol M, Chen W, Targher G: Uric acid as a target of therapy in CKD. American journal of kidney diseases : the official journal of the National Kidney Foundation 2013, 61: 134-146. de Oliveira EP, Burini RC: High plasma uric acid concentration: causes and consequences. Diabetology & metabolic syndrome 2012, 4: 12. Aung T, Myung G, FitzGerald JD: Treatment approaches and adherence to urate-lowering therapy for patients with gout. Patient preference and adherence 2017, 11: 795-800. Li L, Yang C, Zhao Y, Zeng X, Liu F, Fu P: Is hyperuricemia an independent risk factor for new-onset chronic kidney disease?: A systematic review and meta-analysis based on observational cohort studies. BMC nephrology 2014, 15: 122. Lapi F, Azoulay L, Yin H, Nessim SJ, Suissa S: Concurrent use of diuretics, angiotensin converting enzyme inhibitors, and angiotensin receptor blockers with non-steroidal anti-inflammatory drugs and risk of acute kidney injury: nested case-control study. BMJ (Clinical research ed) 2013, 346: e8525. Zhu JN, Qi XY, Tan Y, Lyu XH: [Dietary Factors Associated with Hyperuricemia and Glycolipid Metabolism Disorder in Middle-aged and Elderly People]. Sichuan da xue xue bao Yi xue ban = Journal of Sichuan University Medical science edition 2016, 47: 68-72. Choi HK, Atkinson K, Karlson EW, Willett W, Curhan G: Purine-rich foods, dairy and protein intake, and the risk of gout in men. The New England journal of medicine 2004, 350: 1093-1103. Benn CL, Dua P, Gurrell R, Loudon P, Pike A, Storer RI, Vangjeli C: Physiology of Hyperuricemia and Urate-Lowering Treatments. Frontiers in medicine 2018, 5: 160. Desaulniers P, Fernandes M, Gilbert C, Bourgoin SG, Naccache PH: Crystal-induced neutrophil activation. VII. Involvement of Syk in the responses to monosodium urate crystals. Journal of leukocyte biology 2001, 70: 659-668. Terkeltaub R: Update on gout: new therapeutic strategies and options. Nature reviews Rheumatology 2010, 6: 30-38. Knake C, Stamp L, Bahn A: Molecular mechanism of an adverse drug-drug interaction of allopurinol and furosemide in gout treatment. Biochemical and biophysical research communications 2014, 452: 157-162. Perez-Ruiz F, Jansen T, Tausche AK, Juarez-Campo M, Gurunath RK, Richette P: Efficacy and safety of lesinurad for the treatment of hyperuricemia in gout. Drugs in context 2019, 8: 212581. Enomoto A, Kimura H, Chairoungdua A, Shigeta Y, Jutabha P, Cha SH, Hosoyamada M, Takeda M, Sekine T, Igarashi T, et al: Molecular identification of a renal urate anion exchanger that regulates blood urate levels. Nature 2002, 417: 447-452. Huneycutt E, Board C, Clements JN: Lesinurad, a Selective URAT-1 Inhibitor With a Novel Mechanism in Combination With a Xanthine Oxidase Inhibitor, for Hyperuricemia Associated With Gout. Journal of pharmacy practice 2017 : 897190017734427. Hoy SM: Lesinurad: First Global Approval. Drugs 2016, 76: 509-516. Hu QH, Zhang X, Wang X, Jiao RQ, Kong LD: Quercetin regulates organic ion transporter and uromodulin expression and improves renal function in hyperuricemic mice. European journal of nutrition 2012, 51: 593-606. Billiet L, Doaty S, Katz JD, Velasquez MT: Review of hyperuricemia as new marker for metabolic syndrome. ISRN rheumatology 2014, 2014: 852954. Wu T, Chen J, Dong S, Li H, Cao Y, Tian Y, Fu W, Zhou P, Xi B, Pang J: Identification and characterization of a potent and selective inhibitor of human urate transporter 1. Pharmacological reports : PR 2017, 69: 1103-1112. Haidari F, Keshavarz SA, Mohammad Shahi M, Mahboob SA, Rashidi MR: Effects of Parsley (Petroselinum crispum) and its Flavonol Constituents, Kaempferol and Quercetin, on Serum Uric Acid Levels, Biomarkers of Oxidative Stress and Liver Xanthine Oxidoreductase Aactivity inOxonate-Induced Hyperuricemic Rats. Iranian journal of pharmaceutical research : IJPR 2011, 10: 811-819. Soliman MM, Baiomy AA, Yassin MH: Molecular and Histopathological Study on the Ameliorative Effects of Curcumin Against Lead Acetate-Induced Hepatotoxicity and Nephrototoxicity in Wistar Rats. Biological trace element research 2015, 167: 91-102. Saad DY, Soliman MM, Baiomy AA, Yassin MH, El-Sawy HB: Effects of Karela (Bitter Melon; Momordica charantia) on genes of lipids and carbohydrates metabolism in experimental hypercholesterolemia: biochemical, molecular and histopathological study. BMC complementary and alternative medicine 2017, 17: 319. Kuwabara M: Hyperuricemia, Cardiovascular Disease, and Hypertension. Pulse (Basel, Switzerland) 2016, 3: 242-252. Nuki G, Simkin PA: A concise history of gout and hyperuricemia and their treatment. Arthritis research & therapy 2006, 8 Suppl 1: S1. Wang MX, Liu YL, Yang Y, Zhang DM, Kong LD: Nuciferine restores potassium oxonate-induced hyperuricemia and kidney inflammation in mice. European journal of pharmacology 2015, 747: 59-70. Di Giovine FS, Malawista SE, Nuki G, Duff GW: Interleukin 1 (IL 1) as a mediator of crystal arthritis. Stimulation of T cell and synovial fibroblast mitogenesis by urate crystal-induced IL 1. Journal of immunology (Baltimore, Md : 1950) 1987, 138: 3213-3218. Terkeltaub R: Gout in 2006: the perfect storm. Bulletin of the NYU hospital for joint diseases 2006, 64: 82-86. Zamocky M, Regelsberger G, Jakopitsch C, Obinger C: The molecular peculiarities of catalase-peroxidases. FEBS letters 2001, 492: 177-182. Selvaratnam J, Robaire B: Overexpression of catalase in mice reduces age-related oxidative stress and maintains sperm production. Experimental gerontology 2016, 84: 12-20. Zamudio-Cuevas Y, Hernandez-Diaz C, Pineda C, Reginato AM, Cerna-Cortes JF, Ventura-Rios L, Lopez-Reyes A: Molecular basis of oxidative stress in gouty arthropathy. Clinical rheumatology 2015, 34: 1667-1672. Smith EU, Diaz-Torne C, Perez-Ruiz F, March LM: Epidemiology of gout: an update. Best practice & research Clinical rheumatology 2010, 24: 811-827. Grayson PC, Kim SY, LaValley M, Choi HK: Hyperuricemia and incident hypertension: a systematic review and meta-analysis. Arthritis care & research 2011, 63: 102-110. Fleischmann R, Kerr B, Yeh LT, Suster M, Shen Z, Polvent E, Hingorani V, Quart B, Manhard K, Miner JN, Baumgartner S: Pharmacodynamic, pharmacokinetic and tolerability evaluation of concomitant administration of lesinurad and febuxostat in gout patients with hyperuricaemia. Rheumatology (Oxford, England) 2014, 53: 2167-2174. Shen Z, Rowlings C, Kerr B, Hingorani V, Manhard K, Quart B, Yeh LT, Storgard C: Pharmacokinetics, pharmacodynamics, and safety of lesinurad, a selective uric acid reabsorption inhibitor, in healthy adult males. Drug design, development and therapy 2015, 9: 3423-3434. Saag KG, Fitz-Patrick D, Kopicko J, Fung M, Bhakta N, Adler S, Storgard C, Baumgartner S, Becker MA: Lesinurad Combined With Allopurinol: A Randomized, Double-Blind, Placebo-Controlled Study in Gout Patients With an Inadequate Response to Standard-of-Care Allopurinol (a US-Based Study). Arthritis & rheumatology (Hoboken, NJ) 2017, 69: 203-212. Perez-Ruiz F, Sundy JS, Miner JN, Cravets M, Storgard C: Lesinurad in combination with allopurinol: results of a phase 2, randomised, double-blind study in patients with gout with an inadequate response to allopurinol. Annals of the rheumatic diseases 2016, 75: 1074-1080. Miner JN, Tan PK, Hyndman D, Liu S, Iverson C, Nanavati P, Hagerty DT, Manhard K, Shen Z, Girardet JL, et al: Lesinurad, a novel, oral compound for gout, acts to decrease serum uric acid through inhibition of urate transporters in the kidney. Arthritis research & therapy 2016, 18: 214. Lepist EI, Ray AS: Renal drug-drug interactions: what we have learned and where we are going. Expert opinion on drug metabolism & toxicology 2012, 8: 433-448. Otani N, Ouchi M, Hayashi K, Jutabha P, Anzai N: Roles of organic anion transporters (OATs) in renal proximal tubules and their localization. Anatomical science international 2017, 92: 200-206. Shen Z, Yeh LT, Wallach K, Zhu N, Kerr B, Gillen M: In Vitro and In Vivo Interaction Studies Between Lesinurad, a Selective Urate Reabsorption Inhibitor, and Major Liver or Kidney Transporters. Clinical drug investigation 2016, 36: 443-452. Vitart V, Rudan I, Hayward C, Gray NK, Floyd J, Palmer CN, Knott SA, Kolcic I, Polasek O, Graessler J, et al: SLC2A9 is a newly identified urate transporter influencing serum urate concentration, urate excretion and gout. Nature genetics 2008, 40: 437-442. Habu Y, Yano I, Takeuchi A, Saito H, Okuda M, Fukatsu A, Inui K: Decreased activity of basolateral organic ion transports in hyperuricemic rat kidney: roles of organic ion transporters, rOAT1, rOAT3 and rOCT2. Biochemical pharmacology 2003, 66: 1107-1114. Kono H, Chen CJ, Ontiveros F, Rock KL: Uric acid promotes an acute inflammatory response to sterile cell death in mice. The Journal of clinical investigation 2010, 120: 1939-1949. Romi MM, Arfian N, Tranggono U, Setyaningsih WAW, Sari DCR: Uric acid causes kidney injury through inducing fibroblast expansion, Endothelin-1 expression, and inflammation. BMC nephrology 2017, 18: 326. Tables Table.1. The primers used for quantitative real time PCR (qRT-PCR). Gene Product size (bp) Accession number Direction Sequence (5'-3') mOAT-1 183 NM_008766.3 Sense GACAGGGTCTCATCCCTAGC Antisense GTCCCTGACACACTGACTGA mOAT-3 153 NM_001164635.1 Sense TACAGTTGTCCGTGTCTGCT Antisense CTTCCTCCTTCTTGCCGTTG mURAT-1 145 NM_009203.3 Sense GATAGGTTTGGGCGCAGAAG Antisense TCATCATGACACCTGCCACT mGlut-9 153 NM_001102415.1 Sense TTCGGGTCCTTCCTTCCTCTA Antisense GGACACAGTCACAGACCAGA m b -actin 143 Nm_007393.5 Sense CCAGCCTTCCTTCTTGGGTA Antisense CAATGCCTGGGTACATGGTG Supplementary Files ArriveChecklist.pdf Cite Share Download PDF Status: Published Journal Publication published 10 Feb, 2020 Read the published version in BMC Pharmacology and Toxicology → Version 3 posted Editor assigned by journal 06 Jan, 2020 Submission checks completed at journal 05 Jan, 2020 Editor invited by journal 05 Jan, 2020 You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7730","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":283563,"identity":"b0aa34b8-7b11-4bc7-943d-546b133a6186","order_by":1,"name":"Youseef Alghamdi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYNACG5t6fgkwS0KGSC1paQmSMxgYG4BaeIjVcjjB4AZYCwNhLQbH2x8++JCQlmd8u/n4oxs1FjwM7IePbsCr5cwZY8MZCTbFZneOJTbnHAM6jCct7QZeLTdy2KR5f6QxbruRY9icwwbUIsFjRkBL+vPffxIOM26eAdLyjygtCWbMDAmHEzdIALXkthGhRRLoF8mehDRjiRtpibNz+yR42Aj5hQ8YYh9+JNjI8c9IPvA551udHD/74WN4tSgcQBdhw6ccBOQbCKkYBaNgFIyCUQAAttpMpJuVmsEAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-7208-7123","institution":"Biochemistry Department, Faculty of Veterinary Medicine, Benha University, Egypt","correspondingAuthor":true,"prefix":"","firstName":"Youseef","middleName":"","lastName":"Alghamdi","suffix":""},{"id":283564,"identity":"cfc54ca3-9f65-42ce-8f6b-1286321bc2f6","order_by":2,"name":"Mohamed Mohamed Soliman","email":"","orcid":"","institution":"Benha University Faculty of Veterinary Medicine, Biochemistry Department","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"Mohamed","lastName":"Soliman","suffix":""},{"id":283565,"identity":"be93f79c-a012-48f5-8102-3f9c60067666","order_by":3,"name":"Mohamed Nasan","email":"","orcid":"","institution":"Zagazig University Faculty of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"Nasan","suffix":""}],"badges":[],"createdAt":"2019-11-08 11:16:32","currentVersionCode":3,"declarations":"","doi":"10.21203/rs.2.17096/v3","doiUrl":"https://doi.org/10.21203/rs.2.17096/v3","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s40360-020-0386-7","type":"published","date":"2020-02-10T12:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":341059,"identity":"c4911474-4b3e-4692-8199-ecd18f31bb59","added_by":"auto","created_at":"2020-01-08 21:50:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":25994,"visible":true,"origin":"","legend":"The impact of ZUR on changes in GPT, GOT, uric acid and BUN in hyperuricemic mice. Data are presented as means ± SE of six different mice. *p \u003c .05 vs control group; #p \u003c .05 vs HUR group and $p \u003c .05 vis either HU+ ALP or HU + ZUR groups. CNT: control; HU: hyperuricemia; ALP ; ZUR. Units of GPT and GOT are U/L, and for uric acid and BUN are mg/dl.","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/830955ec-9562-473e-9c58-b3e50aa6b288/v3/1.png"},{"id":341061,"identity":"98d020a6-94c2-441f-8124-06cd08a38277","added_by":"auto","created_at":"2020-01-08 21:50:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":13852,"visible":true,"origin":"","legend":"The impact of ZUR on changes in XOD activity in the serum and liver of hyperuricemic mice. Data are presented as means ± SE of five different mice. *p \u003c .05 vs control group; #p \u003c .05 vs HUR group and $p \u003c .05 vis either HU+ ALP or HU + ZUR groups. XOD: xanthine oxidase; CNT: control; HU: hyperuricemia; ALP; ZUR. Measured unites for serum activity of XOD is U/l while for liver tissues is U/ g protein.","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/830955ec-9562-473e-9c58-b3e50aa6b288/v3/2.png"},{"id":341062,"identity":"edd11835-2106-4aed-a483-f6a836f252a8","added_by":"auto","created_at":"2020-01-08 21:50:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":20340,"visible":true,"origin":"","legend":"The impact of ZUR on changes in MDA, catalase and GPx in hyperuricemic mice. Data are presented as means ± SE of five different mice. *p \u003c .05 vs control group; #p \u003c .05 vs HUR group and $p \u003c .05 vis either HU+ ALP or HU + ZUR groups. MDA: malondialdehyde; GPx: glutathione peroxidase; CNT: control; HU: hyperuricemia; ALP; ZUR. Units of MDA is nmol/ml, while for catalase and GPx are U/l.","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/830955ec-9562-473e-9c58-b3e50aa6b288/v3/3.png"},{"id":341063,"identity":"53e60f04-d1f1-4700-960a-8bad55e2e16d","added_by":"auto","created_at":"2020-01-08 21:50:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":16015,"visible":true,"origin":"","legend":"The impact of ZUR on changes in IL-1b and TNF-a in hyperuricemic mice. Data are presented as means ± SE of five different mice. *p \u003c .05 vs control group; #p \u003c .05 vs HUR group and $p \u003c .05 vis either HU+ ALP or HU + ZUR groups. IL-1b: interleukin-1 beta; TNF-a: tumor necrosis factor alpha; CNT: control; HU: hyperuricemia; ALP: l; ZUR. Measured units of IL-1 and TNF are pg/ml.","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/830955ec-9562-473e-9c58-b3e50aa6b288/v3/4.png"},{"id":341064,"identity":"1f204634-9e4a-47ae-b7c0-8875b1c6aae4","added_by":"auto","created_at":"2020-01-08 21:50:01","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":37852,"visible":true,"origin":"","legend":"The ameliorative impact of ZUR on mRNA expression of OAT-1, OAT-3, URAT-1 and GLUT-9 in hyperuricemic mice by real time PCR. Graphic presentation of renal mRNA levels by real-time PCR analysis of OAT1 (A), OAT3 (B), URAT-1(C) and GLUT-9 (D) in different groups of mice after normalization with beta actin. *p \u003c .05 vs control group; #p \u003c .05 vs HUR group and $p \u003c.05 vs either HU+ ALP or HU + ZUR groups.","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/830955ec-9562-473e-9c58-b3e50aa6b288/v3/5.png"},{"id":341065,"identity":"75be7340-7392-40e9-9fa6-5d8e43cb9964","added_by":"auto","created_at":"2020-01-08 21:50:01","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":616463,"visible":true,"origin":"","legend":"Histopathological examination of Kidneys. A. A kidney from the control group, showing a normal histological picture with normal glomerular (thick arrow) and tubular (thin arrows) architecture. B. A kidney from the hyperuricemic group, showing shrinkage of glomerular tufts (thick arrow) with periglomrular and interstitial (*) round cells infiltration. Tubular lumina showing obvious urate crystals occluding the lumina (thin arrows). C. A kidney from the ALP group, showing no marked change in renal histology with normal glomerular (thick arrow) and tubular (thin arrows) architecture. D. A kidney from the ZUR administered group, showing degeneration of renal tubules (thick arrows) with few interstitial round cells infiltration (*). E. A kidney from the hyperuricemic group, treated with ALP, showing restoration of normal glomerular (thick arrow) and tubular (thin arrows) architecture. F. A kidney from the hyperuricemic group, treated with ZUR alone, showing a slight restoration of normal glomerular (thick arrow) and tubular (thin arrows) picture with the presence of interstitial oedema. G. A kidney from the hyperuricemic group, treated with ZUR and ALP, showing a normal histological picture of both glomerular (thick arrow) and tubular (thick arrow) tissue, with the absence of urate crystals. H\u0026E. Scale bar= 50 μm.","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/830955ec-9562-473e-9c58-b3e50aa6b288/v3/6.png"},{"id":341066,"identity":"2aaa05a7-e064-4137-bded-9aa4e8069f68","added_by":"auto","created_at":"2020-01-08 21:50:01","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":589127,"visible":true,"origin":"","legend":"Immunohistochemical examination of TGF-β1. A. A kidney from the control group showing no expression of TGF-β in renal tissues. B. A kidney from the hyperuricemic group, showing a prominent expression of TGF-β1 in renal tubular tissue. C. A kidney from the ALP group, showing no marked expression of TGF-β1 in renal tissue. D. A kidney from the ZUR administered group, showing prominent expression of TGF-β1 in renal tubular tissue with moderate intensity. E. A kidney from the hyperuricemic group, treated with ALP shed absence of TGF-β1 immunoreactivity in tubular tissue. F. A kidney from the hyperuricemic group, treated with ZUR alone, showing a prominent moderate intensity of TGF-β1 in renal tissue. G. A kidney from the hyperuricemic group, treated with ZUR and ALP, showing glomerular and tubular tissue with no TGF-β1 expression. H\u0026E. Scale bar= 50 μm.","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/830955ec-9562-473e-9c58-b3e50aa6b288/v3/7.png"},{"id":341067,"identity":"e4b35f1a-4bdd-4365-aaf4-04202ccaf863","added_by":"auto","created_at":"2020-01-08 21:50:01","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":47260,"visible":true,"origin":"","legend":"Schematic illustration for the ameliorative effects of lesinurad and allopurinol on hyperuricemia.","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/830955ec-9562-473e-9c58-b3e50aa6b288/v3/8.png"},{"id":13484747,"identity":"373eb05e-00f5-47f8-8af8-e37e92035644","added_by":"auto","created_at":"2021-09-16 21:59:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2795978,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7730/v3/6245d421-ce37-47c7-b977-f64f7b1ba33e.pdf"},{"id":341060,"identity":"4f18ce1b-1812-41ba-ac25-ac1f8443a03e","added_by":"auto","created_at":"2020-01-08 21:50:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1089649,"visible":true,"origin":"","legend":"","description":"","filename":"ArriveChecklist.pdf","url":"https://assets-eu.researchsquare.com/files/830955ec-9562-473e-9c58-b3e50aa6b288/v3/Arrive Checklist.pdf"}],"financialInterests":"","formattedTitle":"Impact of Lesinurad and Allopurinol on Experimental Hyperuricemia in mice: Biochemical, Molecular and Immunohistochemical Study","fulltext":[{"header":"Background","content":"\u003cp\u003eUric acid (UA) is the end product of an exogenous and endogenous pool of purines metabolism. The exogenous pool is dependent on diet especially from animal proteins. The endogenous pool depends on the production of uric acid from the liver, intestines and other tissues [1]. Potential sources of the exogenous pool of hyperuricemia (HU) consists of food (i.e. purine rich products), glucose, and fructose [2], which is controlled by xanthine oxidase, that irreversibly oxidizes xanthine into uric acid (UA) [3, 4]. UA is primarily excreted through the kidneys in urine (65\u0026ndash;75%) and to a lesser extent through the gastrointestinal tract (25\u0026ndash;35%) [3, 5]. An increase in the level of uric acid in the blood is known as hyperuricemia , and is the cause of gout, which manifests in inflammatory arthritis and painful disabling with acute attacks [6].\u003c/p\u003e\n\u003cp\u003eHU is defined as an increase in UA levels over 7 mg/dL in men and 6 mg/dL in women [7]. HU is mainly associated with the following: (1) alcohol consumption; (2) a fructose rich diet; (3) excess consumption of seafood or meat; (4) diuretics; (5) some medications; and (6) angiotensin converting enzymes [8, 9]. Gout is associated with precipitation of monosodium urate (MSU) crystals in joints and soft tissues [10, 11]. Deposition of MSU crystals in the big toe, some joints and the ankle are associated with neutrophil infiltration, swelling and pain [12]. The first line of gout treatment is allopurinol (ALP), a xanthine oxidase inhibitor stimulating the renal secretion and excretion of UA [11]. Other anti-inflammatory non-steroidal drugs known to inhibit cyclooxygenase activity (i.e. cortisol, indomethacin and glucocorticoids) are beneficial for the treatment of gout [13]. However, these medications have severe side effects and interactions capable of harming human health [14].\u003c/p\u003e\n\u003cp\u003eA promising approach for the treatment of HU and its associated complications consists of alternative therapies, i.e. dietary flavonoids and hypouricemic curative agents with suboptimal doses devoid of undesirable ALP side effects. The need to identify safe drugs is therefore vital for both physicians and patients. A new medication used for treatment of HU is lesinurad, commonly named Zurampic (ZUR). ZUR was approved in December 2015 by the US Food and Drug Administration and works on the urate-anion exchanger transporter (URAT1) in combination with ALP [15]. Furthermore, URAT1 is a trans-membrane protein that acts as a urate-specific and organic anion exchanger, being localized in the luminal membrane of the proximal convoluted tubules [16]. URAT-1 action increased urate filtration and reabsorption from proximal convoluted tubules[17]. Lesinurad inhibits URAT1 and Organic Anion Transporters (OATs) controlling uric acid reabsorption, and increases the urinary excretion of uric acid [18]. A previous study postulate that the declined levels of serum uric acid levels takes place in response to the effect of lesinurad on renal urate. The current study therefore examined the ameliorative synergistic impact of lesinurad and ALP on oxonate-induced HU in mice at the biochemical, molecular and histopathological levels.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eChemicals and Kits\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePotassium Oxonate (PO), agarose, ALP and ethidium bromide were purchased from Sigma-Aldrich (St. Louis, MO, USA). Zurampic was purchased from Ironwood Pharmaceuticals, Inc., Cambridge, MA02142. 100 bp DNA ladder and reverse transcriptase enzymes were from MBI (Fermentas, Thermo Fisher Scientific, USA). Qiazol and Oligo dT were from QIAGEN (Valencia, CA, USA). The kits for catalase, MDA and glutathione peroxidase (GPx) were purchased from Biodiagnostic Co. (Dokki, Giza, Egypt). The kits for glutamate pyruvate transaminase (GPT), glutamate oxalate transaminase (GOT), blood urea nitrogen (BUN) and uric acid were from BIO-MED Diagnostics and EGY- CHEM for lab technology, Badr City, Egypt. Xanthine Oxidase kit (Catalog No: E-BC-K024), mouse IL-1 beta (Catalog No: E-EL-M0037) and mouse TNF-alpha (Catalog NO: E-EL-M0049) were obtained from Elabscience Biotechnology Inc. USA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn Vivo Animals and Design\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Scientific Deanship of Taif University, Saudi Arabia, along with its Ethical Committee, approved all procedures used in this study for the project #1\u0026ndash;439\u0026ndash;6099, based on the NIH Guide for the care and use of laboratory animals. A total of forty-two male Swiss mice, ten weeks old, weighting 30-35 grams from college of pharmacy, King Abdel-Aziz University, Jeddah, Saudi Arabia were used for this study. To overcome stress and complete adaptation, the mice were handled manually for seven days. \u0026nbsp;The animals were kept in a 12/12 hours day-dark cycle and were given free access to food and water. Seven groups (6 mice /group) were allocated to the following treatments:\u003c/p\u003e\n\u003cp\u003eGroup 1; negative control (CNT), gained free access to food and water. Group 2; positive hyperuricemic group (HU), received potassium oxonate (PO) intraperitoneally (250 mg/kg bw, once a day at 8:00 am). The dosages of PO and timing were determined as stated above [19]. Time of administration was fixed to avoid noctorinal and diurnal changes in biochemical measurements. Group 3 received orally allopurinol (ALP; 5 mg/kg body weight daily one hour after PO administration) for seven days [20]. Group 4 was administered orally ZUR in a dose of 80 mg/kg as stated by Wu et al. [21]. For seven days, groups 5 and 6 were administered PO at 8.00 am, followed by ALP for Group 5 and ZUR for Group 6 one hour later (9: 00 am). Group 7 was administered PO for seven days, followed by a combination of ALP and ZUR one hour later. For treatments in groups from 5 to 7, same doses given in group 3 and 4 were used. At the end of the experimental design (2 weeks), the mice inhaled dimethyl ether and were decapitated. Serum was extracted and stored at \u0026ndash;20 \u003csup\u003e\u0026deg;\u003c/sup\u003eC until biochemical measurements took place. Kidney and liver tissues were soaked in Qiazol for RNA extraction and in Bowan\u0026rsquo;s solution for histology and immunohistochemistry examination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eXanthine Oxidase activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXanthine oxidase (XOD) catalyzes hypoxanthine, to form xanthine and superoxide anion free radicals, resulting in a purplish red substance in the presence of electronic receptors and a chromogenic agent. XOD activity can be calculated by measuring the OD value of the purplish red substance at 530 nm in serum samples. For liver tissues, following homogenization in normal saline on ice, in a ratio of one liver tissue and nine for normal saline, homogenate is centrifuged for ten minutes and supernatant used for assay. The XOD unite for serum values is U/l, and for liver homogenates is U/g protein tissue. The protocol employed was partially modified in accordance with the method of Haidari et al, [22].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSerum biochemistry, antioxidants, and cytokines assessments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe serum levels of liver and kidney biomarkers were assayed calorimetrically, using specific commercial kits based on the manufacturer\u0026rsquo;s instruction manual. Antioxidants such as malondialdehyde (MDA), catalase and glutathione peroxidase as well as cytokines were measured spectrophotometrically using commercial ELISA kits explained in chemicals section based on kit attached description manual.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction, cDNA synthesis and quantitative real time PCR (qRT-PCR) \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted as described before [23] from the kidney tissues. Frozen samples were homogenized in a homogenizer. Chloroform (300 \u0026micro;L) was added to the homogenate, then centrifuged at 4 \u0026deg;C with 12000 rpm for ten minutes. The supernatant was separated and an equal volume of isopropyl alcohol was added then centrifuged at 4 \u0026deg;C with 12000 rpm for 15 minutes. The pellets of RNA were dissolved in Diethylpyrocarbonate (DEPC) water after washing with 70% alcohol and air drying. The integrity of RNA was confirmed [24]. 3 \u0026micro;g of extracted RNA and 0.5 ng oligo dT (Qiagen Valencia, CA, USA) was denatured following incubation in a Bio-Rad T100\u003csup\u003eTM\u003c/sup\u003e Thermal Cycler at 70 \u0026deg;C for five minutes. Denatured RNA was reverse transcribed after the addition of 2 \u0026micro;L of 10 mM dNTPs, 100 U of M-MuLV (SibEnzyme, Ak, Novosibirsk, Russia) and 2 \u0026micro;L of 10X RT-buffer, before being incubated in a Bio-Rad T100\u003csup\u003eTM\u003c/sup\u003e Thermal Cycler for one hour at 37 \u0026deg;C, then for ten minutes at 90 \u0026deg;C, to ensure enzyme inactivation. For quantitative real time PCR analysis (qRT-PCR), primers for the examined genes (Table 1) were designed using \u003ca href=\"https://www.genscript.com/tools/real-time-pcr-tagman-primer-design-tool\"\u003eGenScript Real-time PCR (TaqMan) Primer Design\u003c/a\u003e (\u003ca href=\"https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool\"\u003ehttps://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool\u003c/a\u003e). Each PCR reaction consisted of 1.5 \u0026mu;l of 1 \u0026mu;g/\u0026mu;l cDNA, 10 \u0026mu;l SYBR Green PCR Master Mix (Quanti Tect SYBR Green PCR Kit, Qiagen, Valencia, CA, USA), along with 1 \u0026mu;M of forward and reverse primer for each examined gene and nuclease free H\u003csub\u003e2\u003c/sub\u003eO to a final volume of 20 \u0026mu;l. Reactions were run and analyzed in Applied Biosystem 7500 Fast Real time PCR Detection system. qRT-PCR conditions are: 95\u0026deg;C for ten minutes (first denaturation) and forty cycles of 95\u0026deg;C for fifteen seconds (second denaturation stage) followed by 60 \u0026deg;C for one minute (annealing and extension stage). The critical threshold (Ct) of the target gene was normalized with quantities (Ct) of the housekeeping gene (\u0026beta;-actin), using the formula x = \u003csup\u003e2\u0026minus;\u0026Delta;\u0026Delta;\u003c/sup\u003eCt, where there is x = fold difference relative to the control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistological and immunohistochemistry analyses of kidney\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe kidney tissue was dehydrated and embedded in paraffin, then sectioned at 5\u0026micro;m. The slides were subsequently stained with hematoxylin and eosin (H\u0026amp;E) and the morphological changes were examined using a microscope (Eclipse 80i, Nikon, Japan), with images being captured by a digital camera (Fuij Co., Sapporo, Japan).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; For immunohistochemistry, the paraffin-embedded renal sections were deparaffinized, rehydrated and immersed in H2O2 (3%) for ten minutes, in order to block any peroxidase activity. Following this, the slides were washed in phosphate buffer saline. Nonspecific binding sites were blocked by bovine serum albumin (5%) prior to the addition of TGF-\u0026beta;1 polyclonal antibody in a dilution of 1:300 overnight at 4 \u003csup\u003eₒ\u003c/sup\u003eC. The slides were then washed in PBS and incubated with a secondary antibody, developed with 3.3\u0026rsquo;-diaminobezidine tetrahydrochloride and counterstained with hematoxyline.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are means \u0026plusmn; standard error of six values collected from six different mice per each treatment. Data were analyzed using one-way ANOVA (analysis of variance) setting the probability level P\u0026lt;0.05, with the individual comparisons obtained by Duncan's multiple range tests for SPSS software version 11.5 for Windows (SPSS, IBM, Chicago, IL, USA). The probability level P\u0026lt;0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eThe impact of Lesinurad and ALP on \u003c/strong\u003e\u003cstrong\u003eLiver and kidney biomarkers in hyperuricemic mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHyperuricemic group showed an increase in serum levels of GPT, GOT, uric acid and BUN. HU group received either ALP or ZUR showed a decrease in GPT, GOT, uric acid and BUN levels [Figure 1A-B]. Co-administration of ALP and ZUR revealed an ameliorative and additive synergistic effect (P\u0026lt; 0.05) on the normalization of GPT, GOT, uric acid and BUN levels (Figure 1A). It should be noted that ZUR revealed same effect induced by ALP in hyperuricemic administered mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe impact of Lesinurad and ALP on \u003c/strong\u003e\u003cstrong\u003eserum and hepatic XOD activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs shown in Figure 2, there was an increase of XOD activities in serum and liver of hyperuricemic mice. , This increase in XOD activity were significantly normalized to control levels in ALP and ZUR administered hyperuricemic mice. Combination treatment, using both ZUR and ALP, induced an additive and synergistic decrease in XOD activity compared to both hyperuricemic ALP and hyperuricemic ZUR treated groups.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe impact of Lesinurad and ALP on \u003c/strong\u003e\u003cstrong\u003eantioxidant activities altered by hyperuricemia\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHU increased tissue degradation, represented by an increase in levels of MDA (Figure 3A), which was normalized in hyperuricemic mice by both ALP and ZUR treatment. HU decreased catalase and GPx levels that were \u0026nbsp;readjusted following ALP administration, and to a lesser extent for ZUR administered groups (Figure 3B). Administration of ZUR to hyperuricemic mice, together with ALP, induced an additive ameliorative effect on the changes induced on MDA, catalase and GPx levels (Figure 3A, B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe impact of Lesinurad and ALP on changes in cytokines altered \u003c/strong\u003e\u003cstrong\u003ein hyperuricemic mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFigure 4 demonstrates the changes in serum levels of IL-1\u0026beta; and TNF-a. HU induced a state of inflammation, with a significant increase in \u0026nbsp;serum levels of IL-1\u0026beta; and TNF-a (P\u0026lt; 0.05). Administration of ALP and ZUR to hyperuricemic mice normalized both IL-1\u0026beta; and TNF-a levels. Co-administration of ALP and ZUR induced a clear synergistic inhibitory effect on IL-1\u0026beta; and TNF-a ((P\u0026lt;0.05, Figure 4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe impact of Lesinurad and ALP on mRNA expression of renal genes associated with hyperuricemia\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis current study examined the expression levels of genes responsible for urate excretion and reabsorption in the kidneys (mOAT-1, mOAT-3, mURTA-1 and mGLUT9). As shown in Fig. 5, in comparison to the mice in the control group, oxonate administration induced a significant down-regulation of mRNA expression of mOAT-1 and mOAT-3 in mice kidneys, alongside a significant up-regulation of the mURAT-1 and mGlut-9 expressions (p\u0026lt; 0.05). The alteration in the mRNA expression of urate transporter-related genes was consistent with the elevation of serum uric acid and BUN levels. ALP and ZUR treatment alone showed a significant down-regulation in mURAT-1 and mGlut-9 mRNA levels, as well as up-regulation in mOAT-1 and mOAT-3 expression (Figure 5). The additive synergistic effect on altered genes could be clearly observed when ALP and ZUR were co-administered to the hyperuricemic group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe impact of Lesinurad and Allopurinol on renal histology and TGF-\u003c/strong\u003e\u003cstrong\u003e\u0026beta;1\u003c/strong\u003e\u003cstrong\u003e immunoreactivity in hyperuricemic mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHistopathological examination revealed that the kidneys of the control group demonstrated a normal histological picture, including normal glomerular and tubular architecture (Figure 6A). However, the kidneys of the hyperuricemic group revealed shrinkage of glomerular tufts with periglomrular and interstitial round cells infiltration. Tubular lumina showed obvious urate crystals occluding the lumina (Figure 6B). The kidneys of the ALP administered group demonstrated no marked change in renal histology (Figure 6C), while the kidneys of the ZUR administered group revealed degeneration of renal tubules with a few interstitial round cells infiltration (Figure 6D). The kidneys of the hyperuricemic group treated with ALP showed restoration of normal glomerular and tubular architecture (Figure 6E), while those administered only with ZUR demonstrated a slight restoration of a normal picture, with the presence of interstitial oedema (Figure 6F). The kidneys of the hyperuricemic group treated with both ZUR and ALP demonstrated a normal histological picture of both glomerular and tubular tissue, including an absence of urate crystals (Figure 6G).\u003c/p\u003e\n\u003cp\u003eImmunohistochemical examination of kidney for TGF-\u0026beta;1 immunoreactivity revealed \u0026lrm;that the kidneys of hyperuricemic group showed a clear and strong expression for TGF-\u0026beta;1 \u0026lrm;in kidney tissues\u0026rlm; \u0026rlm;\u0026lrm;(Figure 7B) in comparison to control group which showed no \u0026lrm;immunoreactivity (Figure 7A). Same is reported for ALP administered group which showed no marked \u0026lrm;expression of TGF-\u0026beta;1 in renal tissue (Figure 7C). The kidneys of the ZUR group revealed \u0026lrm;a very faint expression of TGF-\u0026beta;1 in renal tubular tissue, having moderate intensity (Figure \u0026lrm;\u0026lrm;7D). In addition, the kidneys of hyperuricemic group treated with ALP demonstrated an \u0026lrm;absence of TGF-\u0026beta;1 expression in tubular tissues (Figure 7E). The kidneys of hyperuricemic \u0026lrm;group treated with ZUR alone showed a moderate intensity for TGF-\u0026beta;1 in \u0026lrm;kidney tissues (Figure 7F). However, the kidneys of the hyperuricemic group treated with ZUR and ALP showed glomerular and tubular tissue lacking of any TGF-\u0026beta;1 immunoreactivity \u0026lrm;\u0026lrm;(Figure 7G). \u0026lrm;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAs noted above, hyperuricemia is a cause of gout, as well as a number of clinical disorders, including: chronic kidney disease; hypertension; \u0026nbsp;diabetes; cardiovascular disorders; dyslipidemia; endothelial dysfunction; and atherosclerosis. HU is associated with an increase in the production of oxygen free radicals, oxidative stress and up-regulation of pro-inflammatory cytokines and mediators [13, 25]. The management of gout, cardiovascular and metabolic disorders depends on the activity of xanthine oxidase. The key for hyperuricemia control includes the inhibition of an overproduction of uric acid, along with inflammation and oxidative stress [26].\u003c/p\u003e\n\u003cp\u003eAs previously discussed, uric acid induces a state of inflammation in the kidneys and causes an inflammatory reaction. This accords with a previous study reported relatively similar findings when employing Nuciferine [27]. A number of researchers have confirmed that gout shares many pathogenetic features associated with other inflammatory disorders, i.e. a rapid increase in the secretion of some pro-inflammatory cytokines (IL-1\u0026beta;, IL-6 and TNF-\u0026alpha;) [28, 29]. The current study identified that the use of ALP or ZUR alone failed to reduce levels of IL-1\u0026beta; and TNF-\u0026alpha; in hyperuricemic mice, suggesting that the co-administration of ALP and ZUR exerted their anti-inflammatory effect to prevent development of gout from HU.\u003c/p\u003e\n\u003cp\u003eAs known, catalases and peroxidases are oxidoreductases that are involved in the molecular defensive mechanisms against reactive oxygen species to counter act the\u0026nbsp; harmful effect of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e [30]. The increased\u0026nbsp;\u003ca href=\"https://en.wikipedia.org/wiki/Oxidative_stress\"\u003eoxidative stress\u003c/a\u003e\u0026nbsp;that occurs with\u0026nbsp;cell damage and inflammation in mice is alleviated by\u0026nbsp; an increase in catalase \u003ca href=\"https://en.wikipedia.org/wiki/Gene_expression\"\u003eexpression\u003c/a\u003e and or secretion [31]. In the parallel,\u0026nbsp;the antioxidant enzyme; \u003ca href=\"https://www.sciencedirect.com/topics/biochemistry-genetics-and-molecular-biology/glutathione-peroxidase\"\u003eglutathione peroxidase\u003c/a\u003e (GPx); helps in\u0026nbsp; scavenging cellular free radicals. GPx prevents\u0026nbsp;\u003ca href=\"https://www.sciencedirect.com/topics/biochemistry-genetics-and-molecular-biology/lipid-peroxidation\"\u003elipid peroxidation\u003c/a\u003e\u0026nbsp;and maintain intracellular\u0026nbsp;\u003ca href=\"https://www.sciencedirect.com/topics/biochemistry-genetics-and-molecular-biology/homeostasis\"\u003ehomeostasis\u003c/a\u003e [32]. In current study,\u0026nbsp;hyperuricemia increased ROS due to the increase in uric acid levels [33]. A significant decline was observed in the serum levels of catalase and GPx activities, accompanied by a significant increase in MDA levels in the hyperuricemic group compared to control. ALP (either alone, or in combination with ZUR) significantly normalized, and reversed, changes in the measured serum levels of antioxidants and the lipid peroxidation marker in hyperuricemic mice, thus suggesting that ALP and ZUR increased antioxidant enzyme activities through their impact on oxidative stress biomarkers.\u003c/p\u003e\n\u003cp\u003eXanthine oxidase inhibitors (ALP) are used as first-line therapy for patients with chronic gout, due to factors including availability, efficacy and low cost. However, ALP fails to lower the serum urate to the target level in a substantial subset of adherent patients. This results in the advice for Lesinurad therapy to be taken together with ALP. Lesinurad is a novel selective uricosuric, capable of overcoming the above limitations, while also proving effective in patients having an inadequate response to ALP monotherapy.\u003c/p\u003e\n\u003cp\u003eEfforts have been made, over a number of decades, to find a wide range of sufficient and safe urate lowering drugs. The close association between HU, metabolic and cardiovascular comorbidities has raised further interest in the development of novel urate-lowering drugs\u0026nbsp; [34]. Uricosurics remain the second choice for treatment of HU and gout, with all recent prescriptions supporting the combination of uricosurics and ALP once monotherapy of each has proved ineffective [35].\u003c/p\u003e\n\u003cp\u003eLesinurad is a selective URAT-1 inhibitor approved for HU treatment associated with gout, in combination with ALP. Its exact molecular mechanism is not fully elucidated in animal models. In clinical trials using healthy volunteers, a single dose of ZUR significantly reduced serum UA [35-37], with its efficiency being due to approximately a third of the drug being excreted from the kidneys [36]. The drug should be taken for patients who are refractory to ALP therapy [38]. These current results prompted an investigation into the beneficial action of ZUR on genes capable of validating the excretion and secretion of uric acid [39].\u003c/p\u003e\n\u003cp\u003eTransporters play important roles in the pharmacology of xenobiotics that start with the recognition of the key contribution of P-glycoprotein to drug properties including biliary excretion, intestinal absorption, penetration the blood-brain barrier and drug-drug interactions [40]. Over 400 transporters expressed in various tissues throughout the body, comprising members of the solute carrier ATP binding cassette protein families have been reported [40]. OATs family comprises a group of over 10 trans-membrane proteins [41]. OAT1 to -5 are expressed mainly in the kidney, other members are expressed in remaining other tissues. OATs proteins act to maintain kidney homeostasis as urate efflux transporters [41]. Lesinurad has been reported to regulate OAT-1 and OAT-3 expression in \u003cem\u003ein vitro\u003c/em\u003e studies [42]. That means, lesinurad and ALP interacts on the kidney to facilitate and increase urate excretion.\u0026nbsp; The current study confirmed that lesinurad has the potential to act in synergistic way to control the expression of URAT-1, OAT 1 and -3 in kidney tissues to increase urate excretion and secretion.\u003c/p\u003e\n\u003cp\u003eSerum BUN levels form the markers of renal dysfunction. In addition, mURAT-1 is the main regulator for urate reabsorption (50%), playing a key role in the homeostasis of urate [16]. The glucose transporter 9 (GLUT9) is a protein responsible for urate reabsorption [43], while OAT-1 and OAT-3 are responsible for renal primary urate excretion [44]. This suggests that abnormalities in renal urate transporters may have important implications for the impairment of uric acid excretion, along with HU. The findings of the current study indicate that HU up-regulated mURAT-1 and mGLUT-9 and down-regulated mOAT-1 and mOAT-3, while co-administration of Lesinurad and ALP induced ameliorative synergistic effects. In addition, ZUR and ALP induced up-regulation in mOAT1 and mOAT-3 mRNA, alongside down-regulation in mURAT1 and mGLUT9 in the kidneys of hyperuricemic mice, thus indicating an enhancement of urate excretion reducing serum UA levels. This study confirm that ZUR demonstrates additional uricosuric effects in the presence of ALP, which are mediated through renal mOAT1, mOAT-3, mURAT1 and mGLUT9 regulation in hyperuricemic mice.\u003c/p\u003e\n\u003cp\u003eHU results in fibrosis and renal tissues injuries involving inflammation and fibroblast expansion with high levels of sodium in extracellular fluids due to an increase in uric acid levels resulting in tissue nucleation [45], thus leading to inflammation influencing the biology of renal interstitial cells [45]. The increase in UA causes the expansion of fibroblasts, as well as up-regulation in the immunoreactivity of profibrotic factors (TGF-\u0026beta;1), confirming the activation of fibrotic pathways in hyperuricemic patients [46]. As demonstrated in Figure 7, this alteration in TGF-\u0026beta;1 was confirmed during HU and normalization following co-administration of ZUR and ALP.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe present study confirmed that ALP and ZUR co-administration being capable of lowering serum UA. In addition, they led to an additive synergistic decrease in XOD activity in serum and liver tissues and ameliorated induced oxidative stress and changes in pro-inflammatory cytokines. Furthermore, ALP and ZUR co-administration synergistically down-regulated the mRNA expression of URAT1 and GLUT9, and up-regulated the mRNA expression of OAT1 and OAT-3 in hyperuricemic mice. Furthermore, both ALP and ZUR acted together to improve kidney pathomorphology. All ZUR and ALP effects are summarized in Figure 8. This study therefore suggests the advantages of the co-administration of ALP and ZUR for HU therapy for their beneficial effects on kidney at the biochemical, molecular and cellular levels.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eALP:\u0026nbsp; Allopurinol; BUN:\u0026nbsp; Blood urea nitrogen; CNT: control; CT:\u0026nbsp; cycle threshold; DEPC: diethylpyrocarbonate; GOT: glutamate oxalacetate transaminase; GPT:\u0026nbsp; glutamate pyruvate transaminase; GPx:\u0026nbsp; Glutathione peroxidase; H and E: Hematoxylin and eosin; HU:\u0026nbsp; Hyperuricemia; IL-1b:\u0026nbsp; Interleukin-1 beta; Malondialdehyde: MDA; mGLUT9: mouse glucose transporter 9; M-Mul V:\u0026nbsp; moloney Murine Leukemia Virus; mURAT1: mouse urate anion transporter 1;MSU: monosodium urate;\u0026nbsp; NF\u003csub\u003ek\u003c/sub\u003eB: Nuclear factor kappa-b; OATs: organic anion transporters; PBS: phosphate buffer saline; PO:\u0026nbsp; Potassium oxonate; qRT-PCR:\u0026nbsp; quantitative real time polymerase chain reaction; RNA:\u0026nbsp; Ribonucleic acids; TBE: Tris-borate-EDTA; TGF-1b : transforming growth factor-1 beta; TNF-a:\u0026nbsp; Tumor necrosis factor-alpha; UA:\u0026nbsp; Uric acid; Xanthine Oxidase: XOD; ZUR:\u0026nbsp; Zurampic.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics and Consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by The Scientific Deanship of Taif University, Saudi Arabia, along with its ethical committee approved this study, based on the NIH Guide for the care and use of laboratory animal. All precautions were followed to minimize animal suffering throughout the experiments. Consent to publish is not applicable\u0026rsquo; in this section.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was completely supported by Taif university, Saudi Arabia for project number 1-439-6099.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe acknowledge Scientific Deanship of Taif University, Saudi Arabia, for financial support of current study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are available up on request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable on this section\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors declare that no conflict of interest\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed equally to finish this finished work: YSA, MMS and\u0026nbsp; MAN were responsible for the conception and design of the experiments; MAN, YSA and MMS undertook the experiments; MMS analyzed the data; MMS undertook the biochemical assays; MAN performed the histopathology; MMS was responsible for the gene expression; and YSA and MMS undertook the data interpretation.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChaudhary K, Malhotra K, Sowers J, Aroor A: \u003cstrong\u003eUric Acid - key ingredient in the recipe for cardiorenal metabolic syndrome.\u003c/strong\u003e \u003cem\u003eCardiorenal medicine \u003c/em\u003e2013, \u003cstrong\u003e3:\u003c/strong\u003e208-220.\u003c/li\u003e\n\u003cli\u003eZgaga L, Theodoratou E, Kyle J, Farrington SM, Agakov F, Tenesa A, Walker M, McNeill G, Wright AF, Rudan I, et al: \u003cstrong\u003eThe association of dietary intake of purine-rich vegetables, sugar-sweetened beverages and dairy with plasma urate, in a cross-sectional study.\u003c/strong\u003e \u003cem\u003ePloS one \u003c/em\u003e2012, \u003cstrong\u003e7:\u003c/strong\u003ee38123.\u003c/li\u003e\n\u003cli\u003eRock KL, Kataoka H, Lai JJ: \u003cstrong\u003eUric acid as a danger signal in gout and its comorbidities.\u003c/strong\u003e \u003cem\u003eNature reviews Rheumatology \u003c/em\u003e2013, \u003cstrong\u003e9:\u003c/strong\u003e13-23.\u003c/li\u003e\n\u003cli\u003eJalal DI, Chonchol M, Chen W, Targher G: \u003cstrong\u003eUric acid as a target of therapy in CKD.\u003c/strong\u003e \u003cem\u003eAmerican journal of kidney diseases : the official journal of the National Kidney Foundation \u003c/em\u003e2013, \u003cstrong\u003e61:\u003c/strong\u003e134-146.\u003c/li\u003e\n\u003cli\u003ede Oliveira EP, Burini RC: \u003cstrong\u003eHigh plasma uric acid concentration: causes and consequences.\u003c/strong\u003e \u003cem\u003eDiabetology \u0026amp; metabolic syndrome \u003c/em\u003e2012, \u003cstrong\u003e4:\u003c/strong\u003e12.\u003c/li\u003e\n\u003cli\u003eAung T, Myung G, FitzGerald JD: \u003cstrong\u003eTreatment approaches and adherence to urate-lowering therapy for patients with gout.\u003c/strong\u003e \u003cem\u003ePatient preference and adherence \u003c/em\u003e2017, \u003cstrong\u003e11:\u003c/strong\u003e795-800.\u003c/li\u003e\n\u003cli\u003eLi L, Yang C, Zhao Y, Zeng X, Liu F, Fu P: \u003cstrong\u003eIs hyperuricemia an independent risk factor for new-onset chronic kidney disease?: A systematic review and meta-analysis based on observational cohort studies.\u003c/strong\u003e \u003cem\u003eBMC nephrology \u003c/em\u003e2014, \u003cstrong\u003e15:\u003c/strong\u003e122.\u003c/li\u003e\n\u003cli\u003eLapi F, Azoulay L, Yin H, Nessim SJ, Suissa S: \u003cstrong\u003eConcurrent use of diuretics, angiotensin converting enzyme inhibitors, and angiotensin receptor blockers with non-steroidal anti-inflammatory drugs and risk of acute kidney injury: nested case-control study.\u003c/strong\u003e \u003cem\u003eBMJ (Clinical research ed) \u003c/em\u003e2013, \u003cstrong\u003e346:\u003c/strong\u003ee8525.\u003c/li\u003e\n\u003cli\u003eZhu JN, Qi XY, Tan Y, Lyu XH: \u003cstrong\u003e[Dietary Factors Associated with Hyperuricemia and Glycolipid Metabolism Disorder in Middle-aged and Elderly People].\u003c/strong\u003e \u003cem\u003eSichuan da xue xue bao Yi xue ban = Journal of Sichuan University Medical science edition \u003c/em\u003e2016, \u003cstrong\u003e47:\u003c/strong\u003e68-72.\u003c/li\u003e\n\u003cli\u003eChoi HK, Atkinson K, Karlson EW, Willett W, Curhan G: \u003cstrong\u003ePurine-rich foods, dairy and protein intake, and the risk of gout in men.\u003c/strong\u003e \u003cem\u003eThe New England journal of medicine \u003c/em\u003e2004, \u003cstrong\u003e350:\u003c/strong\u003e1093-1103.\u003c/li\u003e\n\u003cli\u003eBenn CL, Dua P, Gurrell R, Loudon P, Pike A, Storer RI, Vangjeli C: \u003cstrong\u003ePhysiology of Hyperuricemia and Urate-Lowering Treatments.\u003c/strong\u003e \u003cem\u003eFrontiers in medicine \u003c/em\u003e2018, \u003cstrong\u003e5:\u003c/strong\u003e160.\u003c/li\u003e\n\u003cli\u003eDesaulniers P, Fernandes M, Gilbert C, Bourgoin SG, Naccache PH: \u003cstrong\u003eCrystal-induced neutrophil activation. VII. Involvement of Syk in the responses to monosodium urate crystals.\u003c/strong\u003e \u003cem\u003eJournal of leukocyte biology \u003c/em\u003e2001, \u003cstrong\u003e70:\u003c/strong\u003e659-668.\u003c/li\u003e\n\u003cli\u003eTerkeltaub R: \u003cstrong\u003eUpdate on gout: new therapeutic strategies and options.\u003c/strong\u003e \u003cem\u003eNature reviews Rheumatology \u003c/em\u003e2010, \u003cstrong\u003e6:\u003c/strong\u003e30-38.\u003c/li\u003e\n\u003cli\u003eKnake C, Stamp L, Bahn A: \u003cstrong\u003eMolecular mechanism of an adverse drug-drug interaction of allopurinol and furosemide in gout treatment.\u003c/strong\u003e \u003cem\u003eBiochemical and biophysical research communications \u003c/em\u003e2014, \u003cstrong\u003e452:\u003c/strong\u003e157-162.\u003c/li\u003e\n\u003cli\u003ePerez-Ruiz F, Jansen T, Tausche AK, Juarez-Campo M, Gurunath RK, Richette P: \u003cstrong\u003eEfficacy and safety of lesinurad for the treatment of hyperuricemia in gout.\u003c/strong\u003e \u003cem\u003eDrugs in context \u003c/em\u003e2019, \u003cstrong\u003e8:\u003c/strong\u003e212581.\u003c/li\u003e\n\u003cli\u003eEnomoto A, Kimura H, Chairoungdua A, Shigeta Y, Jutabha P, Cha SH, Hosoyamada M, Takeda M, Sekine T, Igarashi T, et al: \u003cstrong\u003eMolecular identification of a renal urate anion exchanger that regulates blood urate levels.\u003c/strong\u003e \u003cem\u003eNature \u003c/em\u003e2002, \u003cstrong\u003e417:\u003c/strong\u003e447-452.\u003c/li\u003e\n\u003cli\u003eHuneycutt E, Board C, Clements JN: \u003cstrong\u003eLesinurad, a Selective URAT-1 Inhibitor With a Novel Mechanism in Combination With a Xanthine Oxidase Inhibitor, for Hyperuricemia Associated With Gout.\u003c/strong\u003e \u003cem\u003eJournal of pharmacy practice \u003c/em\u003e2017\u003cstrong\u003e:\u003c/strong\u003e897190017734427.\u003c/li\u003e\n\u003cli\u003eHoy SM: \u003cstrong\u003eLesinurad: First Global Approval.\u003c/strong\u003e \u003cem\u003eDrugs \u003c/em\u003e2016, \u003cstrong\u003e76:\u003c/strong\u003e509-516.\u003c/li\u003e\n\u003cli\u003eHu QH, Zhang X, Wang X, Jiao RQ, Kong LD: \u003cstrong\u003eQuercetin regulates organic ion transporter and uromodulin expression and improves renal function in hyperuricemic mice.\u003c/strong\u003e \u003cem\u003eEuropean journal of nutrition \u003c/em\u003e2012, \u003cstrong\u003e51:\u003c/strong\u003e593-606.\u003c/li\u003e\n\u003cli\u003eBilliet L, Doaty S, Katz JD, Velasquez MT: \u003cstrong\u003eReview of hyperuricemia as new marker for metabolic syndrome.\u003c/strong\u003e \u003cem\u003eISRN rheumatology \u003c/em\u003e2014, \u003cstrong\u003e2014:\u003c/strong\u003e852954.\u003c/li\u003e\n\u003cli\u003eWu T, Chen J, Dong S, Li H, Cao Y, Tian Y, Fu W, Zhou P, Xi B, Pang J: \u003cstrong\u003eIdentification and characterization of a potent and selective inhibitor of human urate transporter 1.\u003c/strong\u003e \u003cem\u003ePharmacological reports : PR \u003c/em\u003e2017, \u003cstrong\u003e69:\u003c/strong\u003e1103-1112.\u003c/li\u003e\n\u003cli\u003eHaidari F, Keshavarz SA, Mohammad Shahi M, Mahboob SA, Rashidi MR: \u003cstrong\u003eEffects of Parsley (Petroselinum crispum) and its Flavonol Constituents, Kaempferol and Quercetin, on Serum Uric Acid Levels, Biomarkers of Oxidative Stress and Liver Xanthine Oxidoreductase Aactivity inOxonate-Induced Hyperuricemic Rats.\u003c/strong\u003e \u003cem\u003eIranian journal of pharmaceutical research : IJPR \u003c/em\u003e2011, \u003cstrong\u003e10:\u003c/strong\u003e811-819.\u003c/li\u003e\n\u003cli\u003eSoliman MM, Baiomy AA, Yassin MH: \u003cstrong\u003eMolecular and Histopathological Study on the Ameliorative Effects of Curcumin Against Lead Acetate-Induced Hepatotoxicity and Nephrototoxicity in Wistar Rats.\u003c/strong\u003e \u003cem\u003eBiological trace element research \u003c/em\u003e2015, \u003cstrong\u003e167:\u003c/strong\u003e91-102.\u003c/li\u003e\n\u003cli\u003eSaad DY, Soliman MM, Baiomy AA, Yassin MH, El-Sawy HB: \u003cstrong\u003eEffects of Karela (Bitter Melon; Momordica charantia) on genes of lipids and carbohydrates metabolism in experimental hypercholesterolemia: biochemical, molecular and histopathological study.\u003c/strong\u003e \u003cem\u003eBMC complementary and alternative medicine \u003c/em\u003e2017, \u003cstrong\u003e17:\u003c/strong\u003e319.\u003c/li\u003e\n\u003cli\u003eKuwabara M: \u003cstrong\u003eHyperuricemia, Cardiovascular Disease, and Hypertension.\u003c/strong\u003e \u003cem\u003ePulse (Basel, Switzerland) \u003c/em\u003e2016, \u003cstrong\u003e3:\u003c/strong\u003e242-252.\u003c/li\u003e\n\u003cli\u003eNuki G, Simkin PA: \u003cstrong\u003eA concise history of gout and hyperuricemia and their treatment.\u003c/strong\u003e \u003cem\u003eArthritis research \u0026amp; therapy \u003c/em\u003e2006, \u003cstrong\u003e8 Suppl 1:\u003c/strong\u003eS1.\u003c/li\u003e\n\u003cli\u003eWang MX, Liu YL, Yang Y, Zhang DM, Kong LD: \u003cstrong\u003eNuciferine restores potassium oxonate-induced hyperuricemia and kidney inflammation in mice.\u003c/strong\u003e \u003cem\u003eEuropean journal of pharmacology \u003c/em\u003e2015, \u003cstrong\u003e747:\u003c/strong\u003e59-70.\u003c/li\u003e\n\u003cli\u003eDi Giovine FS, Malawista SE, Nuki G, Duff GW: \u003cstrong\u003eInterleukin 1 (IL 1) as a mediator of crystal arthritis. Stimulation of T cell and synovial fibroblast mitogenesis by urate crystal-induced IL 1.\u003c/strong\u003e \u003cem\u003eJournal of immunology (Baltimore, Md : 1950) \u003c/em\u003e1987, \u003cstrong\u003e138:\u003c/strong\u003e3213-3218.\u003c/li\u003e\n\u003cli\u003eTerkeltaub R: \u003cstrong\u003eGout in 2006: the perfect storm.\u003c/strong\u003e \u003cem\u003eBulletin of the NYU hospital for joint diseases \u003c/em\u003e2006, \u003cstrong\u003e64:\u003c/strong\u003e82-86.\u003c/li\u003e\n\u003cli\u003eZamocky M, Regelsberger G, Jakopitsch C, Obinger C: \u003cstrong\u003eThe molecular peculiarities of catalase-peroxidases.\u003c/strong\u003e \u003cem\u003eFEBS letters \u003c/em\u003e2001, \u003cstrong\u003e492:\u003c/strong\u003e177-182.\u003c/li\u003e\n\u003cli\u003eSelvaratnam J, Robaire B: \u003cstrong\u003eOverexpression of catalase in mice reduces age-related oxidative stress and maintains sperm production.\u003c/strong\u003e \u003cem\u003eExperimental gerontology \u003c/em\u003e2016, \u003cstrong\u003e84:\u003c/strong\u003e12-20.\u003c/li\u003e\n\u003cli\u003eZamudio-Cuevas Y, Hernandez-Diaz C, Pineda C, Reginato AM, Cerna-Cortes JF, Ventura-Rios L, Lopez-Reyes A: \u003cstrong\u003eMolecular basis of oxidative stress in gouty arthropathy.\u003c/strong\u003e \u003cem\u003eClinical rheumatology \u003c/em\u003e2015, \u003cstrong\u003e34:\u003c/strong\u003e1667-1672.\u003c/li\u003e\n\u003cli\u003eSmith EU, Diaz-Torne C, Perez-Ruiz F, March LM: \u003cstrong\u003eEpidemiology of gout: an update.\u003c/strong\u003e \u003cem\u003eBest practice \u0026amp; research Clinical rheumatology \u003c/em\u003e2010, \u003cstrong\u003e24:\u003c/strong\u003e811-827.\u003c/li\u003e\n\u003cli\u003eGrayson PC, Kim SY, LaValley M, Choi HK: \u003cstrong\u003eHyperuricemia and incident hypertension: a systematic review and meta-analysis.\u003c/strong\u003e \u003cem\u003eArthritis care \u0026amp; research \u003c/em\u003e2011, \u003cstrong\u003e63:\u003c/strong\u003e102-110.\u003c/li\u003e\n\u003cli\u003eFleischmann R, Kerr B, Yeh LT, Suster M, Shen Z, Polvent E, Hingorani V, Quart B, Manhard K, Miner JN, Baumgartner S: \u003cstrong\u003ePharmacodynamic, pharmacokinetic and tolerability evaluation of concomitant administration of lesinurad and febuxostat in gout patients with hyperuricaemia.\u003c/strong\u003e \u003cem\u003eRheumatology (Oxford, England) \u003c/em\u003e2014, \u003cstrong\u003e53:\u003c/strong\u003e2167-2174.\u003c/li\u003e\n\u003cli\u003eShen Z, Rowlings C, Kerr B, Hingorani V, Manhard K, Quart B, Yeh LT, Storgard C: \u003cstrong\u003ePharmacokinetics, pharmacodynamics, and safety of lesinurad, a selective uric acid reabsorption inhibitor, in healthy adult males.\u003c/strong\u003e \u003cem\u003eDrug design, development and therapy \u003c/em\u003e2015, \u003cstrong\u003e9:\u003c/strong\u003e3423-3434.\u003c/li\u003e\n\u003cli\u003eSaag KG, Fitz-Patrick D, Kopicko J, Fung M, Bhakta N, Adler S, Storgard C, Baumgartner S, Becker MA: \u003cstrong\u003eLesinurad Combined With Allopurinol: A Randomized, Double-Blind, Placebo-Controlled Study in Gout Patients With an Inadequate Response to Standard-of-Care Allopurinol (a US-Based Study).\u003c/strong\u003e \u003cem\u003eArthritis \u0026amp; rheumatology (Hoboken, NJ) \u003c/em\u003e2017, \u003cstrong\u003e69:\u003c/strong\u003e203-212.\u003c/li\u003e\n\u003cli\u003ePerez-Ruiz F, Sundy JS, Miner JN, Cravets M, Storgard C: \u003cstrong\u003eLesinurad in combination with allopurinol: results of a phase 2, randomised, double-blind study in patients with gout with an inadequate response to allopurinol.\u003c/strong\u003e \u003cem\u003eAnnals of the rheumatic diseases \u003c/em\u003e2016, \u003cstrong\u003e75:\u003c/strong\u003e1074-1080.\u003c/li\u003e\n\u003cli\u003eMiner JN, Tan PK, Hyndman D, Liu S, Iverson C, Nanavati P, Hagerty DT, Manhard K, Shen Z, Girardet JL, et al: \u003cstrong\u003eLesinurad, a novel, oral compound for gout, acts to decrease serum uric acid through inhibition of urate transporters in the kidney.\u003c/strong\u003e \u003cem\u003eArthritis research \u0026amp; therapy \u003c/em\u003e2016, \u003cstrong\u003e18:\u003c/strong\u003e214.\u003c/li\u003e\n\u003cli\u003eLepist EI, Ray AS: \u003cstrong\u003eRenal drug-drug interactions: what we have learned and where we are going.\u003c/strong\u003e \u003cem\u003eExpert opinion on drug metabolism \u0026amp; toxicology \u003c/em\u003e2012, \u003cstrong\u003e8:\u003c/strong\u003e433-448.\u003c/li\u003e\n\u003cli\u003eOtani N, Ouchi M, Hayashi K, Jutabha P, Anzai N: \u003cstrong\u003eRoles of organic anion transporters (OATs) in renal proximal tubules and their localization.\u003c/strong\u003e \u003cem\u003eAnatomical science international \u003c/em\u003e2017, \u003cstrong\u003e92:\u003c/strong\u003e200-206.\u003c/li\u003e\n\u003cli\u003eShen Z, Yeh LT, Wallach K, Zhu N, Kerr B, Gillen M: \u003cstrong\u003eIn Vitro and In Vivo Interaction Studies Between Lesinurad, a Selective Urate Reabsorption Inhibitor, and Major Liver or Kidney Transporters.\u003c/strong\u003e \u003cem\u003eClinical drug investigation \u003c/em\u003e2016, \u003cstrong\u003e36:\u003c/strong\u003e443-452.\u003c/li\u003e\n\u003cli\u003eVitart V, Rudan I, Hayward C, Gray NK, Floyd J, Palmer CN, Knott SA, Kolcic I, Polasek O, Graessler J, et al: \u003cstrong\u003eSLC2A9 is a newly identified urate transporter influencing serum urate concentration, urate excretion and gout.\u003c/strong\u003e \u003cem\u003eNature genetics \u003c/em\u003e2008, \u003cstrong\u003e40:\u003c/strong\u003e437-442.\u003c/li\u003e\n\u003cli\u003eHabu Y, Yano I, Takeuchi A, Saito H, Okuda M, Fukatsu A, Inui K: \u003cstrong\u003eDecreased activity of basolateral organic ion transports in hyperuricemic rat kidney: roles of organic ion transporters, rOAT1, rOAT3 and rOCT2.\u003c/strong\u003e \u003cem\u003eBiochemical pharmacology \u003c/em\u003e2003, \u003cstrong\u003e66:\u003c/strong\u003e1107-1114.\u003c/li\u003e\n\u003cli\u003eKono H, Chen CJ, Ontiveros F, Rock KL: \u003cstrong\u003eUric acid promotes an acute inflammatory response to sterile cell death in mice.\u003c/strong\u003e \u003cem\u003eThe Journal of clinical investigation \u003c/em\u003e2010, \u003cstrong\u003e120:\u003c/strong\u003e1939-1949.\u003c/li\u003e\n\u003cli\u003eRomi MM, Arfian N, Tranggono U, Setyaningsih WAW, Sari DCR: \u003cstrong\u003eUric acid causes kidney injury through inducing fibroblast expansion, Endothelin-1 expression, and inflammation.\u003c/strong\u003e \u003cem\u003eBMC nephrology \u003c/em\u003e2017, \u003cstrong\u003e18:\u003c/strong\u003e326.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp style=\"margin: 0in; margin-bottom: .0001pt; vertical-align: baseline;\"\u003e\u003cspan style=\"font-family: 'Calibri',sans-serif; color: black;\"\u003eTable.1. The primers used for quantitative real time PCR (qRT-PCR).\u003c/span\u003e\u003c/p\u003e\n\u003cp style=\"margin: 0in; margin-bottom: .0001pt; vertical-align: baseline;\"\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable style=\"width: 419.4pt; border-collapse: collapse; border: none;\" width=\"559\"\u003e\n\u003ctbody\u003e\n\u003ctr style=\"height: 51.95pt;\"\u003e\n\u003ctd style=\"width: 53.85pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid black 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 51.95pt;\" width=\"72\"\u003e\n\u003ctable\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"vertical-align: top;\" width=\"611\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003eGene\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 46.75pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid black 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 51.95pt;\" colspan=\"2\" width=\"62\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003eProduct size (bp)\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 98.75pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid black 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 51.95pt;\" width=\"132\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003eAccession number\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 71.5pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid black 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 51.95pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003eDirection\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border-top: solid black 1.0pt; border-left: none; border-bottom: solid black 1.0pt; border-right: none; padding: 0in 5.4pt 0in 5.4pt; height: 51.95pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003eSequence (5'-3')\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 26.0pt;\"\u003e\n\u003ctd style=\"width: 53.85pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" rowspan=\"2\" width=\"72\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003emOAT-1\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 46.75pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" colspan=\"2\" rowspan=\"2\" width=\"62\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003e183\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 98.75pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" rowspan=\"2\" width=\"132\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eNM_008766.3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 71.5pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eSense\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eGACAGGGTCTCATCCCTAGC\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 26.0pt;\"\u003e\n\u003ctd style=\"width: 71.5pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eAntisense\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eGTCCCTGACACACTGACTGA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 26.0pt;\"\u003e\n\u003ctd style=\"width: 53.85pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" rowspan=\"2\" width=\"72\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003emOAT-3\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 46.75pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" colspan=\"2\" rowspan=\"2\" width=\"62\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003e153\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 98.75pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" rowspan=\"2\" width=\"132\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eNM_001164635.1\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 71.5pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eSense\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eTACAGTTGTCCGTGTCTGCT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 26.0pt;\"\u003e\n\u003ctd style=\"width: 71.5pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eAntisense\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eCTTCCTCCTTCTTGCCGTTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 26.0pt;\"\u003e\n\u003ctd style=\"width: 59.4pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" colspan=\"2\" rowspan=\"2\" width=\"79\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003emURAT-1\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 41.2pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" rowspan=\"2\" width=\"55\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003e145\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 98.75pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" rowspan=\"2\" width=\"132\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eNM_009203.3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 71.5pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eSense\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eGATAGGTTTGGGCGCAGAAG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 26.0pt;\"\u003e\n\u003ctd style=\"width: 71.5pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eAntisense\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eTCATCATGACACCTGCCACT\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 26.0pt;\"\u003e\n\u003ctd style=\"width: 53.85pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" rowspan=\"2\" width=\"72\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003emGlut-9\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 46.75pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" colspan=\"2\" rowspan=\"2\" width=\"62\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003e153\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 98.75pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" rowspan=\"2\" width=\"132\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eNM_001102415.1\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 71.5pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eSense\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eTTCGGGTCCTTCCTTCCTCTA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 26.0pt;\"\u003e\n\u003ctd style=\"width: 71.5pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eAntisense\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eGGACACAGTCACAGACCAGA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 26.0pt;\"\u003e\n\u003ctd style=\"width: 53.85pt; border: none; border-bottom: solid black 1.0pt; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" rowspan=\"2\" width=\"72\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003em\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cspan style=\"font-family: Symbol; color: black;\"\u003eb\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cspan style=\"color: black;\"\u003e-actin\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 46.75pt; border: none; border-bottom: solid black 1.0pt; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" colspan=\"2\" rowspan=\"2\" width=\"62\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003e143\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 98.75pt; border: none; border-bottom: solid black 1.0pt; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" rowspan=\"2\" width=\"132\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eNm_007393.5\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 71.5pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eSense\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border: none; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eCCAGCCTTCCTTCTTGGGTA\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 26.0pt;\"\u003e\n\u003ctd style=\"width: 71.5pt; border: none; border-bottom: solid black 1.0pt; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"95\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eAntisense\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 148.55pt; border: none; border-bottom: solid black 1.0pt; background: white; padding: 0in 5.4pt 0in 5.4pt; height: 26.0pt;\" width=\"198\"\u003e\n\u003cp style=\"margin-bottom: 10.0pt; text-align: center; line-height: normal;\"\u003e\u003cspan style=\"color: black;\"\u003eCAATGCCTGGGTACATGGTG\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-pharmacology-and-toxicology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"phat","sideBox":"Learn more about [BMC Pharmacology and Toxicology](http://bmcpharmacoltoxicol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/phat/Default.aspx","title":"BMC Pharmacology and Toxicology","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Lesinurad, ameliorative effects, hyperuricemia, gene expression, kidney affection, XOD activity.","lastPublishedDoi":"10.21203/rs.2.17096/v3","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.2.17096/v3","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground : Hyperuricemia\u0026nbsp;is an abnormal increase in uric acid levels in the blood. It is the cause of gout that manifested by inflammatory arthritis and painful disable. Therefore, current study evaluated the potential ameliorative impact of Lesinurad and Allopurinol on the kidneys of hyperuricemic mice at the biochemical, molecular and cellular levels.\u003c/p\u003e\u003cp\u003e Methods : Lesinurad and allopurinol alone or in combination were orally administered to hyperuricemic and control mice for seven consecutive days. Levels of uric acid and blood urea nitrogen, along with antioxidants and inflammatory cytokines (IL-1β and TNF-a) were measured in the serum. The mRNA expression of mouse urate anion transporter-1, glucose transporter 9, organic anion transporters, in renal tissues were examined using quantitative real time PCR (qRT-PCR). Simultaneously, the immunoreactivity of transforming growth factor-beta 1 was examined immunohistochemically. \u003c/p\u003e\u003cp\u003eResults : Lesinurad and allopurinol administration resulted in significant decrease in serum levels of uric acid, blood urea nitrogen, xanthine oxidase activity, catalase, glutathione peroxidase and inflammatory cytokines (IL-1β and TNF-a) reported in hyperuricemic mice. Both partially reversed oxonate-induced alterations in renal mURAT-1, mGLUT-9, mOAT-1 and mOAT-3 expressions, as well as alterations in the immunoreactivity of TGF- β1, resulting in the increase of renal uric acid secretion and excretion. The combined administration of lesinurad and ALP restored all altered parameters in a synergistic manner, improving renal function in the hyperuricemic mouse model employed. \u003c/p\u003e\u003cp\u003eConclusion : This study confirmed synergistic ameliorative hypouricemic impact of both lesinurad and allopurinol in the treatment of hyperuricemia in mice at the biochemical, molecular and cellular levels.\u003c/p\u003e","manuscriptTitle":"Impact of Lesinurad and Allopurinol on Experimental Hyperuricemia in mice: Biochemical, Molecular and Immunohistochemical Study","msid":"","msnumber":"","nonDraftVersions":[{"code":3,"date":"2020-01-08 21:49:59","doi":"10.21203/rs.2.17096/v3","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorAssigned","content":"","date":"2020-01-06T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-01-05T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-01-05T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-pharmacology-and-toxicology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"phat","sideBox":"Learn more about [BMC Pharmacology and Toxicology](http://bmcpharmacoltoxicol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/phat/Default.aspx","title":"BMC Pharmacology and Toxicology","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}},{"code":2,"date":"2019-12-17 15:13:15","doi":"10.21203/rs.2.17096/v2","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Minor revision","date":"2020-01-03T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2019-12-27T12:00:00+00:00","index":1,"fulltext":"Recommendation: Accept without revision\nForm responses:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Needs some language corrections before being published**\n* Declaration of competing interests: **I declare that I have no competing interests**\n\nComments to Author:\n---\n"},{"type":"editorInvitedReview","content":"","date":"2019-12-25T12:00:00+00:00","index":2,"fulltext":"Recommendation: Accept after discretionary revisions\nForm responses:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Needs some language corrections before being published**\n* Declaration of competing interests: **I declare that I have no competing interests**\n\nComments to Author:\n---\n"},{"type":"editorInvitedReview","content":"","date":"2019-12-25T12:00:00+00:00","index":3,"fulltext":"Recommendation: Major revisions required\nForm responses:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **No**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Needs some language corrections before being published**\n* Declaration of competing interests: **I declare that I have no competing interests**\n\nComments to Author:\n---\nPlease include all comments for the authors in this box rather than uploading your report as an attachment. Please only upload as attachments annotated versions of manuscripts, graphs, supporting materials or other aspects of your report which cannot be included in a text format.\nPlease overwrite this text whePHAT-D-19-00225\n1-Title Ameliorative Effects of Lesinurad (Zurampic) on Experimental Hyperuricemia,Biochemical, Molecular and Immunohistochemical Study.\nComment: mention if clinical or animal study because the title of each study should be comprehensive .\nComment : please, remove the (Zurampic) .\n2- Abstract:\nComment : please remove the abbreviations from abstract content.\nComment : evaluated instead of evaluates.\n\nExperimental Animals and Design\nComment : change this phrase ( in vivo animal )\nComment : rephrasing (The Swiss mice used in this experiment consisted of a total of forty-two male mice aged ten weeks (weight 30-35g), originating from the College of Pharmacy, King Abdel-Aziz University, Jeddah, Saudi Arabia.)\nComment : rephrasing (The mice were handled manually for seven days in order to overcome stress).\n.Seven groups of mice were employed, each consisting of six individuals. Comment :\n1-Group 1 was the negative control (CNT), with the mice given free access to food and water. Give another suitable expression about this group,please.\n2- Group 2 was the positive hyperuricemic group, in which the mice received PO intraperitoneally (250 mg/kg bw, single dose every day at 8:00 am). Please change the (single dose ) to once dose unless this work would be rejected in addition to the period of administration.\n3- Group 4 was administered ZUR, accompanied by an orally administered dose of 80 mg/kg, in accordance with Wu et al. (2017) [37].please ,rephrasing .\n4- could you mention the importance of specify the time of administration?\nResults\n1-rephrasing (HU demonstrated an increase in comparison to those of the control (CNT) group in the levels of liver biomarkers, uric acid and BUN).\n2- It should be noted that AUR in HU mice revealed no higher level of influence than in ALP\nadministered hyperuricemic rats. Mention mice and rats ,please give notification if you used more than one animal model.\n3- As shown in Figure 2, there was an increase in the serum and liver XOD activities in\nhyperuricemic mice, which were significantly normalized in the ALP administered group\nas compared to ZUR administered hyperuricemic rats.\nComment : as same above.\n------------------------------------------\nConclusions:\n1- Evidence for the synergistic hypouricemic activity\n2- Comment : give evidence if the combination give synergism or additive effects\nn adding your comments to the authors."},{"type":"reviewerAgreed","content":"","date":"2019-12-22T12:00:00+00:00","index":2,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2019-12-22T12:00:00+00:00","index":3,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2019-12-17T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2019-12-17T12:00:00+00:00","index":1,"fulltext":""},{"type":"editorAssigned","content":"","date":"2019-12-16T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2019-12-15T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2019-12-15T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-pharmacology-and-toxicology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"phat","sideBox":"Learn more about [BMC Pharmacology and Toxicology](http://bmcpharmacoltoxicol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/phat/Default.aspx","title":"BMC Pharmacology and Toxicology","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2019-11-11 20:23:51","doi":"10.21203/rs.2.17096/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2019-12-04T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2019-12-02T12:00:00+00:00","index":2,"fulltext":"Recommendation: Major revisions required\nForm responses:\n---\n* Are the methods appropriate and well described?: **No**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Not suitable for publication unless extensively edited**\n* Declaration of competing interests: **'I declare that I have no competing interests**\n\nComments to Author:\n---\nThe study of Alghamdi and colleagues aims at analyzing the effect of a combined treatment of urate transporters- and xanthine oxidase inhibitors compared to the relative monotherapies on the expression of urate absorption system. In addition, the work evaluates biomarkers of liver and kidney injury, inflammation and oxidative stress in a mouse model of oxonate-induced hyperuricemia. The study concept is timely and interesting given the recent introduction of Zurampic+Allopurinol as a combined therapy against uric acid lithiasis associated to gout. Nonetheless, recent findings indicate a cautious approach to this therapeutic strategy given safety concerns on a possible nephrotoxic effect. In addition, Dotinurad (PMID: 31754883), a novel drug compound with claims of low nephrotoxic effect and Lenisurad-like mechanism is currently under development.\n\nMajor revisions:\n1. For the reasons mentioned above a major point should be raised on formal aspects of article's drafting. In particular, the title and the discussion of data drive reader's focus on a POC, namely hyperuricemia amelioration, which has been already achieved in several clinical studies. Moreover, the title (please revise) do not refers to the actual effect of Zurampic combined to Allopurinol, a recurring finding of all the assays carried out. In light of this, reconsidering the discussion, and even the title might thoroughly increase the overall article impact on readers' attention.\n2. Study design is appropriate although biomarkers definition/specifications need to be stated more clearly.\n3. Please specify how the morphological analysis was carried out, in particular: was it blinded? How many operators performed it? How many slides per animal were considered in the analysis? Were the fields captured randomly?\n\nMinor Revisions:\n1. Line 56 page 4 - Please better address URAT-1 mechanism, the term \"influence\" appears too generic.\n2. Line 48 page 5 - Please word GOT and GPT in full form before the acronyms.\n3. Line 16 page 7 - The assay is poorly described, please specify units, including those lacking in y axis of the relative Figure 1. As in all the other figures the term \"changes\" in unacceptable as not referred to folds.\n4. Line 39 page 8 - Please cite in text as the other reference and add the link in the Bibliography as a webpage reference.\n5. Line 55 page 14 - Line 14 page 15. The paragraph is formally involute, I suggest to mention earlier in text the antioxidant function of the assayed enzymes.\n6. Line 29 page 13 - Please reformulate, as TGF-β expressed of control mice reflects a comparison with the other treated groups rather than a major finding.\n7. Line 33 -35 page 15 - It is not clear whether this refers to the number of new drug compounds available or new drugs molecules lowering the expected amount of serum urate.\n8. Line 9 page 16 - Reference should be the following: Lepist EI et al (PMID22372422). Please describe better the rational beyond Lesinurad activity on OAT1, 3, and 4 (also in light of the previous work cited, Miner JN and colleagues). While providing a more exhaustive mechanisms of Lenisurad on OAT receptors, please consider receptor antagonism and gene expression inhibition/increase as distinct mechanisms rather citing the generic term modulation.\n9. Figure 5 - Please include images of gel with target and housekeeping bands.\n"},{"type":"editorInvitedReview","content":"","date":"2019-12-01T12:00:00+00:00","index":3,"fulltext":"Recommendation: Major revisions required\nForm responses:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I recommend additional statistical review**\n* Quality of written English: **Needs some language corrections before being published**\n* Declaration of competing interests: **I declare that I have no competing interests**\n\nComments to Author:\n---\nResearchers investigated the ameliorative impact of Lesinurad and ALP in combination on oxonate-induced HU in mice at the biochemical, molecular and histopathological levels.This topic fits the scope of Pharmacology and Toxicology, although lack of novelty.\nA combined oral therapy of lesinurad and allopurinol (brand name Duzallo) was also approved by the USFDA in August 2017 to treat uncontrolled\ngout-related hyperuricemia in patients (Abramowicz et al.,2018).\nBesides please consider below similar publications which was not cited, please make some comments on it also\n(1) Abramowicz, Mark, Gianna Zuccotti, and Jean-Marie Pflomm. \"Lesinurad/Allopurinol (Duzallo) for Gout-Associated Hyperuricemia (Reprinted from The Medical Letter on Drugs and Therapeutics vol 59, pg 182-183, 2017).\" JAMA-JOURNAL OF THE AMERICAN MEDICAL ASSOCIATION 319.2 (2018): 188-+.\n(2) Saag, Kenneth G., et al. \"Lesinurad combined with allopurinol: a randomized, double‐blind, placebo‐controlled study in gout patients with an inadequate response to standard‐of‐care allopurinol (a US‐based study).\" Arthritis \u0026 Rheumatology 69.1 (2017): 203-212.\n\np7, line 18 What about female? Does gender of mice matter?\np7, line 56 In combination of ALP and ZUR, not meantion the dose rate for each respectively. Is it the same as group 3 and 4 simultaneously?\nQuantitative analysis for the combination of Lesinurad and ALP on oxonate-induced HU in mice? Or the propotion of ALP is not important?\nP9, line 4 In qRT-PCR protocal please list all reagents and equipments orderly."},{"type":"editorInvitedReview","content":"","date":"2019-11-27T12:00:00+00:00","index":1,"fulltext":"Recommendation: Major revisions required\nForm responses:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **No**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I recommend additional statistical review**\n* Quality of written English: **Needs some language corrections before being published**\n* Declaration of competing interests: **I declare that I have no competing interests**\n\nComments to Author:\n---\nPHAT-D-19-00225\n1-Title Ameliorative Effects of Lesinurad (Zurampic) on Experimental Hyperuricemia,Biochemical, Molecular and Immunohistochemical Study.\nComment: mention if clinical or animal study because the title of each study should be comprehensive .\nComment : please, remove the (Zurampic) .\n2- Abstract:\nComment : please remove the abbreviations from abstract content.\nComment : evaluated instead of evaluates.\n\nExperimental Animals and Design\nComment : change this phrase ( in vivo animal )\nComment : rephrasing (The Swiss mice used in this experiment consisted of a total of forty-two male mice aged ten weeks (weight 30-35g), originating from the College of Pharmacy, King Abdel-Aziz University, Jeddah, Saudi Arabia.)\nComment : rephrasing (The mice were handled manually for seven days in order to overcome stress).\n.Seven groups of mice were employed, each consisting of six individuals. Comment :\n1-Group 1 was the negative control (CNT), with the mice given free access to food and water. Give another suitable expression about this group,please.\n2- Group 2 was the positive hyperuricemic group, in which the mice received PO intraperitoneally (250 mg/kg bw, single dose every day at 8:00 am). Please change the (single dose ) to once dose unless this work would be rejected in addition to the period of administration.\n3- Group 4 was administered ZUR, accompanied by an orally administered dose of 80 mg/kg, in accordance with Wu et al. (2017) [37].please ,rephrasing .\n4- could you mention the importance of specify the time of administration?\nResults\n1-rephrasing (HU demonstrated an increase in comparison to those of the control (CNT) group in the levels of liver biomarkers, uric acid and BUN).\n2- It should be noted that AUR in HU mice revealed no higher level of influence than in ALP\nadministered hyperuricemic rats. Mention mice and rats ,please give notification if you used more than one animal model.\n3- As shown in Figure 2, there was an increase in the serum and liver XOD activities in\nhyperuricemic mice, which were significantly normalized in the ALP administered group\nas compared to ZUR administered hyperuricemic rats.\nComment : as same above.\n------------------------------------------\nConclusions:\n1- Evidence for the synergistic hypouricemic activity\n2- Comment : give evidence if the combination give synergism or additive effects\n"},{"type":"reviewerAgreed","content":"","date":"2019-11-20T12:00:00+00:00","index":4,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2019-11-18T12:00:00+00:00","index":2,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2019-11-18T12:00:00+00:00","index":3,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2019-11-15T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2019-11-15T12:00:00+00:00","index":1,"fulltext":""},{"type":"editorAssigned","content":"","date":"2019-11-06T12:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"","date":"2019-11-05T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2019-11-05T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2019-11-05T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-pharmacology-and-toxicology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"phat","sideBox":"Learn more about [BMC Pharmacology and Toxicology](http://bmcpharmacoltoxicol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/phat/Default.aspx","title":"BMC Pharmacology and Toxicology","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"85fedfd6-4fa5-4671-904f-ffc2b237ae97","owner":[],"postedDate":"January 8th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":43125,"name":"Clinical Pharmacology"}],"tags":[],"updatedAt":"","versionOfRecord":{"articleIdentity":"rs-7730","link":"https://doi.org/10.1186/s40360-020-0386-7","journal":{"identity":"bmc-pharmacology-and-toxicology","isVorOnly":false,"title":"BMC Pharmacology and Toxicology"},"publishedOn":"2020-02-10 12:00:00","publishedOnDateReadable":"February 10th, 2020"},"versionCreatedAt":"2020-01-08 21:49:59","video":"","vorDoi":"10.1186/s40360-020-0386-7","vorDoiUrl":"https://doi.org/10.1186/s40360-020-0386-7","workflowStages":[]},"version":"v3","identity":"rs-7730","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"identity":"rs-7730","version":["v3"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00