Influences of tobacco straw return with lime on microbial community structure of tobacco-planting soil and tobacco leaf quality

Influences of tobacco straw return with lime on microbial community structure of tobacco-planting soil and tobacco leaf quality | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Influences of tobacco straw return with lime on microbial community structure of tobacco-planting soil and tobacco leaf quality chaoqiang jiang, chaolong zu, Muhammad Riaz, ch li, qifa zhu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3450152/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 14 Apr, 2024 Read the published version in Environmental Science and Pollution Research → Version 1 posted 6 You are reading this latest preprint version Abstract Soil amendment is an important strategy to improve soil quality and crop yield. During 2014–2019, we investigated the effects of tobacco straw return with lime on soil nutrients, soil microbial community structure, tobacco leaf yield and quality in southern Anhui, China. A field experiment was conducted in four treatments: straw removed (CK), straw return (St), straw return with dolomite (St + D), and straw return with lime (St + L). Results showed that after five years of continuous treatment, the St + L significantly increased the soil pH by 16.9%, and the contents of soil alkaline nitrogen (N) and available potassium (K) by 17.2% and 23.0%, respectively, compared with the CK. Moreover, the St + L significantly increased tobacco leaf yield (24.0%) and the appearance (9.1%) and sensory (5.9%) quality of flue-cured tobacco leaves. The addition of soil conditioners (straw, dolomite, and lime) resulted in an increase in both the total reads and effective sequences of soil microorganisms. Bacterial diversity was found to be more sensitive to changes in the external environment compared to soil fungi. The application of soil amendments (lime and straw) has been shown to promote the growth of beneficial microorganisms in the soil. Additionally, bacterial species face greater competition and limited availability of resources for survival compared to fungi. Various analytical techniques, such as RDA, correlation analysis, and network analysis, were employed to investigate this finding: soil microorganisms are significantly influenced by the presence of AK, AN and pH contents. These findings can provide an effective method for improving the quality of flue-cured tobacco leaves and guiding the amelioration of acidic soil in regions where tobacco-rice rotation is practiced. Tobacco straw return Lime Microorganism Tobacco leaf quality Soil fertility Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Flue-cured tobacco ( Nicotiana tobacum L.) is an important economic crop widely cultivated in China, accounting for about one-third of the world's tobacco planting area (Zou et al., 2018 ). The large number of tobacco straws left after the tobacco leaves harvest is an important biomass resource (Jiang et al., 2016 ; Chen et al., 2022 ). After tobacco leaves harvesting, the straw is returned to the soil in situ by rotary tiller before rice transplanting in the tobacco-rice rotation regions in South China (Jiang et al., 2016 ; Yan et al., 2016 ). Long-term retention of straw return in the soils has significant effects on improving soil structure, enhancing soil fertility, increasing crop yield, and reducing fertilizer consumption (Li et al., 2018 ; Liu et al., 2021 ). However, the short-term effects of tobacco straw return to the field on rice yield were not obvious (Jiang et al., 2016 ). The degradation of soil microbial nitrogen (N) is initially slow during the early stage of straw return to the field. This results in the temporary fixation of soil microbial N, which can potentially lead to short-term N deficiency. Consequently, this nitrogen deficiency may inhibit plant growth and development (Liao et al., 2018 ). In particular, because of the short sowing time of rice after tobacco leaves harvest, the tillering of rice is usually inhibited by the return of tobacco straw. In addition, the effects of single straw return on ameliorating soil acidity were not significant due to the low basicity of tobacco straw (Liao et al., 2020 ; Jiang et al., 2021 ). Therefore, optimizing straw return strategy is of great significance to improve the utilization of tobacco straw resources and increase crop yield in tobacco-rice rotation regions. Lime (CaCO 3 ) application can improve soil acidity and increase crop yield (Liao et al., 2020 ; Holland et al., 2018 ). The effect of the lime application is mainly to increase soil pH and total base ions, reduce the content of exchangeable aluminum in the soil, to reduce the toxic effect of aluminum and enhance the absorption and utilization of soil nutrients by roots (Ai et al., 2015 ; Jiang et al., 2018 ). The lime application can also improve the structure and metabolic function of the bacterial community by increasing the pH in acid soils (Shi et al., 2023 ), and promoting the decomposition of organic matter (Holland et al., 2018 ; Liao et al., 2018 ). However, the effects of lime application on improving the fertility of acid soils are limited. Studies have shown that lime application and straw return effectively alleviate soil acidity and increasing soil fertility, respectively (Liao et al., 2020 ). Straw return and lime application could promote N uptake for rice plants and increase double cropping rice yield (Liao et al., 2020 ; Liu et al., 2022b ). To alleviate soil acidification and control soil-borne diseases, lime or dolomite powder [CaMg(CO 3 ) 2 ] is used in flue-cured tobacco cropping season (Deng et al., 2019 ). However, this effect was not significant. On the contrary, the calcium (Ca) content of soil increased significantly due to the application of lime, while the potassium (K) content of tobacco leaves decreased continuously, which declined flue-cured tobacco leaf quality (Jiang et al., 2021 ). In addition, current researches mainly focus on the single effects of lime application or straw return to the field, while their interaction is still unclear (Goulding, 2016 ; Liao et al., 2020 ). Therefore, this study aimed to examine the effect of lime and straw return incorporation on the microbial community structure of tobacco-planting soil and flue-cured tobacco leaf quality. It is assumed that, on the one hand, the lime can improve the acid soil; on the other hand, the tobacco straw can increase the soil fertility, improve the soil microbial community structure and enhance the quality of tobacco leaves. Soil microorganisms participate in organic matter transformation, nutrient cycling and fertility formation of soil (Teng et al., 2022 ; Chen et al., 2022 ). Their community structure and richness are important indicators for evaluating soil quality, and also play an important role in crop yield (Li et al., 2019 ; Tong et al., 2021 ). Due to the vital role of soil microorganisms in driving the organic matter cycle, improving soil quality, improving crop yield and sustainable agricultural development, it has received much attention in soil ecological studies (Tong et al., 2021 ; Ren et al., 2022 ). Soil microorganisms serve as the primary regulators of the material cycle within the soil ecosystem, constituting the largest resource pool. Their metabolic activities and interactions with other biological and abiotic factors enable them to effectively regulate soil structure and nutrient cycling (Strecker et al., 2015 ; Allsup et al., 2023 ). The release of nutrients from insoluble substances by soil microorganisms is contingent upon the composition of the microbial community, as alterations to said composition have a direct impact on the activity of soil enzymes (Bell et al., 2015 ). In addition, the structure of the arbuscular mycorrhizal network, once developed, can significantly augment the root absorption area of plants, enhance the uptake and exchange of mineral nutrients, and consequently, fortify their stress resistance capacity (Christopher and Arthur, 2004 ). Therefore, the soil physicochemical properties and microbial community structure should be well considered when studying the effects of farmland management measures on crop growth. In China, more than 45 billion tons of tobacco straw are produced yearly during tobacco leaf production (Liu et al., 2017 ). The return of tobacco straw to the field is of great significance for soil fertility and ecological environment protection. Therefore, in this study, a multi-year field experiment was carried out in the acidic soil of a tobacco-rice rotation area to investigate the effects of tobacco straw return combined with lime application on tobacco leaf quality, soil physicochemical properties and microbial community structure, which will provide a scientific basis for ameliorating soil acidity, increasing flue-cured tobacco leaf quality. 1 Materials and Methods 1.1 Experimental Site Description The field experiment was conducted from 2014 to 2019 in Dongzhi County, Chizhou City, Anhui Province (N 30°16'45.30", E 117°05'3.34"). The experimental site is a typical tobacco-rice rotation area in Southern China. This area has a subtropical humid monsoon climate, with an average annual temperature of 16.9 ℃ and an average annual precipitation of 1554 mm. The mean annual sunshine time is 17055 h. The soil in this region was classified as paddy soil. The soil properties within the top 0–20 cm of soil were as follows: pH 5.48 ± 0.08, organic matter 22.9 ± 1.2 g kg –1 , total nitrogen (N) 1.71 ± 0.06 g kg –1 , alkaline N 171.7 ± 5.7 g kg –1 , available phosphorus (P) 36.5 ± 2.3 g kg –1 and available K 209.3 ± 10.6 g kg –1 . 1.2 Experimental Design and Methodology Four treatments were designed in the fixed-site (2014–2019) field trail as follows: (group 1) control (tobacco straw removed, CK), (group 2) tobacco straw return (St), (group 3) tobacco straw return with dolomite (St + D), (group 4) tobacco straw return with lime (St + L). For the CK treatment, all the tobacco straws were removed from the field after the tobacco leaves harvesting, while for other treatments, tobacco straws were returned to the field and mixed with the topsoil by cutting into 10–15 cm using a rotary tiller. The dosage of lime and dolomite was 1500 kg hm –2 , broadcasted uniformly before the straws returned. The sources of lime and dolomite used in this study was calcitic limestone (Ca 396 g kg − 1 and Mg 2.5 g kg − 1 ) and dolomitic limestone (Ca 220 g kg − 1 and Mg 124 g kg − 1 ), respectively. Treatments were replicated thrice and arranged in a randomized complete block design, totaling 12 plots. The plot size was 36 m 2 (10 m × 3.6 m), and the row and plant spacing was 1.2 m and 0.5 m, respectively. The flue-cured tobacco variety was Yunyan 87. Four stringent ridges [ 30 cm (height) × 30 cm (width)] were set up around each plot to avoid water and fertilizer pollution, and independent water inlet and outlet were set up for each plot. The application of fertilizers for flue-cured tobacco consisted of 115 kg N ha − 1 , 180 kg P 2 O 5 ha − 1 , and 375 kg K 2 O ha − 1 . The specific commercial fertilizers utilized were compound fertilizer for tobacco (N: P: K 9–13.5–22.5), superphosphate (0–15–0), potassium sulfate (0–0–50), and potassium nitrate (13.5–0–46). These fertilizers were uniformly applied one day prior to the transplantation of tobacco seedlings. The cropping system during the experiment was tobacco-rice rotation cropping, that is, tobacco was first transplanted in the middle of March, and rearranged to plant rice after the tobacco leaf harvesting in the middle of July in the same field. 1.3 Soil sample collection After five years of continuous treatment, soil samples were collected on June 27, 2019, during the tobacco leaves harvested. Three representative tobacco plants were selected in each plot, and the whole plant was pulled up and the loose soil was shaken off. And then the soils attached to the roots of the three plants were collected and mixed fully for one replication of the treatment. After removing the roots and debris, the rhizosphere soil samples were mixed and divided into two parts. One part was put into the ice box, brought back to the laboratory and stored in the at -70℃to determine soil microbial diversity. The other part was naturally dried at room temperature to determine soil physical and chemical characteristics. 1.4 Determination of soil physical and chemical characteristics The soil samples were air-dried, ground and screened. Soil pH, organic matter, alkaline N, available P, available K, exchangeable Ca and exchangeable Mg were determined according to the method of Bao, 2000 and more detailed information was described in Shao et al. (2021). 1.5 Soil DNA extraction and gene sequencing The DNA from soil of each sample was extracted by E.Z.N.A.®Soil DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) according to the manufacturer’s instructions. The V4 region of the bacterial 16S rRNA gene was amplified using the primer set of 515 F (5′–GTGCCAGCMGCCGCGG–3′') and 806 R (5′–GGACTACHVGGGTWTCTAAT–3′). The ITS1 region of the fungi was amplified by the primer set of ITS 1F (5′–CTTGGTCATTTAGAG GAAGTAA–3′) and ITS 2R (5′–GCTGCGTTCTTCATCGATGC–3′) were used to amplify the ITS1 region of the fungus. PCR products were detected by 2% agarose gel electrophoresis. Purification was performed using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, U.S.) according to the manufacturer’s instructions. The concentration and purity of the extracted DNA were pooled and pair-end sequenced using an Illumina MiSeq platform (Zhao et al., 2018 ; Su et al., 2020 ). The soil DNA concentration and purity ratios were 16.4–48.2 µg µL − 1 and 1.83–2.20, respectively. 1.6 Soil microbial diversity analysis Usearch (version 10.0) was used for quality control splicing and dechimerism of operational taxonomic units (OTUs) with a 97% similarity, and the abundance and representative sequence of OTUs were obtained. Mothur software (version v.1.30.1) was used to calculate the diversity indices (Coverage, Chao1, Shannon, and Simpson indices) of the bacterial and fungal communities (Schloss et al., 2011 ). The composition of soil microbial community abundance was calculated based on OTUs abundance, and was mapped with R language and Microsoft Excel 2010 software. The SILVA bacterial database and Unite fungi database were used to align the resulting sequences (Zhang et al., 2019 ; Zhang et al., 2020 ). 1.7 Analysis of tobacco yield and quality Tobacco leaves were collected and cured separately in each plot. After drying, flue-cured leaves were graded according to the national flue-cured tobacco standard, and the yield and output values were calculated. According to the appearance quality evaluation standard of flue-cured tobacco, six indexes including color, maturity, leaf structure, identity, oil content and chroma of C3F grade leaves were quantitatively evaluated (Yan et al., 2012 ). The sensory quality of C3F grade leaves was evaluated by technical experts of China Tobacco Anhui Industrial Co., LTD. The evaluation indexes included aroma temperament, aroma volume, impurity, concentration, vigor, delicacy, softness, roundness, irritation, dryness, aftertaste, and sweetness (Zhou et al., 2018 ). 1.8 Statistical analyses The statistical analyses were conducted using Microsoft Excel 2010 and SPSS 19.0. The differences among the treatments were analyzed using the least significant difference method (LSD) multiple range test. 2 Results 2.1 Effects of different treatments on tobacco yield and quality Straw return and lime application significantly effected tobacco leaves yield and output value (Fig. 1 ). Continuous straw return led to a significant increase in the yield and output value of tobacco leaves. The order of yield and output value of tobacco leaves was as follows: St + L > St + D > St > CK. Compared to the CK treatment, the St resulted in a 12.8% increase in yield and a 16.9% increase in the output value of tobacco leaves. Additionally, the St + L significantly increased the yield and output value by 24.0% and 31.6%, respectively. No significant difference was observed in tobacco yield and output value between the St + L and St + D treatments. As shown in Fig. S1 , the St significantly improved the appearance and sensory quality of flue-cured tobacco leaves. Moreover, the St + L significantly increased flue-cured tobacco leaves appearance and sensory quality by 9.1% and 5.9%, respectively. The appearance and sensory quality of tobacco leaves showed the trend of St + L > St + D > St > CK. 2.2 Effects of different treatments on soil physicochemical properties As shown in Table 1 , soil pH was significantly increased by 0.94 and 0.76 in St + L and St + D, respectively, compared with the CK. The St had no significant effect on soil pH, but significantly increased soil organic matter content compared with the CK. The St + L significantly increased the content of soil alkaline N and available K by 17.2% and 23.0%, respectively. Moreover, the St + D and St + L also significantly increased soil exchangeable Ca content, and the St + D significantly increased soil exchangeable Mg content. After 5 years of continuous treatment, the contents of soil organic matter, alkaline N and available K were increased by straw return, while the soil pH, the contents of alkaline N, available K, and exchangeable Ca were increased by lime application. In addition, the principal component analysis (Fig. S2) also showed that a clear difference was observed among the four treatments in soil physicochemical properties. PCA separated the samples into 3 parts (CK and St; St + D; St + L). Table 1 Changes of soil pH and nutrient contents under different treatments Treatments pH Organic matter (g kg − 1 ) Alkaline N (mg kg − 1 ) Available P (mg kg − 1 ) Available K (mg kg − 1 ) Exchangeable Ca (mg kg − 1 ) Exchangeable Mg (mg kg − 1 ) CK 5.57b* 19.27b 120.7b 38.2a 189.0b 1071.9c 138.0b St 5.72b 21.22a 139.5a 39.9a 259.8a 1138.4c 155.0b St + D 6.33a 20.63ab 139.2a 41.1a 235.5a 1443.5b 262.8a St + L 6.51a 19.80ab 141.5a 39.3a 232.4a 1928.5a 148.8b * Values in the same column followed by different letters are significantly different ( P < 0.05) 2.3 Effects of different treatments on the richness and diversity of soil microbial communities The total reads and effective sequences of soil bacteria in all treatment were, respectively 14.94*10 6 -18.51*10 6 and 55930–68112 (Table S3). In addition, the total reads and effective sequences of soil fungus were 14.46*10 6 -17.30*10 6 and 56964–66282 (Table S3). The total reads and effective sequences richness of bacteria in the CK was significantly lower than that in other treatments, while the total reads and effective sequences of bacteria in the St + D was the highest treatment. Compared to the CK treatment, the total reads and effective sequences of bacteria were increased by 23.89% and 21.78% under St + D treatment. However, there was no clear difference in the total reads and effective sequences of soil fungus among different treatments. In addition, the α-diversity of soil bacteria was showed in Fig. S4, the richness, Shannon, Simpson, Pielou, invsimpson, Chao1 and ACE not showed significant differences, while the goods_coverage had significant differences ( P < 0.05). Compared to the CK treatment, the goods_coverage was noteworthily increased by 1.11% under St + D treatment. Nevertheless, the richness, Shannon, Simpson, Pielou, invsimpson, Chao1, ACE and goods_coverage of fungus not presented a significant difference ( P < 0.05) (Fig. S5). Moreover, we used the mantel test to explore the relationship between the α-diversity of microorganism and soil physicochemical properties (Fig. 2 ). We found the goods_coverage of bacteria had a significant correlation with soil physicochemical properties (pH, SOM, AN and TN) ( P < 0.05) (Fig. 2 A). However, the α-diversity of soil fungus did not maintain a visible correlation (Fig. 2 B). As shown in Table S6, Proteobacteria, Acidobacteria, Chloroflexi, Gemmatimonadetes and Bacteroidetes were the main bacterial categories in the soil samples. At the phyla level, the relative abundance of Proteobacteria was 37.4%-41.4%, which was the highest and followed by Acidobacteria (13.9%-15.8%), Chloroflexi (6.7%-10.6%). There were significant differences in community abundance between different treatments of Chloroflexi and Bacteroidetes, and the relative abundance of Chloroflexi in the St (10.6%) was significantly higher than that of the CK (6.7%). The relative abundance of Chloroflexi in all treatments followed the order of St > St + D > St + L > CK. The relative abundance of Bacteroidetes in the St + D (7.5%) was significantly higher than that in the CK and St, and the relative abundance of Bacteroidetes in all treatments followed the order of St + D > St + L > CK ≈ St (Table S6). The relative abundance of soil fungal communities at the phylum level were shown in Table 4, the highest was Ascomycota (40.7%-60.6%), and followed by Eukaryota_norank (31.2%-45.1%) and Basidiomycota (1.7%-12.6%). Eukaryota_norank was the most abundant fungal community composition in the CK, while Ascomycota was the highest in other treatments. The St significantly reduced the number of Eukaryota_norank. The St, St + D and St + L increased the number of Ascomycota, and the St + D reached a statistically significant difference compared with the CK. Compared with the CK, the St + D and St + L treatments decreased the abundance of the Basidiomycota community, while the St increased it (Table S6). In addition, the statistical difference of the two groups with wilcox test to compared differential microorganisms on phylum level (Fig. 3 ). Compared to the CK treatment, the relative abundance of Chloroflexi and TA06 were obviously increased under St treatment (Fig. 3 A). Compared to the CK treatment, the relative abundance of Dadabacteria and Calditrichaeota were significantly increased under St + D treatment (Fig. 3 B). In addition, the relative abundance of Chloroflexi, TA06, Dadabacteria and Fibrobacteres were significantly increased under St + L treatment (Fig. 3 C). However, the relative abundance of Streptophyta was increased under St + D treatment compared to CK treatment (Fig. 3 D). In addition, we adopted the neutral community mode to describe the diversity and species abundance of soil microbial communities (Fig. 4 ). It is seen in Fig. 4 that the Nm of bacteria and fungus were 35960 and 2348, which suggested bacterial species exhibit heightened competition and encounter constrained availability of survival resources compared to fungi. 2.4 Influence of soil environmental factors on soil microbial community As shown in Fig. 5 , redundancy analysis (RDA) was performed to analyze the correlation between soil properties and microbial community. Based on the results of RDA, compared with fungi, the community structure of bacteria was more easily affected by environmental factors. For bacteria community structure, soil alkaline N significantly effected microbial community ( P < 0.05) (Fig. 5 A). However, the organic matter was the most important factor in fungus community structure (Fig. 5 B). Moreover, based on the correlation analysis (Fig. S7), we concluded the relative abundance of Fibrobacteres had a significant positive correlation with soil environmental (SOM, AN, AP, AK and TN) (Fig. S7A). However, the relative abundance of fungus in phylum level had no remarkable correlation (Fig. S7B). In addition, we used procrustes analysis to the link between soil environmental and soil microbial community (Fig. 6 ). From the results of Fig. 6 , we found the relative abundance of soil bacterium had strong correlation with soil environment (M 2 = 0.0943, P < 0.05), while the relative abundance of soil fungus had no contact with soil environment (M 2 = 0.1084, P = 0.420). Moreover, we used two-factor network analysis to further establish the relationship between soil environment and soil microorganism (Fig. 7 ). The order of importance of microorganism was as follows: AK > AN > TK > SOM > pH (Fig. 7 ). Moreover, we used the structural equation modelling (SEM) to establish the connection in plant–microbe–soil (Fig. 8 ). From the result of Fig. 8 , we concluded that the straw (regression coefficient = 0.608) and lime (regression coefficient = 0.719) had a significant positive impact on soil fertility ( P < 0.05) (Fig. 8 A). In addition, the soil fertility showed a positive stimulatory effect (regression coefficient = 1.097) on plant growth, while the soil bacteria showed an inhibitory effect (regression coefficient=-0.194) on plant growth ( P < 0.05) (Fig. 8 A). Other than that, we concluded that soil fertility was the most important influencing factor on the yield of plant, followed by lime and straw (Fig. 8 B). 3 Discussion 3.1 Effects of straw and lime application on yield and quality of tobacco In this study, the St + L not only increased tobacco leaf yield, but also improved the quality of tobacco compared with the CK. Our previous study also found that straw return and lime application significantly increased the yield of tobacco leaves by 21.4% compared with the control (Jiang et al., 2021 ). After five years of continuous treatment, the St + L significantly increased tobacco leaf yield by 24.0% (Fig. 1 ), and also increased the appearance and sensory quality of flue-cured tobacco leaves by 9.1% and 5.9%, respectively (Fig. S1 ). However, improper use of soil amendments led to decreased crop yield and quality. It was reported that long-term application of large quantities of lime could lead to an imbalance of soil potassium, calcium, sodium and other elements, inhibiting plant growth and development, thus reducing the yield and quality of flue-cured tobacco leaves (Liu et al., 2022 ). Therefore, the amount and timing of lime application for soil amendment should be considered comprehensively, which should be modified by both the effects on plant growth and the soil microbial environment (Holland et al., 2018 ). 3.2 Effects of straw and lime application on soil fertility and soil microbial Agricultural practices (straw returning and lime) contribute to soil fertility and the utilization of nutrients in the soil (Grass et al., 2020 ; Chu et al., 2022 ). In our study, with the addition of amendments such as straw and lime, the pH, organic matter, and available nutrient content of the soil have increased to varying degrees (Table 1 ). There are several possible explanations for this result.1): Crop straw, an agricultural waste, contains alkaline substances and nutrients that can be utilized to enhance acidic soil directly (Wang et al., 2009 ; Wang et al., 2011 ).2): The application of lime serves to neutralize both active and latent acids present in acidified red soil, while concurrently enhancing the effective cation exchange capacity and optimizing the efficacy of potassium (Jaskulska et al., 2014 ; Valentinuzzi et al., 2015 ). Liu et al ( 2022 ) found the act of reintroducing straw back into the field has the potential to greatly enhance soil fertility and promote a wider range of microbial species. In addition, the application of lime has been found to effectively mitigate the acidity levels in acidic soil, leading to notable enhancements in crop yield and the uptake of potassium in acidified red soil (Mei et al., 2016 ). The richness and diversity of soil bacterial community are important indicators of soil quality, and play an important role in protecting soil health (Kou et al., 2020; Chen et al., 2022b ). In this study, it was found that lime or dolomite powder application significantly increased the effective sequence number and OTU abundance of bacteria in the rhizosphere soil of tobacco plants (Table S3), and also increased the bacterial goods_coverage, indicating that lime application can improve the diversity of the bacterial community. Soil bacterial community is a relatively stable system, and its richness and species enrichment are affected by tillage methods, fertilization measures, soil amendments, and cropping systems etc. (Li et al., 2019 ; Chen et al., 2022b ). Yan et al. ( 2016 ) showed that tobacco straw return significantly increased soil bacterial OTU and chao1. Moreover, straw mulching also increased soil nutrient content and bacterial community diversity (Thidar et al., 2020 ; Wei et al., 2021 ). In our study, compared to fungi, bacterial diversity is more susceptible to changes in the external environment (Fig. 2 ; Fig. S4; Fig. S5). Similarly, Yang et al. ( 2019 ) found that wheat straw return significantly affected the α-diversity of soil bacteria, but did not change the soil fungal community. Li et al. ( 2018 ) also observed that lime application had little impact on the community structure and diversity of soil fungi, which may be due to the relatively simple planting crops and low initial soil pH (less than 6.5). Bahram et al. ( 2018 ) also found a weak correlation between soil pH and soil fungal diversity by analyzing global topsoil samples. The effects of the St + L on increasing the bacterial community richness and diversity in rhizosphere soil may be greater with the period increase of treatment, which may result from the combined effect of the increase in soil pH and the release of straw nutrients. This requires further investigation in long-term field experiments. This study showed that the combined application of tobacco straw and lime improved the diversity and species richness of the rhizosphere soil bacterial community. In this study Proteobacteria was the highest relative abundance of all the phyla, and followed by Acidobacteria, Chloroflexi, Gemmatimonadetes and Bacteroidetes (Fig. 3 ; Table S6). Similarly, Huang et al. ( 2021 ) found that the dominant bacteria followed the order of Proteobacteria, Actinobacteria, Chloroflexi and Acidobacteria in the rhizosphere soil of tobacco plants. Zhao et al. ( 2017 ) also reported that Proteobacteria and Actinobacteria were the dominant bacterial groups in rhizosphere soil. However, there were significant differences in the relative abundance of soil bacterial dominant flora under different treatments. The relative abundance of Proteobacteria was the highest in the CK, while the relative abundance of Chloroflexi was the lowest in the CK among all treatments (Fig. 3 ; Table S6). Proteobacteria is widely recognized as the predominant bacterial phylum (Xu et al., 2017 ) and encompasses numerous pathogenic bacterial species (Wagg et al., 2018 ). Most Actinobacteria are saprophytic bacteria, and there are also a few Actinobacteria that can lead to animal and plant diseases (Li et al., 2013 ). This potentially indicated that the soil health was significantly affected in the CK, and the leaf yield of the CK was significantly lower than that of the St + L (Fig. 3 ; Table S6). The CK showed the lowest relative abundance of Chloroflexi. A similar result was observed by Ao et al ( 2022 ), reported that the relative abundance of the Chloroflexi community in tobacco field soil decreased significantly with the increase of continuous cropping years. Therefore, this study showed that continuous cropping of flue-cured tobacco for many years decreased the relative abundance of Chloroflexi, while tobacco straw return combined with lime promoted soil health by increasing the abundance of Chloroflexi (Table S6). This potentially implied that straw returning with lime application could improve soil microbial diversity and quality. 3.3 The connection in plant–microbe–soil with straw and lime application In previous study, we found soil fertility, soil bacterial richness and diversity and tobacco yield were obviously improved with straw and lime addition (Table 1 ; Fig. 1 ; Fig. 2 ; Fig. 8 ). This was consistent with prior study (Wei et al., 2021 ), which showed that straw mulch significantly increased the number of soil specific bacteria and the relative abundance of Proteobacteria, Firmicutes, and Planctomycetes, thus improving the coordination of chemical composition and the sensory quality of tobacco leaves. As a result, straw return and lime application improves soil pH and nutrients to increase the yield of flue-cured tobacco, while the relative abundance of bacteria had a negative impact on the yield of plant (Fig. 8 ). Indeed, the straw return of the diseased plants may increase bacterial pathogen community in the soil, thereby reducing crop yields (Yan et al., 2016 ). Therefore, the straw of diseased plants should be removed from the field as far as possible, and it is necessary to conduct more research on the effect of tobacco straw return on the occurrence of plant diseases. In addition, lime (up to 3000 kg hm –2 ) and dolomite powder (up to 6000 kg hm –2 ) application soil may have certain negative effects, such as a large amount of Ca accumulation in soil (Jiang et al., 2021 ), which would aggravate imbalance between K, Ca and Mg nutrients of tobacco plants, and lead to the deficiency of Mg in tobacco leaf (Li et al., 2005 ). In addition, the incorporation of lime and straw has the potential to enhance the activity and respiration rate of soil bacteria, consequently expediting the assimilation of soil nutrients and fostering competition with plant roots (Dai et al., 2017 ; Saleem et al., 2019 ). Therefore, it is suggested to carry out a long-term field experiment to comprehensively evaluate the effects of tobacco straw return and lime on tobacco field soil regulation to lay a foundation for the research and development of more efficient soil amendments. This study holds significant importance in uncovering the mechanisms behind the improvement soil pH and nutrient leaves and the enhancement of tobacco yield and quality through the implementation of tobacco straw return and lime application (Fig. 8 ). Soil pH is a simple and effective indicator used to assess soil quality regulation, and also the most common predictor for evaluating lime requirement (Holland et al., 2018 ; Liao et al., 2020 ). In the first year of this experiment, no significant difference was found in soil pH among different treatments (Jiang et al., 2021 ). However, after five years, soil pH was significantly increased by 0.94 units (16.9%) under the treatment of St + L (Table 1 ). This is consistent with Zhang et al. ( 2020 ) finding that the change in soil pH had a key impact on soil microbial biomass, especially on Gram-negative bacteria and fungi. Nacke et al. ( 2011 ) and Ao et al. ( 2022 ) also found that soil pH is a key environmental factor affecting soil bacterial community structure and diversity. This explanation is consistent with previous findings that the physiological function of some soil bacteria was inhibited by soil pH, while some bacteria could adapt well to the effects of soil acidification (Lauber et al., 2009 ). It is also possible that soil pH did not directly change the bacterial community, but influenced the composition of soil microflora (Suleiman et al., 2013 ; Bahram et al., 2018 ). Soil pH could be effectively regulated by incorporating soil amendments like lime, which could adjust the structure of soil bacterial communities, suppress the growth of pathogens, and enhance the soil microenvironment (Ao et al., 2022 ; Chen et al., 2022b ). For instance, the addition of organic fertilizer and lime substantially augmented the populations of actinomycetes and Proteobacteria in rhizosphere soil, consequently improving overall soil health (Chen et al., 2022b ). The incorporation of straw into the soil has resulted in a notable enhancement of the soil's nutrient availability, consequently exerting an influence on the community composition and abundance of soil microorganisms in our study (Table 1 ; Fig. 8 ). With the improvement of soil nutrients, returning straw to the field can significantly improve the bacterial diversity and richness index of saline alkali soil (Carbonetto et al., 2014 ; Zhao et al., 2014 ). In addition, we found the coverage of bacteria had a significant correlation with soil physicochemical properties (pH, SOM, AN and TN) (Fig. 2 ). Similar finding was also reported Zhang et al. ( 2020 ) who showed that the biomass of gram-negative bacteria increased significantly with the increase of soil total N content. Dai et al., 2021 found the involvement of microorganisms in the process of straw recycling encompasses two key functions. 1) their active participation in the decomposition and maturation of straw, leading to enhanced soil fertility;2) their contribution towards disease prevention and control, as well as the promotion of plant growth, achieved through the improvement of microbial community structure and individual activity. The straw into the field alongside fertilizer has the potential to enhance the diversity and abundance of advantageous bacterial communities, consequently fostering plant well-being and augmenting agricultural productivity (Tian et al., 2014 ; Xiong et al., 2018 ). Straw, being a prospective provider of carbon, nitrogen, and potassium, exerts an influence on the elemental cycling, humus content, microbial species, and soil habitat conditions within the soil (Cai et al., 2020 ; Chen et al., 2020 ). It was mainly due to the increased available N content, which potentially reduced its inhibitory effect on bacterial metabolism. It was reported that the bacteria did not need to secrete more extracellular enzymes to decompose organic matter to obtain sufficient N source substrates, so that more carbon was used to promote growth instead of extracellular enzyme synthesis (Zhang et al., 2020 ). Lime nitrogen could promote soil microbial colonization and enhance the prevalence of functional bacteria such as Sphingomonas , Nitrospira and Flavobacterium , which are associated with the soil nitrogen cycle (Shen et al., 2021 ). In addition, soil microorganisms in genera level ( Sphingomonas , Nitrospira and Flavobacterium ) play a crucial role in ecosystem decomposition processes, influencing nutrient cycling via their mineralization rate and spatial distribution within the soil (Bardgett et al., 2014; Liu et al., 2023 ). The application of lime, straw returning to the field, and soil remediation exhibit a certain level of homogeneity. Concurrently, the treatment of straw contributes to the restoration of soil dynamics and the repair of damaged soil. A systematic integration of the theory of straw returning to the field, application of lime with the primary aspects of microbiota can offer novel insights for soil remediation. 4 Conclusion In our study, it has been determined that the utilization of straw, dolomite and lime as soil amendments yields notable improvements in both crop productivity and soil characteristics. The St + L also significantly increased tobacco leaf yield and quality of flue-cured tobacco. In addition, straw return with lime application (St + L) significantly increased the soil pH, SOM and the content of soil available nutrients compared with the CK. The total reads and effective sequences of soil microorganism were increased with soil conditioner addition (straw, dolomite and lime). Compared to soil fungi, bacterial diversity was more susceptible to changes in the external environment. The application of soil amendments (lime and straw) has been found to enhance the proliferation of beneficial microorganisms within the soil. Moreover, bacterial species exhibit heightened competition and encounter constrained availability of survival resources compared to fungi. By employing various analytical techniques (RDA, correlation analysis and network analysis), our study determined that soil microorganisms are significantly influenced by the presence of AK, AN and pH levels. Our findings present an effective approach for ameliorating acidic soil and enhancing tobacco leaf yield and quality in regions where tobacco-rice rotation is practiced. This method contributes to the improvement of soil acidity and promotes better outcomes in terms of tobacco leaf production and quality. Declarations Ethical Approval Not applicable. Consent to Participate Not applicable. Consent to Publish Not applicable. Authors Contributions CJ: data curation, writing-original draft, writing-review and editing; RM: review and editing; CZ: supervision and funding acquisition; CL, QZ, and XH: investigation and data correction. QD: writing-original draft; JS: writing-review and editing, and funding acquisition. All authors contributed to the article and approved the submitted version. Funding This work was funded by the National Natural Science Foundation of China (Grant numbers: 41271320) Competing Interests The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher’s note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References Ai C, Liang G, Sun J, He P, Tang S, Yang SH (2015) The alleviation of acid soil stress in rice by inorganic or organic ameliorants is associated with changes in soil enzyme activity and microbial community composition. Biol Fert Soils 51:465–477. 10.1007/s00374-015-0994-3 Allsup CM, George I, Lankau RA (2023) Shifting microbial communities can enhance tree tolerance to changing climates. Science 380(6647):835–840. 10.1126/science.adf2027 Ao J, Li B, Yan K, Li Y (2022) Effects of continuous cropping on tobacco-planting soil bacterial community diversity in typical tobacco growing areas of Yunnan Province. J Agric Resour Environ 39(1):46–54. 10.13254/j.jare.2020.0721 Bahram M, Hildebrand F, Forslund SK, Anderson JL, Soudzilovskaia NA, Bodegom PM (2018) Structure and function of the global topsoil microbiome. Nature 560:233–237. 10.1038/s41586-018-0386-6 Bao SD (2000) Soil agrochemistry analysis. China Agriculture Press, Beijing. (in Chinese) Bardgett RD, Putten WHVD (2014) Belowground biodiversity and ecosystem functioning. Nature 515(7528):505–511. 10.1038/nature13855 Bell CW, Asao S, Calderon F, Wolk B, Wallenstein MD (2015) Plant nitrogen uptake drives rhizosphere bacterial community assembly during plant growth. Soil Biol Biochem 85:170–182. 10.1016/j.soilbio.2015.03.006 Cai A, Xu H, Duan Y, Zhang X, Xu M (2020) Changes in mineral-associated carbon and nitrogen by long-term fertilization and sequestration potential with various cropping across china dry croplands. Soil Till Res 205:104725. 10.1016/j.still.2020.104725 Carbonetto B, Rascovan N, Alejandro M, Vázquez Martin P, Kathleen T (2014) Structure, composition and metagenomic profile of soil microbiomes associated to agricultural land use and tillage systems in argentine pampas. PLoS ONE 9(6):e99949. 10.1371/journal.pone.0099949 Chen D, Wang X, Carrión VJ, Yin S, Yue Z, Liao Y (2022b) Acidic amelioration of soil amendments improves soil health by impacting rhizosphere microbial assemblies. Soil Biol Biochem 167:108599. 10.1016/j.soilbio.2022.108599 Chen L, Sun S, Yao B, Peng Y, Gao C, Qin T (2022) Effects of straw return and straw biochar on soil properties and crop growth: A review. Front Plant Sci 13:986763. 10.3389/fpls.2022.986763 Chen XQ, Li T, Lu DJ, Cheng L, Zhou JM, Wang HY (2020) Estimation of soil available potassium in chinese agricultural fields using a modified sodium tetraphenyl boron method. Land Degrad Dev, 31(14) Christopher W, Arthur S (2004) Nomenclatural clarifications and new taxa in the glomeromycota pacispora. Mycol Res 108:981–982. 10.1017/S0953756204231173 Chu X, Bai N, Zheng X, Wang Q, Pan X, Li S, Zhang J, Zhang H, He W, Zhong F, Lv W, Zhang H (2022) Effects of straw returning combined with earthworm addition on nitrification and ammonia oxidizers in paddy soil. Front Microbiol 13:1069554. 10.3389/fmicb.2022.1069554 Dai Z, Zhang X, Tang C (2017) Potential role of biochars in decreasing soil acidification: A critical review. Sci Total Environ 581:601–611. 10.1016/j.scitotenv.2016.12.169 Deng X, Huang J, Yang L, Chen J, Li Y, Tian M (2019) The synergistic effect of lime, green manure and bio-organic fertilizer on restoration of acid field and improvement of tobacco production efficiency. Plant Nut Fert Sci 25(9):1577–1587. 10.11674/zwyf.18372 Goulding KWT (2016) Soil acidification and the importance of liming agricultural soils with particular reference to the United Kingdom. Soil Use Manage 32:390–399. 10.1111/sum.12270 Grass I, Kubitza C, Krishna VV, Corre MD, Mußhoff O, Pütz P, Drescher J, Rembold K, Ariyanti ES (2020) Trade-offs between multifunctionality and profit in tropical smallholder landscapes. Nat Commun 11(1):1186. 10.1038/s41467-020-15013-5 Holland JE, Bennett AE, Newton AC, White PJ, McKenzie BM, George TS (2018) Liming impacts on soils, crops and biodiversity in the UK: a review. Sci Total Environ 610:316–332. 10.1016/j.scitotenv.2017.08.020 Huang K, Ye C, Li D, Li Q, He C, Yang G (2021) Effects of control agents against tobacco root-knot nematode disease on bacterial community structure in rhizosphere soil of tobacco plants. Tob Sci Technol 54(11):9–17 (in Chinese) Jaskulska I, Jasklski D, Kobierski M (2014) Effect of liming on the change of some agrochemical soil properties in a long-term fertilization experiment. Plant Soil Environ 60(4):146–150. 10.2478/intag-2014-0015 Jiang C, Shen J, Wang H, Li D, Li T, Wang W (2016) Effect of tobacco straw incorporation on rice yield and nutrient absorption and its substitute for potassium fertilizer. Chin J Appl Ecol 27(12):3969–3976 (in Chinese) Jiang C, Shen J, Yan Y, Zu C (2021) Straw return with dolomite application increase flue-cured tobacco leaf yield and quality. Int J Agric Biol 25:291–297. 10.17957/IJAB/15.1669 Jiang Y, Liao P, Gestel N, Sun Y, Zeng Y, Huang S (2018) Lime application lowers the global warming potential of a double rice cropping system. Geoderma 325:1–8. 10.1016/j.geoderma.2018.03.034 Kou Z, Zhou X (2020) Variation of soil bacterial community in tobacco field after different years of continuous monocropping. J Plant Nut Fert 26(3):511–521. 10.11674/zwyf.19219 Lauber CL, Hamady M, Knight R, Fierer N (2009) Pyrosequencing-based assessment of soil pH as a predictor of soil bacterial community structure at the continental scale. Appl Environ Microb 75(15):5111–5120. 10.1128/aem.00335-09 Li H, Dai M, Dai S, Dong X (2018) Current status and environment impact of direct straw return in China’s cropland-A review. Ecotox Environ Safe 159:193–300. 10.1016/j.ecoenv.2018.05.014 Li J, Zhang M, Lin Q, Chen Z, Xie G, Peng J (2005) Effects of interaction of potassium, calcium and magnesium on flue-cured tobacco growth and nutrient absorption. J Anhui Agric Univ 32(4):529–533 (in Chinese). 10.13610/j.cnki.1672-352x.2005.04.027 Li W, Zhi X, Tang S (2013) Actinobacterial systematics in China: past, present and future. Microbiol China 40(10):1860–1873 (in Chinese) Li Y, Hu Y, Song D, Liang S, Qin X, Siddique KHM (2019) The effects of straw incorporation with plastic film mulch on soil properties and bacterial community structure on the loess plateau. Eur J Soil Sci 72:979–994. 10.1111/ejss.12912 Liao P, Huang S, van Gestel NC, Zeng Y, Wu Z, van Groenigen KJ (2018) Liming and straw retention interact to increase nitrogen uptake and grain yield in a double rice-cropping system. Field Crop Res 216:217–224. 10.1016/j.fcr.2017.11.026 Liao P, Liu L, He Y, Tang G, Zhang J, Zeng Y (2020) Interactive effects of liming and straw incorporation on yield and nitrogen uptake in a double rice cropping system. Acta Agron Sinica 46(1):84–92 (in Chinese) Liu Bo, Xia H, Jiang CC, Muhammad R, Yang L, Chen YF, Fan XP, Xia XG (2022) 14 year applications of chemical fertilizers and crop straw effects on soil labile organic carbon fractions, enzyme activities and microbial community in rice-wheat rotation of middle China. Sci Total Environ , 841,156608. 10.1016/j.scitotenv.2022.156608 Liu J, Cui J, Liu H, Pan Q, He X (2022) Research progress of soil amelioration of acidified soil by soil amendments. J Environ Eng Technol 12(1):173–184. 10.12153/j.issn.1674-991X.20210119 Liu J, Jiang B, Shen J, Zhu X, Yi W, Li Y (2021) Contrasting effects of straw and straw-derived biochar applications on soil carbon accumulation and nitrogen use efficiency in double-rice cropping systems. Agr Ecosyst Environ 311:107286. 10.1016/j.agee.2020.107286 Liu L, Gao Y, Yang W, Liu J, Wang Z (2023) Community metagenomics reveals the processes of nutrient cycling regulated by microbial functions in soils with P fertilizer input. Plant Soil. 10.1007/s11104-023-05875-1 Liu L, Liao P, Shao H, Liu J, Yang X, Wang J (2022b) Interactive effects of liming and straw return on apparent soil potassium balance in a double rice cropping system. Acta Agron Sinica 48(1):226–237 (in Chinese) Liu Y, Jiang C, Shen J, Li T, Wang W, Cui Q (2017) Decomposition rates and nutrient release patterns of tobacco straw. Soils 49(3):543–549 (in Chinese) Mei XY, Gao JS, Yang XY, Huang J, Cai ZJ, Li DC, Wang BR, Liu KL, Xu MG, Zhang HM (2016) The response of soil potassium availability in rhizospheric soil of winter wheat to acidified and limed red soil. J Plant Nutr Fertilizer 22(6):1568–1577 (in Chinese) Nacke H, Thürmer A, Wollherr A, Will C, Hodac L, Herold N (2011) Pyrosequencing-based assessment of bacterial community structure along different management types in German forest and grassland soils. PLoS ONE 6(2):el7000. 10.1371/journal.pone.0017000 Ren B, Ma Z, Zhao B, Liu P, Zhang J (2022) Influences of split application and nitrification inhibitor on nitrogen losses, grain yield, and net income for summer maize production. Front Plant Sci 13:982373. 10.3389/fpls.2022.982373 Saleem M, Hu J, Jousset A (2019) More than the sum of its parts: Microbiome biodiversity as a driver of plant growth and soil health. Annu Rev Ecol Evol S 50:145–168. 10.1146/annurev-ecolsys-110617-062605 Schloss PD, Gevers D, Westcott SL (2011) Reducing the effects of PCR amplification and sequencing artifacts on 16S rRNA-Based studies. PLoS ONE 6(12):e27310. 10.1371/journal.pone.0027310 Shao F, Jiang C, Zu C, Xue B, Xu J, Shen J (2012) Influence of sulfur and stillage fertilizer on the growth, quality of flue-cured tobacco, and pH in alkaline soil. Acta Bot Bor-Occident Sin 32:2479–2485 (in Chinese). 10.3969/j.issn.1000-4025.2012.12.017 Shen J, Zhang M, Liu G, Li X, Shi D, Wang Y (2021) Effect of lime nitrogen application on microbial flora of tobacco rhizosphere soil. Soil Fert Sci China 175–82. 10.11838/sfsc.1673-6257.19562 Shi H, Xiang B, Zhu Z, Zou M, Peng W, Yin Z (2023) Effects of quicklime application on bacterial community structure and metabolic function in acidified tobacco-planting soil. Tob. Sci. Technol. 2023, 56(5), 8–16 (in Chinese). 10.16135/j.issn1002-0861.2023.0064 Strecker T, Barnard RL, Niklaus PA, Scherer-Lorenzen M, Blumenbach JF (2015) Effects of plant diversity, functional group composition, and fertilization on soil microbial properties in experimental grassland. PLoS ONE 10(5). 10.1371/journal.pone.0125678 Su Y, Lv JL, Yu M, Ma ZH, Xi H, Kou CL (2020) Long-term decomposed straw return positively affects the soil microbial community. J Appl Microbiol 128:138–150. 10.1111/jam.14435 Suleiman AKA, Manoeli L, Boldo JT, Pereira MG, Roesch LFW (2013) Shifts in soil bacterial community after eight years of land-use changes. Syst Appl Microbiol 36(2):137–144. 10.1016/j.syapm.2012.10.007 Teng K, Zhang Q, Peng J, Chen Q, Tian M, Chao J (2022) Effects of reductive soil disinfestation on chemical properties and microbial community structure of soils before and after tobacco planting. Tob Sci Technol 55(4):9–19 (in Chinese). 10.16135/j.issn1002-0861.2021.0607 Thidar M, Gong D, Mei X, Gao L, Li H, Hao W (2020) Mulching improved soil water, root distribution and yield of maize in the Loess Plateau of Northwest China. Agr Water Manage 241:106340. 10.1016/j.agwat.2020.106340 Tian BY, Wang CX, LV RR (2014) Community structure and succession regulation of fungal consortia in the lignocellulose-degrading process on natural biomass. Sci World J 845721. 10.1155/2014/845721 Tong W, Yang M, Wang H, Feng X, Zhang L, Zhou B (2021) Effects of tillage methods on fungal community structure in rhizosphere soil of flue-cured tobacco in mountainous tobacco fields. Acta Tab Sinica 27(1):56–63 (in Chinese). 10.16472/j.chinatobacco.2020.t0064 Valentinuzzi F, Mimmo T, Cesco S (2015) The effect of lime on the rhizospheric processes and elemental uptake of white lupin. Environ Exp Bot 118:85–94. 10.1016/j.envexpbot.2015.06.010 Wagg C, Dudenhöffer JH, Widmer F, Heijden MGA (2018) Linking diversity, synchrony and stability in soil microbial communities. Funct Ecol 32(5):1280–1292. 10.1111/1365-2435.13056 Wang N, Li JY, Xu RK (2009) Use of various agricultural by -products to study the pH effects in an acid tea garden soil. Soil Use Manage 25:128–132. 10.1111/j.1475-2743.2009.00203.x Wang N, Xu RK, Li JY (2011) Amelioration of an acid Ultisol by agricultural by-products. Land Degrad Dev 22:513–518. 10.1002/ldr.1025 Wei J, Wang Z, Xu T, Wang J, Li B, Ao J (2021) Effects of straw mulching and film-uncovering on the bacterial community of sloping farmland soil and tobacco leaf quality. Chin J Soil Sci 52(1):82–89 (in Chinese) Xiong J, Gong YJ, Chen ZQ, Lei SN, Li Y, Zhang T, Tian BY (2018) Comparative Analysis on Population Composition, Structure and Diversity of Species Involved in Degradation of Different Lignocellulosic Materials. J Northeast Agricultural Sci 43(5):27–33 (in Chinese) Xu Y, Fang Z, Lu X, Hao L (2017) Effects of starane on maize soil bacterial diversity analyzed by high-throughput sequencing technology. Acta Microbiol Sinica 57(7):985–993 (in Chinese) Yan H, Yan H, Ji S, Han M, Lei J, Yan K (2012) Correlation analysis between appearance quality and sensory quality of Henan flue-cured tobacco. Tob Sci Technol (7), 17–23 (in Chinese). Yan N, Guo D, Yao Z, Dou Y, Liu X, Zhang Z (2016) Effects of tobacco stalk returning on soil bacterial diversity. Acta Agric. Jiangxi 28(5), 40–45 (in Chinese). doi: 0.3969/j.issn.1001-8581.2016.05.009 Yang H, Ma J, Rong Z, Zeng D, Wang Y, Hu S (2019) Wheat straw return influences nitrogen-cycling and pathogen associated soil microbiota in a wheat-soybean rotation system. Front Microbiol 10:1811. 10.3389/fmicb.2019.01811 Yao C, Zhang J, Lu Y, Ma M, Yao Y (2017) Natural grass improves the composition and structure of the bacterial community in the soil of apple orchards. J Beijing Uni Agric 32(4):36–41 (in Chinese) Zhang M, Muhammad R, Zhang L, Xia H, El-desouki Z, Jiang CC (2019) Response of fungal communities in different soils to biochar and chemical fertilizers under simulated rainfall conditions. Sci Total Environ 691:654–663. 10.1016/j.scitotenv.2019.07.151 Zhang X, Xu M, Shi F (2020) Impact of typical agricultural land use on the characteristics of soil microbial communities in the Nyingchi region of southeastern Tibet. J Agro-Environ Sci 39(2):331–342 (in Chinese) Zhao F, Zhao M, Wang Y, Pang F (2017) Biodiversity of bacteria and fungi in rhizosphere of strawberry with different continuous cropping years. Microbiol China 44(6):1377–1386 (in Chinese) Zhao J, Zhang R, Xue C, Xun W, Sun L, Xu Y (2014) Pyrosequencing reveals contrasting soil bacterial diversity and community structure of two main winter wheat cropping systems in china. Microb Ecol 67(2):443. 10.1007/s00248-013-0322-0 Zhao J, Zhou X, Jiang A, Fan J, Lan T, Zhang J (2018) Distinct impacts of reductive soil disinfestation and chemical soil disinfestation on soil fungal communities and memberships. Appl Microbiol Biot 102(17):7623–7634. 10.1007/s00253-018-9107-1 Zhou Y, Guo W, LI X, Zhou X, Wang X, Guo J (2018) Correlation between free amino acids and sensory quality for flue-cured tobacco of fresh flavor type tobacco-planting areas. Tob Sci Technol 51(11):28–35 (in Chinese). 10.16135/j.issn1002-0861.2017.0557 Zou C, Li Y, Huang W, Zhao G, Pu G, Su J (2018) Rotation and manure amendment increase soil macro-aggregates and associated carbon and nitrogen stocks in flue-cured tobacco production. Geoderma 325:49–58. 10.1016/j.geoderma.2018.03.017 Supplementary Files SupplementaryInformation.docx Cite Share Download PDF Status: Published Journal Publication published 14 Apr, 2024 Read the published version in Environmental Science and Pollution Research → Version 1 posted Editorial decision: Major Revision 07 Mar, 2024 Reviewers agreed at journal 03 Dec, 2023 Reviewers invited by journal 17 Nov, 2023 Editor invited by journal 09 Nov, 2023 Editor assigned by journal 24 Oct, 2023 First submitted to journal 18 Oct, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3450152","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":250909931,"identity":"81383123-8839-49f5-89f7-42080de8cdaf","order_by":0,"name":"chaoqiang jiang","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"chaoqiang","middleName":"","lastName":"jiang","suffix":""},{"id":250909932,"identity":"ced6d3fc-9ae3-4bd2-870b-352d7d63c2e2","order_by":1,"name":"chaolong zu","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"chaolong","middleName":"","lastName":"zu","suffix":""},{"id":250909933,"identity":"e77c2c53-33e7-4731-ba93-24902b61e5d1","order_by":2,"name":"Muhammad Riaz","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"","lastName":"Riaz","suffix":""},{"id":250909934,"identity":"e4ba4060-0740-4c04-8063-81179c204ab9","order_by":3,"name":"ch li","email":"","orcid":"","institution":"anhui provincial tobacoo company","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"ch","middleName":"","lastName":"li","suffix":""},{"id":250909935,"identity":"0c22adad-4fa9-4f1a-9e15-3718daaf8190","order_by":4,"name":"qifa zhu","email":"","orcid":"","institution":"anhui wannan leaf tobacoo company","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"qifa","middleName":"","lastName":"zhu","suffix":""},{"id":250909936,"identity":"dcb188cd-adea-413f-95c1-4d340fcce4cd","order_by":5,"name":"hao Xia","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"hao","middleName":"","lastName":"Xia","suffix":""},{"id":250909937,"identity":"13f73c90-6744-470b-8756-5c32b7c1364a","order_by":6,"name":"qing dong","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"qing","middleName":"","lastName":"dong","suffix":""},{"id":250909938,"identity":"43bd1eda-db4d-499a-8118-b04c9088915f","order_by":7,"name":"Jia Shen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYDACCRA2YOBhY2ZsfJBQYUO8Fjl+9ubDBg/OpBGpBQiMJXuOpUk+bDtEWIf87OZjDywK7BI33Mgxq0hgO8DA396dgFeLwZ1j6QYSBslgLTcSeO4wSJw5uwG/FokcMwkJA2aoFolnQJFc/FrkZ+R/A2qpB2spSDA4TFgLw40cNqCWw2DvMyQkEKHF4EYayGHHwYEskXAgjYegX+RnJD+TlvhTDY7Kjz//2cjxt/cScBgQMEsgcXgIKgcBxg9EKRsFo2AUjIIRCwA0K0kxDpeOIAAAAABJRU5ErkJggg==","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Jia","middleName":"","lastName":"Shen","suffix":""}],"badges":[],"createdAt":"2023-10-16 02:02:45","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3450152/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3450152/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11356-024-33241-w","type":"published","date":"2024-04-15T03:49:32+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":46879020,"identity":"12687d16-549f-4000-aa50-d1cfa93fe15d","added_by":"auto","created_at":"2023-11-21 21:26:43","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":287809,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figures1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3450152/v1/a0e59de34aafbb9c24c1f646.jpg"},{"id":46879028,"identity":"22bad3da-582c-49e2-a50a-97e7998e2db6","added_by":"auto","created_at":"2023-11-21 21:26:43","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":415236,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figures2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3450152/v1/f523c10a94db8d8c18f3f09d.jpg"},{"id":46879021,"identity":"ce71efd4-2c3e-4945-b109-6925dd05d49e","added_by":"auto","created_at":"2023-11-21 21:26:43","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":356065,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figures3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3450152/v1/3d014f0d5d742606ac2dad8b.jpg"},{"id":46882388,"identity":"81a492ad-27f0-494e-89b2-22aa832f058c","added_by":"auto","created_at":"2023-11-21 21:42:43","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":352979,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figures4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3450152/v1/2943da2deffb1bda7012cc4c.jpg"},{"id":46880522,"identity":"78c0db36-5690-4b10-8489-d8a29a174987","added_by":"auto","created_at":"2023-11-21 21:34:43","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":255006,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figures5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3450152/v1/497112eac6c4c3e7153c5bbc.jpg"},{"id":46880520,"identity":"b1f0a835-50eb-4ed5-a28a-759bd45989f8","added_by":"auto","created_at":"2023-11-21 21:34:43","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":265302,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figures6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3450152/v1/7f4f3b1962f55731ea86d561.jpg"},{"id":46879022,"identity":"4a1a4f17-0cf6-4841-a671-7557fc36ebba","added_by":"auto","created_at":"2023-11-21 21:26:43","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":339645,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figures7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3450152/v1/32964e54765b974c2c7a42bb.jpg"},{"id":46879023,"identity":"08cf1541-d172-4d14-87c7-dd11fad78f28","added_by":"auto","created_at":"2023-11-21 21:26:43","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":376336,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Figures8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3450152/v1/f96f80ced395f9f0dd4a721c.jpg"},{"id":56573621,"identity":"3e1215cb-5ab0-499c-aed5-6f87154649c7","added_by":"auto","created_at":"2024-05-16 03:49:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3376193,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3450152/v1/838dac98-2c5d-47ab-aade-27d06234a96c.pdf"},{"id":46879026,"identity":"c6413388-4532-4b4b-aed2-e945eab82ff4","added_by":"auto","created_at":"2023-11-21 21:26:43","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":1305198,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-3450152/v1/228e91e4d413d4003bb44be3.docx"}],"financialInterests":"","formattedTitle":"Influences of tobacco straw return with lime on microbial community structure of tobacco-planting soil and tobacco leaf quality","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFlue-cured tobacco (\u003cem\u003eNicotiana tobacum\u003c/em\u003e L.) is an important economic crop widely cultivated in China, accounting for about one-third of the world's tobacco planting area (Zou et al., \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The large number of tobacco straws left after the tobacco leaves harvest is an important biomass resource (Jiang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Chen et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). After tobacco leaves harvesting, the straw is returned to the soil in situ by rotary tiller before rice transplanting in the tobacco-rice rotation regions in South China (Jiang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Yan et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Long-term retention of straw return in the soils has significant effects on improving soil structure, enhancing soil fertility, increasing crop yield, and reducing fertilizer consumption (Li et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Liu et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, the short-term effects of tobacco straw return to the field on rice yield were not obvious (Jiang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The degradation of soil microbial nitrogen (N) is initially slow during the early stage of straw return to the field. This results in the temporary fixation of soil microbial N, which can potentially lead to short-term N deficiency. Consequently, this nitrogen deficiency may inhibit plant growth and development (Liao et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In particular, because of the short sowing time of rice after tobacco leaves harvest, the tillering of rice is usually inhibited by the return of tobacco straw. In addition, the effects of single straw return on ameliorating soil acidity were not significant due to the low basicity of tobacco straw (Liao et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Jiang et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Therefore, optimizing straw return strategy is of great significance to improve the utilization of tobacco straw resources and increase crop yield in tobacco-rice rotation regions.\u003c/p\u003e \u003cp\u003eLime (CaCO\u003csub\u003e3\u003c/sub\u003e) application can improve soil acidity and increase crop yield (Liao et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Holland et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The effect of the lime application is mainly to increase soil pH and total base ions, reduce the content of exchangeable aluminum in the soil, to reduce the toxic effect of aluminum and enhance the absorption and utilization of soil nutrients by roots (Ai et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Jiang et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The lime application can also improve the structure and metabolic function of the bacterial community by increasing the pH in acid soils (Shi et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and promoting the decomposition of organic matter (Holland et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Liao et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, the effects of lime application on improving the fertility of acid soils are limited. Studies have shown that lime application and straw return effectively alleviate soil acidity and increasing soil fertility, respectively (Liao et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Straw return and lime application could promote N uptake for rice plants and increase double cropping rice yield (Liao et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Liu et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e). To alleviate soil acidification and control soil-borne diseases, lime or dolomite powder [CaMg(CO\u003csub\u003e3\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003e] is used in flue-cured tobacco cropping season (Deng et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, this effect was not significant. On the contrary, the calcium (Ca) content of soil increased significantly due to the application of lime, while the potassium (K) content of tobacco leaves decreased continuously, which declined flue-cured tobacco leaf quality (Jiang et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In addition, current researches mainly focus on the single effects of lime application or straw return to the field, while their interaction is still unclear (Goulding, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Liao et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Therefore, this study aimed to examine the effect of lime and straw return incorporation on the microbial community structure of tobacco-planting soil and flue-cured tobacco leaf quality. It is assumed that, on the one hand, the lime can improve the acid soil; on the other hand, the tobacco straw can increase the soil fertility, improve the soil microbial community structure and enhance the quality of tobacco leaves.\u003c/p\u003e \u003cp\u003eSoil microorganisms participate in organic matter transformation, nutrient cycling and fertility formation of soil (Teng et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Chen et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Their community structure and richness are important indicators for evaluating soil quality, and also play an important role in crop yield (Li et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Tong et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Due to the vital role of soil microorganisms in driving the organic matter cycle, improving soil quality, improving crop yield and sustainable agricultural development, it has received much attention in soil ecological studies (Tong et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Ren et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Soil microorganisms serve as the primary regulators of the material cycle within the soil ecosystem, constituting the largest resource pool. Their metabolic activities and interactions with other biological and abiotic factors enable them to effectively regulate soil structure and nutrient cycling (Strecker et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Allsup et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The release of nutrients from insoluble substances by soil microorganisms is contingent upon the composition of the microbial community, as alterations to said composition have a direct impact on the activity of soil enzymes (Bell et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In addition, the structure of the arbuscular mycorrhizal network, once developed, can significantly augment the root absorption area of plants, enhance the uptake and exchange of mineral nutrients, and consequently, fortify their stress resistance capacity (Christopher and Arthur, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Therefore, the soil physicochemical properties and microbial community structure should be well considered when studying the effects of farmland management measures on crop growth. In China, more than 45\u0026nbsp;billion tons of tobacco straw are produced yearly during tobacco leaf production (Liu et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The return of tobacco straw to the field is of great significance for soil fertility and ecological environment protection. Therefore, in this study, a multi-year field experiment was carried out in the acidic soil of a tobacco-rice rotation area to investigate the effects of tobacco straw return combined with lime application on tobacco leaf quality, soil physicochemical properties and microbial community structure, which will provide a scientific basis for ameliorating soil acidity, increasing flue-cured tobacco leaf quality.\u003c/p\u003e"},{"header":"1 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e1.1 Experimental Site Description\u003c/h2\u003e \u003cp\u003eThe field experiment was conducted from 2014 to 2019 in Dongzhi County, Chizhou City, Anhui Province (N 30\u0026deg;16'45.30\", E 117\u0026deg;05'3.34\"). The experimental site is a typical tobacco-rice rotation area in Southern China. This area has a subtropical humid monsoon climate, with an average annual temperature of 16.9 ℃ and an average annual precipitation of 1554 mm. The mean annual sunshine time is 17055 h. The soil in this region was classified as paddy soil. The soil properties within the top 0\u0026ndash;20 cm of soil were as follows: pH 5.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08, organic matter 22.9\u0026thinsp;\u0026plusmn;\u0026thinsp;1.2 g kg\u003csup\u003e\u0026ndash;1\u003c/sup\u003e, total nitrogen (N) 1.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 g kg\u003csup\u003e\u0026ndash;1\u003c/sup\u003e, alkaline N 171.7\u0026thinsp;\u0026plusmn;\u0026thinsp;5.7 g kg\u003csup\u003e\u0026ndash;1\u003c/sup\u003e, available phosphorus (P) 36.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3 g kg\u003csup\u003e\u0026ndash;1\u003c/sup\u003e and available K 209.3\u0026thinsp;\u0026plusmn;\u0026thinsp;10.6 g kg\u003csup\u003e\u0026ndash;1\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e1.2 Experimental Design and Methodology\u003c/h2\u003e \u003cp\u003eFour treatments were designed in the fixed-site (2014\u0026ndash;2019) field trail as follows: (group 1) control (tobacco straw removed, CK), (group 2) tobacco straw return (St), (group 3) tobacco straw return with dolomite (St\u0026thinsp;+\u0026thinsp;D), (group 4) tobacco straw return with lime (St\u0026thinsp;+\u0026thinsp;L). For the CK treatment, all the tobacco straws were removed from the field after the tobacco leaves harvesting, while for other treatments, tobacco straws were returned to the field and mixed with the topsoil by cutting into 10\u0026ndash;15 cm using a rotary tiller. The dosage of lime and dolomite was 1500 kg hm\u003csup\u003e\u0026ndash;2\u003c/sup\u003e, broadcasted uniformly before the straws returned. The sources of lime and dolomite used in this study was calcitic limestone (Ca 396 g kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and Mg 2.5 g kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) and dolomitic limestone (Ca 220 g kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and Mg 124 g kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), respectively. Treatments were replicated thrice and arranged in a randomized complete block design, totaling 12 plots. The plot size was 36 m\u003csup\u003e2\u003c/sup\u003e (10 m \u0026times; 3.6 m), and the row and plant spacing was 1.2 m and 0.5 m, respectively. The flue-cured tobacco variety was Yunyan 87. Four stringent ridges [ 30 cm (height) \u0026times; 30 cm (width)] were set up around each plot to avoid water and fertilizer pollution, and independent water inlet and outlet were set up for each plot. The application of fertilizers for flue-cured tobacco consisted of 115 kg N ha\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, 180 kg P\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e5\u003c/sub\u003e ha\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, and 375 kg K\u003csub\u003e2\u003c/sub\u003eO ha\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The specific commercial fertilizers utilized were compound fertilizer for tobacco (N: P: K 9\u0026ndash;13.5\u0026ndash;22.5), superphosphate (0\u0026ndash;15\u0026ndash;0), potassium sulfate (0\u0026ndash;0\u0026ndash;50), and potassium nitrate (13.5\u0026ndash;0\u0026ndash;46). These fertilizers were uniformly applied one day prior to the transplantation of tobacco seedlings. The cropping system during the experiment was tobacco-rice rotation cropping, that is, tobacco was first transplanted in the middle of March, and rearranged to plant rice after the tobacco leaf harvesting in the middle of July in the same field.\u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e1.3 Soil sample collection\u003c/h2\u003e \u003cp\u003eAfter five years of continuous treatment, soil samples were collected on June 27, 2019, during the tobacco leaves harvested. Three representative tobacco plants were selected in each plot, and the whole plant was pulled up and the loose soil was shaken off. And then the soils attached to the roots of the three plants were collected and mixed fully for one replication of the treatment. After removing the roots and debris, the rhizosphere soil samples were mixed and divided into two parts. One part was put into the ice box, brought back to the laboratory and stored in the at -70℃to determine soil microbial diversity. The other part was naturally dried at room temperature to determine soil physical and chemical characteristics.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e1.4 Determination of soil physical and chemical characteristics\u003c/h2\u003e \u003cp\u003eThe soil samples were air-dried, ground and screened. Soil pH, organic matter, alkaline N, available P, available K, exchangeable Ca and exchangeable Mg were determined according to the method of Bao, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2000\u003c/span\u003e and more detailed information was described in Shao et al. (2021).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e1.5 Soil DNA extraction and gene sequencing\u003c/h2\u003e \u003cp\u003eThe DNA from soil of each sample was extracted by E.Z.N.A.\u0026reg;Soil DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) according to the manufacturer\u0026rsquo;s instructions. The V4 region of the bacterial 16S rRNA gene was amplified using the primer set of 515 F (5\u0026prime;\u0026ndash;GTGCCAGCMGCCGCGG\u0026ndash;3\u0026prime;') and 806 R (5\u0026prime;\u0026ndash;GGACTACHVGGGTWTCTAAT\u0026ndash;3\u0026prime;). The ITS1 region of the fungi was amplified by the primer set of ITS 1F (5\u0026prime;\u0026ndash;CTTGGTCATTTAGAG GAAGTAA\u0026ndash;3\u0026prime;) and ITS 2R (5\u0026prime;\u0026ndash;GCTGCGTTCTTCATCGATGC\u0026ndash;3\u0026prime;) were used to amplify the ITS1 region of the fungus. PCR products were detected by 2% agarose gel electrophoresis. Purification was performed using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, U.S.) according to the manufacturer\u0026rsquo;s instructions. The concentration and purity of the extracted DNA were pooled and pair-end sequenced using an Illumina MiSeq platform (Zhao et al., \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Su et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The soil DNA concentration and purity ratios were 16.4\u0026ndash;48.2 \u0026micro;g \u0026micro;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 1.83\u0026ndash;2.20, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e1.6 Soil microbial diversity analysis\u003c/h2\u003e \u003cp\u003eUsearch (version 10.0) was used for quality control splicing and dechimerism of operational taxonomic units (OTUs) with a 97% similarity, and the abundance and representative sequence of OTUs were obtained. Mothur software (version v.1.30.1) was used to calculate the diversity indices (Coverage, Chao1, Shannon, and Simpson indices) of the bacterial and fungal communities (Schloss et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The composition of soil microbial community abundance was calculated based on OTUs abundance, and was mapped with R language and Microsoft Excel 2010 software. The SILVA bacterial database and Unite fungi database were used to align the resulting sequences (Zhang et al., \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e1.7 Analysis of tobacco yield and quality\u003c/h2\u003e \u003cp\u003eTobacco leaves were collected and cured separately in each plot. After drying, flue-cured leaves were graded according to the national flue-cured tobacco standard, and the yield and output values were calculated. According to the appearance quality evaluation standard of flue-cured tobacco, six indexes including color, maturity, leaf structure, identity, oil content and chroma of C3F grade leaves were quantitatively evaluated (Yan et al., \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The sensory quality of C3F grade leaves was evaluated by technical experts of China Tobacco Anhui Industrial Co., LTD. The evaluation indexes included aroma temperament, aroma volume, impurity, concentration, vigor, delicacy, softness, roundness, irritation, dryness, aftertaste, and sweetness (Zhou et al., \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e1.8 Statistical analyses\u003c/h2\u003e \u003cp\u003eThe statistical analyses were conducted using Microsoft Excel 2010 and SPSS 19.0. The differences among the treatments were analyzed using the least significant difference method (LSD) multiple range test.\u003c/p\u003e \u003c/div\u003e "},{"header":"2 Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.1 Effects of different treatments on tobacco yield and quality\u003c/h2\u003e \u003cp\u003eStraw return and lime application significantly effected tobacco leaves yield and output value (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Continuous straw return led to a significant increase in the yield and output value of tobacco leaves. The order of yield and output value of tobacco leaves was as follows: St\u0026thinsp;+\u0026thinsp;L\u0026thinsp;\u0026gt;\u0026thinsp;St\u0026thinsp;+\u0026thinsp;D\u0026thinsp;\u0026gt;\u0026thinsp;St\u0026thinsp;\u0026gt;\u0026thinsp;CK. Compared to the CK treatment, the St resulted in a 12.8% increase in yield and a 16.9% increase in the output value of tobacco leaves. Additionally, the St\u0026thinsp;+\u0026thinsp;L significantly increased the yield and output value by 24.0% and 31.6%, respectively. No significant difference was observed in tobacco yield and output value between the St\u0026thinsp;+\u0026thinsp;L and St\u0026thinsp;+\u0026thinsp;D treatments. As shown in Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e, the St significantly improved the appearance and sensory quality of flue-cured tobacco leaves. Moreover, the St\u0026thinsp;+\u0026thinsp;L significantly increased flue-cured tobacco leaves appearance and sensory quality by 9.1% and 5.9%, respectively. The appearance and sensory quality of tobacco leaves showed the trend of St\u0026thinsp;+\u0026thinsp;L\u0026thinsp;\u0026gt;\u0026thinsp;St\u0026thinsp;+\u0026thinsp;D\u0026thinsp;\u0026gt;\u0026thinsp;St\u0026thinsp;\u0026gt;\u0026thinsp;CK.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Effects of different treatments on soil physicochemical properties\u003c/h2\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, soil pH was significantly increased by 0.94 and 0.76 in St\u0026thinsp;+\u0026thinsp;L and St\u0026thinsp;+\u0026thinsp;D, respectively, compared with the CK. The St had no significant effect on soil pH, but significantly increased soil organic matter content compared with the CK. The St\u0026thinsp;+\u0026thinsp;L significantly increased the content of soil alkaline N and available K by 17.2% and 23.0%, respectively. Moreover, the St\u0026thinsp;+\u0026thinsp;D and St\u0026thinsp;+\u0026thinsp;L also significantly increased soil exchangeable Ca content, and the St\u0026thinsp;+\u0026thinsp;D significantly increased soil exchangeable Mg content. After 5 years of continuous treatment, the contents of soil organic matter, alkaline N and available K were increased by straw return, while the soil pH, the contents of alkaline N, available K, and exchangeable Ca were increased by lime application. In addition, the principal component analysis (Fig. S2) also showed that a clear difference was observed among the four treatments in soil physicochemical properties. PCA separated the samples into 3 parts (CK and St; St\u0026thinsp;+\u0026thinsp;D; St\u0026thinsp;+\u0026thinsp;L).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eChanges of soil pH and nutrient contents under different treatments\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatments\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOrganic matter\u003c/p\u003e \u003cp\u003e(g kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAlkaline N\u003c/p\u003e \u003cp\u003e(mg kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAvailable P\u003c/p\u003e \u003cp\u003e(mg kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAvailable K\u003c/p\u003e \u003cp\u003e(mg kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eExchangeable Ca\u003c/p\u003e \u003cp\u003e(mg kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eExchangeable Mg\u003c/p\u003e \u003cp\u003e(mg kg\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.57b*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19.27b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e120.7b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e38.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e189.0b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1071.9c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e138.0b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.72b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.22a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e139.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e39.9a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e259.8a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1138.4c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e155.0b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSt\u0026thinsp;+\u0026thinsp;D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.33a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.63ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e139.2a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e41.1a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e235.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1443.5b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e262.8a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSt\u0026thinsp;+\u0026thinsp;L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.51a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19.80ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e141.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e39.3a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e232.4a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1928.5a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e148.8b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e* Values in the same column followed by different letters are significantly different (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Effects of different treatments on the richness and diversity of soil microbial communities\u003c/h2\u003e \u003cp\u003eThe total reads and effective sequences of soil bacteria in all treatment were, respectively 14.94*10\u003csup\u003e6\u003c/sup\u003e-18.51*10\u003csup\u003e6\u003c/sup\u003e and 55930\u0026ndash;68112 (Table S3). In addition, the total reads and effective sequences of soil fungus were 14.46*10\u003csup\u003e6\u003c/sup\u003e-17.30*10\u003csup\u003e6\u003c/sup\u003e and 56964\u0026ndash;66282 (Table S3). The total reads and effective sequences richness of bacteria in the CK was significantly lower than that in other treatments, while the total reads and effective sequences of bacteria in the St\u0026thinsp;+\u0026thinsp;D was the highest treatment. Compared to the CK treatment, the total reads and effective sequences of bacteria were increased by 23.89% and 21.78% under St\u0026thinsp;+\u0026thinsp;D treatment. However, there was no clear difference in the total reads and effective sequences of soil fungus among different treatments. In addition, the α-diversity of soil bacteria was showed in Fig. S4, the richness, Shannon, Simpson, Pielou, invsimpson, Chao1 and ACE not showed significant differences, while the goods_coverage had significant differences (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Compared to the CK treatment, the goods_coverage was noteworthily increased by 1.11% under St\u0026thinsp;+\u0026thinsp;D treatment. Nevertheless, the richness, Shannon, Simpson, Pielou, invsimpson, Chao1, ACE and goods_coverage of fungus not presented a significant difference (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig. S5). Moreover, we used the mantel test to explore the relationship between the α-diversity of microorganism and soil physicochemical properties (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). We found the goods_coverage of bacteria had a significant correlation with soil physicochemical properties (pH, SOM, AN and TN) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). However, the α-diversity of soil fungus did not maintain a visible correlation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs shown in Table S6, Proteobacteria, Acidobacteria, Chloroflexi, Gemmatimonadetes and Bacteroidetes were the main bacterial categories in the soil samples. At the phyla level, the relative abundance of Proteobacteria was 37.4%-41.4%, which was the highest and followed by Acidobacteria (13.9%-15.8%), Chloroflexi (6.7%-10.6%). There were significant differences in community abundance between different treatments of Chloroflexi and Bacteroidetes, and the relative abundance of Chloroflexi in the St (10.6%) was significantly higher than that of the CK (6.7%). The relative abundance of Chloroflexi in all treatments followed the order of St\u0026thinsp;\u0026gt;\u0026thinsp;St\u0026thinsp;+\u0026thinsp;D\u0026thinsp;\u0026gt;\u0026thinsp;St\u0026thinsp;+\u0026thinsp;L\u0026thinsp;\u0026gt;\u0026thinsp;CK. The relative abundance of Bacteroidetes in the St\u0026thinsp;+\u0026thinsp;D (7.5%) was significantly higher than that in the CK and St, and the relative abundance of Bacteroidetes in all treatments followed the order of St\u0026thinsp;+\u0026thinsp;D\u0026thinsp;\u0026gt;\u0026thinsp;St\u0026thinsp;+\u0026thinsp;L\u0026thinsp;\u0026gt;\u0026thinsp;CK\u0026thinsp;\u0026asymp;\u0026thinsp;St (Table S6). The relative abundance of soil fungal communities at the phylum level were shown in Table\u0026nbsp;4, the highest was Ascomycota (40.7%-60.6%), and followed by Eukaryota_norank (31.2%-45.1%) and Basidiomycota (1.7%-12.6%). Eukaryota_norank was the most abundant fungal community composition in the CK, while Ascomycota was the highest in other treatments. The St significantly reduced the number of Eukaryota_norank. The St, St\u0026thinsp;+\u0026thinsp;D and St\u0026thinsp;+\u0026thinsp;L increased the number of Ascomycota, and the St\u0026thinsp;+\u0026thinsp;D reached a statistically significant difference compared with the CK. Compared with the CK, the St\u0026thinsp;+\u0026thinsp;D and St\u0026thinsp;+\u0026thinsp;L treatments decreased the abundance of the Basidiomycota community, while the St increased it (Table S6). In addition, the statistical difference of the two groups with wilcox test to compared differential microorganisms on phylum level (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Compared to the CK treatment, the relative abundance of Chloroflexi and TA06 were obviously increased under St treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Compared to the CK treatment, the relative abundance of Dadabacteria and Calditrichaeota were significantly increased under St\u0026thinsp;+\u0026thinsp;D treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). In addition, the relative abundance of Chloroflexi, TA06, Dadabacteria and Fibrobacteres were significantly increased under St\u0026thinsp;+\u0026thinsp;L treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). However, the relative abundance of Streptophyta was increased under St\u0026thinsp;+\u0026thinsp;D treatment compared to CK treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). In addition, we adopted the neutral community mode to describe the diversity and species abundance of soil microbial communities (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). It is seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e that the Nm of bacteria and fungus were 35960 and 2348, which suggested bacterial species exhibit heightened competition and encounter constrained availability of survival resources compared to fungi.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Influence of soil environmental factors on soil microbial community\u003c/h2\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, redundancy analysis (RDA) was performed to analyze the correlation between soil properties and microbial community. Based on the results of RDA, compared with fungi, the community structure of bacteria was more easily affected by environmental factors. For bacteria community structure, soil alkaline N significantly effected microbial community (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). However, the organic matter was the most important factor in fungus community structure (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Moreover, based on the correlation analysis (Fig. S7), we concluded the relative abundance of Fibrobacteres had a significant positive correlation with soil environmental (SOM, AN, AP, AK and TN) (Fig. S7A). However, the relative abundance of fungus in phylum level had no remarkable correlation (Fig. S7B). In addition, we used procrustes analysis to the link between soil environmental and soil microbial community (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). From the results of Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, we found the relative abundance of soil bacterium had strong correlation with soil environment (M\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.0943, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while the relative abundance of soil fungus had no contact with soil environment (M\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.1084, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.420). Moreover, we used two-factor network analysis to further establish the relationship between soil environment and soil microorganism (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The order of importance of microorganism was as follows: AK\u0026thinsp;\u0026gt;\u0026thinsp;AN\u0026thinsp;\u0026gt;\u0026thinsp;TK\u0026thinsp;\u0026gt;\u0026thinsp;SOM\u0026thinsp;\u0026gt;\u0026thinsp;pH (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Moreover, we used the structural equation modelling (SEM) to establish the connection in plant\u0026ndash;microbe\u0026ndash;soil (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). From the result of Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e, we concluded that the straw (regression coefficient\u0026thinsp;=\u0026thinsp;0.608) and lime (regression coefficient\u0026thinsp;=\u0026thinsp;0.719) had a significant positive impact on soil fertility (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). In addition, the soil fertility showed a positive stimulatory effect (regression coefficient\u0026thinsp;=\u0026thinsp;1.097) on plant growth, while the soil bacteria showed an inhibitory effect (regression coefficient=-0.194) on plant growth (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). Other than that, we concluded that soil fertility was the most important influencing factor on the yield of plant, followed by lime and straw (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Discussion","content":" \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003cdiv id=\"Sec17\" class=\"Section3\"\u003e \u003ch2\u003e3.1 Effects of straw and lime application on yield and quality of tobacco\u003c/h2\u003e \u003cp\u003eIn this study, the St\u0026thinsp;+\u0026thinsp;L not only increased tobacco leaf yield, but also improved the quality of tobacco compared with the CK. Our previous study also found that straw return and lime application significantly increased the yield of tobacco leaves by 21.4% compared with the control (Jiang et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). After five years of continuous treatment, the St\u0026thinsp;+\u0026thinsp;L significantly increased tobacco leaf yield by 24.0% (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and also increased the appearance and sensory quality of flue-cured tobacco leaves by 9.1% and 5.9%, respectively (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). However, improper use of soil amendments led to decreased crop yield and quality. It was reported that long-term application of large quantities of lime could lead to an imbalance of soil potassium, calcium, sodium and other elements, inhibiting plant growth and development, thus reducing the yield and quality of flue-cured tobacco leaves (Liu et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Therefore, the amount and timing of lime application for soil amendment should be considered comprehensively, which should be modified by both the effects on plant growth and the soil microbial environment (Holland et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Effects of straw and lime application on soil fertility and soil microbial\u003c/h2\u003e \u003cp\u003eAgricultural practices (straw returning and lime) contribute to soil fertility and the utilization of nutrients in the soil (Grass et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Chu et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In our study, with the addition of amendments such as straw and lime, the pH, organic matter, and available nutrient content of the soil have increased to varying degrees (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). There are several possible explanations for this result.1): Crop straw, an agricultural waste, contains alkaline substances and nutrients that can be utilized to enhance acidic soil directly (Wang et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).2): The application of lime serves to neutralize both active and latent acids present in acidified red soil, while concurrently enhancing the effective cation exchange capacity and optimizing the efficacy of potassium (Jaskulska et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Valentinuzzi et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Liu et al (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) found the act of reintroducing straw back into the field has the potential to greatly enhance soil fertility and promote a wider range of microbial species. In addition, the application of lime has been found to effectively mitigate the acidity levels in acidic soil, leading to notable enhancements in crop yield and the uptake of potassium in acidified red soil (Mei et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe richness and diversity of soil bacterial community are important indicators of soil quality, and play an important role in protecting soil health (Kou et al., 2020; Chen et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e). In this study, it was found that lime or dolomite powder application significantly increased the effective sequence number and OTU abundance of bacteria in the rhizosphere soil of tobacco plants (Table S3), and also increased the bacterial goods_coverage, indicating that lime application can improve the diversity of the bacterial community. Soil bacterial community is a relatively stable system, and its richness and species enrichment are affected by tillage methods, fertilization measures, soil amendments, and cropping systems etc. (Li et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Chen et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e). Yan et al. (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) showed that tobacco straw return significantly increased soil bacterial OTU and chao1. Moreover, straw mulching also increased soil nutrient content and bacterial community diversity (Thidar et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wei et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In our study, compared to fungi, bacterial diversity is more susceptible to changes in the external environment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e; Fig. S4; Fig. S5). Similarly, Yang et al. (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) found that wheat straw return significantly affected the α-diversity of soil bacteria, but did not change the soil fungal community. Li et al. (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) also observed that lime application had little impact on the community structure and diversity of soil fungi, which may be due to the relatively simple planting crops and low initial soil pH (less than 6.5). Bahram et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) also found a weak correlation between soil pH and soil fungal diversity by analyzing global topsoil samples. The effects of the St\u0026thinsp;+\u0026thinsp;L on increasing the bacterial community richness and diversity in rhizosphere soil may be greater with the period increase of treatment, which may result from the combined effect of the increase in soil pH and the release of straw nutrients. This requires further investigation in long-term field experiments. This study showed that the combined application of tobacco straw and lime improved the diversity and species richness of the rhizosphere soil bacterial community.\u003c/p\u003e \u003cp\u003eIn this study Proteobacteria was the highest relative abundance of all the phyla, and followed by Acidobacteria, Chloroflexi, Gemmatimonadetes and Bacteroidetes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e; Table S6). Similarly, Huang et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) found that the dominant bacteria followed the order of Proteobacteria, Actinobacteria, Chloroflexi and Acidobacteria in the rhizosphere soil of tobacco plants. Zhao et al. (\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) also reported that Proteobacteria and Actinobacteria were the dominant bacterial groups in rhizosphere soil. However, there were significant differences in the relative abundance of soil bacterial dominant flora under different treatments. The relative abundance of Proteobacteria was the highest in the CK, while the relative abundance of Chloroflexi was the lowest in the CK among all treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e; Table S6). Proteobacteria is widely recognized as the predominant bacterial phylum (Xu et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and encompasses numerous pathogenic bacterial species (Wagg et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Most Actinobacteria are saprophytic bacteria, and there are also a few Actinobacteria that can lead to animal and plant diseases (Li et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). This potentially indicated that the soil health was significantly affected in the CK, and the leaf yield of the CK was significantly lower than that of the St\u0026thinsp;+\u0026thinsp;L (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e; Table S6). The CK showed the lowest relative abundance of Chloroflexi. A similar result was observed by Ao et al (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), reported that the relative abundance of the Chloroflexi community in tobacco field soil decreased significantly with the increase of continuous cropping years. Therefore, this study showed that continuous cropping of flue-cured tobacco for many years decreased the relative abundance of Chloroflexi, while tobacco straw return combined with lime promoted soil health by increasing the abundance of Chloroflexi (Table S6). This potentially implied that straw returning with lime application could improve soil microbial diversity and quality.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.3 The connection in plant\u0026ndash;microbe\u0026ndash;soil with straw and lime application\u003c/h2\u003e \u003cp\u003eIn previous study, we found soil fertility, soil bacterial richness and diversity and tobacco yield were obviously improved with straw and lime addition (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). This was consistent with prior study (Wei et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), which showed that straw mulch significantly increased the number of soil specific bacteria and the relative abundance of Proteobacteria, Firmicutes, and Planctomycetes, thus improving the coordination of chemical composition and the sensory quality of tobacco leaves. As a result, straw return and lime application improves soil pH and nutrients to increase the yield of flue-cured tobacco, while the relative abundance of bacteria had a negative impact on the yield of plant (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). Indeed, the straw return of the diseased plants may increase bacterial pathogen community in the soil, thereby reducing crop yields (Yan et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Therefore, the straw of diseased plants should be removed from the field as far as possible, and it is necessary to conduct more research on the effect of tobacco straw return on the occurrence of plant diseases. In addition, lime (up to 3000 kg hm\u003csup\u003e\u0026ndash;2\u003c/sup\u003e) and dolomite powder (up to 6000 kg hm\u003csup\u003e\u0026ndash;2\u003c/sup\u003e) application soil may have certain negative effects, such as a large amount of Ca accumulation in soil (Jiang et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), which would aggravate imbalance between K, Ca and Mg nutrients of tobacco plants, and lead to the deficiency of Mg in tobacco leaf (Li et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). In addition, the incorporation of lime and straw has the potential to enhance the activity and respiration rate of soil bacteria, consequently expediting the assimilation of soil nutrients and fostering competition with plant roots (Dai et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Saleem et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Therefore, it is suggested to carry out a long-term field experiment to comprehensively evaluate the effects of tobacco straw return and lime on tobacco field soil regulation to lay a foundation for the research and development of more efficient soil amendments. This study holds significant importance in uncovering the mechanisms behind the improvement soil pH and nutrient leaves and the enhancement of tobacco yield and quality through the implementation of tobacco straw return and lime application (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSoil pH is a simple and effective indicator used to assess soil quality regulation, and also the most common predictor for evaluating lime requirement (Holland et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Liao et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In the first year of this experiment, no significant difference was found in soil pH among different treatments (Jiang et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, after five years, soil pH was significantly increased by 0.94 units (16.9%) under the treatment of St\u0026thinsp;+\u0026thinsp;L (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This is consistent with Zhang et al. (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) finding that the change in soil pH had a key impact on soil microbial biomass, especially on Gram-negative bacteria and fungi. Nacke et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) and Ao et al. (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) also found that soil pH is a key environmental factor affecting soil bacterial community structure and diversity. This explanation is consistent with previous findings that the physiological function of some soil bacteria was inhibited by soil pH, while some bacteria could adapt well to the effects of soil acidification (Lauber et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). It is also possible that soil pH did not directly change the bacterial community, but influenced the composition of soil microflora (Suleiman et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Bahram et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Soil pH could be effectively regulated by incorporating soil amendments like lime, which could adjust the structure of soil bacterial communities, suppress the growth of pathogens, and enhance the soil microenvironment (Ao et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Chen et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e). For instance, the addition of organic fertilizer and lime substantially augmented the populations of actinomycetes and Proteobacteria in rhizosphere soil, consequently improving overall soil health (Chen et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e). The incorporation of straw into the soil has resulted in a notable enhancement of the soil's nutrient availability, consequently exerting an influence on the community composition and abundance of soil microorganisms in our study (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). With the improvement of soil nutrients, returning straw to the field can significantly improve the bacterial diversity and richness index of saline alkali soil (Carbonetto et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zhao et al., \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In addition, we found the coverage of bacteria had a significant correlation with soil physicochemical properties (pH, SOM, AN and TN) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Similar finding was also reported Zhang et al. (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) who showed that the biomass of gram-negative bacteria increased significantly with the increase of soil total N content. Dai et al., 2021 found the involvement of microorganisms in the process of straw recycling encompasses two key functions. 1) their active participation in the decomposition and maturation of straw, leading to enhanced soil fertility;2) their contribution towards disease prevention and control, as well as the promotion of plant growth, achieved through the improvement of microbial community structure and individual activity. The straw into the field alongside fertilizer has the potential to enhance the diversity and abundance of advantageous bacterial communities, consequently fostering plant well-being and augmenting agricultural productivity (Tian et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Xiong et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Straw, being a prospective provider of carbon, nitrogen, and potassium, exerts an influence on the elemental cycling, humus content, microbial species, and soil habitat conditions within the soil (Cai et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Chen et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). It was mainly due to the increased available N content, which potentially reduced its inhibitory effect on bacterial metabolism. It was reported that the bacteria did not need to secrete more extracellular enzymes to decompose organic matter to obtain sufficient N source substrates, so that more carbon was used to promote growth instead of extracellular enzyme synthesis (Zhang et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Lime nitrogen could promote soil microbial colonization and enhance the prevalence of functional bacteria such as \u003cem\u003eSphingomonas\u003c/em\u003e, \u003cem\u003eNitrospira\u003c/em\u003e and \u003cem\u003eFlavobacterium\u003c/em\u003e, which are associated with the soil nitrogen cycle (Shen et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In addition, soil microorganisms in genera level (\u003cem\u003eSphingomonas\u003c/em\u003e, \u003cem\u003eNitrospira\u003c/em\u003e and \u003cem\u003eFlavobacterium\u003c/em\u003e) play a crucial role in ecosystem decomposition processes, influencing nutrient cycling via their mineralization rate and spatial distribution within the soil (Bardgett et al., 2014; Liu et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The application of lime, straw returning to the field, and soil remediation exhibit a certain level of homogeneity. Concurrently, the treatment of straw contributes to the restoration of soil dynamics and the repair of damaged soil. A systematic integration of the theory of straw returning to the field, application of lime with the primary aspects of microbiota can offer novel insights for soil remediation.\u003c/p\u003e \u003c/div\u003e "},{"header":"4 Conclusion","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003cp\u003eIn our study, it has been determined that the utilization of straw, dolomite and lime as soil amendments yields notable improvements in both crop productivity and soil characteristics. The St\u0026thinsp;+\u0026thinsp;L also significantly increased tobacco leaf yield and quality of flue-cured tobacco. In addition, straw return with lime application (St\u0026thinsp;+\u0026thinsp;L) significantly increased the soil pH, SOM and the content of soil available nutrients compared with the CK. The total reads and effective sequences of soil microorganism were increased with soil conditioner addition (straw, dolomite and lime). Compared to soil fungi, bacterial diversity was more susceptible to changes in the external environment. The application of soil amendments (lime and straw) has been found to enhance the proliferation of beneficial microorganisms within the soil. Moreover, bacterial species exhibit heightened competition and encounter constrained availability of survival resources compared to fungi. By employing various analytical techniques (RDA, correlation analysis and network analysis), our study determined that soil microorganisms are significantly influenced by the presence of AK, AN and pH levels. Our findings present an effective approach for ameliorating acidic soil and enhancing tobacco leaf yield and quality in regions where tobacco-rice rotation is practiced. This method contributes to the improvement of soil acidity and promotes better outcomes in terms of tobacco leaf production and quality.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCJ:\u0026nbsp;data curation, writing-original draft,\u0026nbsp;writing-review and editing; RM:\u0026nbsp;review and editing; CZ:\u0026nbsp;supervision\u0026nbsp;and funding acquisition; CL, QZ, and XH: investigation and data correction. QD:\u0026nbsp;writing-original draft; JS:\u0026nbsp;writing-review\u0026nbsp;and editing,\u0026nbsp;and funding acquisition.\u0026nbsp;All authors contributed to the article and approved the submitted version.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by the National Natural Science Foundation of China (Grant numbers: 41271320)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePublisher\u0026rsquo;s note\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll claims expressed in this article are solely those of the\u0026nbsp;authors and do not necessarily represent those of their affiliated\u0026nbsp;organizations, or those of the publisher, the editors and the\u0026nbsp;reviewers. Any product that may be evaluated in this article, or\u0026nbsp;claim that may be made by its manufacturer, is not guaranteed\u0026nbsp;or endorsed by the publisher.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAi C, Liang G, Sun J, He P, Tang S, Yang SH (2015) The alleviation of acid soil stress in rice by inorganic or organic ameliorants is associated with changes in soil enzyme activity and microbial community composition. Biol Fert Soils 51:465\u0026ndash;477. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00374-015-0994-3\u003c/span\u003e\u003cspan address=\"10.1007/s00374-015-0994-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllsup CM, George I, Lankau RA (2023) Shifting microbial communities can enhance tree tolerance to changing climates. Science 380(6647):835\u0026ndash;840. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.adf2027\u003c/span\u003e\u003cspan address=\"10.1126/science.adf2027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAo J, Li B, Yan K, Li Y (2022) Effects of continuous cropping on tobacco-planting soil bacterial community diversity in typical tobacco growing areas of Yunnan Province. J Agric Resour Environ 39(1):46\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.13254/j.jare.2020.0721\u003c/span\u003e\u003cspan address=\"10.13254/j.jare.2020.0721\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBahram M, Hildebrand F, Forslund SK, Anderson JL, Soudzilovskaia NA, Bodegom PM (2018) Structure and function of the global topsoil microbiome. Nature 560:233\u0026ndash;237. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-018-0386-6\u003c/span\u003e\u003cspan address=\"10.1038/s41586-018-0386-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao SD (2000) Soil agrochemistry analysis. China Agriculture Press, Beijing. (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBardgett RD, Putten WHVD (2014) Belowground biodiversity and ecosystem functioning. Nature 515(7528):505\u0026ndash;511. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature13855\u003c/span\u003e\u003cspan address=\"10.1038/nature13855\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBell CW, Asao S, Calderon F, Wolk B, Wallenstein MD (2015) Plant nitrogen uptake drives rhizosphere bacterial community assembly during plant growth. Soil Biol Biochem 85:170\u0026ndash;182. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.soilbio.2015.03.006\u003c/span\u003e\u003cspan address=\"10.1016/j.soilbio.2015.03.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai A, Xu H, Duan Y, Zhang X, Xu M (2020) Changes in mineral-associated carbon and nitrogen by long-term fertilization and sequestration potential with various cropping across china dry croplands. Soil Till Res 205:104725. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.still.2020.104725\u003c/span\u003e\u003cspan address=\"10.1016/j.still.2020.104725\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarbonetto B, Rascovan N, Alejandro M, V\u0026aacute;zquez Martin P, Kathleen T (2014) Structure, composition and metagenomic profile of soil microbiomes associated to agricultural land use and tillage systems in argentine pampas. PLoS ONE 9(6):e99949. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0099949\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0099949\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen D, Wang X, Carri\u0026oacute;n VJ, Yin S, Yue Z, Liao Y (2022b) Acidic amelioration of soil amendments improves soil health by impacting rhizosphere microbial assemblies. Soil Biol Biochem 167:108599. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.soilbio.2022.108599\u003c/span\u003e\u003cspan address=\"10.1016/j.soilbio.2022.108599\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen L, Sun S, Yao B, Peng Y, Gao C, Qin T (2022) Effects of straw return and straw biochar on soil properties and crop growth: A review. Front Plant Sci 13:986763. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fpls.2022.986763\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2022.986763\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen XQ, Li T, Lu DJ, Cheng L, Zhou JM, Wang HY (2020) Estimation of soil available potassium in chinese agricultural fields using a modified sodium tetraphenyl boron method. Land Degrad Dev, 31(14)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChristopher W, Arthur S (2004) Nomenclatural clarifications and new taxa in the glomeromycota pacispora. Mycol Res 108:981\u0026ndash;982. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1017/S0953756204231173\u003c/span\u003e\u003cspan address=\"10.1017/S0953756204231173\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu X, Bai N, Zheng X, Wang Q, Pan X, Li S, Zhang J, Zhang H, He W, Zhong F, Lv W, Zhang H (2022) Effects of straw returning combined with earthworm addition on nitrification and ammonia oxidizers in paddy soil. Front Microbiol 13:1069554. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2022.1069554\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2022.1069554\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai Z, Zhang X, Tang C (2017) Potential role of biochars in decreasing soil acidification: A critical review. Sci Total Environ 581:601\u0026ndash;611. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.scitotenv.2016.12.169\u003c/span\u003e\u003cspan address=\"10.1016/j.scitotenv.2016.12.169\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng X, Huang J, Yang L, Chen J, Li Y, Tian M (2019) The synergistic effect of lime, green manure and bio-organic fertilizer on restoration of acid field and improvement of tobacco production efficiency. Plant Nut Fert Sci 25(9):1577\u0026ndash;1587. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.11674/zwyf.18372\u003c/span\u003e\u003cspan address=\"10.11674/zwyf.18372\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoulding KWT (2016) Soil acidification and the importance of liming agricultural soils with particular reference to the United Kingdom. Soil Use Manage 32:390\u0026ndash;399. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/sum.12270\u003c/span\u003e\u003cspan address=\"10.1111/sum.12270\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrass I, Kubitza C, Krishna VV, Corre MD, Mu\u0026szlig;hoff O, P\u0026uuml;tz P, Drescher J, Rembold K, Ariyanti ES (2020) Trade-offs between multifunctionality and profit in tropical smallholder landscapes. Nat Commun 11(1):1186. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-020-15013-5\u003c/span\u003e\u003cspan address=\"10.1038/s41467-020-15013-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolland JE, Bennett AE, Newton AC, White PJ, McKenzie BM, George TS (2018) Liming impacts on soils, crops and biodiversity in the UK: a review. Sci Total Environ 610:316\u0026ndash;332. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.scitotenv.2017.08.020\u003c/span\u003e\u003cspan address=\"10.1016/j.scitotenv.2017.08.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang K, Ye C, Li D, Li Q, He C, Yang G (2021) Effects of control agents against tobacco root-knot nematode disease on bacterial community structure in rhizosphere soil of tobacco plants. Tob Sci Technol 54(11):9\u0026ndash;17 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJaskulska I, Jasklski D, Kobierski M (2014) Effect of liming on the change of some agrochemical soil properties in a long-term fertilization experiment. Plant Soil Environ 60(4):146\u0026ndash;150. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2478/intag-2014-0015\u003c/span\u003e\u003cspan address=\"10.2478/intag-2014-0015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang C, Shen J, Wang H, Li D, Li T, Wang W (2016) Effect of tobacco straw incorporation on rice yield and nutrient absorption and its substitute for potassium fertilizer. Chin J Appl Ecol 27(12):3969\u0026ndash;3976 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang C, Shen J, Yan Y, Zu C (2021) Straw return with dolomite application increase flue-cured tobacco leaf yield and quality. Int J Agric Biol 25:291\u0026ndash;297. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.17957/IJAB/15.1669\u003c/span\u003e\u003cspan address=\"10.17957/IJAB/15.1669\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Y, Liao P, Gestel N, Sun Y, Zeng Y, Huang S (2018) Lime application lowers the global warming potential of a double rice cropping system. Geoderma 325:1\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.geoderma.2018.03.034\u003c/span\u003e\u003cspan address=\"10.1016/j.geoderma.2018.03.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKou Z, Zhou X (2020) Variation of soil bacterial community in tobacco field after different years of continuous monocropping. J Plant Nut Fert 26(3):511\u0026ndash;521. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.11674/zwyf.19219\u003c/span\u003e\u003cspan address=\"10.11674/zwyf.19219\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLauber CL, Hamady M, Knight R, Fierer N (2009) Pyrosequencing-based assessment of soil pH as a predictor of soil bacterial community structure at the continental scale. Appl Environ Microb 75(15):5111\u0026ndash;5120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/aem.00335-09\u003c/span\u003e\u003cspan address=\"10.1128/aem.00335-09\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H, Dai M, Dai S, Dong X (2018) Current status and environment impact of direct straw return in China\u0026rsquo;s cropland-A review. Ecotox Environ Safe 159:193\u0026ndash;300. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ecoenv.2018.05.014\u003c/span\u003e\u003cspan address=\"10.1016/j.ecoenv.2018.05.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Zhang M, Lin Q, Chen Z, Xie G, Peng J (2005) Effects of interaction of potassium, calcium and magnesium on flue-cured tobacco growth and nutrient absorption. J Anhui Agric Univ 32(4):529\u0026ndash;533 (in Chinese). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.13610/j.cnki.1672-352x.2005.04.027\u003c/span\u003e\u003cspan address=\"10.13610/j.cnki.1672-352x.2005.04.027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Zhi X, Tang S (2013) Actinobacterial systematics in China: past, present and future. Microbiol China 40(10):1860\u0026ndash;1873 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Hu Y, Song D, Liang S, Qin X, Siddique KHM (2019) The effects of straw incorporation with plastic film mulch on soil properties and bacterial community structure on the loess plateau. Eur J Soil Sci 72:979\u0026ndash;994. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ejss.12912\u003c/span\u003e\u003cspan address=\"10.1111/ejss.12912\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao P, Huang S, van Gestel NC, Zeng Y, Wu Z, van Groenigen KJ (2018) Liming and straw retention interact to increase nitrogen uptake and grain yield in a double rice-cropping system. Field Crop Res 216:217\u0026ndash;224. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fcr.2017.11.026\u003c/span\u003e\u003cspan address=\"10.1016/j.fcr.2017.11.026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao P, Liu L, He Y, Tang G, Zhang J, Zeng Y (2020) Interactive effects of liming and straw incorporation on yield and nitrogen uptake in a double rice cropping system. Acta Agron Sinica 46(1):84\u0026ndash;92 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Bo, Xia H, Jiang CC, Muhammad R, Yang L, Chen YF, Fan XP, Xia XG (2022) 14 year applications of chemical fertilizers and crop straw effects on soil labile organic carbon fractions, enzyme activities and microbial community in rice-wheat rotation of middle China. \u003cem\u003eSci Total Environ\u003c/em\u003e, 841,156608. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.scitotenv.2022.156608\u003c/span\u003e\u003cspan address=\"10.1016/j.scitotenv.2022.156608\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Cui J, Liu H, Pan Q, He X (2022) Research progress of soil amelioration of acidified soil by soil amendments. J Environ Eng Technol 12(1):173\u0026ndash;184. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.12153/j.issn.1674-991X.20210119\u003c/span\u003e\u003cspan address=\"10.12153/j.issn.1674-991X.20210119\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Jiang B, Shen J, Zhu X, Yi W, Li Y (2021) Contrasting effects of straw and straw-derived biochar applications on soil carbon accumulation and nitrogen use efficiency in double-rice cropping systems. Agr Ecosyst Environ 311:107286. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.agee.2020.107286\u003c/span\u003e\u003cspan address=\"10.1016/j.agee.2020.107286\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Gao Y, Yang W, Liu J, Wang Z (2023) Community metagenomics reveals the processes of nutrient cycling regulated by microbial functions in soils with P fertilizer input. Plant Soil. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11104-023-05875-1\u003c/span\u003e\u003cspan address=\"10.1007/s11104-023-05875-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Liao P, Shao H, Liu J, Yang X, Wang J (2022b) Interactive effects of liming and straw return on apparent soil potassium balance in a double rice cropping system. Acta Agron Sinica 48(1):226\u0026ndash;237 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Jiang C, Shen J, Li T, Wang W, Cui Q (2017) Decomposition rates and nutrient release patterns of tobacco straw. Soils 49(3):543\u0026ndash;549 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMei XY, Gao JS, Yang XY, Huang J, Cai ZJ, Li DC, Wang BR, Liu KL, Xu MG, Zhang HM (2016) The response of soil potassium availability in rhizospheric soil of winter wheat to acidified and limed red soil. J Plant Nutr Fertilizer 22(6):1568\u0026ndash;1577 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNacke H, Th\u0026uuml;rmer A, Wollherr A, Will C, Hodac L, Herold N (2011) Pyrosequencing-based assessment of bacterial community structure along different management types in German forest and grassland soils. PLoS ONE 6(2):el7000. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0017000\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0017000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen B, Ma Z, Zhao B, Liu P, Zhang J (2022) Influences of split application and nitrification inhibitor on nitrogen losses, grain yield, and net income for summer maize production. Front Plant Sci 13:982373. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fpls.2022.982373\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2022.982373\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaleem M, Hu J, Jousset A (2019) More than the sum of its parts: Microbiome biodiversity as a driver of plant growth and soil health. Annu Rev Ecol Evol S 50:145\u0026ndash;168. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev-ecolsys-110617-062605\u003c/span\u003e\u003cspan address=\"10.1146/annurev-ecolsys-110617-062605\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchloss PD, Gevers D, Westcott SL (2011) Reducing the effects of PCR amplification and sequencing artifacts on 16S rRNA-Based studies. PLoS ONE 6(12):e27310. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0027310\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0027310\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao F, Jiang C, Zu C, Xue B, Xu J, Shen J (2012) Influence of sulfur and stillage fertilizer on the growth, quality of flue-cured tobacco, and pH in alkaline soil. Acta Bot Bor-Occident Sin 32:2479\u0026ndash;2485 (in Chinese). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3969/j.issn.1000-4025.2012.12.017\u003c/span\u003e\u003cspan address=\"10.3969/j.issn.1000-4025.2012.12.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen J, Zhang M, Liu G, Li X, Shi D, Wang Y (2021) Effect of lime nitrogen application on microbial flora of tobacco rhizosphere soil. Soil Fert Sci China 175\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.11838/sfsc.1673-6257.19562\u003c/span\u003e\u003cspan address=\"10.11838/sfsc.1673-6257.19562\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi H, Xiang B, Zhu Z, Zou M, Peng W, Yin Z (2023) Effects of quicklime application on bacterial community structure and metabolic function in acidified tobacco-planting soil. \u003cem\u003eTob. Sci. Technol.\u003c/em\u003e 2023, 56(5), 8\u0026ndash;16 (in Chinese). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.16135/j.issn1002-0861.2023.0064\u003c/span\u003e\u003cspan address=\"10.16135/j.issn1002-0861.2023.0064\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrecker T, Barnard RL, Niklaus PA, Scherer-Lorenzen M, Blumenbach JF (2015) Effects of plant diversity, functional group composition, and fertilization on soil microbial properties in experimental grassland. PLoS ONE 10(5). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0125678\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0125678\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu Y, Lv JL, Yu M, Ma ZH, Xi H, Kou CL (2020) Long-term decomposed straw return positively affects the soil microbial community. J Appl Microbiol 128:138\u0026ndash;150. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jam.14435\u003c/span\u003e\u003cspan address=\"10.1111/jam.14435\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuleiman AKA, Manoeli L, Boldo JT, Pereira MG, Roesch LFW (2013) Shifts in soil bacterial community after eight years of land-use changes. Syst Appl Microbiol 36(2):137\u0026ndash;144. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.syapm.2012.10.007\u003c/span\u003e\u003cspan address=\"10.1016/j.syapm.2012.10.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeng K, Zhang Q, Peng J, Chen Q, Tian M, Chao J (2022) Effects of reductive soil disinfestation on chemical properties and microbial community structure of soils before and after tobacco planting. Tob Sci Technol 55(4):9\u0026ndash;19 (in Chinese). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.16135/j.issn1002-0861.2021.0607\u003c/span\u003e\u003cspan address=\"10.16135/j.issn1002-0861.2021.0607\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThidar M, Gong D, Mei X, Gao L, Li H, Hao W (2020) Mulching improved soil water, root distribution and yield of maize in the Loess Plateau of Northwest China. Agr Water Manage 241:106340. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.agwat.2020.106340\u003c/span\u003e\u003cspan address=\"10.1016/j.agwat.2020.106340\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian BY, Wang CX, LV RR (2014) Community structure and succession regulation of fungal consortia in the lignocellulose-degrading process on natural biomass. Sci World J 845721. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2014/845721\u003c/span\u003e\u003cspan address=\"10.1155/2014/845721\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTong W, Yang M, Wang H, Feng X, Zhang L, Zhou B (2021) Effects of tillage methods on fungal community structure in rhizosphere soil of flue-cured tobacco in mountainous tobacco fields. Acta Tab Sinica 27(1):56\u0026ndash;63 (in Chinese). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.16472/j.chinatobacco.2020.t0064\u003c/span\u003e\u003cspan address=\"10.16472/j.chinatobacco.2020.t0064\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValentinuzzi F, Mimmo T, Cesco S (2015) The effect of lime on the rhizospheric processes and elemental uptake of white lupin. Environ Exp Bot 118:85\u0026ndash;94. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.envexpbot.2015.06.010\u003c/span\u003e\u003cspan address=\"10.1016/j.envexpbot.2015.06.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWagg C, Dudenh\u0026ouml;ffer JH, Widmer F, Heijden MGA (2018) Linking diversity, synchrony and stability in soil microbial communities. Funct Ecol 32(5):1280\u0026ndash;1292. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1365-2435.13056\u003c/span\u003e\u003cspan address=\"10.1111/1365-2435.13056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang N, Li JY, Xu RK (2009) Use of various agricultural by -products to study the pH effects in an acid tea garden soil. Soil Use Manage 25:128\u0026ndash;132. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1475-2743.2009.00203.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1475-2743.2009.00203.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang N, Xu RK, Li JY (2011) Amelioration of an acid Ultisol by agricultural by-products. Land Degrad Dev 22:513\u0026ndash;518. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ldr.1025\u003c/span\u003e\u003cspan address=\"10.1002/ldr.1025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei J, Wang Z, Xu T, Wang J, Li B, Ao J (2021) Effects of straw mulching and film-uncovering on the bacterial community of sloping farmland soil and tobacco leaf quality. Chin J Soil Sci 52(1):82\u0026ndash;89 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiong J, Gong YJ, Chen ZQ, Lei SN, Li Y, Zhang T, Tian BY (2018) Comparative Analysis on Population Composition, Structure and Diversity of Species Involved in Degradation of Different Lignocellulosic Materials. J Northeast Agricultural Sci 43(5):27\u0026ndash;33 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu Y, Fang Z, Lu X, Hao L (2017) Effects of starane on maize soil bacterial diversity analyzed by high-throughput sequencing technology. Acta Microbiol Sinica 57(7):985\u0026ndash;993 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan H, Yan H, Ji S, Han M, Lei J, Yan K (2012) Correlation analysis between appearance quality and sensory quality of Henan flue-cured tobacco. Tob Sci Technol (7), 17\u0026ndash;23 (in Chinese).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan N, Guo D, Yao Z, Dou Y, Liu X, Zhang Z (2016) Effects of tobacco stalk returning on soil bacterial diversity. \u003cem\u003eActa Agric. Jiangxi\u003c/em\u003e 28(5), 40\u0026ndash;45 (in Chinese). doi: 0.3969/j.issn.1001-8581.2016.05.009\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang H, Ma J, Rong Z, Zeng D, Wang Y, Hu S (2019) Wheat straw return influences nitrogen-cycling and pathogen associated soil microbiota in a wheat-soybean rotation system. Front Microbiol 10:1811. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2019.01811\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2019.01811\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao C, Zhang J, Lu Y, Ma M, Yao Y (2017) Natural grass improves the composition and structure of the bacterial community in the soil of apple orchards. J Beijing Uni Agric 32(4):36\u0026ndash;41 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang M, Muhammad R, Zhang L, Xia H, El-desouki Z, Jiang CC (2019) Response of fungal communities in different soils to biochar and chemical fertilizers under simulated rainfall conditions. Sci Total Environ 691:654\u0026ndash;663. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.scitotenv.2019.07.151\u003c/span\u003e\u003cspan address=\"10.1016/j.scitotenv.2019.07.151\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Xu M, Shi F (2020) Impact of typical agricultural land use on the characteristics of soil microbial communities in the Nyingchi region of southeastern Tibet. J Agro-Environ Sci 39(2):331\u0026ndash;342 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao F, Zhao M, Wang Y, Pang F (2017) Biodiversity of bacteria and fungi in rhizosphere of strawberry with different continuous cropping years. Microbiol China 44(6):1377\u0026ndash;1386 (in Chinese)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao J, Zhang R, Xue C, Xun W, Sun L, Xu Y (2014) Pyrosequencing reveals contrasting soil bacterial diversity and community structure of two main winter wheat cropping systems in china. Microb Ecol 67(2):443. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00248-013-0322-0\u003c/span\u003e\u003cspan address=\"10.1007/s00248-013-0322-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao J, Zhou X, Jiang A, Fan J, Lan T, Zhang J (2018) Distinct impacts of reductive soil disinfestation and chemical soil disinfestation on soil fungal communities and memberships. Appl Microbiol Biot 102(17):7623\u0026ndash;7634. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00253-018-9107-1\u003c/span\u003e\u003cspan address=\"10.1007/s00253-018-9107-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Y, Guo W, LI X, Zhou X, Wang X, Guo J (2018) Correlation between free amino acids and sensory quality for flue-cured tobacco of fresh flavor type tobacco-planting areas. Tob Sci Technol 51(11):28\u0026ndash;35 (in Chinese). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.16135/j.issn1002-0861.2017.0557\u003c/span\u003e\u003cspan address=\"10.16135/j.issn1002-0861.2017.0557\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou C, Li Y, Huang W, Zhao G, Pu G, Su J (2018) Rotation and manure amendment increase soil macro-aggregates and associated carbon and nitrogen stocks in flue-cured tobacco production. Geoderma 325:49\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.geoderma.2018.03.017\u003c/span\u003e\u003cspan address=\"10.1016/j.geoderma.2018.03.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"environmental-science-and-pollution-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"espr","sideBox":"Learn more about [Environmental Science and Pollution Research](https://www.springer.com/journal/11356)","snPcode":"11356","submissionUrl":"https://submission.nature.com/new-submission/11356/3","title":"Environmental Science and Pollution Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Tobacco straw return, Lime, Microorganism, Tobacco leaf quality, Soil fertility","lastPublishedDoi":"10.21203/rs.3.rs-3450152/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3450152/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSoil amendment is an important strategy to improve soil quality and crop yield. During 2014\u0026ndash;2019, we investigated the effects of tobacco straw return with lime on soil nutrients, soil microbial community structure, tobacco leaf yield and quality in southern Anhui, China. A field experiment was conducted in four treatments: straw removed (CK), straw return (St), straw return with dolomite (St\u0026thinsp;+\u0026thinsp;D), and straw return with lime (St\u0026thinsp;+\u0026thinsp;L). Results showed that after five years of continuous treatment, the St\u0026thinsp;+\u0026thinsp;L significantly increased the soil pH by 16.9%, and the contents of soil alkaline nitrogen (N) and available potassium (K) by 17.2% and 23.0%, respectively, compared with the CK. Moreover, the St\u0026thinsp;+\u0026thinsp;L significantly increased tobacco leaf yield (24.0%) and the appearance (9.1%) and sensory (5.9%) quality of flue-cured tobacco leaves. The addition of soil conditioners (straw, dolomite, and lime) resulted in an increase in both the total reads and effective sequences of soil microorganisms. Bacterial diversity was found to be more sensitive to changes in the external environment compared to soil fungi. The application of soil amendments (lime and straw) has been shown to promote the growth of beneficial microorganisms in the soil. Additionally, bacterial species face greater competition and limited availability of resources for survival compared to fungi. Various analytical techniques, such as RDA, correlation analysis, and network analysis, were employed to investigate this finding: soil microorganisms are significantly influenced by the presence of AK, AN and pH contents. These findings can provide an effective method for improving the quality of flue-cured tobacco leaves and guiding the amelioration of acidic soil in regions where tobacco-rice rotation is practiced.\u003c/p\u003e","manuscriptTitle":"Influences of tobacco straw return with lime on microbial community structure of tobacco-planting soil and tobacco leaf quality","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-11-21 21:26:38","doi":"10.21203/rs.3.rs-3450152/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major Revision","date":"2024-03-08T01:07:17+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2023-12-03T15:16:50+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2023-11-18T04:22:30+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"Environmental Science and Pollution Research","date":"2023-11-09T13:28:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-10-24T05:07:40+00:00","index":"","fulltext":""},{"type":"submitted","content":"Environmental Science and Pollution Research","date":"2023-10-18T21:06:16+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"environmental-science-and-pollution-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"espr","sideBox":"Learn more about [Environmental Science and Pollution Research](https://www.springer.com/journal/11356)","snPcode":"11356","submissionUrl":"https://submission.nature.com/new-submission/11356/3","title":"Environmental Science and Pollution Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"b8a94109-17bc-4284-8a04-0e0694b4d4f2","owner":[],"postedDate":"November 21st, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-05-16T03:49:32+00:00","versionOfRecord":{"articleIdentity":"rs-3450152","link":"https://doi.org/10.1007/s11356-024-33241-w","journal":{"identity":"environmental-science-and-pollution-research","isVorOnly":false,"title":"Environmental Science and Pollution Research"},"publishedOn":"2024-04-15 03:49:32","publishedOnDateReadable":"April 15th, 2024"},"versionCreatedAt":"2023-11-21 21:26:38","video":"","vorDoi":"10.1007/s11356-024-33241-w","vorDoiUrl":"https://doi.org/10.1007/s11356-024-33241-w","workflowStages":[]},"version":"v1","identity":"rs-3450152","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3450152","identity":"rs-3450152","version":["v1"]},"buildId":"FbvkV6FR0MCFSLy54lSbu","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}