An antagonistic epigenetic mechanism regulating gene expression in pollen revealed through single-nucleus multiomics

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
Full text 132,288 characters · extracted from preprint-html · click to expand
An antagonistic epigenetic mechanism regulating gene expression in pollen revealed through single-nucleus multiomics | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results An antagonistic epigenetic mechanism regulating gene expression in pollen revealed through single-nucleus multiomics Colette L. Picard , Lucia Ichino , Tyler J. Buckley , Brandon A. Boone , Jaewon Yun , Kevin D. Abuhanna , Yi Zhang , Noah J. Behrendt , Su May Lei Soe , Chongyuan Luo , Steven E. Jacobsen doi: https://doi.org/10.1101/2025.10.13.682236 Colette L. Picard 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lucia Ichino 1 Molecular Biology Institute, University of California Los Angeles , Los Angeles, CA 90095, USA 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tyler J. Buckley 1 Molecular Biology Institute, University of California Los Angeles , Los Angeles, CA 90095, USA 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Brandon A. Boone 1 Molecular Biology Institute, University of California Los Angeles , Los Angeles, CA 90095, USA 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA 3 Department of Chemistry and Physics, Western Carolina University , Cullowhee, NC, 28723, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jaewon Yun 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kevin D. Abuhanna 4 Department of Human Genetics, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yi Zhang 4 Department of Human Genetics, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Noah J. Behrendt 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Su May Lei Soe 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Chongyuan Luo 4 Department of Human Genetics, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Steven E. Jacobsen 1 Molecular Biology Institute, University of California Los Angeles , Los Angeles, CA 90095, USA 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA 5 Howard Hughes Medical Institute (HHMI) , UCLA, Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: jacobsen{at}ucla.edu Abstract Full Text Info/History Metrics Supplementary material Data/Code Preview PDF Abstract Arabidopsis MBD5, MBD6, and MBD7 are CG-specific methyl-readers with opposite functions: MBD5 and MBD6 (MBD5/6) repress methylated loci in pollen vegetative nuclei (VN), while MBD7 prevents transgene silencing, possibly by promoting DNA demethylation. Here we show that loss of MBD7 rescues transcriptional defects at a large subset of MBD5/6-bound loci. Using simultaneous profiling of DNA methylation and transcription in single pollen nuclei, we found that MBD5/6-bound loci that are actively demethylated in immature VN lose additional methylation in mbd5/6 , prior to transcriptional derepression. A subset of these loci is also bound by MBD7, correlating with demethylation and transcriptional derepression in mbd5/6 that are both reversed by loss of MBD7 . Conversely, ectopically recruiting the MBD7 complex to MBD5/6 targets causes partial demethylation and upregulation. We propose that MBD5/6 maintain silencing in VN in part by preventing the MBD7 complex from enhancing the active demethylation that occurs during VN maturation. Main Text DNA methylation is an epigenetic modification associated with transcriptional silencing in eukaryotic organisms 1 – 3 . DNA methylation can repress transcription by interfering with transcription factor binding or by recruiting specific repressors to chromatin 1 , 3 . In Arabidopsis thaliana , two CG-specific DNA methylation readers, MBD5 and MBD6, act redundantly to maintain silencing of a group of transposable elements and promoter-methylated genes 4 . MBD5 and MBD6 interact with α-crystallin domain (ACD) containing protein ACD15 via their StkyC domains 5 . ACD15 in turn dimerizes with ACD21, which recruits the J-domain protein SILENZIO (SLN) 5 . All members of the protein complex are required for silencing 5 . Although MBD5, MBD6, and their interactors are expressed throughout the plant, transcriptional derepression in mbd5 mbd6 double mutants ( mbd5/6 ) is mostly restricted to the vegetative nucleus (VN) of pollen 6 . The VN has a distinctive epigenetic state, characterized by loss of CG methylation due to active demethylation primarily by DEMETER (DME) and to a lesser extent ROS1, loss of repressive histone modification H3K9me2, and chromatin decondensation 7 – 14 . The VN specificity of mbd5/6 derepression suggests that MBD5/6 are uniquely important in this altered environment, although the mechanism remains unclear 6 . Unlike MBD5/6, MBD7 prevents silencing of transgenes and a limited number of endogenous genes 15 – 18 . MBD7 also recruits a pair of ACD proteins via its StkyC domain: INCREASED DNA METHYLATION 3 (IDM3) (or LIL) and IDM2, which in turn interact with the histone acetyltransferase IDM1 15 – 18 . In seedlings, loss of each component of the MBD7 complex causes the same mild DNA hypermethylation and transcriptional downregulation phenotype 15 – 23 . The MBD7 complex was proposed to help promote the activity of DNA demethylases at CG-dense methylated DNA, possibly via the histone acetyltransferase activity of IDM1, leading to loss of DNA methylation and increased expression 18 , 20 – 23 . Alternatively, since DNA methylation changes in MBD7 complex mutants are modest, it has also been proposed that MBD7 may function purely downstream of DNA methylation 15 . It is also possible that the function of the MBD7 complex is more pronounced in specific tissues. MBD5/6 and MBD7 all bind genomic regions characterized by a high density of methylated CG dinucleotides 4 , 18 , raising the question of how these two complexes functionally interact. Here we report that loss of MBD7 rescues transcriptional derepression in mbd5/6 VN at >50% of loci. Using simultaneous profiling of DNA methylation and RNA expression in single pollen nuclei, we show that CG methylation is decreased in mbd5/6 pollen specifically at sites demethylated by DME/ROS1 in the VN, and this occurs prior to transcriptional derepression. Both the methylation loss and the transcriptional derepression are rescued in mbd5 mbd6 mbd7 (mbd5/6/7 ) at a subset of MBD5/6 targets that are more densely methylated and particularly enriched in MBD7 ChIP-seq signal. Thus, MBD5 and MBD6 prevent excessive demethylation in the VN at shared DME/ROS1 and MBD7 targets by antagonizing MBD7. MBD7 binding to chromatin is not directly affected by MBD5/6. We therefore propose that the expression levels of these methylated transcripts are in part regulated by the ratio of activating to repressing MBD complexes on chromatin. Consistent with this, shifting the ratio towards activation by ectopically recruiting the MBD7 complex to MBD5/6-bound loci was sufficient to partially overcome MBD5/6-mediated silencing and cause mild transcriptional upregulation and DNA demethylation. This work also highlights the power of using single-nucleus simultaneous transcriptome and methylome sequencing in plants to probe methylation dynamics at a high resolution, revealing novel antagonistic interactions between the MBD5/6 and MBD7 complexes. Results Loss of MBD7 partially rescues the mbd5/6 transcriptional derepression phenotype To investigate the relationship between MBD5, MBD6, and MBD7, we generated an mbd5/6/7 triple mutant by CRISPR/Cas9 ( Extended Data Fig. 1a ) and performed RNA-seq in mature pollen ( Supplementary Table 1 ). Using our recently updated pollen transcriptome annotation 6 , we identified 202 significantly upregulated transcripts in mbd5/6 pollen ( Fig. 1a , Supplementary Table 2 ), including genes, transposons, and novel uncharacterized transcripts. This list was highly consistent between two independent experiments and with published data 6 ( Extended Data Fig. 1b-c ). Nearly all of the mbd5/6 upregulated transcripts were either transposons (TEs) or had TE-like DNA methylation patterns ( Extended Data Fig. 1a-c ), consistent with MBD5/6 primarily regulating methylated loci. This suggests that MBD5 and MBD6 primarily function to repress TEs in pollen. Only 37 significantly differentially expressed transcripts were found in the mbd7 mutant, most of which (n=29) were downregulated ( Fig. 1a ). This is consistent with the previously described role of MBD7 as an inhibitor of silencing with few endogenous targets 15 – 18 . Download figure Open in new tab Figure 1: MBD7 activates loci repressed by MBD5 and MBD6 in pollen. A) VENN diagrams showing the intersection of significantly upregulated and downregulated transcripts in mature pollen by RNA-seq in indicated mutants. B) Distribution of expression change (log2 fold-change in indicated mutant over wild-type control) in mature pollen for the indicated groups of differentially expressed transcripts. P-value: paired t-test. C) Examples of genes repressed by MBD5/6, and either rescued, partially rescued, or not rescued by loss of MBD7 (see D). Upper tracks: wild-type whole-genome bisulfite-seq in mature pollen. Lower tracks: RNA-seq in mature pollen. D) Heatmap of pollen RNA-seq expression for the 202 transcripts upregulated in mbd5/6 . TPM: transcripts per million, scaled by row. E) Like B, but over mbd5/6 upregulated transcripts rescued, partially rescued, or not rescued by mbd7 . P-value: paired t-test. Upregulation of many mbd5/6 upregulated transcripts was rescued in the mbd5/6/7 triple mutant ( Fig. 1a-c ). Using hierarchical clustering of TPM estimates across our pollen RNA-seq dataset ( Fig. 1d ), we classified the mbd5/6 upregulated transcripts based on extent of rescue: 101 (50%) transcripts were mostly restored to wild-type expression levels in mbd5/6/7 (“rescued”), 35 (17%) transcripts were partially restored (“partially rescued”), and 53 (26%) transcripts had similar expression levels in mbd5/6 and mbd5/6/7 (“not rescued”) ( Fig. 1c-e , Extended Data Fig. 1d ). An additional 13 mbd5/6 upregulated transcripts that did not fall cleanly into these three categories were omitted from this analysis. Most mbd5/6 upregulated transcripts were not misregulated in mbd7 alone ( Fig. 1d ). The few significantly downregulated transcripts in mbd7 were generally only mildly downregulated in mbd7 , strongly upregulated in mbd5/6 , and rescued in mbd5/6/7 ( Fig. 1b , Extended Data Fig. 1e ). This suggests that MBD7 primarily promotes the expression of MBD5/6 targets, and that MBD7 can activate these targets much more strongly in mbd5/6 mutants than in wild-type. Together, our data indicate that MBD5/6 and MBD7 regulate an overlapping set of transcripts in pollen, and function antagonistically at these loci. MBD5/6 and MBD7 prefer different subsets of CG-methylated loci To investigate the interaction between MBD5/6 and MBD7 at target loci, we performed ChIP-seq of three independent lines of flag-tagged MBD7 in mbd7 (MBD7-Flag) alongside two independent lines of flag-tagged MBD6 in mbd6 (MBD6-Flag) ( Extended Data Fig. 2a , Supplementary Table 1 ) using unopened flower buds. Since MBD5 and MBD6 are part of the same complex, they highly colocalize by ChIP-seq, 4 and our MBD6-Flag ChIP-seq data were consistent with published MBD5 and MBD6 ChIP-seq data 4 ( Extended Data Fig. 2b ). Additionally, both MBD6 and MBD7 were correlated with DNA methylation density with a strong preference for CG over non-CG methylation, consistent with previous reports, 4 , 18 ( Extended Data Fig. 2c ). Since MBD6 and MBD7 showed a shared preference for regions with high CG methylation (mCG) density, we predicted that MBD6 and MBD7 would bind similar sites in the genome. We quantified this by identifying peaks of MBD6 and MBD7 occupancy and then measuring average ChIP-seq signal for all samples across the union of all MBD6 and MBD7 peaks ( Fig. 2a-b ). As predicted, MBD6 and MBD7 occupied a strongly overlapping set of sites in wild-type, with similar preference for high mCG density ( Fig. 2a-b , Extended Data Fig. 2c ). However, while both MBD6 and MBD7 were enriched at most of these regions, they were also anticorrelated: the peaks with the highest MBD6 occupancy tended to have the lowest MBD7 occupancy and vice-versa ( Fig. 2a-b ). This suggests that while both MBD5/6 and MBD7 have affinity for high mCG density, other factors help fine-tune their localization. Download figure Open in new tab Figure 2: MBD5/6 and MBD7 prefer different subsets of CG-methylated loci. A) (Left) Heatmaps of methylation density (sum of % methylation across all cytosines in indicated sequence context) in 400 bp windows centered on the midpoint of the peaks shown at right. Each column was normalized independently. (Right) Heatmaps of MBD6-Flag signal and MBD7-Flag signal (log 2 of IP over no-FLAG control) over the union of all MBD6 and MBD7 peaks. Each column is an independent transgenic line in the indicated mutant background. All heatmaps in (A) share same row order, which was sorted based on the MBD7-Flag T2-2 sample (third column). The top 10% (MBD7-dominant), bottom 10% (MBD6-dominant), and middle 10% (mixed) of peaks are indicated on the right. B) Example browser tracks showing the location of MBD6/7 union peaks (top), with MBD7-dominant, MBD6-dominant, and mixed peaks labeled, as well as MBD6 and MBD7 ChIP-seq signal (this study; log of IP over no-FLAG control), % DNA methylation data from inflorescences with unopened flower buds in the CG, CHG and CHH context 25 , gene annotations (black = forward strand, yellow = reverse), transposon (TE) annotations, and peak coordinates. Genes and TEs are from the araport11 annotation. 41 For % DNA methylation, both Col replicates from 25 were pooled, and only sites with 5 or more coverage are shown; small negative value (−10%) corresponds to sites that had coverage, but no methylation, to distinguish from missing data/sites lacking cytosines. H3K9me2 42 and PolV (NRPE1) 43 ChIP-seq signal also shown. C) (left) Representative example image of a root nucleus expressing pMBD7::MBD7-YFP and incubated with DAPI to stain chromocenters. (right) Percent of foci assayed (n=120 for each condition) where YFP and RFP signal overlapped vs. did not overlap. Left bar shows co-expression of MBD6-RFP and MBD7-YFP, right bar shows control expressing MBD6-RFP with MBD6-YFP. See Extended Data 2f for example images. D) Percent of MBD7-dominant, mixed, and MBD6-dominant peaks from (A) overlapping annotated transcripts classified as either gene body methylated (gbM, mCG only) or TE-like methylated (teM, mC in all contexts). Annotations were from the pollen reannotation in Ichino et al. 2022. 6 E) Metaplots of various epigenetic marks (DNA methylation 25 , NRPE1 43 , histone H1 and H3K9me2 42 , histone H3 and H3K4me3 44 , accessibility by ATAC-seq 45 ), as well as RNA-seq 4 , over the MBD7-dominant, MBD6-dominant, and mixed peaks labeled in A. F) Smoothed distribution of the location of MBD7-dominant, MBD6-dominant, and mixed peaks across Chromosome 4. Approximate location of the pericentromere shown as a grey bar. G) Metaplots of MBD6 and MBD7 ChIP-seq signal (log 2 of IP over no-FLAG control) over pollen mbd5/6 upregulated transcripts that were rescued, partially rescued, and not rescued by loss of MBD7 (see clustering in Fig. 1d ). Control transcripts are an equal number of random genes matched for expression level and length. Plotted values represent the average of multiple independent transgenic lines (N=2 for MBD6-Flag, N=3 for MBD7-Flag). To understand these differences in MBD5/6 and MBD7 occupancy, we first explored the subcellular localization of these proteins. In roots, which are highly amenable to confocal live cell imaging of fluorescently-tagged proteins, MBD5 and MBD6 form strong nuclear foci that depend on interactors ACD15 and ACD21 and overlap chromocenters 5 . MBD7 also interacts with a pair of ACD proteins, IDM3 and IDM2, and can form nuclear foci in vivo when overexpressed 16 , 24 . We therefore investigated the interaction between fluorescently-tagged MBD6 and MBD7 in roots. We first confirmed that MBD7 fused to YFP also formed nuclear foci in roots when expressed from its native promoter ( Fig. 2c ). Unlike MBD6, 5 MBD7 foci only partially overlapped chromocenters and were only partially abolished in the absence of the MBD7 ACD protein interactor IDM3 ( Fig. 2c , Extended Data Fig. 2d-e ). We next co-expressed MBD6-RFP and MBD7-YFP in wild-type plants. While MBD6 and MBD7 foci often overlapped, as expected given their similar affinity for mCG density ( Extended Data Fig. 2c ) and overlapping occupancy by ChIP ( Fig. 2a ), MBD6 and MBD7 foci were much less likely to overlap than a control co-expressing MBD6-RFP and MBD6-YFP ( Fig. 2c , Extended Data Fig. 2f ). This is consistent with MBD5/6 and MBD7 having distinct binding patterns despite a shared set of target sites. We next focused on three groups of MBD6/7 shared peaks by ChIP-seq: the top 10% of peaks bound by MBD7, which tended to have lower MBD6 occupancy (MBD7-dominant peaks), the bottom 10% of peaks bound by MBD7, which had high MBD6 occupancy (MBD6-dominant peaks), and the middle 10% of peaks, which are bound by both MBD6 and MBD7 but with intermediate enrichment (mixed peaks) ( Fig. 2a-b ). Comparing these peaks to published inflorescence DNA methylation data, 25 we found that all three sets of peaks were enriched over regions with elevated DNA methylation ( Fig. 2a-b,d-e ), as expected given that both MBD6 and MBD7 binding correlates with mCG density ( Extended Data Fig. 2c ). However, while CG methylation density at MBD7-dominant peaks was very similar to MBD6-dominant peaks, CHG and CHH methylation (mCHG and mCHH, respectively) was largely absent in MBD7-dominant peaks ( Fig. 2a,b,d-e ). This was reminiscent of ‘gene body methylation’ (gbM), which commonly occurs over genes and is characterized by elevated mCG alongside absence of mCHG and mCHH. 26 By contrast, MBD6-dominant peaks tended to be in regions strongly methylated in all sequence contexts, which is more common over silent TEs and in deep heterochromatin ( Fig. 2a,b, d-e ). Consistent with this, MBD6-dominant peaks were highly enriched in the pericentromere, which is mostly silent heterochromatin, whereas MBD7-dominant and mixed peaks were strongly depleted from the pericentromere and enriched in the chromosome arms, which are gene rich ( Fig. 2f ). MBD6-dominant peaks were also associated with very high levels of H3K9me2, but low H3K4me3, accessibility, and transcription ( Fig. 2e ). MBD7-dominant peaks instead were much more likely to be in or near accessible chromatin, characterized by elevated DNA accessibility, H3K4me3, H3K27ac, and transcription, and depleted H3K9me2 ( Fig. 2e-f , Extended Data Fig. 3a ). However, MBD7-dominant peaks were strongly enriched for H1 directly over the peak, despite peaks occurring in regions that are broadly depleted for H1, whereas MBD6-dominant peaks were in regions of broad H1 enrichment with local depletion of H1 over the peak ( Fig. 2e ). Together, these data indicate that MBD6 preferentially binds regions of very high DNA methylation within broad heterochromatic domains, while MBD7 prefers euchromatic gene body methylation. This is broadly consistent with the MBD5/6 complex functioning in transcriptional repression and the MBD7 complex in transcriptional activation. There are multiple possible explanations for the difference in MBD6 and MBD7 occupancy. One possibility is that the MBD5/6 complex affects MBD7 binding directly, potentially by occupying sites that could otherwise be bound by MBD7. To investigate this, we performed ChIP-seq of MBD7-Flag transformed into both the mbd5/6/7 and mbd7;sln mutant backgrounds (MBD7-Flag mbd5/6 and MBD7-Flag sln respectively) ( Extended Data Fig. 2a ). Both mbd5/6 and sln disrupt MBD5/6 complex function, but in sln MBD5 and MBD6 are still available to bind to their DNA targets. 4 Across two independent MBD7-Flag mbd5/6 lines and three independent MBD7-Flag sln lines, we saw no substantial difference in MBD7 affinity for mCG density ( Extended Data Fig. 2c ), or occupancy over either mbd7 downregulated transcripts ( Extended Data Fig. 3b ), MBD6/7 union peaks ( Extended Data Fig. 3c ), or mbd5/6 upregulated transcripts ( Extended Data Fig. 3d ). This suggests that the MBD5/6 complex itself does not directly affect MBD7 localization. Instead, we hypothesize that MBD7 cannot easily penetrate deep heterochromatin, whereas MBD5/6, as a repressive complex, may be able to access these sites more easily. We next examined MBD6 and MBD7 occupancy over loci upregulated in mbd5/6 pollen. All mbd5/6 upregulated loci, regardless of rescue by mbd7, were strongly enriched for MBD6 over the entire locus and particularly at the TSS ( Fig. 2g , Extended Data Fig. 3d ), suggesting these loci are mostly direct MBD5/6 targets. However, MBD7 occupancy over these transcripts was variable: while all mbd5/6 upregulated transcripts showed some MBD7 enrichment compared to control transcripts, particularly at the TSS, mbd7 “rescued” transcripts ( Fig. 1d ) were substantially more likely to be bound by MBD7 than genes that were only partially or not at all rescued by loss of MBD7 ( Fig. 2g , Extended Data Fig. 3d ). MBD6 occupancy was also lower over mbd7 downregulated loci than over mbd5/6 upregulated loci, consistent with the general anticorrelation between MBD6 and MBD7 binding ( Extended Data Fig. 3e ). We concluded that although most sites strongly bound by MBD5/6 are only weakly bound by MBD7 and vice-versa ( Fig. 2a ), a subset of MBD5/6 targets are also strongly bound by MBD7, and these are upregulated by MBD7 in the absence of mbd5/6 . Single-nucleus multi-omics reveals DNA methylation dynamics in developing pollen nuclei MBD7 has been proposed to enhance the expression of methylated loci by facilitating active DNA demethylation 16 – 18 . To understand how MBD5/6 and MBD7 are interacting at their shared targets, we sought to test whether MBD7 promotes DNA demethylation at mbd5/6 upregulated transcripts in pollen. No loss of DNA methylation in mbd5/6 was previously detected in whole floral tissue 4 . However, the transcriptional derepression in mbd5/6 occurs primarily in the VN of pollen 6 , suggesting the same could be true of DNA methylation changes. To examine the effect of loss of MBD5/6 on DNA methylation in pollen nuclei at high resolution, we performed simultaneous single-nucleus methylcytosine and transcriptome profiling of single pollen nuclei (snmCT-seq) 27 ( Fig. 3a ). We obtained a total of 8,284 pollen nuclei across two independent experiments, 4,150 from Col and 4,134 from mbd5/6 ( Supplementary Tables 1, 3 ). Using Seurat 28 , we identified clusters of nuclei based on transcriptional patterns and assigned cluster identities based on known marker genes 6 , 29 – 31 ( Fig. 3b-c , Extended Data Fig. 4a-b , Supplementary Table 3 ). This analysis identified all the expected pollen cell types 32 and was consistent with clusters that we had previously identified by 10x snRNA-seq in pollen 6 : microspore nuclei (MN), generative nuclei (GN), sperm nuclei (SN), and a progression of clusters of vegetative nuclei (VN), spanning from immediately post-mitosis I (VN1) to mature (VN5) ( Fig. 3b-c , Extended Data Fig. 4c ). Two additional clusters with intermediate expression patterns when compared to the published dataset were named “MN to VN” and “VN1 to 2” based on the two most similar published clusters ( Fig. 3b-c , Extended Data Fig. 4c ). The VN clusters formed a clear developmental trajectory from microspores (MN) transitioning into VN (MN to VN), to immature VN (VN1-VN3) to mature VN (VN4-VN5), as previously observed 6 ( Fig. 3b , arrow). MBD7 was highly and specifically expressed in immature VN (primarily clusters VN1, VN1to2), as was DME, consistent with reports that DME is required for demethylation in VN ( Extended Data Fig. 4d ) 13 . MBD5 and MBD6, while more lowly expressed, were also enriched in immature VN ( Extended Data Fig. 4d-e ). Linker histone H1 has also been reported to be depleted in the VN, which is thought to help promote DNA demethylation and loss of chromatin condensation. 11 Consistent with this, in both our previous snRNA-seq data 6 and in the snmCT-seq dataset, H1 expression is present in the MN but largely absent from VN clusters ( Extended Data Fig. 4f ). Expression of the MBDs, H1, DME, and other DNA methylation-related genes examined was not substantially affected in mbd5/6 ( Extended Data Fig. 4d-f ). Overall, the transcriptome data from snmCT-seq was highly consistent with previous 10x single nuclei data 6 , highlighting the robustness of both methods for detecting different nuclei types in pollen. Download figure Open in new tab Figure 3: snmCT-seq reveals DNA methylation dynamics in developing pollen nuclei. A) Overview of pollen isolation and snmCT-seq protocol (see methods) 6 , 27 . (B) UMAP of pollen nuclei, showing developmental trajectories from microspore nuclei (MN) into sperm nuclei (SN) and vegetative nucleus (VN). A subset of likely doublets of VN and SN, which may stick together during sorting, are separated into their own cluster (”VN and SN”) (see methods, Supplementary Figure 2 ). C) Expression of marker genes for different pollen nuclei types, previously identified by 10x 6 ; most of these markers have also been independently validated in other studies. The three VN markers are for early post-mitotic (MSP2), mid-stage (VEX1) and late-stage (VCK) VN. D) Diagram of approximate relative DNA methylation levels during development from vegetative tissue to MN, and finally to mature SN and VN. Grey box shows dynamics revealed in this study. Published data from FACS-sorted populations of MN and mature VN and SN were used for other parts of the diagram 7 , 12 , 13 , and are also consistent with our data. E) Distribution of average per-nucleus snmCT-seq methylation for nuclei assigned to each cluster in (B). Average methylation was computed over regions hypomethylated in the CG context in VN (VN CG hypo DMRs, left) and hypermethylated in the CHH context in VN (VN CHH hyper DMRs, right). These regions were previously identified from bisulfite-sequencing of purified FACS-sorted VN populations 13 . The red horizontal line marks the median methylation level in MN, for reference. Next, we inspected DNA methylation levels in pollen nuclei in wild-type ( Supplementary Table 4 ). A preliminary dimensionality reduction analysis of the snmCT-seq methylation data alone, aggregated across 25 kb bins genome-wide, showed clear separation of VN nuclei from the other nuclei types, suggesting that the VN adopts a particularly unique methylation state ( Extended Data Fig. 5a-c ), consistent with prior reports. 7 , 12 , 13 Other nuclei types were generally not well separated, suggesting single-nuclei methylomes alone are insufficient to identify most pollen nuclei types, at least with the level of resolution possible from low-coverage single-nucleus data. Based on published bisulfite sequencing of FACS-purified populations of pollen nuclei, MN methylation levels largely resemble somatic nuclei but are decreased in the CHH context ( Fig. 3d ). 12 The methylome of SN resembles MN, with a small increase in CG methylation and decrease in CHG and CHH methylation ( Fig. 3d , Extended Data Fig. 6a) 7 , 12 , 13 . The mature VN is strongly hypermethylated in the CHH context relative to MN, with minor CHG methylation increases in the pericentromere, while simultaneously undergoing some loss of CG and CHG methylation due to active demethylation by DME or ROS1 ( Fig. 3d , Extended Data Fig. 6a) 7 , 12 , 13 . However, these published datasets are from many pooled cells that were purified based on limited information, and lack the resolution of single-cell approaches. Moreover, methylation data for GN and immature VN, the time points between pollen mitosis I and II, has not yet been generated ( Fig. 3d , Extended Data Fig. 6a). We therefore used our snmCT-seq dataset to examine DNA methylation dynamics during wild-type pollen development in more detail, using our RNA expression-based clustering ( Fig. 3b ). We first generated chromosome-wide methylation profiles of nuclei in different transcriptionally defined clusters to observe global methylation behavior during pollen development ( Extended Data Fig. 6b ). As expected, global CG methylation levels were largely unchanged across clusters, with a small decrease in the VN lineage and increase in SN relative to GN and MN ( Extended Data Fig. 6b ). This is consistent with previous studies which found CG hypermethylation in the SN. 7 , 12 , 33 Our data indicates that this occurs after pollen mitosis II, since it is not apparent in the GN cluster ( Extended Data Fig. 6b ). Pericentromeric CHG methylation was mildly increased in the VN lineage relative to MN, but decreased in SN relative to GN ( Extended Data Fig. 6b ), also consistent with previous reports. 7 , 12 , 33 Interestingly, the CHG methylation increase relative to MN was apparent as early as in the MNtoVN cluster, and remained mostly stable throughout VN development ( Extended Data Fig. 6b ). Pericentromeric CHH methylation strongly increased in the VN lineage as expected from previous studies, 7 , 12 , 33 and this methylation gain appeared to be progressive, occurring gradually along the VN maturation trajectory ( Extended Data Fig. 6b ). We next examined methylation patterns in our wild-type nuclei over previously identified regions with less CG methylation in VN compared to SN (“CG hypo DMRs”, which are likely DME targets) and more CHH methylation in VN compared to SN (CHH hyper DMRs) based on FACS-sorted populations 13 . As expected 7 , 12 , 13 , CG methylation over CG hypo DMRs was dramatically decreased in the wild-type VN nuclei, whereas CHH methylation over CHH hyper DMRs decreased in MN, remained low in GN and SN, and greatly increased in the VN ( Fig. 3d-e , Extended Data Fig. 6c ). 13 CHG methylation levels at CG hypo DMRs were also mildly decreased, despite the increase observed at pericentromeres ( Extended Data Fig. 6b-c ). This is consistent with the reported in vitro activity of DME on cytosine methylation in any sequence context. 34 DME was previously reported to mainly target TEs in the chromosome arms in the vegetative cell. 13 Indeed, loss of CG methylation in VN was strongest at euchromatic TEs, consistent with DME targeting patterns 7 , 12 , 13 , while CHH hypermethylation occurred mainly at heterochromatic TEs ( Extended Data Fig. 6d ). Both loss of CG methylation and gain of CHH methylation in VN also occurred over MBD6 ChIP-seq peaks, suggesting that MBD5/6 bind targets of DNA methylation reprogramming in the VN ( Extended Data Fig. 6e ). The increased resolution of our single-cell dataset also allowed us to interrogate the relative timing of methylation changes in VN. Methylation loss, presumably due to DME activity, 7 , 12 , 13 was already apparent in the VN1 cluster, which in pseudotime represents the ‘earliest’ non-MN population of nuclei along the VN developmental trajectory, and decreased further in both VN1to2 and VN2 nuclei before mostly plateauing ( Fig. 3e , Extended Data Fig. 6b-e ). By definition, transcriptional changes occurred throughout the progression of MN to VN5 nuclei, since that is how the clusters were identified. However, our data shows that DNA methylation loss due to DME activity plateaus by VN3. This suggests that active removal of CG methylation in VN by DME and/or ROS1 13 primarily occurs immediately after pollen mitosis I, rather than gradually throughout VN maturation. Consistent with this trend, DME was also highly expressed in immature VN (VN1 and VN1to2) but decreased rapidly by VN3 ( Extended Data Fig. 4d ) 6 , 8 . Similarly, the CHH methyltransferase CMT2, while lowly expressed overall, was more highly expressed in immature VN, and CHH methylation increased more rapidly in immature VN compared to mature VN ( Fig. 3e , Extended Data Fig. 4d ). Thus, our data both confirmed existing observations of pollen methylation dynamics and provided insights into the timing of key DNA methylation changes during pollen development. mbd5/6 mutants lose additional methylation in immature VN, preceding MBD5/6 target gene upregulation MBD5 and MBD6 are primarily expressed in immature VN ( Extended Data Fig. 4d ) 6 which is also where we observed the biggest VN methylation changes in wild-type ( Fig. 3e ), suggesting a potential link between MBD5/6 and DNA methylation reprogramming in immature VN. Consistent with this, our MBD6 ChIP-seq data showed substantial overlap between MBD6-bound regions in inflorescences and regions that are actively demethylated by DME or ROS1 in the VN (CG hypo DMRs 13 ) ( Fig. 4a , Extended Data Fig. 7a ). To test whether loss of MBD5/6 affects VN methylation dynamics, we used our snmCT-seq data to compare methylation levels in mbd5/6 and wild-type in the different pollen nuclei clusters. We observed a marked loss of CG and CHG methylation specifically in the mbd5/6 VN relative to wild-type, along with a minor loss of methylation in the other pollen nuclei types ( Fig. 4b-d , Extended Data Fig. 7b ). Methylation loss in mbd5/6 relative to wild-type was most pronounced at MBD6 ChIP-seq peaks overlapping VN CG hypo DMRs ( Fig. 4c , Extended Data Fig. 7b ), suggesting that MBD5/6 prevent excessive demethylation by DME and/or ROS1 at these sites. A smaller but clear loss of CG and CHG methylation also occurred at MBD6 peaks not overlapping VN CG hypo DMRs ( Fig. 4d , Extended Data Fig. 7b ), as well as at VN CG hypo DMRs not overlapping MBD6 peaks ( Fig. 4b , Extended Data Fig. 7b ). However, VN CG hypo DMRs that did not overlap a significant MBD6 peak were still consistently mildly enriched for MBD6 compared to surrounding regions ( Extended Data Fig. 7a ), which may explain why we still observed hypomethylation at these sites in mbd5/6 ( Fig. 4b , Extended Data Fig. 7b ). We observed only minor loss of methylation in mbd5/6 genome-wide or at VN CHH hyper DMRs ( Extended Data Fig. 7c-d ), suggesting that loss of MBD5/6 primarily affects sites undergoing active demethylation in VN (CG hypo DMRs 13 ). There were no major changes in the expression level of DME or other key DNA methylation-related genes in mbd5/6 ( Extended Data Fig. 4d-e ), and the most strongly CG-demethylated sites were bound by MBD6 in inflorescence ChIP-seq ( Fig. 4a,c ), suggesting that the methylation changes in mbd5/6 were likely directly caused by loss of MBD5/6 binding at their targets. Additionally, mbd5/6 VN becomes most strongly demethylated relative to Col at the loci (VN CG hypo DMRs) and in the nuclei types (immature VN) that are already undergoing active demethylation by DME and/or ROS1 in wild-type ( Fig. 3e , Fig. 4a-d , Extended Data Fig. 4d ). This suggests that MBD5/6 helps protect their bound targets from the wave of active demethylation that occurs during VN development. Download figure Open in new tab Figure 4: mbd5/6 mutants lose methylation in the immature VN, preceding MBD5/6 target gene upregulation. (A) Number of MBD6 ChIP peaks that overlap VN CG hypo DMRs 13 , and vice-versa. Right shows same analysis but using shuffled MBD6 peaks. Within each plot, left column shows the number of total MBD6 (true or shuffled) peaks, plus the proportion of these that overlap CG hypo DMRs. Right column shows the number of CG hypo DMRs, plus the proportion of DMRs overlapping peaks. Regions were considered overlapping if either peak/DMR was >50% covered by the other. (B-D) Distribution of per-nucleus average CG methylation levels calculated over (B) VN CG hypo DMRs not overlapping MBD6 peaks, (C) VN CG hypo DMRs overlapping MBD6 peaks, and (D) MBD6 peaks not overlapping VN CG hypo DMRs (regions indicated at right of each plot). Each plot compares Col and mbd5/6 CG methylation levels across the different snmCT-seq clusters. Stars indicate effect size of difference between WT and mbd5/6 , Cohen’s d. n.e. = no/minimal effect (|d| 0.2, ** = |d| > 0.5, *** = |d| > 0.9. (E) Heatmap of average expression in the Ichino et al. 2022 6 10x dataset, of genes upregulated in mbd5/6 compared to Col, clustered based on the timing of their activation with respect to the VN pseudotime trajectory (immature vs. mature). (F) Expression of the immature and mature VN differentially expressed loci from (E-F) in the current study’s snmCT-seq data (reps 1 and 2). Heatmap row order same as in (E). (G) Distribution of per-nucleus CG methylation levels over +/-400bp surrounding the TSSs of immature and mature VN differentially expressed loci defined in E and F. **** = p-val < 0.00001, *** = p-val < 0.0001, ** = p-val < 0.001, * = p-val < 0.1, n.s. = not significant, t-test comparing Col and mbd5/6 means within indicated cluster. (H) Metaplots of average methylation profiles for Col (left) and mbd5/6 (right) over immature and mature VN differentially expressed loci across the different snmCT-seq clusters. Value shown was average of both replicates. We next compared these methylation changes to the transcriptional changes in mbd5/6 , which also occur primarily in VN 6 . Using our previous 10x snRNA-seq dataset 6 , we identified transcripts that become upregulated in mbd5/6 beginning in either immature VN (VN1-3) or in mature VN (VN4-5) ( Fig. 4e ). These transcripts showed the same immature/mature expression pattern in our snmCT-seq data ( Fig. 4f ). At transcripts upregulated in immature mbd5/6 VN, mbd5/6 nuclei showed a significant drop in average CG methylation relative to Col over the TSS-proximal region (+/- 400 bp around the TSS) beginning in the “MN to VN” cluster ( Fig. 4g-h , Extended Data Fig. 7e-g ), preceding the earliest activation of these genes ( Fig. 4e-f ). Similarly, transcripts upregulated in mature mbd5/6 VN showed significant CG methylation loss relative to Col by the “VN1 to 2” cluster ( Fig. 4g-h , Extended Data Fig. 7e-g ), again preceding the activation of these genes in pseudotime, which occurs in the “VN4” cluster ( Fig. 4e-f ). Like the transcriptional upregulation, the methylation loss in mbd5/6 at upregulated targets was specific to the VN and minimal in MN, GN, or SN ( Fig. 4g-h , Extended Data Fig. 7e-g ). While it’s possible that the additional demethylation of mbd5/6 upregulated transcripts is an indirect consequence of transcriptional activation, the observation that both immature and mature VN differentially expressed transcripts show evidence of demethylation in immature VN, and thereby prior to detectable gene upregulation in mbd5/6 ( Fig. 4e-h ) argues against this possibility. Instead, these data suggest that in the absence of MBD5/6, the promoters of mbd5/6 upregulated transcripts undergo additional active demethylation in VN, facilitating their expression. Loss of MBD7 rescues demethylation of a subset of loci in mbd5/6 pollen Our data so far indicate that (1) MBD7 is required for transcriptional derepression of a subset of misregulated transcripts in mbd5/6 VN ( Fig. 1 ), (2) MBD5/6 and MBD7 prefer to bind different types of high mCG-regions but overlap at a subset of mbd5/6 misregulated transcripts ( Fig. 2 ), and (3) MBD5/6 help protect sites from excessive demethylation during VN reprogramming ( Fig. 4 ). Since MBD7 has been proposed to promote demethylation 16 – 18 , we hypothesized that MBD5 and MBD6 help prevent excessive demethylation during VN reprogramming by antagonizing MBD7. If this model is correct, then the loss of methylation in mbd5/6 should be rescued in mbd5/6/7 . We first tested this by performing BS-seq in mature pollen. We detected no major genome-wide changes in methylation in mbd5/6 or in sln , which has a similar transcriptional phenotype as mbd5/6 4 ( Extended Data Fig. 8a ), consistent with previous reports 6 and with the mbd5/6 snmCT-seq data ( Extended Data Fig. 6b ). We next focused on the set of mbd5/6 upregulated transcripts, which are demethylated around the TSS in mbd5/6 VN relative to Col ( Fig. 4h ). Although the methylation loss was diluted in whole pollen, we were able to detect a small but consistent decrease in CG and CHG methylation in both mbd5/6 and sln around the TSS of mbd5/6 upregulated transcripts ( Extended Data Fig. 8b-e ). The hypomethylation was also detectable at MBD6 target sites that become demethylated in VN 13 ( Extended Data Fig. 8c ). The mbd5/6 hypomethylation was fully rescued in mbd5/6/7 at the mbd5/6 upregulated transcripts that were transcriptionally rescued by loss of MBD7, but only partially at “not rescued” genes and other MBD6 peaks ( Extended Data Fig. 8b-e ). While we were able to detect a mild demethylation phenotype in mbd5/6 whole pollen, and saw rescue in mbd5/6/7 at some loci ( Extended Data Fig. 8b-e ), the difference was very modest relative to our snmCT-seq data ( Fig. 4c ), presumably due to VN nuclei comprising only a subset of the whole pollen samples. We therefore performed an additional replicate of developing pollen snmCT-seq, this time comparing wild-type, mbd7 , mbd5/6 and mbd5/6/7 together. After quality filtering, we obtained over 1000 high-quality nuclei per genotype, with 5,638 nuclei total for this replicate ( Supplementary Table 3) . To compare these data to our previous results, we projected the new transcriptomic data onto our previous analysis and UMAP. We again identified all the expected cell types, with expression patterns broadly consistent with our original clustering ( Extended Data Fig. 9a-b , Supplementary Table 3 ). Compared to the first two experiments, this experiment had fewer nuclei assigned to the mature VN (VN4 and VN5) and mature sperm (SN) clusters, possibly due to differences in the ages of the plants used ( Extended Data Fig. 9a-b , Supplementary Table 3 ). Due to this, VN4 and VN5 were combined into a single ‘mature VN’ cluster for this analysis. Wild-type and mbd5/6 methylation patterns across nuclei clusters in our third snmCT-seq experiment were highly consistent with our previous results, with comparable loss of CG methylation and gain of CHH methylation over VN CG hypo and CHH hyper DMRs 13 in wild-type VN, as well as additional loss of CG methylation at VN CG hypo DMRs in mbd5/6 VN nuclei ( Extended Data Fig. 9c ). At VN CG hypo DMRs, the additional demethylation in mbd5/6 VN was strongly, but not fully, rescued in mbd5/6/7 VN ( Fig. 5a ). Interestingly, the mbd7 single mutant showed mildly increased CG methylation levels relative to wild-type in the VN, but not in other nuclei types, suggesting that MBD7 facilitates the wave of CG demethylation during VN development ( Fig. 5a ). We next looked at methylation patterns at transcriptionally ‘rescued’ loci compared to ‘not rescued’ loci ( Fig. 1d ). We found that most of the methylation loss in mbd5/6 VN was strongly rescued in mbd5/6/7 at transcriptionally ‘rescued’ loci ( Fig. 5b-d , Extended Data Fig. 9d ). These loci also tended to be in regions with higher overall methylation levels compared to ‘not rescued’ loci, and underwent minimal demethylation in wild-type VN that was restricted to the TSS-proximal region ( Fig. 5b-d , Extended Data Fig. 9d ). This suggests that these loci are mostly in silent chromatin that is strongly protected from active demethylation in VN. The ‘not rescued’ loci were generally less methylated than ‘rescued’ loci in wild-type, and lost substantially more methylation in wild-type VN over both the promoter/TSS region and the 5’ end of the annotated transcript ( Fig. 5b-d , Extended Data Fig. 9d ). Additional hypomethylation of these regions in mbd5/6 was generally modest, and was rescued in mbd5/6/7 , but not as fully as at transcriptionally ‘rescued’ loci ( Fig. 5b-d , Extended Data Fig. 9d ). Download figure Open in new tab Fig. 5: Loss of MBD7 rescues excessive demethylation in mbd5/6 pollen. (A) Average CG methylation across the four genotypes tested in snmCT-seq experiment 3, over VN CG hypo DMRs. 13 Each point in the violin plot represents one nucleus’ average methylation over the indicated regions. A red dashed line runs through the wild-type median value. (B) Same as (A), but showing methylation averages across the TSS (+/- 400 bp around TSS) region of mbd5/6 upregulated transcripts ‘not rescued’ (bottom) or ‘rescued’ (top) by mbd7 . (A-B) Number of stars indicates effect size, measured as Cohen’s d . (n.e. = no/minimal effect (|d| 0.2, ** = |d| > 0.5, *** = |d| > 0.9, **** = |d| > 1.5). Color of stars indicates statistical significance: red color = p < 0.001, two-sided t- test. (C) Metaplots of snmCT-seq rep 3 methylation data pseudobulked across all nuclei in each indicated cluster + genotype, over mbd5/6 upregulated transcripts ‘not rescued’ (left) or ‘rescued’ (right) by mbd7 . (D) Example browser images of mbd5/6 upregulated transcripts ‘not rescued’ (right) or ‘rescued’ (left) by mbd7 , showing RNA-seq from whole pollen ( Fig. 1d ), snmCT-seq CG DNA methylation data pooled by indicated genotype + cluster (only MN and VN2 clusters shown; these were selected due to the larger numbers of nuclei in these clusters, which increased the probability of getting good coverage after pooling), and ChIP-seq for MBD6 and MBD7-Flag (average of all lines) ( Fig. 2 ). As much as possible, these loci were chosen based on having fairly even and consistent coverage in all snmCT-seq CG DNA methylation tracks shown. No change in methylation levels was observed in mbd7 single mutant relative to wild-type both at ‘rescued’ and ‘not-rescued’ loci ( Fig. 5b-d ), which is consistent with the absence of transcriptional downregulation of these loci in mbd7 ( Fig. 1d-e ) and indicates that these loci cannot be demethylated by MBD7 in the presence of MBD5/6. However, the TSS region of mbd7 downregulated transcripts showed increased CG methylation in mbd7 , supporting the idea that MBD7 promotes DNA demethylation ( Extended Data Fig. 9e ), as previously suggested in other tissues. 16 – 18 Of note, these loci are less enriched in MBD6 ChIP-seq signal compared to the mbd5/6/7 ‘rescued’ loci, suggesting that MBD7 is able to demethylate them in wild-type because they are not protected by MBD5/6 ( Extended Data Fig. 3e ). Taken together, these data support a model where the MBD5/6 complex protects its targets from excessive demethylation in the VN. This occurs in large part by inhibiting the MBD7 complex, which binds a subset of mbd5/6 upregulated loci and can promote active DNA demethylation. The effect of both MBD5/6 and MBD7 becomes particularly visible during the wave of epigenetic reprogramming that occurs during VN development. However, since loss of mbd7 only rescues the transcriptional derepression and excessive demethylation in mbd5/6 VN at a subset of MBD5/6 loci, we hypothesize that MBD5/6 function independently of MBD7 at the remaining loci, either by directly inhibiting DNA demethylation or by inhibiting additional pathways that help facilitate demethylation during VN development. Recruiting the MBD7 complex to MBD5/6 targets causes mild demethylation and transcriptional upregulation To understand the interaction between MBD5/6 and MBD7 further, we asked whether artificially recruiting excessive MBD7 complex components to MBD5/6 targets was sufficient to overcome MBD5/6 protection and cause DNA demethylation and gene upregulation. Like MBD5/6, which uses its StkyC domain to recruit its complex members, MBD7 recruits its complex via interactions between the MBD7 StkyC domain and the ACD protein IDM3 18 . Indeed, we confirmed that the MBD7 StkyC is necessary and sufficient to interact with IDM3 using BiFC ( Extended Data 10a-b ). We therefore created a modified MBD6 transgene where the MBD6 StkyC domain was replaced with the MBD7 StkyC domain, named MBD6 SWAP ( Fig. 6a ). Using BiFC, we confirmed that MBD6 SWAP interacted with IDM3, and not with ACD15 ( Fig. 6b ). Like wild-type MBD5/6 and MBD7, MBD6 SWAP formed nuclear foci in root nuclei ( Extended Data 10c ). However, while wild-type MBD6 foci were dependent on ACD15 and ACD21 as previously observed 5 , MBD6 SWAP foci were fully dependent on IDM3 ( Extended Data 10d ). Thus, we concluded that MBD6 SWAP recruits the MBD7 complex rather than the MBD5/6 complex. Download figure Open in new tab Fig. 6: Recruiting the MBD7 complex to MBD5/6 targets causes mild demethylation and transcriptional upregulation of silent loci. (A) Diagram of MBD6, MBD7, and MBD6 SWAP constructs. (B) (left) Example BiFC images (YFP, DIC and DIC + YFP merge) and quantification of fluorescence (right) for indicated combination of proteins. First protein listed was tagged with nYFP, second was tagged with cYFP. (C) Distribution of the difference in DNA methylation between wild-type (WT) and indicated genotype, average of three replicates. Values were calculated over regions indicated at right of each plot. p- value = one-sided paired t -test. (D) Example browser images of transcripts upregulated in WT + MBD6 SWAP compared to WT, showing loss of methylation over regions occupied by MBD6. Left shows a locus upregulated in mbd5/6 and rescued in mbd5/6/7 , right is a locus not upregulated in mbd5/6 . (E) Distribution of RNA-seq log 2 (TPM) for all replicates from Col, Col + MBD6 SWAP , mbd5/6 , and mbd5/6 + MBD6 SWAP (l1, l2, and l3 = different transgenic lines). Values shown are for mbd5/6 upregulated transcripts that had little to no expression in wild-type, separated based on whether they’re rescued or not rescued in mbd5/6/7 ( Fig. 1d ). p- value = two-sided paired t -test comparing the average of all samples within a genotype. We next transformed our MBD6 SWAP construct into both wild-type (WT + MBD6 SWAP ) and mbd5/6 ( mbd5/6 + MBD6 SWAP ) plants and performed pollen RNA-seq and WGBS on multiple independent T2 lines. Since the effect of MBD6 SWAP , like mbd5/6, is likely only detectable in the VN of pollen, we expected the changes in whole pollen data to be diluted. Indeed, in both WT + MBD6 SWAP and mbd5/6 + MBD6 SWAP , we observed a mild but consistent decrease in CG DNA methylation relative to the no-transgene control in the TSS region of genes upregulated in mbd5/6 pollen, as well as over MBD6 ChIP-seq peaks ( Fig. 6c-d , Extended Data Fig. 10e ). This suggests that MBD6 SWAP can invade MBD5/6-bound regions and promote demethylation, though the demethylation phenotype is more mild than in mbd5/6 mutants. Additionally, the effect of adding MBD6 SWAP was not stronger in the mbd5/6 background compared to WT, suggesting that the presence of native MBD5/6 doesn’t inhibit MBD6 SWAP binding ( Fig. 6c-d , Extended Data Fig. 10e ). Over mbd5/6 upregulated transcripts, the degree of demethylation was similar regardless of whether the locus could be transcriptionally rescued by loss of MBD7 (‘rescued’ vs. ‘not rescued’, Fig. 1d ), confirming that MBD6 SWAP affects these loci equally regardless of whether they are normally MBD7 targets ( Extended Data Fig. 10f ). VN CG hypo DMRs with the highest MBD6 ChIP-seq signal were also slightly more demethylated on average in both WT + MBD6 SWAP and mbd5/6 + MBD6 SWAP compared to no-transgene controls ( Extended Data Fig. 10g ), suggesting that MBD6 SWAP invades MBD5/6 targets proportionally to native MBD5/6 binding, and therefore accumulates more strongly at sites normally highly bound by MBD5/6. Overall, these data indicate that ectopically recruiting components of the MBD7 complex to MBD5/6-bound sites using a modified MBD6 is sufficient to cause partial demethylation of MBD5/6 target loci. We next looked for expression changes in the RNA-seq data. We saw that transcripts upregulated in mbd5/6 were also upregulated in WT + MBD6 SWAP pollen, but this effect was limited to the loci that are normally silent or barely expressed in wild-type ( Fig. 6e , Extended Data Fig. 10h ). Upregulation of lowly expressed mbd5/6 upregulated loci also occurred regardless of whether the locus could be transcriptionally rescued by loss of MBD7 ( Fig. 6e ). Like the DNA methylation changes, the upregulation of these loci in WT + MBD6 SWAP was also substantially lower than in mbd5/6 mutants. Additionally, loci that were already expressed in WT were unaffected in WT + MBD6 SWAP ( Extended Data Fig. 10h ). MBD6 SWAP also had no significant effect on expression when added to the mbd5/6 background, where these loci are already upregulated ( Fig. 6e , Extended Data Fig. 10h ). Overall, these data show that MBD6 SWAP can recruit MBD7 complex components to MBD5/6 bound sites and promote partial demethylation and activation, but is less effective than loss of MBD5/6, and has little additional impact on transcription in mbd5/6 . Discussion In this manuscript, we identified an antagonistic interaction between the methyl-binding proteins MBD5 and MBD6, which maintain silencing in the VN of pollen, and the anti-silencer MBD7. This work sheds light on the mechanism of silencing by MBD5/6 and why it is uniquely observed in the VN of pollen, and also provides strong evidence that antagonism between MBD5/6 and MBD7 is only one of multiple interactions involved in mediating MBD5/6-based silencing. We also demonstrated the feasibility and power of performing simultaneous analysis of DNA methylation and RNA expression in single nuclei in plants. Developing pollen was an optimal system for testing the snmCT-seq protocol in plants, since vegetative nuclei undergo substantial changes to their methylome. Our snmCT-seq data was able to reveal the precise timing of these methylation changes relative to expression changes during VN maturation, and allowed us to clearly observe and characterize methylation changes in mbd5/6 that occurred primarily in the VN and were hard to detect in bulk pollen. We foresee that this technology will help advance our understanding of methylation dynamics in other heterogeneous plant tissues and potentially reveal other novel cell types that undergo methylation reprogramming. While MBD5 and MBD6 were originally thought to act strictly downstream of DNA methylation 4 , our work shows that a major function of MBD5/6 is to safeguard key loci like transposons from excessive demethylation by DME/ROS1 during normal VN reprogramming in pollen. Here we have focused on MBD7 as a key part of this mechanism. However, we note that MBD7 antagonism does not explain the entire mbd5/6 phenotype, since loss of MBD7 rescues only about half of the mbd5/6 upregulated loci ( Fig. 1d ). Methylation changes in mbd5/6 were rescued in mbd5/6/7 at sites that are also transcriptionally rescued, but not consistently at other sites ( Fig. 5b-d ). This suggests that MBD5/6 protect their remaining targets from demethylation by either directly inhibiting DME and other demethylases, or interacting with other mechanisms that can promote DNA demethylation, similar to MBD7. Discovering how MBD5/6 does this will be an important focus for future work. Several other mechanisms involved in the epigenetic reprogramming of pollen vegetative cells have been described. 11 , 14 For example, a recent study found that another set of DNA methyl-binding proteins, SUVH4/5/6, interact with ARID1 to slow down the eviction of H3K9me2 from the VN, functioning in some ways similarly to MBD5/6 in preventing excessive DNA demethylation in VN. 14 Our data suggest that excessive loss of methylation in the mbd5/6 VN can enable transcription of some loci, possibly by allowing methylation-sensitive transcription factors or transcriptional coactivator complexes to gain access to these methylated chromatin regions. This also likely explains why the mbd5/6 derepression phenotype has only been observed in the VN, since that is one of the few cell types where such dramatic methylation reprogramming is known to occur in Arabidopsis. 7 , 12 , 13 Linker histone H1 is also depleted in the VN. 11 H1 is involved in chromatin condensation, so its depletion in VN is thought to facilitate access of DME to some heterochromatic TE targets 11 . Consistent with this, both our single cell transcriptomic data ( Extended Data Fig. 4f ) and published imaging data 11 show that H1.1 and H1.2 expression levels decrease dramatically prior to pollen mitosis I and therefore are already depleted before DME and MBD5/6/7 are upregulated and before active demethylation of the VN begins. The FACT complex and its nucleosome remodeling activity are also required to allow access of DME to its heterochromatic targets in endosperm 35 . Thus, in the majority of cell types MBD5/6’s function in shielding DNA from demethylases could be functionally redundant with other factors that maintain tight chromatin compaction and prevent access to the demethylation machinery. Indeed, we previously observed enhancement of the mbd5/6 phenotype in h1 mutant seedlings 6 , suggesting that MBD5/6 become more important in a mutant where chromatin is less compacted and more accessible. Future experiments should test whether MBD5/6 are also required for silencing in other cell types that undergo active demethylation, like the central cell, 36 and whether MBD5/6 also function by antagonizing MBD7 in these other tissues. Similarly, our data suggests that MBD7’s activity is also prominent in the pollen VN due to chromatin decompaction. This reconciles well with the initial discovery of MBD7 as an antisilencer in genetic screens 15 – 18 , because transgenes typically integrate in a euchromatic, open environment, and are targeted by the demethylation machinery, which works against de novo methyltransferases. Indeed, our MBD7 ChIP-seq data suggests that in wild-type, MBD7 is enriched in open chromatin compared to pericentromeres. New targets and potential functions for MBD7 were also brought to light by looking at mbd5/6/7 triple mutants. This revealed an interesting tug of war between MBD5/6 and MBD7 complexes, which work in opposite directions to inhibit or facilitate expression of shared target loci, respectively. This seems to play a particularly important role in the VN, where DNA demethylation is facilitated. Our data suggest that MBD7 loss prevents some DNA demethylation from occurring in VN, particularly early in VN development ( Fig. 5 ), suggesting a role for the MBD7 complex in helping to mediate normal VN reprogramming. However, in mbd5/6/7 VN, DNA methylation levels either resemble wild-type or are hypomethylated as in mbd5/6 , suggesting MBD7 functions largely downstream of MBD5/6 to regulate DNA methylation levels in VN. This is also consistent with the transcriptional data ( Fig. 1d ). Thus, our results position the MBD5/6 as a key inhibitor of DNA demethylation in pollen VN via inhibition of MBD7. However, we showed that MBD7’s ChIP-seq enrichment does not increase upon depletion of MBD5/6 or SLN, suggesting that MBD5/6 do not directly affect MBD7 localization, so the exact interaction between MBD5/6 and MBD7 remains unclear. Since all ChIP-seq experiments were performed with inflorescence tissue, it is also possible that MBD7 localization is affected by loss of mbd5/6 specifically in the VN, which would be undetectable in data from whole inflorescences. Future technological advancements allowing high confidence detection of ChIP-seq enrichment in VN nuclei could unravel a different result. Alternatively, it is possible that MBD5/6 interfere with MBD7’s activity instead of its recruitment to DNA, but the mechanism for this remains to be determined. Why would a cell want to simultaneously target both an activator and a repressor to the same locus? Many of the loci upregulated in mbd5/6 and rescued in mbd5/6/7 are transposons that are lowly expressed in wild-type rather than silent ( Fig. 1d , Supplemental Fig. 1 ). One proposed role for TE expression in the VN is to reinforce silencing in the sperm cells via the generation and movement of small RNAs from the VN to the SN 37 – 40 . The balance of repression by MBD5/6 and antisilencing by MBD7 together could help ensure low, stable TE expression for siRNA production, while preventing massive loss of silencing that could negatively impact the fitness of the VN. However, these factors alone are not essential for pollen development, as we did not observe any strong phenotype in any of the mutants. Since MBD5, MBD6 and MBD7 are expressed throughout the plant, 6 we favor the hypothesis that MBD5/6/7 function in most plant cells. However, this does not preclude an important function in pollen. A number of redundant regulatory mechanisms have evolved to reinforce silencing of transposons and other dangerous elements, including MBD5/6, highlighting their importance. Despite the differences in their functions, the MBD5/6 and MBD7 complexes share many structural similarities, suggesting an ancestral system that has evolved to carry out multiple different specialized functions. Both MBD5/6 and MBD7 directly interact with ACD proteins ACD15 and IDM3, respectively. In the MBD5/6 complex, ACD15 then recruits ACD21, which together mediate multimerization and accumulation of numerous copies of MBD5/6 complex members at methylated genomic regions 5 . Here we showed that IDM3 similarly regulates the accumulation of MBD7, suggesting that protein accumulation may be an important aspect of both complexes’ function. However, MBD5/6 foci are completely abolished in acd15 mutants, while MBD7 foci formation was only partially abolished in idm3. One possible explanation is that MBD7 retains enough methyl-DNA binding ability, due to its three MBD domains, to form foci even in the absence of IDM3, whereas MBD5/6 only have one MBD domain and therefore may be more affected by loss of multimerization through their ACD partners. In addition to the shared ability to mediate accumulation, our data suggest that ACD proteins confer functional specificity to the different MBD complexes. Indeed, we show that altering MBD6 to recruit IDM3 instead of ACD15/21 is sufficient to turn this protein from a repressor to an activator. Methods Plant materials and growth conditions All plants used in this study were in the Columbia-0 ecotype (Col-0) and were grown on soil in a greenhouse under long-day conditions (16h light / 8h dark). The following mutant lines were obtained from Arabidopsis Biological Resource Center (ABRC): mbd7-3 (GABI_067_A09), sln (SALK_090484), mbd6-1 (SALK_043927). The mbd5/6 double mutant used in this study is the previously described mbd5/6 CRISPR-1 4 . The idm3/lil-1 and YJ control seeds were kindly donated by the Law lab 15 . Generation of CRISPR/Cas9 mutants The mbd5 mbd6 mbd7 triple mutant was generated using the pYAO::hSpCas9 system 46 to edit MBD5 and MBD7 in the mbd6-1 (SALK_043927) genetic background, as previously described 6 . Briefly, we cloned sequentially a guide for the MBD5 gene (ACCGGAGAACCCGGCTACTC) and a guide for the MBD7 gene (GCTATTCACAGACACTTGGC) into the pYAO::hSpCas9 plasmid by overlapping PCR. The plasmid was transformed into Agl0 agrobacteria, which were used to transform mbd6-1 plants via floral dipping. Mutations were screened in T1 transgenic lines by Sanger sequencing. The plants used in this study are T2 or T3 Cas9 negative segregants, with homozygous mutations. Generation of transgenic lines The FLAG-tagged transgenic lines used for ChIP-seq were generated by cloning the indicated genes including their endogenous promoter and introns into pENTR/D-TOPO vectors (Thermo Fisher) using an In-Fusion reaction (TaKaRa). For MBD7, the promoter region used was ∼1 kb. The sequences were then transferred via a Gateway LR Clonase II reaction (Invitrogen, 11791020) into a pEG302-based binary destination vector including a C-terminal 3xFLAG epitope tag. Similarly, YFP and RFP constructs were generated by first cloning the desired gene + promoter into pENTR using In-Fusion, then performing a Gateway LR reaction into a t-DNA plasmid (pGW540) that adds a C-terminal YFP or RFP tag. MBD6 SWAP transgenic plants were instead created by first generating [MBD6 endogenous promoter]-[MBD6 coding sequence lacking StkyC domain]-[MBD7 StkyC domain] in a pENTR/D-TOPO vector using In-Fusion (TaKaRa). This was inserted via a Gateway LR Clonase II reaction (Invitrogen, 11791020) into a t-DNA plasmid (pGW540) that adds a C-terminal YFP or RFP tag. For co-expression constructs ( Extended Data 2f, 10c ), the desired genes + promoters were first cloned upstream of YFP and RFP as described above. The RFP plasmid was then amplified using custom primers (cggaaccaattcccgatctagtaaca and atcacaaaatctcttttgagtaacaaataaatt). This product was gel purified and inserted into the YFP plasmid that had been digested with XbaI. Vectors were electroporated into Agl0 agrobacteria that were used for plant transformation by agrobacterium-mediated floral dipping. Successful FLAG line transformants were selected on soil using Basta resistance, while RFP/YFP lines were selected on 1/2x MS (Murashige and Skoog, Sigma) agar plates with hygromycin. RNA-sequencing Library preparation Mature pollen RNA-seq was carried out according to our previously described protocol 6 . We harvested ∼500 μl of open flowers in 1.7-ml tubes (Eppendorf), then added 700 μl of Galbraith buffer (45 mM MgCl 2 , 30 mM C 6 H 5 Na 3 O 7 .2H 2 O [Trisodium citrate dihydrate], 20 mM MOPS, 0.1% [v/v] Triton X-100, pH 7, 5 μl per ml of 14.3M Beta-mercaptoethanol [CAS-60-24-2, Fisher Scientific]), and vortexed the samples in the cold room for 2-3 minutes at max speed to release the pollen from the anthers. The suspension was filtered with an 80 μm nylon mesh into a new 1.5 ml tube. The procedure was repeated one more time with the same flowers to increase the yield of pollen. The two aliquots of filtered pollen suspension were combined and centrifuged for 5 min at 500 g, 4°C. The pollen pellet was frozen in liquid nitrogen and stored at −80°C. This procedure was repeated on consecutive days to obtain replicates. Frozen inflorescence or pollen samples were disrupted with a tissue grinder and RNA extraction was performed with the Zymo Direct-zol RNA MiniPrep kit (Zymo Research). In both cases, the in-column DNase I digestion was performed. RNA-seq libraries were generated using the TruSeq Stranded mRNA Library Prep Kit (Illumina), following the manufacturer’s instructions and starting with 500-1000 ng of RNA as input, and sequenced on a Novaseq 6000 machine. Analysis RNA-seq reads were filtered based on quality score and trimmed to remove Illumina adapters using TrimGalore 47 . Reads were then aligned to the Arabidopsis reference genome (TAIR10) using STAR 48 , using custom annotations generated previously based on pollen RNA-seq data 6 ( https://github.com/clp90/mbd56_pollen/ ), and allowing up to 5% of mismatches (-outFilterMismatchNoverReadLmax 0.05). Only uniquely aligned reads were used. PCR duplicates were removed using MarkDuplicates from the Picard Tools suite 49 . Coverage tracks for visualization in the genome browser were generated using Deeptools 50 version 3.0.2 bamCoverage with the options --normalizeUsing CPM and --binSize 10. HTseq 51 was used to obtain read counts over genes and transposons in the custom pollen annotation, using the option --mode=intersection-strict. Differential gene expression analysis was performed using DEseq2 52 with a cutoff for significance of adjusted p -value 1. All transcript types were analyzed together in the differential expression analysis (genes, TEs, and other undefined non-coding transcripts). Transcripts per million (TPM) values were estimated using StringTie version 2.1.6 53 . Figures were generated using R version 4.4.0 and the packages ggplot2 version 3.5.1 54 and pheatmap version 1.0.12 55 . Bisulfite sequencing Mature pollen samples for bisulfite sequencing were obtained with the same procedure described for RNA-seq. DNA extraction from pollen pellets was either performed with the cetyl trimethylammonium bromide (CTAB) method and treated with RNase A (Qiagen) (batches lib1-lib4, Supplementary Table 1 ) or using the Qiagen DNeasy Plant mini kit with on-column RNase A digestion (batch lib5, Supplementary Table 1 ). 20-100 ng of DNA per sample were sheared with the Covaris S2 instrument to an average fragment size of 200bp (Duty Cycle = 10%, Intensity = 5, Cycles per Burst = 200, Treatment Time = 120 seconds). Sheared DNA was used as input for library preparation using the Nugen Ultralow Methyl-Seq kit, following manufacturer’s instructions except for the bisulfite conversion, which was done with the EpiTect Bisulfite Kit (Qiagen, 59104). The bisulfite conversion reaction in the thermocycler was performed twice (overnight) to increase efficiency. Final libraries were sequenced on NovaSeq 6000 or NovaSeq X plus. Analysis Reads were trimmed and filtered with TrimGalore 47 and mapped to the TAIR10 genome with Bismark 56 . PCR duplicates were removed using the script provided with Bismark. Bismark was also used to obtain the methylation percentages for each cytosine and to generate the per-position DNA methylation tracks. For downstream analyses, only cytosines with at least 5 aligned reads were used. Average methylation (weighted by coverage) over different sets of genomic regions was obtained using a custom script (sumByFeature.sh, provided in linked github repository). Plots were generated using R version 4.4.0 and the package ggplot2 version 3.5.1 54 . Published fastq files from buds whole-genome bisulfite sequencing (SRR6410887, SRR6410888) 25 were downloaded from GEO and reanalyzed as above. Per-position methylation data for both replicates was then pooled by adding together the methylated/unmethylated read counts for both replicates at each position. Chromatin immunoprecipitation sequencing (ChIP-seq) ChIP-seq was performed with about 2 grams of inflorescences with unopened flower buds per sample, which was collected and flash-frozen in liquid nitrogen until use. ChIP was performed as in 57 . All buffers, unless otherwise indicated, were supplemented with protease inhibitors: PMSF (Sigma), benzamidine (Sigma), cOmpleteTM Protease Inhibitor Cocktail (Sigma), and MG132 (Sigma). Tissue was ground using a TissueLyser II (Qiagen), using 2 rounds of 90 seconds at frequency 1/30. Tissue powder was dissolved in 25 mL nuclei isolation buffer (50 mM HEPES, 1 M sucrose, 5 mM KCl, 5 mM MgCl 2 , 0.6% Triton X-100). Formaldehyde was added to dissolved sample to a final conc. of 1% and incubated 12 min at room temp on a rotator mixer. Crosslinking was quenched with freshly prepared 2 M glycine for 5 min room temp on a rotator mixer. Nuclei were then purified by first filtering through one layer of miracloth, then successively pelleting and resuspending nuclei in extraction buffer 2 (0.25 M sucrose, 10 mM Tris-HCl pH 8, 10 mM MgCl2, 1% Triton X-100, 5 mM βME) and extraction buffer 3 (1.7 M sucrose, 10 mM Tris-HCl pH 8, 2 mM MgCl 2 , 0.15% Triton X-100, 5 mM βME). After resuspending in extraction buffer 3, nuclei were pelleted for 1 h at 12,000g 4C, then resuspended in nuclei lysis buffer (50 mM Tris pH 8, 10 mM EDTA, 1% SDS). Chromatin was sheared using a Bioruptor Plus (Diagenode) sonicator, 30 sec on / 30 sec off on high, 22 cycles. Samples were diluted with ChIP dilution buffer (1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris pH 8, 167 mM NaCl), and incubated with anti-FLAG antibody (Sigma, 1:800 dilution) overnight at 4C on a rotator mixer. Samples were then incubated with a 1:1 mixture of Protein A and Protein G Dynabeads (Invitrogen) for 2 hours at 4 C on a rotator mixer. Beads were then washed twice with low salt buffer (150 mM NaCl, 0.2% SDS, 0.5% Triton X-100, 2 mM EDTA, 20 mM Tris pH 8), once with high salt buffer (200 mM NaCl, 0.2% SDS, 0.5% Triton X-100, 2 mM EDTA, 20 mM Tris pH 8), once with LiCl buffer (250 mM LiCl, 1% Igepal, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris pH 8), and once with TE buffer (10 mM Tris pH 8, 1 mM EDTA). Sheared chromatin was eluted from beads by resuspending in 250 uL elution buffer (1% SDS, 10 mM EDTA, 0.1 M NaHCO 3 ) and incubating at 65 C for 20 min at 1000 rpm. This step was performed twice to increase yield, combining eluates (final volume 500 uL). 20 uL of elution was used for Western Blot to check pull-down using anti-FLAG HRP antibody (1:10,000 dilution, Sigma). Reverse crosslinking was performed by adding 20 uL 5 M NaCl and incubating 65 C overnight. Protein was digested by adding 1 uL Proteinase K (Invitrogen), 10 uL 0.5 M EDTA and 20 uL 1 M Tris pH 6.5 and incubating 4 h at 45 C 400 rpm. DNA was purified using a standard phenol:chloroform:isoamyl alcohol extraction and precipitated with sodium acetate at ethanol overnight at −20 C. Libraries were made using the Ovation Ultra Low System V2 1-16 kit (NuGEN, 0344NB-A01) following the manufacturer’s instructions, with 15 cycles of PCR, and sequenced on NovaSeq X Plus. Analysis Reads were trimmed and filtered with TrimGalore 47 and mapped to the TAIR10 genome with bowtie2 58 with parameter -X 1000. For each sample, genome-wide coverage tracks were generated using Deeptools 50 v3.5.5 bamCoverage with options – binSize 10 –normalizeUsing CPM –extendReads and excluding the mitochondrial and chloroplast genomes. Coverage tracks for the two no-FLAG controls were averaged using Deeptools bigwigAverage, and then each sample was normalized to the averaged control track using Deeptools bigwigCompare with –operation log2 and –binSize 10. Peaks were identified using MACS2 59 v3.0.0a7 callpeak with options -g 119000000 --seed 123456 -- broad -f BAMPE --broad-cutoff 0.1. Peaks from replicates were combined using bedtools merge. ChIP-seq signal over 400 bp bins was calculated using Deeptools multiBigwigSummary, while metaplots of ChIP-seq signal over different genomic regions was performed using Deeptools computeMatrix followed by plotHeatmap. Clustering of peaks was performed using the –kmeans option of plotHeatmap with k = 5. Published raw sequencing data were downloaded from GEO and reanalyzed as described above: MBD5-Myc and MBD6-Myc (GSM5267036, GSM5267037, GSM5267038) 4 , H3K9me2 (GSM3130575, GSM3130576) 60 , Pol V (GSM2667838, GSM2667837) 43 . mC density correlations For mC density correlations with ChIP-seq signal ( Extended Data 2c ), the genome was split into 400bp non-overlapping bins tiled genome-wide. For analysis shown in Fig. 2a , methylation density was instead calculated over 400 bp bins centered around the midpoint of the ChIP-seq peak. For each bin, methylation density in each sequence context (CG, CHG and CHH) was calculated as the sum of the methylation percentage of all cytosines in that context in the bin. Methylation data used from Harris et al. 2018 Science (SRR6410887, SRR6410888) 25 . Plots were generated in R using the geom_smooth() function from the ggplot2 54 package with default parameters. snmCT-seq Sample preparation for snmCT-seq was performed as previously described for snRNA-seq with the 10X genomics platform, with a minor variation in the last step prior to nuclei sorting 6 . Briefly, mixed spores were isolated from open flowers, and pollen was broken to release nuclei into solution. Nuclei were then filtered and collected by centrifugation. Nuclei pellets were resuspended in 2 mL nuclei extraction buffer and DAPI buffer combined in a 1:8 ratio (Cystain UV Precise P, Sysmex). The Col and mbd5/6 samples were then split into two aliquots, which were sorted simultaneously on two machines: a BD FACS ARIAII instrument and BD FACS ARIA, using the 70 μm nozzle. For each experiment, 4 plates were sorted per genotype, then samples were swapped to the other machine to sort an additional 4 plates. The library preparation was performed as previously described with specific modifications described below 27 . Single nuclei were sorted into a 1 μl reverse transcription reaction that contains 1X First-Strand buffer (Invitrogen) supplemented with 2.5 mM MgCl 2 , 5mM DTT, 0.1% Triton X-100, 0.38 mM each dATP, dTTP, dGTP and 5-methyl-dCTP (NEB), 1 μM dT30VN_5 (/5Biosg/AAGCAGUGGUAUCAACGCAGAGUACUTTTTTUTTTTTUTTTTTUTTTTTUTT TTTVN, synthesized and HPLC purified by IDT), 2 μM N6_3 (/5Biosg/AAGCAGUGGUAUCAACGCAGAGUACNNNNNN, synthesized and HPLC purified by IDT), 2 μM TSO_4: (/5Biosg/AAGCAGUGGUAUCAACGCAGAGUGAAUrGrGrG, synthesized and HPLC purified by IDT), 0.4 U RNaseOUT (Invitrogen), 0.2 U SuperaseIn (Invitrogen), 2 U Superscript II (Invitrogen). The reverse transcription reaction was incubated in a thermocycler with the following condition: 25°C for 5 min, 42°C for 60 min, 70°C for 15 min followed by 4°C incubation. The cDNA was amplified by adding 3 μl PCR mix into each reverse transcription reaction. The PCR mix contains 0.8 μl 5X KAPA 2G Robust Buffer A, 0.2 μl 12 μM ISPCR23_3 (/5SpC3/AAGCAGUGGUAUCAACGCAGAGU), 0.016 μl 5U/μl KAPA2G Robust HotStart DNA Polymerase. The PCR reaction was performed using the following cycling condition: 95°C for 3 min for the initiation denaturing, 8 cycles amplification (95°C for 15 sec, 60°C for 30 sec, 72°C for 120 sec), followed by a final elongation at 72°C for 5 min. Excessive DNA oligos were digested using an 1 μl mix of 0.5 μl of 2U/μl Uracil DNA Glycosylase and 0.5 μl of EB buffer (Qiagen cat. # 19086) at 37°C for 30 min. The protocol of snmCT-seq is available on protocol.io at https://www.protocols.io/view/snmcat-v2-x54v9jby1g3e/v2/ . The snmCT-seq library was amplified for 20 cycles to account for the smaller genome size of Arabidopsis (130 Mb). snmCT-seq data analysis Initial alignment, quality filtering, and data extraction Each library consists of a pool of 384 individual libraries from a single 384 well plate, containing single sorted pollen nucleus in each well. Sixteen plates were sorted each for Col and mbd5/6 , across two separate experiments, for a total of 32 plates/pools of 384 single nuclei each. Note that the library prep for plate #8 of expt 2 Col, and plate #1 of expt 2 mbd5/6 failed, and so these plates were not analyzed. Final pools were each sequenced using a paired-end 100 bp x 100 bp protocol on Novaseq 6000, obtaining an average of approximately 70M reads with valid well barcodes per pool in expt 1, and 124M in expt 2 ( Supplementary Table 1 ). Each pool was initially processed using a custom pipeline (snmCT_seq_map.sh) which handled well demultiplexing, quality filtering, alignment, and extraction of WGBS per-position methylation data and RNA-seq per-gene count data. Briefly, read pairs were demultiplexed according to well barcode, with the same list of barcodes used for each plate (snmCAT_well_barcodes.txt). As recommended in Luo et al . 2017 61 , paired-end reads were hard trimmed by 10bp at both 5’ and 3’ ends to remove bias due to random priming and adaptase behavior, and the 5’ end of read 1 was trimmed by an additional 8 bp to remove the well barcodes. Additionally, due to high rates of chimeric transcripts, read pairs were treated as separate reads. Demultiplexed reads were then trimmed for any remaining adapter sequences and filtered to remove low quality sequences using trim_galore 47 with options -a AGATCGGAAGAG -q 25 --stringency 3 . Remaining reads were aligned to the transcriptome using STAR 48 with options --alignEndsType EndToEnd --outFilterType BySJout --outFilterMultimapNmax 1 --winAnchorMultimapNmax 1 -- outFilterMismatchNmax 999 --outFilterMismatchNoverReadLmax 0.05 -- alignIntronMin 70 --alignIntronMax 5000 --outFilterIntronMotifs RemoveNoncanonical , retaining only unique alignments. Reads that did not align to the transcriptome were then aligned to the bisulfite-converted genome using Bismark 56 with options -N 0 -L 20 --non_directional , again retaining only unique alignments. All RNA-seq and WGBS alignments were filtered to remove PCR duplicates using the MarkDuplicates function from the picard tools suite 49 . RNA-seq read counts over genes were obtained using htseq-count 51 , and WGBS data was processed using the Bismark methylation extractor function to obtain per-site methylation data. Wells/nuclei were then filtered using a very basic, permissive filter to remove failed wells. This filtering retained all wells with at least 1000 RNA-seq reads over at least 200 genes and at least 10% of 1 kb bins tiled genome-wide with 1+ WGBS read. All steps above were handled by our custom pipeline (snmCT_seq_map.sh, see code availability section). snmCT-seq transcriptome-based analysis and clustering Count data from all wells passing the basic RNA QC listed above were combined into one count matrix per sample (4 total). We then applied an additional filter designed to detect potential doublets (two or more nuclei stuck together and sorted into a single well). For this filter, we used the WGBS data for each nucleus to count the number of sites in the genome covered by at least one read, exactly one read, and more than one read. Since most nuclei in the dataset should be haploid (except GN post S-phase), and PCR duplicates have been removed, >1 coverage at any site should not occur. Indeed, coverage >1x was rare, but increased with total genome coverage ( Supplementary Figure S2a ). 163 nuclei across the dataset with substantially elevated rates of >1x coverage were censored as likely doublets ( Supplementary Figure S2a , red dots, Supplementary Table 3 ). Count data from remaining nuclei were then loaded into Seurat 4.0.4 28 and processed following a similar approach to the “Analysis of snRNA-seq” section in the methods of Ichino et al. 2022 6 . Briefly, nuclei were first filtered to exclude those with elevated rates of reads coming from the chloroplast and mitochondrial genomes (>10% of RNA-seq reads) ( Supplementary Table 3 ). We then ran the standard Seurat analysis pipeline to perform initial scaling and finding variable features, then integrated the four samples using the IntegrateData() function after selecting integration features and finding integration anchors. We then performed UMAP projection using RunUMAP() with reduction = ‘pca’, dims = 1:20, min.dist = 0.5, and performed clustering using FindNeighbors() and FindClusters() with resolution = 1.5 to obtain an initial clustering ( Supplementary Figure S2b ). We combined the three SN and the three GN clusters into single clusters due to similar marker expression. The “MN to VN” cluster was named based on having intermediate expression of both MN and VN1 markers, and the “VN1 to 2” cluster was named based on having intermediate expression of both VN1 and VN2 markers. This preliminary clustering also included a cluster that we labeled “VN and SN”, for having expression of both mature VN (VN4 + VN5) and SN markers ( Supplementary Figure S2c ). Upon closer inspection, it became clear that mature VN + SN doublets were common in the dataset and were not all detected in our prior coverage-based filtering ( Supplementary Figure S2a ). This is likely because, in mature pollen, sperm nuclei often form physical associations with vegetative nuclei 62 , and so may be more likely to be sorted together. As a result, a substantial fraction of nuclei in the mature VN and SN clusters had relatively strong expression of markers for both clusters, as did nuclei in the “VN and SN” cluster ( Supplementary Figure S2c ). Additionally, average CG DNA methylation over certain regions is much higher in sperm than in VN 13 , but our initial clustering revealed a subpopulation of SN with lower CG methylation, and a subpopulation of VN4 and VN5 with elevated CG methylation ( Supplementary Figure S2d ). We therefore applied an additional filter by calculating the log 2 ratio of average expression of SN markers, over average expression of VN4,5 markers, for each nucleus in VN4, VN5, and SN ( Supplementary Figure S2c ). All nuclei with a log 2 ratio within [-0.2,0.2] ( Supplementary Figure S2c , red dotted lines), indicating similar levels of mature VN and SN marker expression, were reassigned to the “VN and SN” cluster and censored from most analyses. Analysis of third replicate of snmCT-seq Initial alignment, quality filtering, and data extraction was performed as above. Preliminary doublet filtering based on WGBS coverage was also performed as above ( Supplementary Figure S2e ). Count data from remaining nuclei were then loaded into Seurat 4.0.4 28 , and preliminary filtering to exclude wells with high chloroplast or mitochondrial content was performed as for expts 1 and 2 above ( Supplementary Table 3 ). To obtain cluster assignments, the RNA counts matrix from each genotype in expt 3 was then projected onto the expt 1 + 2 UMAP using the Seurat function FindTransferAnchors() with parameters dims = 1:20, reference.reduction = “pca” , and using only features present in both datasets, followed by MapQuery() with parameters reference.reduction = “pca”, reduction.model = “umap” . Additional doublet filtering based on expression of mature VN and SN markers was also carried out on the nuclei assigned to mature VN or SN, as above ( Supplementary Figure S2f ). snmCT-seq DNA methylome data analysis Prior to snmCT-seq DNA methylome analysis, we performed additional filtering to remove nuclei (n=160) with likely poor bisulfite conversion rates, based on chloroplast methylation ( Supplementary Figure S3a-b ). After finalizing the clusters based on the RNA-seq data, the per-site methylation data for all nuclei in each cluster was pooled to obtain methylation tracks for each cluster using a custom script (see code availability section below). Methylation metaplots over different sets of peaks/genes/regions were generated with deeptools plotProfile 50 and chromosome-wide plots were made as described for bulk BS-seq. Additionally, average methylation per-nucleus over specific regions (e.g. VN CG hypomethylated DMRs) was calculated as the weighted mean (sum methylated / (sum methylated + sum unmethylated)) across all covered cytosines within the regions using a custom script (see code availability section below). For unsupervised clustering based on single-nucleus methylomes alone, we generated .allc files from the initial bismark BAM alignment files using the bam-to-allc function of ALLCools 63 . The fraction of methylated cytosines in each context (CGN, CHG, CHH) was calculated over 25 kb bins tiled genome-wide, by dividing the number of methylated cytosines in the correct context across all reads in the bin by the number of total cytosines in the correct context detected in the bin. UMAP dimensionality reduction was performed using Scanpy 64 . Gene and TE homology analysis for mbd5/6 upregulated loci (Supp. Fig. 1) Each of the 202 mbd5/6 upregulated loci ( Fig. 1d ) were blasted separately to the Araport11 41 gene, TE, and TE gene annotations using blastn 65 and output in format 6. For each locus, if there was no significant homology to a gene, and the TE or TE gene bitscore was > 100, the locus was classified as having TE homology. If there was no significant TE or TE gene homology, but a gene bitscore > 100, the locus was classified as having gene homology. For loci with some homology to both genes and TE/TEgenes, if one bitscore was at least 3x higher than the other, the locus was classified as belonging to the higher category. Six loci had no significant TE or gene homology and were classified as ‘neither’. Data Availability All sequencing data generated for this study are available in the Gene Expression Omnibus (GEO) database under SuperSeries GSE275832 (reviewer token adupemwetfmzbud). Published data used in this study: MBD5-Myc and MBD6-Myc (GSM5267036, GSM5267037, GSM5267038) 4 , H3K9me2 (GSM3130575, GSM3130576) 60 , NRPE1 (GSM2667838, GSM2667837) 43 , 10x snRNA-seq of pollen nuclei (GSM6122351 - GSM6122362) 6 . All raw imaging data was uploaded to the publicly available Dryad database at: http://datadryad.org/stash/share/5uba9L45O928v_qGI_TZaityozQO3nAFwXUI0JI2BZ4 (temporary reviewer link). Seurat objects for the snmCT-seq data analysis are available on github at: https://github.com/clp90/MBD_antagonism Code Availability All custom scripts used for this project are available from github at: https://github.com/clp90/MBD_antagonism Author Contributions LI and SEJ initially conceived the project. LI, CLP, and SEJ wrote the manuscript. All authors participated in manuscript editing. LI performed most of the experiments with assistance from JY. snmCT-seq experiments were carried out by LI, CLP, TB, KDA, and YZ. ChIP-seq experiments were performed by CLP and TB with assistance from SMLS. MBD6 SWAP experiments were conceived by BAB and carried out by BAB, TB, NJB, and SMLS. Data analysis was performed mostly by CLP with help from LI, BAB, and KDA. Work was supervised by CL and SEJ. Supplementary Information Download figure Open in new tab Extended Data 1: pollen RNA-seq analysis related to Fig. 1 . A) Sequence of the guides used to generate CRISPR mutants of MBD5 (left) and MBD7 (right), with Sanger sequencing chromatograms of resulting mutant lines. B) Overlap between mbd5/6 upregulated transcripts in pollen identified in both replicates and pooled analysis from this study, as well as Ichino et al. 2022 6 bulk pollen data. C) Comparison of DESeq2 52 log 2 ( mbd5/6 / wild-type) expression fold change estimates from batch 1 data, batch 2, and the combined (pooled) analysis, over significantly differentially expressed transcripts identified in batch 1 alone, batch 2 alone, and the pooled analysis combining both. DWN = downregulated in mbd5/6 vs. WT, UP = upregulated in mbd5/6 vs. WT. D) Scatterplot of DESeq2-estimated log2 fold change (log2FC) in mbd5/6 vs. mbd5/6/ 7, for the 202 loci significantly upregulated in mbd5/6. Loci were separated based on rescue status, identified based on hierarchical clustering (see Fig. 1d ). E) Heatmap of pollen RNA-seq expression for the 29 transcripts significantly downregulated in mbd7 . Rightmost column flags mbd5/6 upregulated transcripts rescued, partially rescued, and not rescued in mbd5/6/7 (see Fig. 1d ). TPM: transcripts per million, scaled by row. Download figure Open in new tab Extended Data 2: MBD7 ChIP-seq validation and immunofluorescence assays related to Fig. 2 . A) Western blot of MBD6-Flag and MBD7-Flag, MBD7-Flag mbd5/6 , and MBD7-Flag sln lines used for ChIP-seq. Left is the blot of chromatin input to the ChIP, right is post-IP. Expected sizes are 35 kDa for MBD6-Flag and 45 kDa for MBD7-Flag, although we always detect bands above these sizes for both proteins. Red stars indicate samples that were censored due to either unusually weak or strong signal in the input relative to the other lines. Each sample was a different independent transgenic line, numbered T2-[#]. B) Plot of MBD6-Flag ChIP-seq signal for both of the transgenic lines used, over MBD5/6 peaks identified in 4 . C) Loess regression and standard deviation comparing ChIP-seq signal in indicated genotype (average of all samples) to density of methylated CG (mCG), CHG (mCHG) or CHH (mCHH) sites (see methods). ChIP-seq signal shown is the ratio over the no-FLAG control and represents average of both lines for each genotype. Methylation data used was two published replicates from inflorescences with unopened flower buds 25 . The two replicates were pooled prior to analysis to increase depth. D) Two representative examples of nuclei expressing pMBD7::MBD7-YFP and incubated with DAPI to stain chromocenters. E) Example 3D reconstructed images of pMBD7::MBD7-YFP (top) from a Z-stack of root cells alongside quantification of number of foci detected across z-stack images per root tip (bottom, one root tip per n = 9 independent transformed lines per genotype) in both wild-type and ibm1 . F) (left) Representative images of nuclei co-expressing pMBD6::MBD6-RFP and either pMBD6::MBD6-YFP (top) or pMBD7::MBD7-YFP (bottom). (right) quantification of RFP and YFP signal strength in nuclei to the left. Signal was measured along a straight line drawn across the indicated foci (white arrow). Download figure Open in new tab Extended Data 3: MBD7 ChIP-seq analysis related to Fig. 2 . A) Metaplots of various epigenetic marks (histone H2A, H2A.X, and H2A.Z 42 , H2A.W 66 , H3K27me3 44 , H3K27ac 67 ) over the MBD7-dominant, MBD6-dominant, and mixed peaks from Fig. 2a . B) Metaplots and corresponding heatmaps of MBD7-Flag signal (log 2 of IP over no-FLAG control) in indicated background over transcripts downregulated in mbd7 , and a set of control genes matched for expression and length. Plotted values represent the average of multiple independent transgenic lines (N=3 for mbd7 , N=2 for mbd5/6/7 , and N=3 for mbd7;sln ). C) Heatmaps of MBD7-Flag signal (log 2 of IP over no-FLAG control), for multiple independent transgenic lines in the indicated mutant background. Heatmaps all share same row order, which was sorted based on the MBD7-Flag mbd7 T2-2 sample (first column), and is the same as in Fig. 2a . D) Metaplots and corresponding heatmaps of MBD7-Flag signal (log 2 of IP over no-FLAG control) in indicated background over pollen mbd5/6 upregulated transcripts that were rescued, partially rescued, and not rescued by loss of MBD7 (see clustering in Fig. 1d ). Control transcripts are an equal number of randomly selected genes matched for expression level and length. Plotted values represent the average of multiple independent transgenic lines (N=3 for mbd7 , N=2 for mbd5/6/7 , and N=3 for mbd7;sln ). E) Metaplot and heatmap of MBD6-Flag signal (log 2 of IP over no-FLAG control) over mbd5/6 rescued and not rescued transcripts, as well as mbd7 downregulated transcripts, and their matched control genes. Color legend for metaplot same as in (D). Download figure Open in new tab Extended Data 4: snmCT-seq transcriptome data validation related to Fig. 3 . (A) UMAP plots of Col and mbd5/6 samples from both experiments (1 and 2), shown separately. Clusters are labeled on far right plot. Col_1 = Col from expt 1. B) Expression of key marker genes in each cluster, across each experiment and genotype. DML3 and AT5G17340 are elevated in MN. The three VN markers are for early post-mitotic (MSP2), mid-stage (VEX1) and mature (VCK) VN. ENODL7, DUO1 and MORC5 mark GN, HTR10/MGH3 and PCR11 mark SN, and GRP17 marks somatic nuclei. C) Heatmap of correlation of RNA-seq data between clusters identified in snmCT-seq (this study) and a prior 10x pollen dataset. 6 D) Dotplots of average expression of indicated genes across snmCT-seq clusters in Col. E) Dotplots of average expression of indicated genes across snmCT-seq clusters in mbd5/6 . F) Dotplots of average expression of the three H1 homologs in both published 10x pollen data 6 and the snmCT-seq data (this study). Download figure Open in new tab Extended Data 5: unsupervised clustering of nuclei based on snmCT-seq methylation data, related to Fig. 4. (A) UMAP projection of the full snmCT-seq dataset, using the CG methylation data averaged over non-overlapping, 25 kb bins tiled genome-wide. Each plot highlights nuclei in the indicated cluster, using cluster identities based on the snmCT-seq transcriptome data (Fig. 3b). (B) Same as A, but using the CHG methylation data. (C) Same as A, but using the CHH methylation data. Download figure Open in new tab Extended Data 6: Methylation dynamics in Col pollen across snmCT-seq replicates related to Fig. 4. A) Diagram of approximate relative CHG methylation levels during development from vegetative tissue to MN, and finally to mature SN and VN (cite). B) Heatmaps of average CG, CHG and CHH methylation for indicated clusters of nuclei across the length of Chr4, with bins of 100kb. Approximate location of the pericentromere is highlighted in diagram above each plot. C) Distribution of average per-nucleus snmCT-seq methylation for nuclei assigned to each cluster. Average methylation was computed over regions hypomethylated in the CG context in VN (CG and CHG plots) and hypermethylated in the CHH context in VN (CHH plot), relative to SN. These regions were previously identified from bisulfite-sequencing of purified FACS-sorted VN populations 13 . Nuclei from replicate 1 and 2 shown separately. D) Metaplots of methylation data pseudobulked for each cluster indicated, over different genomic annotations. Average of both reps. E) Same as D, but over MBD6 peaks identified from our ChIP-seq. Download figure Open in new tab Extended Data 7: Methylation changes in mbd5/6 pollen across the snmCT-seq dataset related to Fig. 4 . (A) MBD6-3xFLAG ChIP-seq signal in inflorescences over (1) the intersection of MBD6 peaks and VN CG hypo DMRs 13 (“MBD6 and CGhypo”), (2) MBD6 peaks not overlapping VN CG hypo DMRs (“MBD6 not CGhypo”), and (3) VN CG hypo DMRs not overlapping MBD6 peaks (“CGhypo not MBD5/6”). Plotted log2 fold change value is average of two independent transgenic lines. (B) Distribution of snmCT-seq per-nucleus average CHG (top) and CHH (bottom) methylation levels calculated over the indicated set of regions, comparing Col nuclei to mbd5/6 nuclei in each pollen nuclei type cluster (x-axis). (C) Same as B, but showing only the MBD6 peaks overlapping VN CG hypo DMRs, and showing both snmCT-seq replicates separately. (D) Distribution of snmCT-seq per-nucleus average CG methylation levels genome-wide, excluding the chloroplast and mitochondrial chromosomes. (D) Distribution of snmCT-seq per-nucleus average CHH methylation levels over VN CHH hyper DMRs 13 . (E) Distribution of snmCT-seq per-nucleus average CG methylation levels over +/-400bp surrounding the TSSs of immature (top) and mature (bottom) mbd5/6 VN differentially expressed transcripts ( Fig. 4e-f ) in nuclei of indicated nuclei type cluster and genotype, and replicate, showing both snmCT-seq replicates separately. (F) Metaplots of snmCT-seq methylation profiles pseudobulked across all nuclei in indicated nuclei type cluster, genotype and replicate, for immature and mature VN differentially expressed transcripts ( Fig. 4e-f ). Download figure Open in new tab Extended Data 8: Rescue of mbd5/6 methylation loss in mbd5/6/7 whole pollen. (A) Smoothed average CG methylation levels across the entire 4 th chromosome for whole pollen with indicated genotypes, average of all replicates. (B) Violin plots of average CG methylation difference in indicated mutant vs. wild-type, calculated over the TSS region (+/- 400bp of TSS) of transcriptionally rescued mbd5/6 upregulated transcripts (left) and ‘not rescued’ transcripts (right). Plotted values are averages across all replicates **** = p < 0.0001, *** = p < 0.001, ** = p < 0.01, * = p < 0.05, n.s. = not significant, two-sided paired t-tests. (C) Violin plots of average CG methylation difference in indicated mutant vs. wild-type, calculated over the intersection between VN CG hypo DMRs 13 and MBD6 ChIP-seq peaks. P- values are two-sided paired t-tests. (D) Violin plots of average CHG methylation difference in indicated mutant vs. wild-type, calculated over the TSS region (+/- 400bp of TSS) of transcriptionally rescued mbd5/6 upregulated transcripts (left) and ‘not rescued’ transcripts (right). Values are averages across all replicates. Stars representing p- values are same as in B. (E) Example genome browser images showing RNA-seq, WGBS, and MBD6 and MBD7 ChIP-seq for a transcriptionally rescued mbd5/6 upregulated transcript (left) and a ‘not rescued’ transcript. ChIP-seq tracks are average of all independent lines (N=2 for MBD6-Flag, N=3 for MBD7-Flag). Download figure Open in new tab Extended Data 9: Validation of snmCT-seq experiment testing rescue of mbd5/6 by mbd7 . (A) UMAPs showing data from each of the four samples from this experiment, projected onto the UMAP from previous experiments 1 + 2 ( Fig. 3b ). (B) Expression of key marker genes in each cluster (based on projection in A), across each of the four samples in this experiment. DML3 and AT5G17340 are elevated in MN. The three VN markers are for early post-mitotic (MSP2), mid-stage (VEX1) and late-stage (VCK) VN. ENODL7, DUO1 and MORC5 mark GN, HTR10/MGH3 and PCR11 mark SN, and GRP17 marks somatic nuclei. (C) Comparison of methylation dynamics across all snmCT-seq replicates for Col and mbd5/6 . CG (top) and CHH (bottom) methylation levels over VN CG hypo DMRs and VN CHH hyper DMRs 13 , across nuclei in indicated cluster. Each point in the violin plot represents one nucleus’ average methylation over the indicated DMRs. Nuclei from each of the three snmCT-seq experiments (experiments 1 and 2 shown in Fig. 3 , experiment 3 in Fig. 5 ) are shown separately. (D) Average methylation across the four genotypes tested in snmCT-seq experiment 3, across the TSS region of mbd5/6 upregulated transcripts ‘not rescued’ (left) or ‘rescued’ (right) by mbd7 . Each point in the violin plot represents one nucleus’ average methylation over the indicated regions. (E) Same as D, but for loci downregulated in mbd7 pollen, see Ext. Data Fig. 1e . (D-E) Number of stars indicates Cohen’s d. (n.e. = no/minimal effect (|d| 0.2, ** = |d| > 0.5, *** = |d| > 0.9, **** = |d| > 1.5), red color = p < 0.001, two-sided t- test. Download figure Open in new tab Extended Data 10: Validation of MBD6 SWAP related to Fig. 6. (A) Diagram of MBD7 deletions used for BiFC experiments. (B) Example BiFC images testing for interaction between indicated pairs of proteins. (C) Example images (top) and quantification of visible foci (bottom) of either wild-type or acd15 acd21 root nuclei co-expressing a wild-type MBD6 tagged with RFP, and either WT MBD6 or MBD6 SWAP tagged with YFP, from z-stack images of root tips. (D) YFP fluorescence imaging of root nuclei expressing MBD6 SWAP ::YFP in either wild-type or idm3 background. Quantification of foci counts per z-stack at right. (E) Distribution of the difference in DNA methylation between wild-type (WT) and indicated genotype, all three replicates per genotype shown. Values were calculated over regions indicated at top of plot. (F) Distribution of the difference in DNA methylation between wild-type (WT) and indicated genotype, average of three replicates. Values were calculated over mbd5/6 upregulated transcripts whose expression is rescued in mbd5/6/7 (left, see Fig. 1d) or not rescued (right). Average of three replicates shown. p- value = one-sided paired t -test. (G) Distribution of the difference in DNA methylation between wild-type (WT) and indicated genotype over 400 bins overlapping VN CG hypo DMRs. The bins were divided into quintiles based on average MBD6 occupancy by ChIP-seq, with Q1 = least MBD6 and Q5 = most MBD6. Note that CG hypo DMRs and MBD6 peaks strongly overlap (Fig. 4a). (H) Distribution of RNA-seq log 2 (TPM) for all replicates from Col, Col + MBD6 SWAP , mbd5/6 , and mbd5/6 + MBD6 SWAP (l1, l2, and l3 are different transgenic lines). Values shown are for mbd5/6 upregulated transcripts that had at least some expression in wild-type, separated based on whether they’re rescued or not rescued in mbd5/6/7 (Fig. 1d). p- value = two-sided paired t -test comparing the average of all samples within a genotype. Download figure Open in new tab Supplementary Fig. 1: Annotation of mbd5/6 upregulated transcripts. (A) Heatmap of normalized average H3K9me2 signal 60 , NRPE1 signal 43 , and DNA methylation in the CG, CHG and CHH contexts 25 , over all 202 mbd5/6 upregulated transcripts. As a control, a set of 20 randomly selected control genes is also included (flagged grey in ‘up in mbd5/6 ’ column). The ‘rescue status’ column flags loci based on their rescue status in Fig. 1d (‘rescued’, ‘partially rescued’, or ‘not rescued’; all others flagged as ‘inconsistent’). The ‘seq. homology’ column indicates whether the locus was considered to have higher homology to existing Araport11 41 gene or TE/TE gene annotations (see methods). Dendogram and transcript IDs highlighted red are putative expressed genes, based on the hierarchical clustering. (B) Example novel annotation that was considered a gene or gene-like (‘novel_Chr2_noncoding_23’). (C) Example novel annotation that was considered a TE, with TE-like methylation and H3K9me2 (‘novel_Chr5_noncoding_631’). Download figure Open in new tab Supplementary Figure 2: Quality control of snmCT-seq dataset – doublet filtering. A) Doublet filtering based on WGBS coverage for snmCT-seq experiments 1+2. Each point represents a single nucleus. x-axis indicates fraction of cytosines in the genome covered by WGBS reads (≥1x), scaled to the nucleus with the highest coverage in the dataset (whose value is set to x = 1). y-axis represents the fraction of the genome covered >1x, using the same scaling. Rates of >1 coverage increase as overall genome coverage increases, but nuclei that showed substantially higher rates of >1 coverage areas were censored as possible doublets (red dots). N = 163 nuclei were censored because of this filter (see methods). B) Initial UMAP plot of all nuclei from snmCT-seq experiments 1+2 passing the filter in (A) and other basic QC filters (see methods), with cluster labels based on marker gene expression. A putative doublet cluster (‘VNandSN’) has expression of both mature VN and SN markers. C) Doublet filtering based on transcription – experiments 1+2. Log 2 ratio of the average expression of SN markers divided by the expression of mature VN markers for each nucleus, among nuclei in different clusters from (B). Nuclei assigned to the immature VN, as a control, are not enriched for either set of markers. However, VN4, VN5, and SN all have some nuclei falling close to a log 2 ratio of zero (indicating similar expression of mature VN and SN marker genes). Red vertical lines indicate a cutoff of log 2 ratio between −0.2 and 0.2. VN4, VN5, and SN nuclei falling within this region were reassigned to the “VNandSN” cluster as likely doublets. D) Effect of reassigning putative VN/SN doublets identified in (C) to the “VNandSN” cluster in (B). Plot shows distribution of CG methylation levels over VN CG hypo DMRs 13 across all nuclei in indicated cluster, based on different methods to censor doublets. Panel on left shows coverage filter only (see panel A), while right panel shows both coverage filter and the marker expression-based filter in panel C. E) Doublet filtering based on WGBS coverage – experiment 3. F) Doublet filtering based on transcription – experiments 3. VN4 and VN5 were combined into one group (“mature VN”). Download figure Open in new tab Supplementary Figure 3: WGBS conversion rates in the snmCT-seq data. (A) Average fraction CpG methylation over the chloroplast in each sample in experiments 1 and 2. Right panel is same as left, but zoomed in to x in [0,0.2]. (B) Location of the n = 160 nuclei censored for DNA methylation analysis due to low conversion rates in experiments 1 and 2. (C) Average fraction CpG methylation over the chloroplast in each sample in experiment 3. Right panel is same as left, but zoomed in to x in [0,0.2]. (D) Location of the n = 124 nuclei censored for DNA methylation analysis due to low conversion rates in experiment 3. Supplementary Table 1: Sequencing data generated for this study. Lists all RNA-seq, snmCT-seq, ChIP-seq and WGBS libraries sequenced for this study. Three sets of RNA-seq libraries (lib1-lib3) and five batches of WGBS libraries (lib1-lib5) were sequenced. Col-0 = wild-type, mbd5/6 = mbd5 mbd6 double mutant, mbd7 = mbd7 TDNA (GABI_067_A09) mutant, mbd5/6/7 = mbd5 mbd6 mbd7 triple mutant, MBD6 SWAP is a transgene of MBD6 where the MBD6 StkyC has been replaced with the MBD7 StkyC, and line1-3 represent independent transformed lines with the transgene. For snmCT-seq, three separate experiments were performed (expt 1, 2, and 3). For each experiment, Col-0 and mbd5/6 (plus mbd7 and mbd5/6/ 7 in expt 3) pollen nuclei were sorted into 384 well plates, and wells on a plate were multiplexed and sequenced together. Expt #2 Col plate 8 and mbd5/6 plate 1 failed during library prep and were not sequenced. Pairs with valid barcode = number of read pairs sequenced that had a valid well/nucleus ID barcode, median pairs per well = median read pairs per well for indicated plate, %QC pass = percent of reads obtained for plate that passed basic QC filtering for poor quality reads, % align (RNA) = percent of reads that mapped uniquely to the unconverted transcriptome, % align (WGBS) = percent of reads that did not align to transcriptome and did align to converted genome, % dedup (RNA) = percent of RNA reads that were removed as probable PCR duplicates, % dedup (WGBS) = percent of genomic (bisulfite-converted) reads that were removed as probable PCR duplicates. Supplementary Table 2: RNA-seq log2(fold change) and TPM estimates. First tab contains the DESeq2 log2(fold change) and adjusted p- value estimates for indicated sample vs. wild-type (Col0) for all lib1 and lib2 samples (see Supplementary Table 1 for list of libraries), as well as for indicated sample + or – SWAP transgene for lib3 samples. The DE analysis of the lib1 and lib2 samples considered all of them together as replicates. Column names are [library pool]_[genotype of log2fc numerator]_v[genotype of log2fc numerator]_[log2fc/padj] where log2fc = log2(fold change) and padj = adjusted p-value. Variables on far right flag significantly DE genes. Second tab contains TPM estimates from Stringtie for all RNA-seq samples. Column names are [library pool]_[genotype]_[replicate]_tpm. Supplementary Table 3: metadata, quality filtering and cluster assignments for snmCT-seq nuclei. Nuclei are indexed by experiment (1, 2, or 3), genotype (Col-0, mbd5/6 , mbd7 , mbd5/6/7 ), plate (1-8) and well (A-P1-24). Additionally, each plate has one row indicating the number of reads from that plate that could not be assigned to any barcode/nucleus. The ‘RNA STATISTICS’ section gives per-nucleus total reads mapping to the transcriptome, genes detected, and reads not overlapping features, as well as a pass/fail column indicating if the nucleus passed basic filters for RNA-seq data quality (see methods). The ‘WGBS COVERAGE’ section indicates the percentage of 1,000 bp non-overlapping bins tiled genome-wide that contained at least one cytosine in the indicated sequence context with at least one overlapping WGBS read, as well as a pass/fail column for WGBS data quality (see methods). The ‘FINAL ASSIGNMENT’ section indicates which nuclei passed the basic initial filtering (pass = both RNA and WGBS portions passed), coverage-based doublet filtering ( Fig. S2a,e ), filtering based on elevated mitochondrial/chloroplast RNA reads, overall status (pass/fail) of the nucleus, as well as the cluster ID to which this nucleus was assigned based on Seurat analysis of RNA-seq data. The ‘CHLOROPLAST METHYLATION AVERAGES’ section indicates, for each nucleus with sufficient quality WGBS data, the average number of sites with data and average methylation in indicated sequence context, only over the chloroplast. Additionally, nuclei censored due to low conversion rates, based on elevated chloroplast methylation, are indicated here. The ‘GENOME-WIDE METHYLATION AVERAGES’ section is the same as the chloroplast section, but instead over the entire genome excluding the mitochondrial and chloroplast genomes. A second tab lists the number of nuclei assigned to each cluster by experiment and genotype. Supplementary Table 4: average snmCT-seq methylation data over different genomic regions. For each nucleus, methylation data over all genomic regions in the indicated set of regions was averaged. N_sites = number of covered sites across all regions, avg_cov = average coverage per site, avg_me = average methylation. The cluster assignment of each nucleus is also included. Acknowledgements We thank S. Feng, M. Akhavan, and the UCLA Broad Stem Cell Research Center BioSequencing core for high throughput sequencing, and Felicia Codrea and the Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research UCLA Flow Cytometry Core Resource for nuclei sorting. We also thank Yan He and other members of the Jacobsen lab for assistance with ChIP-seq and helpful discussion, and C. Liu and M. Heffel for help with data analysis. This work was supported by a Ruth L. Kirschstein National Institutes of Health Award (F32GM136115) to C.L.P., a Philip Whitcome Pre-Doctoral Fellowship in Molecular Biology to L.I., an NSF GRFP (DGE-2034835, DGE-2444110) to T. J. B., and work in the Luo lab was supported by the UCLA DGSOM startup fund. S.E.J. is an Investigator of the Howard Hughes Medical Institute. Funder Information Declared Ruth L. Kirschstein National Institutes of Health Award , F32GM136115 NSF GRFP , DGE-2034835 , DGE-2444110 Howard Hughes Medical Institute Footnotes https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE275832 https://github.com/clp90/MBD_antagonism References 1. ↵ Greenberg , M. V. C. & Bourc’his , D . The diverse roles of DNA methylation in mammalian development and disease . Nat Rev Mol Cell Biol 20 , 590 – 607 ( 2019 ). OpenUrl CrossRef PubMed 2. Hemenway , E. A. & Gehring , M . Epigenetic Regulation During Plant Development and the Capacity for Epigenetic Memory . Annu Rev Plant Biol 74 , 87 ( 2023 ). 3. ↵ Schmitz , R. J. , Lewis , Z. A. & Goll , M. G . DNA methylation: shared and divergent features across eukaryotes . Trends Genet 35 , 818 ( 2019 ). 4. ↵ Ichino , L. et al. MBD5 and MBD6 couple DNA methylation to gene silencing through the J-domain protein SILENZIO . Science (1979) 372 , 1434 – 1439 ( 2021 ). OpenUrl Abstract / FREE Full Text 5. ↵ Boone , B. A. et al. ACD15, ACD21, and SLN regulate the accumulation and mobility of MBD6 to silence genes and transposable elements . Sci Adv 9 , 1 – 14 ( 2023 ). OpenUrl CrossRef 6. ↵ Ichino , L. et al. Single-nucleus RNA-seq reveals that MBD5, MBD6, and SILENZIO maintain silencing in the vegetative cell of developing pollen . Cell Rep 41 , 111699 ( 2022 ). OpenUrl CrossRef PubMed 7. ↵ Ibarra , C. A. et al. Active DNA Demethylation in Plant Companion Cells Reinforces Transposon Methylation in Gametes . Science (1979) 337 , 1360 – 1364 ( 2012 ). OpenUrl Abstract / FREE Full Text 8. ↵ Park , J. S. et al. Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana . Proc Natl Acad Sci U S A 114 , 2078 – 2083 ( 2017 ). OpenUrl Abstract / FREE Full Text 9. Schoft , V. K. et al. Function of the DEMETER DNA glycosylase in the Arabidopsis thaliana male gametophyte . Proc Natl Acad Sci U S A 108 , 8042 – 8047 ( 2011 ). OpenUrl Abstract / FREE Full Text 10. Mérai , Z. et al. The AAA-ATPase molecular chaperone Cdc48/p97 disassembles sumoylated centromeres, decondenses heterochromatin, and activates ribosomal RNA genes . Proc Natl Acad Sci U S A 111 , 16166 – 16171 ( 2014 ). OpenUrl Abstract / FREE Full Text 11. ↵ He , S. , Vickers , M. , Zhang , J. & Feng , X . Natural depletion of histone H1 in sex cells causes DNA demethylation, heterochromatin decondensation and transposon activation . Elife 8 , e42530 ( 2019 ). OpenUrl PubMed 12. ↵ Calarco , J. P. et al. Reprogramming of DNA methylation in pollen guides epigenetic inheritance via small RNA . Cell 151 , 194 – 205 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 13. ↵ Khouider , S. et al. Male fertility in Arabidopsis requires active DNA demethylation of genes that control pollen tube function . Nat Commun 12 , 410 ( 2021 ). 14. ↵ Li , L. et al. ARID1 is required to regulate and reinforce H3K9me2 in sperm cells in Arabidopsis . Nature Communications 2024 15 : 1 15, 1 – 14 ( 2024 ). OpenUrl CrossRef PubMed 15. ↵ Li , D. et al. The MBD7 complex promotes expression of methylated transgenes without significantly altering their methylation status . Elife 6 , e19893 ( 2017 ). OpenUrl PubMed 16. ↵ Wang , C. et al. Methyl-CpG-Binding Domain Protein MBD7 Is Required for Active DNA Demethylation in Arabidopsis . Plant Physiol 167 , 905 – 914 ( 2015 ). OpenUrl Abstract / FREE Full Text 17. Li , Q. et al. Regulation of Active DNA Demethylation by a Methyl-CpG-Binding Domain Protein in Arabidopsis thaliana . PLoS Genet 11 , e1005210 ( 2015 ). OpenUrl CrossRef PubMed 18. ↵ Lang , Z. et al. The Methyl-CpG-Binding Protein MBD7 Facilitates Active DNA Demethylation to Limit DNA Hyper-methylation and Transcriptional Gene Silencing . Mol Cell 57 , 1 – 13 ( 2015 ). OpenUrl CrossRef PubMed 19. Qian , W. et al. Regulation of active DNA demethylation by an α-crystallin domain protein in Arabidopsis . Mol Cell 55 , 361 – 371 ( 2014 ). OpenUrl CrossRef PubMed Web of Science 20. ↵ Zhao , Y. et al. REPRESSOR OF SILENCING5 Encodes a Member of the Small Heat Shock Protein Family and Is Required for DNA Demethylation in Arabidopsis . Plant Cell 26 , 2660 – 2675 ( 2014 ). OpenUrl Abstract / FREE Full Text 21. Li , X. et al. Antisilencing role of the RNA-directed DNA methylation pathway and a histone acetyltransferase in Arabidopsis . Proc Natl Acad Sci U S A 109 , 11425 – 11430 ( 2012 ). OpenUrl Abstract / FREE Full Text 22. Qian , W. et al. A Histone Acetyltransferase Regulates Active DNA Demethylation in Arabidopsis . Science (1979) 336 , 1445 – 1448 ( 2012 ). OpenUrl Abstract / FREE Full Text 23. ↵ Duan , C. G. et al. A pair of transposon-derived proteins function in a histone acetyltransferase complex for active DNA demethylation . Cell Res 27 , 226 – 240 ( 2017 ). OpenUrl PubMed 24. ↵ Zemach , A. et al. The C-terminal domain of the Arabidopsis AtMBD7 protein confers strong chromatin binding activity . Exp Cell Res 315 , 3554 – 3562 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 25. ↵ Harris , C. J. et al. A DNA methylation reader complex that enhances gene transcription . Science (1979) 362 , 1182 – 1186 ( 2018 ). OpenUrl Abstract / FREE Full Text 26. ↵ Bewick , A. J. & Schmitz , R. J . Gene body DNA methylation in plants . Curr Opin Plant Biol 36 , 103 – 110 ( 2017 ). OpenUrl CrossRef PubMed 27. ↵ Luo , C. et al. Single nucleus multi-omics identifies human cortical cell regulatory genome diversity . Cell Genomics 2 , 100107 ( 2022 ). 28. ↵ Hao , Y. et al. Integrated analysis of multimodal single-cell data . Cell 184 , 3573 – 3587 ( 2021 ). OpenUrl CrossRef PubMed 29. ↵ da Costa-Nunes , J. A . A novel arabidopsis marker line that strongly labels uninucleate microspores and the subsequent male gametophyte development stages . Springerplus 2 , 1 – 8 ( 2013 ). OpenUrl CrossRef PubMed 30. Borg , M. et al. Epigenetic reprogramming rewires transcription during the alternation of generations in arabidopsis . Elife 10 , 1 – 66 ( 2021 ). OpenUrl CrossRef PubMed 31. ↵ Okada , T. , Endo , M. , Singh , M. B. & Bhalla , P. L . Analysis of the histone H3 gene family in Arabidopsis and identification of the male-gamete-specific variant AtMGH3 . The Plant Journal 44 , 557 – 568 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 32. ↵ Kawashima , T. & Berger , F . Epigenetic reprogramming in plant sexual reproduction . Nat Rev Genet 15 , 613 – 624 ( 2014 ). OpenUrl CrossRef PubMed 33. ↵ Walker , J. et al. Sexual-lineage-specific DNA methylation regulates meiosis in Arabidopsis . Nat Genet 50 , 130 – 137 ( 2018 ). OpenUrl CrossRef PubMed 34. ↵ Gehring , M. et al. DEMETER DNA glycosylase establishes MEDEA polycomb gene self-imprinting by allele-specific demethylation . Cell 124 , 495 – 506 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 35. ↵ Frost , J. M. et al. FACT complex is required for DNA demethylation at heterochromatin during reproduction in Arabidopsis . Proc Natl Acad Sci U S A 115 , E4720 – E4729 ( 2018 ). OpenUrl Abstract / FREE Full Text 36. ↵ Gehring , M. & Satyaki , P. R. Endosperm and Imprinting, Inextricably Linked . Plant Physiol 173 , 143 – 154 ( 2017 ). OpenUrl FREE Full Text 37. ↵ Martínez , G. , Panda , K. , Köhler , C. & Slotkin , R. K . Silencing in sperm cells is directed by RNA movement from the surrounding nurse cell . Nat Plants 2 , 16030 ( 2016 ). 38. Slotkin , R. K. et al. Epigenetic Reprogramming and Small RNA Silencing of Transposable Elements in Pollen . Cell 136 , 461 – 472 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 39. Wu , W. et al. Heterochromatic silencing is reinforced by ARID1-mediated small RNA movement in Arabidopsis pollen . New Phytologist 229 , 3269 – 3280 ( 2021 ). OpenUrl CrossRef PubMed 40. ↵ Herridge , R. P. et al. Pseudouridine guides germline small RNA transport and epigenetic inheritance . Nat Struct Mol Biol 32 , 277 – 286 ( 2025 ). OpenUrl CrossRef PubMed 41. ↵ Cheng , C. Y. et al. Araport11: a complete reannotation of the Arabidopsis thaliana reference genome . The Plant Journal 89 , 789 – 804 ( 2017 ). OpenUrl CrossRef PubMed 42. ↵ Bourguet , P. et al. The histone variant H2A.W and linker histone H1 co-regulate heterochromatin accessibility and DNA methylation . Nat Commun 12 , ( 2021 ). 43. ↵ Liu , W. et al. RNA-directed DNA methylation involves co-transcriptional small-RNA-guided slicing of polymerase V transcripts in Arabidopsis . Nat Plants 4 , 181 – 188 ( 2018 ). OpenUrl PubMed 44. ↵ Wang , M. et al. Arabidopsis TRB proteins function in H3K4me3 demethylation by recruiting JMJ14 . Nature Communications 2023 14 : 1 14, 1 – 13 ( 2023 ). OpenUrl PubMed 45. ↵ Li , Z. et al. The MOM1 complex recruits the RdDM machinery via MORC6 to establish de novo DNA methylation . Nature Communications 2023 14 : 1 14, 1 – 16 ( 2023 ). OpenUrl PubMed 46. ↵ Yan , L. et al. High-Efficiency Genome Editing in Arabidopsis Using YAO Promoter-Driven CRISPR/Cas9 System . Mol Plant 8 , 1820 – 1823 ( 2015 ). OpenUrl CrossRef PubMed 47. ↵ Krueger , F. TrimGalore: A wrapper around Cutadapt and FastQC . Preprint at doi: 10.5281/zenodo.7598955 ( 2016 ). OpenUrl CrossRef 48. ↵ Dobin , A. et al. STAR: Ultrafast universal RNA-seq aligner . Bioinformatics 29 , 15 – 21 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 49. ↵ Broad Institute . Picard Toolkit . Preprint at https://github.com/broadinstitute/picard ( 2019 ). 50. ↵ Ramírez , F. et al. deepTools2: a next generation web server for deep-sequencing data analysis . Nucleic Acids Res 44 , W160 – W165 ( 2016 ). OpenUrl CrossRef PubMed 51. ↵ Anders , S. , Pyl , P. T. & Huber , W . HTSeq-a Python framework to work with high-throughput sequencing data . Bioinformatics 31 , 166 – 169 ( 2015 ). OpenUrl CrossRef PubMed Web of Science 52. ↵ Love , M. I. , Huber , W. & Anders , S . Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biol 15 , 550 ( 2014 ). 53. ↵ Kovaka , S. et al. Transcriptome assembly from long-read RNA-seq alignments with StringTie2 . Genome Biol 20 , 1 – 13 ( 2019 ). OpenUrl CrossRef PubMed 54. ↵ Wickham , H. ggplot2: Elegant Graphics for Data Analysis . Preprint at https://ggplot2.tidyverse.org ( 2016 ). 55. ↵ Kolde , R. pheatmap: Pretty Heatmaps . Preprint at https://github.com/raivokolde/pheatmap ( 2018 ). 56. ↵ Krueger , F. & Andrews , S. R . Bismark: A flexible aligner and methylation caller for Bisulfite-Seq applications . Bioinformatics 27 , 1571 – 1572 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 57. ↵ Wang , S. et al. MBD2 couples DNA methylation to transposable element silencing during male gametogenesis . Nature Plants 2024 10 : 1 10, 13 – 24 ( 2024 ). OpenUrl PubMed 58. ↵ Langmead , B. & Salzberg , S. L . Fast gapped-read alignment with Bowtie 2 . Nat Methods 9 , 357 – 359 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 59. ↵ Zhang , Y. et al. Model-based analysis of ChIP-Seq (MACS) . Genome Biol 9 , 1 – 9 ( 2008 ). OpenUrl CrossRef PubMed 60. ↵ Li , X. et al. Mechanistic insights into plant SUVH family H3K9 methyltransferases and their binding to context-biased non-CG DNA methylation . Proc Natl Acad Sci U S A 115 , E8793 – E8802 ( 2018 ). OpenUrl Abstract / FREE Full Text 61. ↵ Luo , C. et al. Single-cell methylomes identify neuronal subtypes and regulatory elements in mammalian cortex . Science (1979) 357 , 600 – 604 ( 2017 ). OpenUrl Abstract / FREE Full Text 62. ↵ Kron , P. , Loureiro , J. , Castro , S. & Čertner , M . Flow cytometric analysis of pollen and spores: An overview of applications and methodology . Cytometry Part A 99 , 348 – 358 ( 2021 ). OpenUrl 63. ↵ Liu , H. et al. DNA methylation atlas of the mouse brain at single-cell resolution . Nature 2021 598 : 7879 598, 120 – 128 ( 2021 ). OpenUrl CrossRef PubMed 64. ↵ Wolf , F. A. , Angerer , P. & Theis , F. J . SCANPY: Large-scale single-cell gene expression data analysis . Genome Biol 19 , 1 – 5 ( 2018 ). OpenUrl CrossRef PubMed 65. ↵ Camacho , C. et al. BLAST+: Architecture and applications . BMC Bioinformatics 10 , ( 2009 ). 66. ↵ Lorković , Z. J. et al. Compartmentalization of DNA Damage Response between Heterochromatin and Euchromatin Is Mediated by Distinct H2A Histone Variants . Current Biology 27 , 1192 – 1199 ( 2017 ). OpenUrl CrossRef PubMed 67. ↵ Yan , W. et al. Dynamic control of enhancer activity drives stage-specific gene expression during flower morphogenesis . Nat Commun 10 , ( 2019 ). View the discussion thread. Back to top Previous Next Posted October 15, 2025. Download PDF Supplementary Material Data/Code Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following An antagonistic epigenetic mechanism regulating gene expression in pollen revealed through single-nucleus multiomics Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share An antagonistic epigenetic mechanism regulating gene expression in pollen revealed through single-nucleus multiomics Colette L. Picard , Lucia Ichino , Tyler J. Buckley , Brandon A. Boone , Jaewon Yun , Kevin D. Abuhanna , Yi Zhang , Noah J. Behrendt , Su May Lei Soe , Chongyuan Luo , Steven E. Jacobsen bioRxiv 2025.10.13.682236; doi: https://doi.org/10.1101/2025.10.13.682236 Share This Article: Copy Citation Tools An antagonistic epigenetic mechanism regulating gene expression in pollen revealed through single-nucleus multiomics Colette L. Picard , Lucia Ichino , Tyler J. Buckley , Brandon A. Boone , Jaewon Yun , Kevin D. Abuhanna , Yi Zhang , Noah J. Behrendt , Su May Lei Soe , Chongyuan Luo , Steven E. Jacobsen bioRxiv 2025.10.13.682236; doi: https://doi.org/10.1101/2025.10.13.682236 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Molecular Biology Subject Areas All Articles Animal Behavior and Cognition (7642) Biochemistry (17715) Bioengineering (13907) Bioinformatics (42005) Biophysics (21472) Cancer Biology (18624) Cell Biology (25534) Clinical Trials (138) Developmental Biology (13391) Ecology (19935) Epidemiology (2067) Evolutionary Biology (24356) Genetics (15617) Genomics (22529) Immunology (17753) Microbiology (40437) Molecular Biology (17200) Neuroscience (88697) Paleontology (667) Pathology (2840) Pharmacology and Toxicology (4829) Physiology (7653) Plant Biology (15171) Scientific Communication and Education (2046) Synthetic Biology (4304) Systems Biology (9827) Zoology (2272)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00