Bisphenol A contamination in irrigation water compromises tomato (Solanum lycopersicum) performance and food safety through oxidative and molecular stress pathway

preprint OA: closed
Full text JSON View at publisher
Full text 82,974 characters · extracted from preprint-html · click to expand
Bisphenol A contamination in irrigation water compromises tomato (Solanum lycopersicum) performance and food safety through oxidative and molecular stress pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Bisphenol A contamination in irrigation water compromises tomato (Solanum lycopersicum) performance and food safety through oxidative and molecular stress pathway Iwebaffa Amos Edet, Oluwafolake Adenike Akinbode, Hillary Chukwuemeka Onyeanusi, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7454406/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Bisphenol A (BPA) is a pervasive endocrine-disrupting compound increasingly detected in wastewater effluents and reclaimed irrigation water, raising concerns for crop health and food safety. This study investigated the physiological, biochemical, and molecular responses of tomato ( Solanum lycopersicum L. cv. Roma VF [NH5]) exposed to BPA-contaminated irrigation water under controlled greenhouse conditions at the Institute of Agricultural Research and Training, Obafemi Awolowo University, and the National Horticultural Research Institute, Ibadan, Nigeria. Plants were irrigated with 0, 50, 100, and 200 µg L⁻¹ BPA for 30 days, and growth, photosynthetic traits, oxidative stress biomarkers, antioxidant defense, and stress-related gene expression were assessed. BPA exposure significantly reduced plant height, chlorophyll content (SPAD), and photosystem II efficiency (Fv/Fm), with declines most pronounced at 200 µg L⁻¹. Lipid peroxidation increased by 171% relative to control,which indicated severe oxidative damage. Antioxidant enzymes (superoxide dismutase, catalase, peroxidase) and their corresponding genes (SlSOD, SlCAT, SlPOD) were markedly upregulated, reflecting activation of the redox defense system. Moreover, a 2.7-fold induction of SlHSP70 expression suggested generalized molecular stress responses and proteostasis disruption.Hence, these findings demonstrated that even environmentally relevant BPA levels can impair tomato plant growth and photosynthetic performance via oxidative and molecular stress pathways. Beyond productivity losses, the results showed that potential risks for food quality and human exposure under wastewater reuse practices. Monitoring and mitigation strategies are urgently needed to minimize BPA contamination in agricultural irrigation systems and safeguard both crop performance and food safety. BisphenolA(BPA) Tomato(Solanumlycopersicum) Wastewater irrigation Oxidative stress Antioxidant defense Food safety Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Bisphenol A (BPA) is among the most widely produced synthetic chemicals globally, with an estimated annual output exceeding 6 million tonnes (Manzoor et al., 2022). As a monomer in the manufacture of polycarbonate plastics and epoxy resins, BPA is extensively used in consumer goods, food packaging, thermal paper, and industrial applications. Its widespread use and persistence result in continuous release into aquatic environments through industrial discharge, landfill leachates, and wastewater effluents (Torres-García et al., 2022). BPA is now frequently detected in surface waters, groundwater, and even treated municipal wastewater, raising global concerns about its potential ecological and human health risks (Yu et al., 2019). BPA is a well-recognized endocrine-disrupting compound (EDC) that mimics or antagonizes natural hormones, interfering with developmental and physiological processes in animals and humans (Hafezi and Abdel-Rahman 2019). In plants, however, the impacts of BPA remain less understood, despite growing evidence of its uptake and bioaccumulation in edible crops irrigated with reclaimed wastewater (Changyun et al. 2020, Nwankwo et al., 2025). The presence of BPA in agricultural soils and irrigation water therefore presents a dual challenge: potential impairment of crop productivity and food safety risks through dietary exposure(Wolff Leal et al. 2025) . Recent studies suggest that BPA exposure can alter photosynthetic efficiency, induce oxidative stress, and disrupt metabolic homeostasis in crops such as lettuce, wheat,Arabidopsis, and cucumber (Changyun et al. 2020, Wen-Juan Pan et al..2013; Molina-López et al., 2023). Elevated ROS generation and lipid peroxidation appear to be central to its phytotoxicity, accompanied by activation of antioxidant defense systems and stress-responsive gene expression(Rao et al., 2025). However, most studies to date have focused on seedlings under hydroponic exposure or short-term treatments, leaving significant knowledge gaps regarding whole-plant responses under soil-based greenhouse conditions (Xingyi et al., 2017). Moreover, the molecular mechanisms by which BPA modulates stress signaling, particularly heat shock proteins and redox regulatory genes, remain underexplored (Zhang et al., 2025) Tomato ( Solanum lycopersicum ) is a globally important horticultural crop, both economically and nutritionally, and is widely cultivated under irrigation. Its high water demand makes it particularly vulnerable to contamination from reclaimed wastewater sources(Saffan et al., 2022), Yet, systematic evaluations of BPA effects on tomato growth, physiology, and molecular stress responses under realistic greenhouse conditions are limited. (Zhou et al., 2024, Kotowska et al., 2025) This study therefore investigated the physiological, biochemical, and molecular responses of tomato plants exposed to BPA-contaminated irrigation water. Specifically, we assessed growth parameters, chlorophyll content, photosystem II efficiency, lipid peroxidation, antioxidant enzyme activities, and expression of key stress-related genes. By linking physiological impairments with biochemical and transcriptional responses, this work provides mechanistic insights into BPA phytotoxicity and highlights the broader implications for food safety and agricultural sustainability in regions increasingly reliant on wastewater reuse. Materials and Method Plant Material and Greenhouse Conditions Tomato ( Solanum lycopersicum L., cv. Roma VF[NH5]) seeds (obtained from the National Horticultural Research Institute, Ibadan, Nigeria) were surface sterilized in 1% (v/v) sodium hypochlorite (Merck, Germany) for 5 min and rinsed thoroughly with sterile distilled water (3×). Seeds were germinated in plastic seedling trays containing sterilized soil:sand:compost mixture (2:1:1, v/v/v). After 14 days, uniform seedlings were transplanted into 3 L pots filled with sterilized loamy soil. Plants were grown in a greenhouse maintained at 25 ± 2°C, 65–70% relative humidity, and a 16 h light/8 h dark photoperiod under natural light supplemented with sodium lamps (Philips SON-T Agro 400 W). Plants were watered with distilled water until the start of BPA treatments. BPA Treatment Analytical-grade Bisphenol A (BPA; purity ≥ 99%, Sigma-Aldrich, USA; CAS No. 80-05-7) was dissolved in absolute ethanol (HPLC grade, Merck, Germany) to prepare a 1 g/L stock solution. Working concentrations of 50, 100, and 200 µg/L were prepared by dilution with sterile distilled water. The control group received distilled water containing < 0.01% ethanol, matching solvent levels in the BPA treatments. Each plant received 200 mL of the respective treatment solution via soil irrigation twice weekly for 30 days. Treatments were arranged in a randomized complete block design (RCBD) with five replicates per treatment. Growth and Physiological Measurements Plant height was measured weekly from soil surface to the shoot apex with a digital meter rule. Chlorophyll content was measured at 30 days after treatment (DAT) using a SPAD-502 Plus chlorophyll meter (Konica Minolta, Japan). Three fully expanded leaves per plant were measured, and mean SPAD values were calculated(Shibaeva et al. 2020). Photosystem II efficiency (Fv/Fm) was determined on dark-adapted leaves (30 min) using a portable chlorophyll fluorometer (PAM-2100, Heinz Walz GmbH, Germany)(Schreiber et al., 1996) Lipid Peroxidation Assay :Lipid peroxidation was quantified by malondialdehyde (MDA) content using the thiobarbituric acid (TBA) method.(Leon and Borges 2020) Extraction : 0.5 g of fresh leaf tissue was homogenized in 5 mL 0.1% (w/v) trichloroacetic acid (TCA; Sigma-Aldrich) using a chilled mortar and pestle. Homogenates were centrifuged at 12,000×g for 15 min at 4°C (Eppendorf 5810R centrifuge, Germany). Reaction : 1 ml of supernatant was mixed with 4 ml of 0.5% (w/v) TBA prepared in 20% (w/v) TCA. The mixture was incubated at 95°C for 30 min, rapidly cooled on ice, and centrifuged again at 12,000×g for 10 min. Measurement Absorbance was measured at 532 nm and corrected for nonspecific absorbance at 600 nm using a UV–Vis spectrophotometer (Shimadzu UV-1800, Japan). MDA concentration was calculated using an extinction coefficient of 155 mM⁻¹ cm⁻¹.(Rashid et al.,2022) Antioxidant Enzyme Assays Fresh leaf tissue (0.5 g) was homogenized in 5 mL of ice-cold extraction buffer (50 mM potassium phosphate buffer, pH 7.0, containing 1 mM EDTA, 1% polyvinylpyrrolidone [PVP-40], and 0.1 mM phenylmethylsulfonyl fluoride [PMSF]). The homogenate was centrifuged at 12,000×g for 20 min at 4°C, and the supernatant was used for enzyme assays(Alici and Arabaci 2016) Superoxide dismutase (SOD; EC 1.15.1.1) Assayed by inhibition of photochemical reduction of nitroblue tetrazolium (NBT, Sigma-Aldrich). Reaction mixture (3 mL) contained 50 mM phosphate buffer (pH 7.8), 13 mM methionine, 75 µM NBT, 2 µM riboflavin, and 0.1 mL enzyme extract. Absorbance was measured at 560 nm (Ilker Durak et al.1993) Catalase (CAT; EC 1.11.1.6) Activity measured by decomposition of H₂O₂ at 240 nm. Reaction mixture contained 50 mM phosphate buffer (pH 7.0), 10 mM H₂O₂, and 0.1 mL enzyme extract. (Li et al. 2007) Peroxidase (POD; EC 1.11.1.7) Activity determined using guaiacol as substrate. Reaction mixture contained 50 mM phosphate buffer (pH 6.0), 20 mM guaiacol, 10 mM H₂O₂, and 0.1 mL enzyme extract. Increase in absorbance at 470 nm was recorded.(Shahryar, 2014) Enzyme activity was expressed as units per mg protein. Protein concentration was determined using Bradford’s method with bovine serum albumin (BSA) as standard.(Kielkopf et al., 2020) Gene Expression Analysis RNA Extraction and cDNA Synthesis: Total RNA was extracted from 100 mg frozen leaf tissue using TRIzol reagent (Invitrogen, USA) following manufacturer’s instructions. RNA purity and concentration were checked with a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, USA), and integrity confirmed by agarose gel electrophoresis (1%). First-strand cDNA was synthesized from 1 µg total RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Japan).(Moebes et al .,2022) qRT-PCR Analysis: Quantitative real-time PCR (qRT-PCR) was performed on an ABI Step One Plus Real-Time PCR System (Applied Biosystems, USA) using SYBR Premix Ex Taq II (Takara, Japan). Reactions (20 µL) contained 10 µL SYBR Green Master Mix, 0.4 µL of each primer (10 µM), 2 µL cDNA, and 7.2 µL nuclease-free water. Cycling conditions were: 95°C for 30 s; 40 cycles of 95°C for 5 s and 60°C for 30 s. Melt-curve analysis confirmed specificity(Wagner, 2013) Primers: The following primers were used (synthesized by Macrogen Inc., South Korea): Gene Forward Primer (5′→3′) Reverse Primer (5′→3′) Reference SlSOD GCTTGGGAGGAGAAACTGGA AGCCTCCTTGTTGAGGATGA Designed (this study) SlCAT GATGGTGACTTTGCTGGCTT TCGATCTCCTTCTCGGTCAT Designed (this study) SlPOD TCTACGAGGCTGGTCTTGGT AGATGTCGTTGAGGTCCTGA Designed (this study) SlHSP70 CAGCTTCCTTCCCTTCCATC AAGTGGAGCCTCAGTTGAGG Designed (this study) SlActin (reference) GTCAGTCTTATTTTTTTTACTTTGGTTA ATATTAAACTGCATTTTGTACTACGTTGTTG [NCBI: GenBank: U60481.1] Relative gene expression was quantified using the 2⁻ΔΔCt method (Livak and Schmittgen, 2001, Feng Lixiang et al.,2025) Statistical Analysis All experiments were performed with five biological replicates per treatment. Data were expressed as mean ± standard error (SE). Statistical significance among treatments was assessed by one-way analysis of variance (ANOVA) using SPSS v25.0 (IBM Corp., USA), followed by Duncan’s Multiple Range Test (DMRT) at p < 0.05. Result 1. BPA exposure impaired tomato growth and photosynthetic performance The tomato plants exposed to BPA-contaminated irrigation water exhibited dose-dependent growth inhibition (Fig. 1 ).when compared to the control (0 µg/L).The Plant height recorded observed a significantly reduction by 14.2%, 27.8%, and 41.6% under 50, 100, and 200 µg/L BPA treatments, respectively (p < 0.05). Similarly, the relative chlorophyll content (SPAD index) recorded a declined progression, with a maximum 32.5% reduction at 200 µg/L. Chlorophyll fluorescence analysis which revealed a marked decrease in photosystem II efficiency (Fv/Fm), hence the drop from 0.81 (control) to 0.62 (200 µg/L BPA) ,which indicated an impaired photochemical activity and stress-induced damage to photosynthetic apparatus. 2. BPA induced lipid peroxidation and oxidative stress The malondialdehyde (MDA), an index of lipid peroxidation (Fig. 2 ) observed a significant increase in the BPA-exposed plants. At 200 µg/L,Thus, the MDA levels were elevated by 171% compared with control experiment (p < 0.01),which reflected an enhanced oxidative membrane damage and Concomitantly,the accumulatio of hydrogen peroxide (H₂O₂) was observed,given a suggestion of redox imbalance under BPA stress. Therefore these findings demonstrated that environmentally relevant BPA concentrations can disrupt cellular homeostasis and promote oxidative damage in tomato plant leaves when exposed.. 3. Antioxidant enzyme activities were upregulated in response to BPA The exposure to BPA observed a counteractive oxidative stress, antioxidant defense mechanisms which were activated in which superoxide dismutase (SOD) activity record a significant increase (Fig. 3 ) by 1.6-, 2.1-, and 2.9-fold at 50, 100, and 200 µg/L BPA, respectively. while, catalase (CAT) and peroxidase (POD) activities showed significant induction,with a maximum recorded increase of 2.4- and 2.8-fold at 200 µg/L BPA (p < 0.05). These responses thus indicated an enzymatic strategy to detoxify the excess ROS and mitigate the oxidative damage. 4. BPA modulated stress-responsive gene expression The qRT-PCR analysis revealed transcriptional reprogramming of stress-related genes. The antioxidant enzyme genes ( SlSOD, SlCAT, SlPOD ) (Fig. 4 ) were significantly upregulated in a dose-dependent manner,which was consistent with biochemical enzyme activities. Additionally, The SlHSP70 , a molecular chaperone associated with general stress responses,recorded a 2.7-fold increase in expression under 200 µg/L BPA exposure, Thus, showing an activation of cellular stress adaptation pathways. The reference gene SlActin remained stable across treatments with evidenced normalization. The integrated impact of BPA stress on tomato plant physiology, Overtly, with these results It has demonstrated that chronic exposure to BPA, even at environmentally relevant concentrations will negatively affect tomato plant growth and it leaves photosynthetic performance with induced oxidative stress. Hence the observed activation of antioxidant enzymes and stress-related genes indicated a compensatory defense responses although insufficient to fully restore redox balance under high BPA exposure which still accent to the potential ecological and agricultural risks posed by BPA in reclaimed water used for irrigation in agricultural fields. Discussion This findings in this study demonstrated that the exposure of tomato plants to environmentally relevant concentrations of Bisphenol A (BPA) which, even as low as 50 µg L⁻¹ recorded a significant impaired growth, photosynthentic damage, and redox homeostasis which was consistent with the report of Abdelmoneim et al ., (2024). with the decline in plant height, SPAD chlorophyll content, and PSII efficiency (Fv/Fm) greatly emphasised that BPA's phytotoxic potential through oxidative and photochemical disruption has distruptive activity on tomato plant as aligned with the recent observations in tomato and cucumber by Li et al., (2018) and Siddqiui.et al., (2022) where BPA was observed to compromised photosynthetic metrics and induced photoinhibition, also the pronounced increase in malondialdehyde (MDA; +171%) alongside upregulated antioxidant enzyme activities (SOD, CAT, POD) and gene expression revealed that oxidative stress was a key mode of BPA toxicity as compared with the control experiment as consistent ROS-mediated damage and partial activation of defensive machinery was observed which merged with such observation recorded in both lettuce and wheat under bisphenol exposure (Meli et al., 2020,Feng Lixiang et al. 2025)). A noteworthy obervation from this research was the record of 2.7-fold induction of SlHSP70, which clearly indicated that BPA triggers broader proteotoxic stress responses in plant as HSP70 expression was a conserved pointer of cellular stress,which also included chemical, thermal, and oxidative stress attributes which was earlier reported across diverse plant systems (Mahmood et al. 2015) Although municipal effluent levels of BPA are generally below 1 µg L⁻¹, localized pollution hotspots (e.g., industrial discharge) and episodic leachate inputs may reach tens of micrograms per liter when accumulated and used for agricultural irrigation in dry water regions of the world ((Lee and Peart 2000,Corraleset al., 2015; Hing-Biu et al., 2000). More alarmingly, BPA uptake under reclaimed-water irrigation has led to residue accumulation in edible crops as asserted by Lu et al. (2015) and Helmecke et al., (2020), who suggested that agricultural performance and food safety may be compromised even at low exposure levels during this emerging climate stressors like heat and high vapor pressure deficit (VPD) under climate change can exacerbate BPA effects by the amplification of ROS generation and accelerated chlorophyll degradation (Qiu et al. , 2025). This synergy raises the concern for crops irrigated with BPA-contaminated water in warming environments. Thus,mitigation strategies are imperative as recent technologies through the use of activated carbon adsorption, biochar amendments, advanced oxidation processes (e.g., UV/H₂O₂) and constructed wetland systems have demonstrated high efficacy (often >90%) in the removal of BPA from water (Gallego-Ramírez et al ., 2024).In conclusion, even modest BPA levels can disrupt tomato physiology, with disruptive implications for both Agricultural productivity and consumer safety. Hence, future research should evaluate the interactive effects with climate stressors and explore reuse regimes that integrates mitigation technologies for agricultural irrigation or reuse water for crop irrigation in farmers field . Declarations Acknowledgements The authors gratefully acknowledge the technical assistance of the staff at the Institute of Agricultural Research and Training, Obafemi Awolowo University, and the National Horticultural Research Institute, Ibadan, Nigeria, where greenhouse experiments were conducted. Funding This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors just self helped. Authors’ Contributions Edet Iwebaffa Amos: Conceptualization, Methodology, Data curation, Writing – original draft, Supervision. Akinbode Oluwafolake Adenike: Formal analysis, Writing – review & editing. Onyeanusi Hillary Chukwuemeka: Laboratory analysis, Visualization. Iwebafa George Oluwadamilare: Investigation, Data curation. Afolabi Clement Gboyega: Resources, Validation, Writing – review & editing. All authors read and approved the final manuscript. Ethical Approval Not applicable. Consent to Participate Not applicable. Consent to Publish Not applicable. Competing Interests The authors declare that they have no competing interests. Data Availability Statement The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request. References Abdelmoneim, M., Hafez, E., Dawood, M., Hammad, S. and Ghazy, M. (2024). Toxicity of bisphenol A and p -nitrophenol on tomato plants: Morpho-physiological, ionomic profile, and antioxidants/defense-related gene expression studies. Biomolecular Concepts , 15 (1), 20220049. https://doi.org/10.1515/bmc-2022-0049 Aguilar Diaz De Leon J and Borges CR (2020) Evaluation of Oxidative Stress in Biological Samples Using the Thiobarbituric Acid Reactive Substances Assay. J Vis Exp. 2020 May 12;(159):10.3791/61122. doi: 10.3791/61122. PMID: 32478759; PMCID: PMC9617585. Alici, Esma Hande, and Gulnur Arabaci. (2016) “ PPO and CAT Enzyme Activities in Rumex Obtusifolius L”. Annual Research and Review in Biology 11 (3):1-7. https://doi.org/10.9734/ARRB/2016/29809. Changyun Xiao, Lihong Wang, Qing Zhou, Xiaohua Huang (2020)Hazards of bisphenol A (BPA) exposure: A systematic review of plant toxicology studies, Journal of Hazardous Materials, Volume384,2020,121488,ISSN0304-3894,https://doi.org/10.1016/j.jhazmat.2019.121488. Changyun Xiao, Lihong Wang, Qing Zhou, Xiaohua Huang, (2020)Hazards of bisphenol A (BPA) exposure: A systematic review of plant toxicology studies,Journal of Hazardous Materials,Volume 384,2020,121488,ISSN 0304-3894, https://doi.org/10.1016/j.jhazmat.2019.121488. Corrales J, Kristofco LA, Steele WB, Yates BS, Breed CS, Williams ES, Brooks BW. (2015) Global Assessment of Bisphenol A in the Environment: Review and Analysis of Its Occurrence and Bioaccumulation. Dose Response. 2015 Jul 29;13(3):1559325815598308. doi: 10.1177/1559325815598308. PMID: 26674671; PMCID: PMC4674187. Feng Lixiang, Zhao Rongqian, Kui Zhang, Wenxing Yang(2025) Comparison of the 2-CT method and the 2-ΔΔCT method for real-time qPCR data analysis bioRxiv 2025.07.16.665089; doi: https://doi.org/10.1101/2025.07.16.665089 Gallego-Ramírez, C., Chica, E., and Rubio-Clemente, A. (2024). Combination of Biochar and Advanced Oxidation Processes for the Sustainable Elimination of Pharmaceuticals in Water. Sustainability , 16 (23), 10761. https://doi.org/10.3390/su162310761 Hafezi SA, Abdel-Rahman WM(2019) The Endocrine Disruptor Bisphenol A (BPA) Exerts a Wide Range of Effects in Carcinogenesis and Response to Therapy. Curr Mol Pharmacol. 2019;12(3):230-238. doi: 10.2174/1874467212666190306164507. PMID: 30848227; PMCID: PMC6864600. Helmecke, M., Fries, E. and Schulte, C (2020). Regulating water reuse for agricultural irrigation: risks related to organic micro-contaminants. Environ Sci Eur 32 , 4 (2020). https://doi.org/10.1186/s12302-019-0283-0 Hing-Biu Lee, Thomas E. Peart (2000) Bisphenol A Contamination in Canadian Municipal and Industrial Wastewater and Sludge Samples. Water Quality Research Journal 1 May 2000; 35 (2): 283–298. doi: https://doi.org/10.2166/wqrj.2000.018 Ilker Durak, Zuhal Yurtarslanl, Orhan Canbolat, Ömer Akyol(1993),A methodological approach to superoxide dismutase (SOD) activity assay based on inhibition of nitroblue tetrazolium (NBT) reduction ,Clinica Chimica Acta ,Volume 214, Issue 1,1993,Pages 103-104,ISSN 0009-8981, https://doi.org/10.1016/0009-8981(93)90307-P. J.L. Torres-García, M. Ahuactzin-Pérez, F.J. Fernández, Diana V. Cortés-Espinosa,(2022)Bisphenol A in the environment and recent advances in biodegradation by fungi, Chemosphere, Volume 303, Part 1,2022,134940,ISSN 0045-6535, https://doi.org/10.1016/j.chemosphere.2022.134940. Kielkopf CL, (2020)Bradford Assay for Determining Protein Concentration. Kielkopf CL, Bauer W, Urbatsch IL.Cold Spring Harb Protoc. 2020 Apr 1;2020(4):102269. doi: 10.1101/pdb.prot102269.PMID: 32238597 Kotowska, U., Piotrowska-Niczyporuk, A., Kapelewska, J., and Jasinska, L. L. (2025). The Impact of Organic Micropollutants on the Biochemical Composition and Stress Markers in Wolffia arrhiza . Molecules , 30 (3), 445. https://doi.org/10.3390/molecules30030445 Li Y, Schellhorn HE. Rapid kinetic microassay for catalase activity. J Biomol Tech. 2007 Sep;18(4):185-7. PMID: 17916790; PMCID: PMC2062561. Li YT, Liang Y, Li YN, Che XK, Zhao SJ, Zhang ZS, Gao HY (2018) Mechanisms by which Bisphenol A affect the photosynthetic apparatus in cucumber (Cucumis sativus L.) leaves. Sci Rep. 2018 Mar 9;8(1):4253. doi: 10.1038/s41598-018-22486-4. PMID: 29523804; PMCID: PMC5844896. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001 Dec;25(4):402-8. doi: 10.1006/meth.2001.1262. PMID: 11846609. Lu J, Wu J, Stoffella PJ, Wilson PC. (2015) Uptake and distribution of bisphenol A and nonylphenol in vegetable crops irrigated with reclaimed water. J Hazard Mater. 2015;283:865-70. doi: 10.1016/j.jhazmat.2014.10.018. Epub 2014 Oct 22. PMID: 25464330. Mahmood K, Jadoon S, Mahmood Q, Irshad M, Hussain J. (2015) Synergistic effects of toxic elements on heat shock proteins. Biomed Res Int. 2014;2014:564136. doi: 10.1155/2014/564136. Epub 2014 Jul 20. Erratum in: Biomed Res Int. 2015;2015:204057. doi: 10.1155/2015/204057. PMID: 25136596; PMCID: PMC4127286. Manzoor MF, Tariq T, Fatima B, Sahar A, Tariq F, Munir S, Khan S, Nawaz Ranjha MMA, Sameen A, Zeng XA, Ibrahim SA (2022) An insight into bisphenol A, food exposure and its adverse effects on health: A review. Front Nut r. 2022 Nov 3;9:1047827. doi: 10.3389/fnut.2022.1047827. PMID: 36407508; PMCID: PMC9671506. Meli R, Monnolo A, Annunziata C, Pirozzi C, Ferrante MC (2020). Oxidative Stress and BPA Toxicity: An Antioxidant Approach for Male and Female Reproductive Dysfunction. Antioxidants (Basel). 2020 May 10;9(5):405. doi: 10.3390/antiox9050405. PMID: 32397641; PMCID: PMC7278868. Moebes M, Kuhlmann H, Demidov D, Lermontova I.(2022) Optimization of quantitative reverse transcription PCR method for analysis of weakly expressed genes in crops based on rapeseed. Front Plant Sci. 2022 Aug 9;13:954976. doi: 10.3389/fpls.2022.954976. PMID: 36017265; PMCID: PMC9396215. Molina-López, A. M., Bujalance-Reyes, F., Ayala-Soldado, N., Mora-Medina, R., Lora-Benítez, A., and Moyano-Salvago, R. (2023). An Overview of the Health Effects of Bisphenol A from a One Health Perspective. Animals , 13 (15), 2439. https://doi.org/10.3390/ani13152439 Nwankwo, C.E.I., Okeke, E.S., Umeoguaju, F.U. (2025) Addressing emerging contaminants in agriculture affecting plant–soil interaction: a review on bio-based and nano-enhanced strategies for soil health and global food security (GFS). Discov Toxicol 2 , 4 (2025). https://doi.org/10.1007/s44339-025-00018-w Qiu, Q., Sun, Y., Guo, D., Wang, L., Pagay, V., and Wang, S. (2025). Heat Stress Downregulates Photosystem I Redox State on Leaf Photosynthesis in Grapevine. Agronomy , 15 (4), 948. https://doi.org/10.3390/agronomy15040948 Rao, M. J., Duan, M., Zhou, C., Jiao, J., Cheng, P., Yang, L., Wei, W., Shen, Q., Ji, P., Yang, Y., Conteh, O., Yan, D., Yuan, H., Rauf, A., Ai, J., and Zheng, B. (2025). Antioxidant Defense System in Plants: Reactive Oxygen Species Production, Signaling, and Scavenging During Abiotic Stress-Induced Oxidative Damage. Horticulturae , 11 (5), 477. https://doi.org/10.3390/horticulturae11050477 Rashid, M. A. M., Rahman, M., Mahmud, A. O., Morshed, A. S. M., Haque, M. M., and Hossain, M. M. (2022). UV-Vis Spectrophotometer as an Alternative Technique for the Determination of Hydroquinone in Vinyl Acetate Monomer. Photochem , 2 (2), 435-447. https://doi.org/10.3390/photochem2020030 Saffan, M. M., Koriem, M. A., El-Henawy, A., El-Mahdy, S., El-Ramady, H., Elbehiry, F., Omara, A. E.-D., Bayoumi, Y., Badgar, K., and Prokisch, J. (2022). Sustainable Production of Tomato Plants ( Solanum lycopersicum L.) under Low-Quality Irrigation Water as Affected by Bio-Nanofertilizers of Selenium and Copper. Sustainability , 14 (6), 3236. https://doi.org/10.3390/su14063236 Schreiber, U., Kühl, M., Klimant, I. et al. (1996) Measurement of chlorophyll fluorescence within leaves using a modified PAM Fluorometer with a fiber-optic microprobe. Photosynth Res 47 , 103–109 (1996). https://doi.org/10.1007/BF00017758 Shahryar Saeidian (2014)Activity of Guaiacol Peroxidase of Solanum Lycopersicum In presence of Detergents and Chaotropic Agents IOSR Journal of Pharmacy (e)-ISSN: 2250-3013, (p)-ISSN: 2319-4219 www.iosrphr.org Volume 4, Issue 2 (February 2014), Pp 01-05 Shibaeva, T.G., Mamaev, A.V. and Sherudilo, E.G(2020). Evaluation of a SPAD-502 Plus Chlorophyll Meter to Estimate Chlorophyll Content in Leaves with Interveinal Chlorosis. Russ J Plant Physiol 67 , 690–696 (2020). https://doi.org/10.1134/S1021443720040160 Siddqiui, S. ., Alkahtani, M. A. ., Ghamdy, H. A. A. ., Alqahtani, W. S. S. ., Al qthanin, R. N. ., Al shahrani , R. R. ., and Alquyr, S. M. . (2022). Phytotoxic Effects of Bisphenol a on Growth Indicants And Chlorophyll Content of Pisum Sativum L. Bangladesh Journal of Botany , 51 (2), 237–245. https://doi.org/10.3329/bjb.v51i2.60420 Wagner, E.M. (2013). Monitoring Gene Expression: Quantitative Real-Time RT-PCR. In: Freeman, L. (eds) Lipoproteins and Cardiovascular Disease. Methods in Molecular Biology, vol 1027. Humana Press, Totowa, NJ. https://doi.org/10.1007/978-1-60327-369-5_2 Wen-Juan Pan, Can Xiong, Qiu-Ping Wu, Jin-Xia Liu, Hong-Mei Liao, Wei Chen, Yong-Sheng Liu, Lei Zheng(2013)Effect of BPA on the germination, root development, seedling growth and leaf differentiation under different light conditions in Arabidopsis thaliana,Chemosphere,Volume 93, Issue 10,2013,Pages 2585-2592,ISSN 0045-6535,https://doi.org/10.1016/j.chemosphere.2013.09.081. Wolff Leal, T., Tochetto, G., Lima, S. V. d. M., de Oliveira, P. V., Schossler, H. J., de Oliveira, C. R. S., and da Silva Júnior, A. H. (2025). Nanoplastics and Microplastics in Agricultural Systems: Effects on Plants and Implications for Human Consumption. Microplastics , 4 (2), 16. https://doi.org/10.3390/microplastics4020016 Xingyi Li, Lihong Wang, Shengman Wang, Qing Yang, Qing Zhou, Xiaohua Huang(2018)A preliminary analysis of the effects of bisphenol A on the plant root growth via changes in endogenous plant hormones,Ecotoxicology and Environmental Safety,Volume 150,2018,Pages 152-158,ISSN 0147-6513,https://doi.org/10.1016/j.ecoenv.2017.12.031. Yu Hu, Qingqing Zhu, Xueting Yan, Chunyang Liao, Guibin Jiang(2019) Occurrence, fate and risk assessment of BPA and its substituents in wastewater treatment plant: A review ,Environmental Research ,Volume 178,2019,108732,ISSN 0013-9351, https://doi.org/10.1016/j.envres.2019.108732. Zhang, Y., Lu, S., Dong, Y. (2025) Unveiling the impact of bisphenol a exposure on gene expression and immune response in diabetic nephropathy through integrative toxicogenomics and molecular dynamics approaches. Diabetol Metab Syndr 17 , 340 (2025). https://doi.org/10.1186/s13098-025-01874-7 Zhou Y, Fu J, Ye Y, Xu Q, Liang J, Chen Y, Mo Y, Liu K(2024). Physiological and molecular response mechanisms of tomato seedlings to cadmium (Cd) and lead (Pb) stress. PeerJ. 2024 Nov 29;12:e18533. doi: 10.7717/peerj.18533. PMID: 39624120; PMCID: PMC11610467. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7454406","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":510995458,"identity":"f4c3ba85-91b2-4d60-8024-476d78793776","order_by":0,"name":"Iwebaffa Amos Edet","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwUlEQVRIiWNgGAWjYBACNjCyYZADcQ48IF5LGoMxWEsC8RalMSQ2gJhEaeGTSD724EeCXfr8sMMPgbbYyek2ELJCIi3dsCchOXfj7TQDoJZkY7MDhLRI55hJ8P5gzt04OwGk5UDiNsJa8r9J/kmoTzecnf6BWC05bNI8CYcT5KVziLVF/pm5sUzCccMN0jkFBxIMiPCLfM/hZw/fJFTLy89O3/zhQ4WdHEEtcGAAVmlArHKwdQ2kqB4Fo2AUjIIRBQA410I55lfN6AAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-8094-6503","institution":"Department of Crop Protection Federal University of Agriculture Abeokuta, Nigeria","correspondingAuthor":true,"prefix":"","firstName":"Iwebaffa","middleName":"Amos","lastName":"Edet","suffix":""},{"id":510995459,"identity":"912758bc-f4dd-47bb-9cdd-93c7941d15ae","order_by":1,"name":"Oluwafolake Adenike Akinbode","email":"","orcid":"","institution":"Institute of Agricultural Research and Training- Obafemi Awolowo University Ibadan Nigeria","correspondingAuthor":false,"prefix":"","firstName":"Oluwafolake","middleName":"Adenike","lastName":"Akinbode","suffix":""},{"id":510995460,"identity":"2f51b46d-13f5-4b83-ae74-d25471e1068f","order_by":2,"name":"Hillary Chukwuemeka Onyeanusi","email":"","orcid":"","institution":"National Horticultural Research Institute Ibadan Nigeria","correspondingAuthor":false,"prefix":"","firstName":"Hillary","middleName":"Chukwuemeka","lastName":"Onyeanusi","suffix":""},{"id":510995461,"identity":"8ac18100-a3b1-4ad4-aef0-212006af10f7","order_by":3,"name":"George Oluwadamilare Iwebafa","email":"","orcid":"","institution":"National Horticultural Research Institute Ibadan Nigeria","correspondingAuthor":false,"prefix":"","firstName":"George","middleName":"Oluwadamilare","lastName":"Iwebafa","suffix":""},{"id":510995462,"identity":"756999dd-488c-4e0d-b540-a72fa20445ec","order_by":4,"name":"Clement Gboyega Afolabi","email":"","orcid":"","institution":"Department of Crop Protection Federal University of Agriculture Abeokuta Nigeria","correspondingAuthor":false,"prefix":"","firstName":"Clement","middleName":"Gboyega","lastName":"Afolabi","suffix":""}],"badges":[],"createdAt":"2025-08-25 13:50:05","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7454406/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7454406/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":91321690,"identity":"6dda1915-929f-4076-9d68-32892d84390f","added_by":"auto","created_at":"2025-09-15 09:14:58","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":53767,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of BPA on tomato growth and photosynthetic performance.\u003c/strong\u003e\u003cbr\u003e\nPlant height, chlorophyll content (SPAD index), and maximum quantum efficiency of photosystem II (Fv/Fm) in tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e cv. Roma VF) irrigated with 0, 50, 100, and 200 µg L⁻¹ Bisphenol A for 30 days. Values are means ± SE (n = 5). Different letters indicate significant differences among treatments (Duncan’s test, p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7454406/v1/bddd1b9547f4cee02ca64cd4.png"},{"id":91320440,"identity":"83aeef23-049f-4c73-be17-2e493ad34038","added_by":"auto","created_at":"2025-09-15 09:06:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":35145,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLipid peroxidation in tomato leaves under BPA exposure.\u003c/strong\u003e\u003cbr\u003e\nMalondialdehyde (MDA) content, an indicator of lipid peroxidation, in tomato plants irrigated with BPA-contaminated water (0–200 µg L⁻¹). Data represent mean ± SE (n = 5). Bars with different letters differ significantly (p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7454406/v1/12a76b223479a2140bc4e243.png"},{"id":91322050,"identity":"ee233482-a151-43a4-ad1e-38c2f9dd014b","added_by":"auto","created_at":"2025-09-15 09:22:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":59629,"visible":true,"origin":"","legend":"\u003cp\u003eAntioxidant enzyme activities in tomato leaves exposed to BPA.Activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) in leaves of tomato plants after 30 days of irrigation with BPA (0–200 µg L⁻¹). Values are means ± SE (n = 5). Letters above bars indicate significant differences at p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7454406/v1/9a0faf471194c802b71e31d9.png"},{"id":91320443,"identity":"ea76046d-fa0c-45d9-9ab8-7b308bd676b1","added_by":"auto","created_at":"2025-09-15 09:06:58","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":71436,"visible":true,"origin":"","legend":"\u003cp\u003eBPA-induced transcriptional changes in stress-related genes. Relative expression of antioxidant enzyme genes (SlSOD, SlCAT, SlPOD) and the molecular chaperone gene (SlHSP70) in tomato plants irrigated with BPA (0–200 µg L⁻¹). Expression levels were normalized to SlActin and calculated using the 2⁻ΔΔCt method. Bars represent means ± SE (n = 3). Different letters denote significant differences (p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7454406/v1/01e7a75f6ad89bfb8cc21b95.png"},{"id":93813104,"identity":"431d46e1-0128-4848-9607-3054fdfc19f4","added_by":"auto","created_at":"2025-10-17 21:22:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":949442,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7454406/v1/523f1fbf-2b9d-494c-97fd-69491eaa46ed.pdf"}],"financialInterests":"","formattedTitle":"Bisphenol A contamination in irrigation water compromises tomato (Solanum lycopersicum) performance and food safety through oxidative and molecular stress pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBisphenol A (BPA) is among the most widely produced synthetic chemicals globally, with an estimated annual output exceeding 6\u0026nbsp;million tonnes (Manzoor et al., 2022). As a monomer in the manufacture of polycarbonate plastics and epoxy resins, BPA is extensively used in consumer goods, food packaging, thermal paper, and industrial applications. Its widespread use and persistence result in continuous release into aquatic environments through industrial discharge, landfill leachates, and wastewater effluents (Torres-Garc\u0026iacute;a et al., 2022). BPA is now frequently detected in surface waters, groundwater, and even treated municipal wastewater, raising global concerns about its potential ecological and human health risks (Yu et al., 2019).\u003c/p\u003e\u003cp\u003eBPA is a well-recognized endocrine-disrupting compound (EDC) that mimics or antagonizes natural hormones, interfering with developmental and physiological processes in animals and humans (Hafezi and Abdel-Rahman 2019). In plants, however, the impacts of BPA remain less understood, despite growing evidence of its uptake and bioaccumulation in edible crops irrigated with reclaimed wastewater (Changyun et al. 2020, Nwankwo et al., 2025). The presence of BPA in agricultural soils and irrigation water therefore presents a dual challenge: potential impairment of crop productivity and food safety risks through dietary exposure(Wolff Leal et al. 2025) .\u003c/p\u003e\u003cp\u003eRecent studies suggest that BPA exposure can alter photosynthetic efficiency, induce oxidative stress, and disrupt metabolic homeostasis in crops such as lettuce, wheat,Arabidopsis, and cucumber (Changyun et al. 2020, Wen-Juan Pan et al..2013; Molina-L\u0026oacute;pez et al., 2023). Elevated ROS generation and lipid peroxidation appear to be central to its phytotoxicity, accompanied by activation of antioxidant defense systems and stress-responsive gene expression(Rao et al., 2025). However, most studies to date have focused on seedlings under hydroponic exposure or short-term treatments, leaving significant knowledge gaps regarding whole-plant responses under soil-based greenhouse conditions (Xingyi et al., 2017). Moreover, the molecular mechanisms by which BPA modulates stress signaling, particularly heat shock proteins and redox regulatory genes, remain underexplored (Zhang et al., 2025)\u003c/p\u003e\u003cp\u003eTomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e) is a globally important horticultural crop, both economically and nutritionally, and is widely cultivated under irrigation. Its high water demand makes it particularly vulnerable to contamination from reclaimed wastewater sources(Saffan et al., 2022), Yet, systematic evaluations of BPA effects on tomato growth, physiology, and molecular stress responses under realistic greenhouse conditions are limited. (Zhou et al., 2024, Kotowska et al., 2025)\u003c/p\u003e\u003cp\u003eThis study therefore investigated the physiological, biochemical, and molecular responses of tomato plants exposed to BPA-contaminated irrigation water. Specifically, we assessed growth parameters, chlorophyll content, photosystem II efficiency, lipid peroxidation, antioxidant enzyme activities, and expression of key stress-related genes. By linking physiological impairments with biochemical and transcriptional responses, this work provides mechanistic insights into BPA phytotoxicity and highlights the broader implications for food safety and agricultural sustainability in regions increasingly reliant on wastewater reuse.\u003c/p\u003e"},{"header":"Materials and Method","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003ePlant Material and Greenhouse Conditions\u003c/h2\u003e\u003cp\u003eTomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e L., cv. Roma VF[NH5]) seeds (obtained from the National Horticultural Research Institute, Ibadan, Nigeria) were surface sterilized in 1% (v/v) sodium hypochlorite (Merck, Germany) for 5 min and rinsed thoroughly with sterile distilled water (3×). Seeds were germinated in plastic seedling trays containing sterilized soil:sand:compost mixture (2:1:1, v/v/v). After 14 days, uniform seedlings were transplanted into 3 L pots filled with sterilized loamy soil. Plants were grown in a greenhouse maintained at 25 ± 2°C, 65–70% relative humidity, and a 16 h light/8 h dark photoperiod under natural light supplemented with sodium lamps (Philips SON-T Agro 400 W). Plants were watered with distilled water until the start of BPA treatments.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eBPA Treatment\u003c/h3\u003e\n\u003cp\u003eAnalytical-grade Bisphenol A (BPA; purity ≥ 99%, Sigma-Aldrich, USA; CAS No. 80-05-7) was dissolved in absolute ethanol (HPLC grade, Merck, Germany) to prepare a 1 g/L stock solution. Working concentrations of 50, 100, and 200 µg/L were prepared by dilution with sterile distilled water. The control group received distilled water containing \u0026lt; 0.01% ethanol, matching solvent levels in the BPA treatments. Each plant received 200 mL of the respective treatment solution via soil irrigation twice weekly for 30 days. Treatments were arranged in a randomized complete block design (RCBD) with five replicates per treatment.\u003c/p\u003e\n\u003ch3\u003eGrowth and Physiological Measurements\u003c/h3\u003e\n\u003cp\u003e\u003cb\u003ePlant height\u003c/b\u003e was measured weekly from soil surface to the shoot apex with a digital meter rule.\u003c/p\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e\u003cb\u003eChlorophyll content\u003c/b\u003e was measured at 30 days after treatment (DAT) using a SPAD-502 Plus chlorophyll meter (Konica Minolta, Japan). Three fully expanded leaves per plant were measured, and mean SPAD values were calculated(Shibaeva et al. 2020). \u003cb\u003ePhotosystem II efficiency (Fv/Fm)\u003c/b\u003e was determined on dark-adapted leaves (30 min) using a portable chlorophyll fluorometer (PAM-2100, Heinz Walz GmbH, Germany)(Schreiber et al., 1996) \u003cb\u003eLipid Peroxidation Assay\u003c/b\u003e:Lipid peroxidation was quantified by malondialdehyde (MDA) content using the thiobarbituric acid (TBA) method.(Leon and Borges 2020)\u003cb\u003eExtraction\u003c/b\u003e: 0.5 g of fresh leaf tissue was homogenized in 5 mL 0.1% (w/v) trichloroacetic acid (TCA; Sigma-Aldrich) using a chilled mortar and pestle. Homogenates were centrifuged at 12,000×g for 15 min at 4°C (Eppendorf 5810R centrifuge, Germany).\u003cb\u003eReaction\u003c/b\u003e: 1 ml of supernatant was mixed with 4 ml of 0.5% (w/v) TBA prepared in 20% (w/v) TCA. The mixture was incubated at 95°C for 30 min, rapidly cooled on ice, and centrifuged again at 12,000×g for 10 min.\u003c/p\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMeasurement\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eAbsorbance was measured at 532 nm and corrected for nonspecific absorbance at 600 nm using a UV–Vis spectrophotometer (Shimadzu UV-1800, Japan). MDA concentration was calculated using an extinction coefficient of 155 mM⁻¹ cm⁻¹.(Rashid et al.,2022)\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eAntioxidant Enzyme Assays\u003c/p\u003e\u003cp\u003eFresh leaf tissue (0.5 g) was homogenized in 5 mL of ice-cold extraction buffer (50 mM potassium phosphate buffer, pH 7.0, containing 1 mM EDTA, 1% polyvinylpyrrolidone [PVP-40], and 0.1 mM phenylmethylsulfonyl fluoride [PMSF]). The homogenate was centrifuged at 12,000×g for 20 min at 4°C, and the supernatant was used for enzyme assays(Alici and Arabaci 2016)\u003c/p\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eSuperoxide dismutase (SOD; EC 1.15.1.1)\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eAssayed by inhibition of photochemical reduction of nitroblue tetrazolium (NBT, Sigma-Aldrich). Reaction mixture (3 mL) contained 50 mM phosphate buffer (pH 7.8), 13 mM methionine, 75 µM NBT, 2 µM riboflavin, and 0.1 mL enzyme extract. Absorbance was measured at 560 nm (Ilker Durak et al.1993)\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCatalase (CAT; EC 1.11.1.6)\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eActivity measured by decomposition of H₂O₂ at 240 nm. Reaction mixture contained 50 mM phosphate buffer (pH 7.0), 10 mM H₂O₂, and 0.1 mL enzyme extract. (Li et al. 2007)\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003ePeroxidase (POD; EC 1.11.1.7)\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eActivity determined using guaiacol as substrate. Reaction mixture contained 50 mM phosphate buffer (pH 6.0), 20 mM guaiacol, 10 mM H₂O₂, and 0.1 mL enzyme extract. Increase in absorbance at 470 nm was recorded.(Shahryar, 2014)\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eEnzyme activity was expressed as units per mg protein. Protein concentration was determined using Bradford’s method with bovine serum albumin (BSA) as standard.(Kielkopf et al., 2020)\u003c/p\u003e\n\u003ch3\u003eGene Expression Analysis\u003c/h3\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003eRNA Extraction and cDNA Synthesis:\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from 100 mg frozen leaf tissue using TRIzol reagent (Invitrogen, USA) following manufacturer’s instructions. RNA purity and concentration were checked with a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, USA), and integrity confirmed by agarose gel electrophoresis (1%). First-strand cDNA was synthesized from 1 µg total RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Japan).(Moebes et al .,2022)\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eqRT-PCR Analysis:\u003c/h2\u003e\u003cp\u003eQuantitative real-time PCR (qRT-PCR) was performed on an ABI Step One Plus Real-Time PCR System (Applied Biosystems, USA) using SYBR Premix Ex Taq II (Takara, Japan). Reactions (20 µL) contained 10 µL SYBR Green Master Mix, 0.4 µL of each primer (10 µM), 2 µL cDNA, and 7.2 µL nuclease-free water. Cycling conditions were: 95°C for 30 s; 40 cycles of 95°C for 5 s and 60°C for 30 s. Melt-curve analysis confirmed specificity(Wagner, 2013)\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003ePrimers:\u003c/h3\u003e\n\u003cp\u003eThe following primers were used (synthesized by Macrogen Inc., South Korea):\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer (5′→3′)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse Primer (5′→3′)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eReference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSlSOD\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCTTGGGAGGAGAAACTGGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGCCTCCTTGTTGAGGATGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eDesigned (this study)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSlCAT\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGATGGTGACTTTGCTGGCTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCGATCTCCTTCTCGGTCAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eDesigned (this study)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSlPOD\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCTACGAGGCTGGTCTTGGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGATGTCGTTGAGGTCCTGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eDesigned (this study)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSlHSP70\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGCTTCCTTCCCTTCCATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAGTGGAGCCTCAGTTGAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eDesigned (this study)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSlActin\u003c/em\u003e (reference)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTCAGTCTTATTTTTTTTACTTTGGTTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATATTAAACTGCATTTTGTACTACGTTGTTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[NCBI: GenBank: U60481.1]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eRelative gene expression was quantified using the 2⁻ΔΔCt method (Livak and Schmittgen, 2001, Feng Lixiang et al.,2025)\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eAll experiments were performed with five biological replicates per treatment. Data were expressed as mean ± standard error (SE). Statistical significance among treatments was assessed by one-way analysis of variance (ANOVA) using SPSS v25.0 (IBM Corp., USA), followed by Duncan’s Multiple Range Test (DMRT) at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Result","content":"\u003cp\u003e1. BPA exposure impaired tomato growth and photosynthetic performance\u003c/p\u003e\u003cp\u003eThe tomato plants exposed to BPA-contaminated irrigation water exhibited dose-dependent growth inhibition (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).when compared to the control (0 µg/L).The Plant height recorded observed a significantly reduction by \u003cb\u003e14.2%, 27.8%, and 41.6%\u003c/b\u003e under 50, 100, and 200 µg/L BPA treatments, respectively (p \u0026lt; 0.05). Similarly, the relative chlorophyll content (SPAD index) recorded a declined progression, with a maximum \u003cb\u003e32.5% reduction\u003c/b\u003e at 200 µg/L. Chlorophyll fluorescence analysis which revealed a marked decrease in photosystem II efficiency (Fv/Fm), hence the drop from \u003cb\u003e0.81 (control)\u003c/b\u003e to \u003cb\u003e0.62 (200 µg/L BPA)\u003c/b\u003e,which indicated an impaired photochemical activity and stress-induced damage to photosynthetic apparatus.\u003c/p\u003e\u003cp\u003e2. BPA induced lipid peroxidation and oxidative stress\u003c/p\u003e\u003cp\u003eThe malondialdehyde (MDA), an index of lipid peroxidation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) observed a significant increase in the BPA-exposed plants. At 200 µg/L,Thus, the MDA levels were elevated by \u003cb\u003e171%\u003c/b\u003e compared with control experiment (p \u0026lt; 0.01),which reflected an enhanced oxidative membrane damage and Concomitantly,the accumulatio of hydrogen peroxide (H₂O₂) was observed,given a suggestion of redox imbalance under BPA stress. Therefore these findings demonstrated that environmentally relevant BPA concentrations can disrupt cellular homeostasis and promote oxidative damage in tomato plant leaves when exposed..\u003c/p\u003e\u003cp\u003e3. Antioxidant enzyme activities were upregulated in response to BPA\u003c/p\u003e\u003cp\u003eThe exposure to BPA observed a counteractive oxidative stress, antioxidant defense mechanisms which were activated in which superoxide dismutase (SOD) activity record a significant increase (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) by \u003cb\u003e1.6-, 2.1-, and 2.9-fold\u003c/b\u003e at 50, 100, and 200 µg/L BPA, respectively. while, catalase (CAT) and peroxidase (POD) activities showed significant induction,with a maximum recorded increase of \u003cb\u003e2.4- and 2.8-fold\u003c/b\u003e at 200 µg/L BPA (p \u0026lt; 0.05). These responses thus indicated an enzymatic strategy to detoxify the excess ROS and mitigate the oxidative damage.\u003c/p\u003e\u003cp\u003e4. BPA modulated stress-responsive gene expression\u003c/p\u003e\u003cp\u003eThe qRT-PCR analysis revealed transcriptional reprogramming of stress-related genes. The antioxidant enzyme genes (\u003cem\u003eSlSOD, SlCAT, SlPOD\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) were significantly upregulated in a dose-dependent manner,which was consistent with biochemical enzyme activities. Additionally, The \u003cem\u003eSlHSP70\u003c/em\u003e, a molecular chaperone associated with general stress responses,recorded a \u003cb\u003e2.7-fold increase\u003c/b\u003e in expression under 200 µg/L BPA exposure, Thus, showing an activation of cellular stress adaptation pathways. The reference gene \u003cem\u003eSlActin\u003c/em\u003e remained stable across treatments with evidenced normalization.\u003c/p\u003e\u003cp\u003eThe integrated impact of BPA stress on tomato plant physiology, Overtly, with these results It has demonstrated that chronic exposure to BPA, even at environmentally relevant concentrations will negatively affect tomato plant growth and it leaves photosynthetic performance with induced oxidative stress. Hence the observed activation of antioxidant enzymes and stress-related genes indicated a compensatory defense responses although insufficient to fully restore redox balance under high BPA exposure which still accent to the potential ecological and agricultural risks posed by BPA in reclaimed water used for irrigation in agricultural fields.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis findings in this study demonstrated that the exposure of tomato plants to environmentally relevant concentrations of Bisphenol A (BPA) which, even as low as 50 µg L⁻¹ recorded a significant impaired growth, photosynthentic damage, and redox homeostasis which was consistent with \u0026nbsp; the report of Abdelmoneim \u003cem\u003eet al\u003c/em\u003e., (2024). with the decline in plant height, SPAD chlorophyll content, and PSII efficiency (Fv/Fm) greatly emphasised that BPA's phytotoxic potential through oxidative and photochemical disruption has distruptive activity on tomato plant as aligned with \u0026nbsp;the recent observations in tomato and cucumber by Li et al.,\u0026nbsp;(2018) and Siddqiui.et al., (2022) \u0026nbsp;where BPA was observed to compromised photosynthetic metrics and induced photoinhibition, also the pronounced increase in malondialdehyde (MDA; +171%) alongside upregulated antioxidant enzyme activities (SOD, CAT, POD) and gene expression revealed that oxidative stress was a key mode of BPA toxicity as compared with the control experiment as consistent ROS-mediated damage and partial activation of defensive machinery was observed which merged with such observation recorded in both lettuce and wheat under bisphenol exposure (Meli \u0026nbsp;et al., 2020,Feng Lixiang et al. 2025)). A noteworthy obervation from this research was the record of \u0026nbsp;2.7-fold induction of SlHSP70, which clearly \u0026nbsp;indicated that BPA triggers broader proteotoxic stress responses in plant as HSP70 expression was a conserved pointer of cellular stress,which also included \u0026nbsp;chemical, thermal, and oxidative stress attributes which was earlier \u0026nbsp;reported across diverse plant systems (Mahmood et al. 2015)\u003c/p\u003e\n\u003cp\u003eAlthough municipal effluent levels of BPA \u0026nbsp;are generally below 1 µg L⁻¹, localized pollution hotspots (e.g., industrial discharge) and episodic leachate inputs may reach tens of micrograms per liter when accumulated and used for agricultural irrigation in dry water regions of the world ((Lee and Peart 2000,Corraleset al., 2015; Hing-Biu\u0026nbsp;et al., 2000). More alarmingly, BPA uptake under reclaimed-water irrigation has led to residue accumulation in edible crops as asserted by Lu et al. (2015) and Helmecke et al., (2020), who \u0026nbsp;suggested \u0026nbsp;that agricultural performance and food safety may be compromised even at low exposure levels during this emerging climate stressors like heat and high vapor pressure deficit (VPD) under climate change can exacerbate BPA effects by the amplification of ROS generation and accelerated chlorophyll degradation (Qiu \u003cem\u003eet al.\u003c/em\u003e, 2025). This synergy raises the concern for crops irrigated with BPA-contaminated water in warming environments. Thus,mitigation strategies are imperative as recent technologies through the use of activated carbon adsorption, biochar amendments, advanced oxidation processes (e.g., UV/H₂O₂) and constructed wetland systems have demonstrated high efficacy (often \u0026gt;90%) in the removal of BPA from water (Gallego-Ramírez\u0026nbsp;\u003cem\u003eet al\u003c/em\u003e., 2024).In conclusion, even modest BPA levels can disrupt tomato physiology, with disruptive implications for both Agricultural \u0026nbsp;productivity and consumer safety. Hence, future research should evaluate the interactive effects with climate stressors and explore reuse regimes that \u0026nbsp;integrates mitigation technologies for agricultural irrigation or reuse water for crop irrigation in farmers field .\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;The authors gratefully acknowledge the technical assistance of the staff at the Institute of Agricultural Research and Training, Obafemi Awolowo University, and the National Horticultural Research Institute, Ibadan, Nigeria, where greenhouse experiments were conducted.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors just self helped.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ Contributions\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;Edet Iwebaffa Amos: Conceptualization, Methodology, Data curation, Writing – original draft, Supervision.\u003cbr\u003e\u0026nbsp;Akinbode Oluwafolake Adenike: Formal analysis, Writing – review \u0026amp; editing.\u003cbr\u003e\u0026nbsp;Onyeanusi Hillary Chukwuemeka: Laboratory analysis, Visualization.\u003cbr\u003e\u0026nbsp;Iwebafa George Oluwadamilare: Investigation, Data curation.\u003cbr\u003e\u0026nbsp;Afolabi Clement Gboyega: Resources, Validation, Writing – review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003eAll authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;Not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;Not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;Not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;The authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbdelmoneim, M., Hafez, E., Dawood, M., Hammad, S. and Ghazy, M. (2024). Toxicity of bisphenol A and \u003cem\u003ep\u003c/em\u003e-nitrophenol on tomato plants: Morpho-physiological, ionomic profile, and antioxidants/defense-related gene expression studies. \u003cem\u003eBiomolecular Concepts\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(1), 20220049. https://doi.org/10.1515/bmc-2022-0049\u003c/li\u003e\n\u003cli\u003eAguilar Diaz De Leon J and Borges CR (2020) Evaluation of Oxidative Stress in Biological Samples Using the Thiobarbituric Acid Reactive Substances Assay. J Vis Exp. 2020 May 12;(159):10.3791/61122. doi: 10.3791/61122. PMID: 32478759; PMCID: PMC9617585.\u003c/li\u003e\n\u003cli\u003eAlici, Esma Hande, and Gulnur Arabaci. (2016) \u0026ldquo; PPO and CAT Enzyme Activities in Rumex Obtusifolius L\u0026rdquo;. \u003cem\u003eAnnual Research \u003c/em\u003e\u003cem\u003eand\u003c/em\u003e\u003cem\u003e Review in Biology\u003c/em\u003e 11 (3):1-7. https://doi.org/10.9734/ARRB/2016/29809.\u003c/li\u003e\n\u003cli\u003eChangyun Xiao, Lihong Wang, Qing Zhou, Xiaohua Huang (2020)Hazards of bisphenol A (BPA) exposure: A systematic review of plant toxicology studies,\u003cem\u003eJournal of Hazardous Materials,\u003c/em\u003eVolume384,2020,121488,ISSN0304-3894,https://doi.org/10.1016/j.jhazmat.2019.121488.\u003c/li\u003e\n\u003cli\u003eChangyun Xiao, Lihong Wang, Qing Zhou, Xiaohua Huang, (2020)Hazards of bisphenol A (BPA) exposure: A systematic review of plant toxicology studies,Journal of Hazardous Materials,Volume 384,2020,121488,ISSN 0304-3894, https://doi.org/10.1016/j.jhazmat.2019.121488.\u003c/li\u003e\n\u003cli\u003eCorrales J, Kristofco LA, Steele WB, Yates BS, Breed CS, Williams ES, Brooks BW. (2015) Global Assessment of Bisphenol A in the Environment: Review and Analysis of Its Occurrence and Bioaccumulation. Dose Response. 2015 Jul 29;13(3):1559325815598308. doi: 10.1177/1559325815598308. PMID: 26674671; PMCID: PMC4674187.\u003c/li\u003e\n\u003cli\u003eFeng Lixiang, Zhao Rongqian, Kui Zhang, Wenxing Yang(2025) Comparison of the 2-CT method and the 2-\u0026Delta;\u0026Delta;CT method for real-time qPCR data analysis bioRxiv 2025.07.16.665089; doi: https://doi.org/10.1101/2025.07.16.665089\u003c/li\u003e\n\u003cli\u003eGallego-Ram\u0026iacute;rez, C., Chica, E., and Rubio-Clemente, A. (2024). Combination of Biochar and Advanced Oxidation Processes for the Sustainable Elimination of Pharmaceuticals in Water. \u003cem\u003eSustainability\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(23), 10761. https://doi.org/10.3390/su162310761\u003c/li\u003e\n\u003cli\u003eHafezi SA, Abdel-Rahman WM(2019) The Endocrine Disruptor Bisphenol A (BPA) Exerts a Wide Range of Effects in Carcinogenesis and Response to Therapy. \u003cem\u003eCurr Mol Pharmacol.\u003c/em\u003e 2019;12(3):230-238. doi: 10.2174/1874467212666190306164507. PMID: 30848227; PMCID: PMC6864600.\u003c/li\u003e\n\u003cli\u003eHelmecke, M., Fries, E. and Schulte, C (2020). Regulating water reuse for agricultural irrigation: risks related to organic micro-contaminants. \u003cem\u003eEnviron Sci Eur\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, 4 (2020). https://doi.org/10.1186/s12302-019-0283-0\u003c/li\u003e\n\u003cli\u003eHing-Biu Lee, Thomas E. Peart (2000) Bisphenol A Contamination in Canadian Municipal and Industrial Wastewater and Sludge Samples. \u003cem\u003eWater Quality Research Journal\u003c/em\u003e 1 May 2000; 35 (2): 283\u0026ndash;298. doi: https://doi.org/10.2166/wqrj.2000.018\u003c/li\u003e\n\u003cli\u003eIlker Durak, Zuhal Yurtarslanl, Orhan Canbolat, \u0026Ouml;mer Akyol(1993),A methodological approach to superoxide dismutase (SOD) activity assay based on inhibition of nitroblue tetrazolium (NBT) reduction\u003cem\u003e,Clinica Chimica Acta\u003c/em\u003e,Volume 214, Issue 1,1993,Pages 103-104,ISSN 0009-8981, https://doi.org/10.1016/0009-8981(93)90307-P.\u003c/li\u003e\n\u003cli\u003eJ.L. Torres-Garc\u0026iacute;a, M. Ahuactzin-P\u0026eacute;rez, F.J. Fern\u0026aacute;ndez, Diana V. Cort\u0026eacute;s-Espinosa,(2022)Bisphenol A in the environment and recent advances in biodegradation by fungi, \u003cem\u003eChemosphere,\u003c/em\u003eVolume 303, Part 1,2022,134940,ISSN 0045-6535, https://doi.org/10.1016/j.chemosphere.2022.134940.\u003c/li\u003e\n\u003cli\u003eKielkopf CL, (2020)Bradford Assay for Determining Protein Concentration. Kielkopf CL, Bauer W, Urbatsch IL.Cold Spring Harb Protoc. 2020 Apr 1;2020(4):102269. doi: 10.1101/pdb.prot102269.PMID: 32238597\u003c/li\u003e\n\u003cli\u003eKotowska, U., Piotrowska-Niczyporuk, A., Kapelewska, J., and Jasinska, L. L. (2025). The Impact of Organic Micropollutants on the Biochemical Composition and Stress Markers in \u003cem\u003eWolffia arrhiza\u003c/em\u003e. \u003cem\u003eMolecules\u003c/em\u003e, \u003cem\u003e30\u003c/em\u003e(3), 445. https://doi.org/10.3390/molecules30030445 \u003c/li\u003e\n\u003cli\u003eLi Y, Schellhorn HE. Rapid kinetic microassay for catalase activity. J Biomol Tech. 2007 Sep;18(4):185-7. PMID: 17916790; PMCID: PMC2062561.\u003c/li\u003e\n\u003cli\u003eLi YT, Liang Y, Li YN, Che XK, Zhao SJ, Zhang ZS, Gao HY (2018) Mechanisms by which Bisphenol A affect the photosynthetic apparatus in cucumber (Cucumis sativus L.) leaves. Sci Rep. 2018 Mar 9;8(1):4253. doi: 10.1038/s41598-018-22486-4. PMID: 29523804; PMCID: PMC5844896.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001 Dec;25(4):402-8. doi: 10.1006/meth.2001.1262. PMID: 11846609.\u003c/li\u003e\n\u003cli\u003eLu J, Wu J, Stoffella PJ, Wilson PC. (2015) Uptake and distribution of bisphenol A and nonylphenol in vegetable crops irrigated with reclaimed water. J Hazard Mater. 2015;283:865-70. doi: 10.1016/j.jhazmat.2014.10.018. Epub 2014 Oct 22. PMID: 25464330.\u003c/li\u003e\n\u003cli\u003eMahmood K, Jadoon S, Mahmood Q, Irshad M, Hussain J. (2015) Synergistic effects of toxic elements on heat shock proteins. Biomed Res Int. 2014;2014:564136. doi: 10.1155/2014/564136. Epub 2014 Jul 20. Erratum in: Biomed Res Int. 2015;2015:204057. doi: 10.1155/2015/204057. PMID: 25136596; PMCID: PMC4127286.\u003c/li\u003e\n\u003cli\u003eManzoor MF, Tariq T, Fatima B, Sahar A, Tariq F, Munir S, Khan S, Nawaz Ranjha MMA, Sameen A, Zeng XA, Ibrahim SA (2022) An insight into bisphenol A, food exposure and its adverse effects on health: A review. \u003cem\u003eFront Nut\u003c/em\u003er. 2022 Nov 3;9:1047827. doi: 10.3389/fnut.2022.1047827. PMID: 36407508; PMCID: PMC9671506.\u003c/li\u003e\n\u003cli\u003eMeli R, Monnolo A, Annunziata C, Pirozzi C, Ferrante MC (2020). Oxidative Stress and BPA Toxicity: An Antioxidant Approach for Male and Female Reproductive Dysfunction. Antioxidants (Basel). 2020 May 10;9(5):405. doi: 10.3390/antiox9050405. PMID: 32397641; PMCID: PMC7278868.\u003c/li\u003e\n\u003cli\u003eMoebes M, Kuhlmann H, Demidov D, Lermontova I.(2022) Optimization of quantitative reverse transcription PCR method for analysis of weakly expressed genes in crops based on rapeseed. Front Plant Sci. 2022 Aug 9;13:954976. doi: 10.3389/fpls.2022.954976. PMID: 36017265; PMCID: PMC9396215.\u003c/li\u003e\n\u003cli\u003eMolina-L\u0026oacute;pez, A. M., Bujalance-Reyes, F., Ayala-Soldado, N., Mora-Medina, R., Lora-Ben\u0026iacute;tez, A., and Moyano-Salvago, R. (2023). An Overview of the Health Effects of Bisphenol A from a One Health Perspective. \u003cem\u003eAnimals\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(15), 2439. https://doi.org/10.3390/ani13152439\u003c/li\u003e\n\u003cli\u003eNwankwo, C.E.I., Okeke, E.S., Umeoguaju, F.U. (2025) Addressing emerging contaminants in agriculture affecting plant\u0026ndash;soil interaction: a review on bio-based and nano-enhanced strategies for soil health and global food security (GFS). \u003cem\u003eDiscov Toxicol\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 4 (2025). https://doi.org/10.1007/s44339-025-00018-w\u003c/li\u003e\n\u003cli\u003eQiu, Q., Sun, Y., Guo, D., Wang, L., Pagay, V., and Wang, S. (2025). Heat Stress Downregulates Photosystem I Redox State on Leaf Photosynthesis in Grapevine. \u003cem\u003eAgronomy\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(4), 948. https://doi.org/10.3390/agronomy15040948\u003c/li\u003e\n\u003cli\u003eRao, M. J., Duan, M., Zhou, C., Jiao, J., Cheng, P., Yang, L., Wei, W., Shen, Q., Ji, P., Yang, Y., Conteh, O., Yan, D., Yuan, H., Rauf, A., Ai, J., and Zheng, B. (2025). Antioxidant Defense System in Plants: Reactive Oxygen Species Production, Signaling, and Scavenging During Abiotic Stress-Induced Oxidative Damage. \u003cem\u003eHorticulturae\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(5), 477. https://doi.org/10.3390/horticulturae11050477\u003c/li\u003e\n\u003cli\u003eRashid, M. A. M., Rahman, M., Mahmud, A. O., Morshed, A. S. M., Haque, M. M., and Hossain, M. M. (2022). UV-Vis Spectrophotometer as an Alternative Technique for the Determination of Hydroquinone in Vinyl Acetate Monomer. \u003cem\u003ePhotochem\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e(2), 435-447. https://doi.org/10.3390/photochem2020030\u003c/li\u003e\n\u003cli\u003eSaffan, M. M., Koriem, M. A., El-Henawy, A., El-Mahdy, S., El-Ramady, H., Elbehiry, F., Omara, A. E.-D., Bayoumi, Y., Badgar, K., and Prokisch, J. (2022). Sustainable Production of Tomato Plants (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e L.) under Low-Quality Irrigation Water as Affected by Bio-Nanofertilizers of Selenium and Copper. \u003cem\u003eSustainability\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(6), 3236. https://doi.org/10.3390/su14063236\u003c/li\u003e\n\u003cli\u003eSchreiber, U., K\u0026uuml;hl, M., Klimant, I. \u003cem\u003eet al.\u003c/em\u003e(1996) Measurement of chlorophyll fluorescence within leaves using a modified PAM Fluorometer with a fiber-optic microprobe. \u003cem\u003ePhotosynth Res\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e, 103\u0026ndash;109 (1996). https://doi.org/10.1007/BF00017758\u003c/li\u003e\n\u003cli\u003eShahryar Saeidian (2014)Activity of Guaiacol Peroxidase of Solanum Lycopersicum In presence of Detergents and Chaotropic Agents IOSR Journal of Pharmacy (e)-ISSN: 2250-3013, (p)-ISSN: 2319-4219 www.iosrphr.org Volume 4, Issue 2 (February 2014), Pp 01-05\u003c/li\u003e\n\u003cli\u003eShibaeva, T.G., Mamaev, A.V. and Sherudilo, E.G(2020). Evaluation of a SPAD-502 Plus Chlorophyll Meter to Estimate Chlorophyll Content in Leaves with Interveinal Chlorosis. \u003cem\u003eRuss J Plant Physiol\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 690\u0026ndash;696 (2020). https://doi.org/10.1134/S1021443720040160\u003c/li\u003e\n\u003cli\u003eSiddqiui, S. ., Alkahtani, M. A. ., Ghamdy, H. A. A. ., Alqahtani, W. S. S. ., Al qthanin, R. N. ., Al shahrani , R. R. ., and Alquyr, S. M. . (2022). Phytotoxic Effects of Bisphenol a on Growth Indicants And Chlorophyll Content of Pisum Sativum L. \u003cem\u003eBangladesh Journal of Botany\u003c/em\u003e, \u003cem\u003e51\u003c/em\u003e(2), 237\u0026ndash;245. https://doi.org/10.3329/bjb.v51i2.60420\u003c/li\u003e\n\u003cli\u003eWagner, E.M. (2013). Monitoring Gene Expression: Quantitative Real-Time RT-PCR. In: Freeman, L. (eds) Lipoproteins and Cardiovascular Disease. Methods in Molecular Biology, vol 1027. Humana Press, Totowa, NJ. https://doi.org/10.1007/978-1-60327-369-5_2\u003c/li\u003e\n\u003cli\u003eWen-Juan Pan, Can Xiong, Qiu-Ping Wu, Jin-Xia Liu, Hong-Mei Liao, Wei Chen, Yong-Sheng Liu, Lei Zheng(2013)Effect of BPA on the germination, root development, seedling growth and leaf differentiation under different light conditions in Arabidopsis thaliana,Chemosphere,Volume 93, Issue 10,2013,Pages 2585-2592,ISSN 0045-6535,https://doi.org/10.1016/j.chemosphere.2013.09.081.\u003c/li\u003e\n\u003cli\u003eWolff Leal, T., Tochetto, G., Lima, S. V. d. M., de Oliveira, P. V., Schossler, H. J., de Oliveira, C. R. S., and da Silva J\u0026uacute;nior, A. H. (2025). Nanoplastics and Microplastics in Agricultural Systems: Effects on Plants and Implications for Human Consumption. \u003cem\u003eMicroplastics\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e(2), 16. https://doi.org/10.3390/microplastics4020016\u003c/li\u003e\n\u003cli\u003eXingyi Li, Lihong Wang, Shengman Wang, Qing Yang, Qing Zhou, Xiaohua Huang(2018)A preliminary analysis of the effects of bisphenol A on the plant root growth via changes in endogenous plant hormones,Ecotoxicology and Environmental Safety,Volume 150,2018,Pages 152-158,ISSN 0147-6513,https://doi.org/10.1016/j.ecoenv.2017.12.031.\u003c/li\u003e\n\u003cli\u003eYu Hu, Qingqing Zhu, Xueting Yan, Chunyang Liao, Guibin Jiang(2019) Occurrence, fate and risk assessment of BPA and its substituents in wastewater treatment plant: A review\u003cem\u003e,Environmental Research\u003c/em\u003e,Volume 178,2019,108732,ISSN 0013-9351, https://doi.org/10.1016/j.envres.2019.108732.\u003c/li\u003e\n\u003cli\u003eZhang, Y., Lu, S., Dong, Y. (2025) Unveiling the impact of bisphenol a exposure on gene expression and immune response in diabetic nephropathy through integrative toxicogenomics and molecular dynamics approaches. \u003cem\u003eDiabetol Metab Syndr\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 340 (2025). https://doi.org/10.1186/s13098-025-01874-7\u003c/li\u003e\n\u003cli\u003eZhou Y, Fu J, Ye Y, Xu Q, Liang J, Chen Y, Mo Y, Liu K(2024). Physiological and molecular response mechanisms of tomato seedlings to cadmium (Cd) and lead (Pb) stress. PeerJ. 2024 Nov 29;12:e18533. doi: 10.7717/peerj.18533. PMID: 39624120; PMCID: PMC11610467.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"BisphenolA(BPA),Tomato(Solanumlycopersicum), Wastewater, irrigation, Oxidative stress, Antioxidant defense, Food safety","lastPublishedDoi":"10.21203/rs.3.rs-7454406/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7454406/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBisphenol A (BPA) is a pervasive endocrine-disrupting compound increasingly detected in wastewater effluents and reclaimed irrigation water, raising concerns for crop health and food safety. This study investigated the physiological, biochemical, and molecular responses of tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e L. cv. Roma VF [NH5]) exposed to BPA-contaminated irrigation water under controlled greenhouse conditions at the Institute of Agricultural Research and Training, Obafemi Awolowo University, and the National Horticultural Research Institute, Ibadan, Nigeria. Plants were irrigated with 0, 50, 100, and 200 µg L⁻¹ BPA for 30 days, and growth, photosynthetic traits, oxidative stress biomarkers, antioxidant defense, and stress-related gene expression were assessed. BPA exposure significantly reduced plant height, chlorophyll content (SPAD), and photosystem II efficiency (Fv/Fm), with declines most pronounced at 200 µg L⁻¹. Lipid peroxidation increased by 171% relative to control,which \u0026nbsp;indicated severe oxidative damage. Antioxidant enzymes (superoxide dismutase, catalase, peroxidase) and their corresponding genes (SlSOD, SlCAT, SlPOD) were markedly upregulated, reflecting activation of the redox defense system. Moreover, a 2.7-fold induction of SlHSP70 expression suggested generalized molecular stress responses and proteostasis disruption.Hence, these findings demonstrated that even environmentally relevant BPA levels can impair tomato plant growth and photosynthetic performance via oxidative and molecular stress pathways. Beyond productivity losses, the results showed that potential risks for food quality and human exposure under wastewater reuse practices. Monitoring and mitigation strategies are urgently needed to minimize BPA contamination in agricultural irrigation systems and safeguard both crop performance and food safety.\u003c/p\u003e","manuscriptTitle":"Bisphenol A contamination in irrigation water compromises tomato (Solanum lycopersicum) performance and food safety through oxidative and molecular stress pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-15 09:06:53","doi":"10.21203/rs.3.rs-7454406/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4f7cefa0-020a-4788-9e5e-46da61576193","owner":[],"postedDate":"September 15th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-17T21:14:39+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-15 09:06:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7454406","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7454406","identity":"rs-7454406","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00