Partition defective 3 promotes TAZ nuclear localization and promotes Amphiregulin transcription to promote liver hepatocellular carcinoma cell invasion, migration and epithelial mesenchymal

Partition defective 3 promotes TAZ nuclear localization and promotes Amphiregulin transcription to promote liver hepatocellular carcinoma cell invasion, migration and epithelial mesenchymal | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Partition defective 3 promotes TAZ nuclear localization and promotes Amphiregulin transcription to promote liver hepatocellular carcinoma cell invasion, migration and epithelial mesenchymal Hai-Yan Fu, Qiu-Hong Wang, Hong-Juan Li, Jian-Peng Gao, Li Liu, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1953346/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Partition defective 3 (PARD3) regulates cell polarity and functions as a cancer promoting or tumor suppressor in different cancer types. PARD3 was reported to be highly expressed in liver hepatocellular carcinoma (LIHC) tissues and high expression of PARD3 was significantly associated with poor clinicopathological features and lower overall survival, but whether PARD3 regulated invasion, migration and epithelial mesenchymal transition (EMT) in LIHC has not been reported. Objectives To investigate the effect and mechanism of PARD3 on LIHC cell invasion, migration and EMT. Methods PARD3 expression in LIHC tumor group and relationship with survival were queried according to the GEPIA website. PARD3 mRNA and protein expression in 41 clinical samples were determined by RT-qPCR and immunohistochemistry (IHC), respectively. PARD3, transcriptional coactivator with PDZ-binding motif (TAZ)and amphiregulin ༈AREG༉expression in HepG2 cells with overexpression or knockdown, and the expression of PARD3, TAZ, AREG and EMT related proteins were determined by Western blot. Transwell assay for HepG2cell invasion ability. The migration ability of HepG2 cells was detected by wound healing experiments. TAZ localization was detected by immunofluorescence. Co-IP detected the effect of PARD3 on TAZ and TAZ TEAD binding. The effect of TAZ on AREG transcript levels was examined by RT-qPCR. Results PARD3 was found to be highly expressed in LIHC tumor group by GEPIA website query, and the expression of PARD3 gradually increased with increasing tumor stage, and high expression of PARD3 usually means low overall survival in LIHC. We also found that PARD3 was highly expressed in LIHC tissues. Knockdown of PARD3 inhibited HepG2 cell invasion, migration and EMT, while overexpression of PARD3 played the opposite role. Moreover, PARD3 promotes AREG transcription by promoting TAZ nuclear localization, which in turn promotes LIHC cell invasion, migration and EMT. Conclusion PARD3 promotes TAZ nuclear localization and promotes AREG transcription to promote epithelial mesenchymal transition in LIHC. liver hepatocellular carcinoma epithelial mesenchymal transition PARD3 TAZ AREG Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Liver cancer is a major health problem and a cause of death worldwide. It is reported that the incidence rate of liver cancer will rise faster than other cancers, and the 5-year survival rate is only 18% in 2020. It is estimated that the number of liver cancer deaths will exceed 1 million in 2030 (Khamis, et al. 2021). In China, liver cancer accounts for 70–80% of primary liver malignancies and is the second leading cause of cancer-related death(Wang, et al. 2021 ). Liver cancer is divided into liver hepatocellular carcinoma (LIHC) and intrahepatic cholangiocarcinoma (CC), of which LIHC accounts for 75–85% and CC for 10–15% (Temraz, et al. 2021). Hepatitis virus, cirrhosis, alcohol consumption, metabolic syndrome, alcoholic liver disease, nonalcoholic steatohepatitis are all leading causes of hepatocellular carcinoma (Tang, et al. 2022; Yeh, et al. 2021 ). Currently, hepatectomy, percutaneous ablation, liver transplantation, gene therapy, immunotherapy, and genomically targeted therapy are all common treatments for LIHC (Cao, et al. 2021). However, since most LIHC patients are asymptomatic at an early stage and the disease is mainly diagnosed at an advanced stage, many patients do not receive early intervention and treatment, resulting in an overall poor prognosis(Wu, et al. 2021). Therefore, there is an urgent need to identify new effective biomarkers to evaluate the prognosis of LIHC patients, thereby improving the efficacy of treatment strategies and more refined follow-up plans. LIHC metastasis is considered to be the main reason for the high recurrence rate of LIHC, and epithelial mesenchymal transition (EMT) is important for the metastatic process(Zhu, et al. 2021 ). EMT is a highly conserved and reversible cellular process. In this process, epithelial cells lose apical basal polarity, weaken intercellular junctions and rearrange the cytoskeleton, acquire invasiveness, and become mesenchymal stem cells(Jung, et al. 2019; Lin, et al. 2019). This provides cancer cells with the ability to invade and disseminate during metastasis in the context of the tumor microenvironment, and confers drug resistance to malignancies(Xu, et al. 2021). Therefore, inhibition of EMT is an important means to inhibit tumor metastasis. Partition defective 3 (PARD3) has been reported to be involved in the development of tight junctions involved in epithelial cell-cell contact(Wang, et al. 2017). Depletion of PARD3 disrupts tight junction assembly(Huang, et al. 2022). However, the cellular functions of PARD3 in cell polarity formation, cell proliferation and migration are easily affected by many factors such as protein dislocation(Nakamura, et al. 2016). Current studies have shown that PARD3 has different roles in different cancer types. For example, in anaplastic thyroid cancer, PARD3 reduces cell invasion, migration and EMT(Zhang, et al. 2019). In lung squamous cell carcinoma, PARD3 plays an anti-cancer role by reducing tumor invasion and metastasis(Bonastre, et al. 2015). Whereas in colorectal cancer tissues PARD3 is overexpressed and inhibition of PARD3 inhibits cell proliferation(Wang and Jin 2019 ). It was also found that PARD3 was highly expressed in LIHC tissues, and high expression of PARD3 was significantly associated with adverse clinicopathological features and lower overall survival(Li, et al. 2021). In this paper, we mainly investigate whether PARD3 regulates EMT in LIHC and the possible mechanisms. TAZ, a well characterized transcriptional effector of Hippo signaling, is involved in various physiopathological processes, such as cell proliferation and death, and has the effects of promoting tumor growth, metastasis, drug resistance, and tissue regeneration(Gao, et al. 2021; Seo, et al. 2019; Thompson 2020 ). Studies have shown that TAZ is closely associated with the development and progression of LIHC, and inhibiting its activity may be a new approach for the treatment of LIHC(Cho, et al. 2021) In melanoma cells and breast cancer cells PARD3 promoted TAZ activity to promote cell growth(Lv, et al. 2015). According to the literature, we found that Amphiregulin (AREG) is a direct target gene of TAZ(Han, et al. 2014; Martini, et al. 2017). AREG has been reported to be involved in various physiopathological processes such as cancer(Steponaitis, et al. 2019), scleral remodeling(She, et al. 2022), skin fibrosis (Zhang, et al. 2021a), bone formation(Raimondo, et al. 2019). In cancer, AREG has been validated as an oncogene(Ahn, et al. 2013). For example, in pancreatic cancer cells AREG has been reported to promote cell invasion, migration and EMT(Wang, et al. 2020). AREG was detected to be up-regulated in human endometrial cancer tissues and inhibition of AREG showed migration and invasion inhibition on cells(Shimada, et al. 2017). Here, we investigated whether PARD3 regulates EMT process through TAZ-AREG in LIHC. 2. Materials And Methods 2.1 Database analysis Gene Expression Profiling Interactive Analysis (GEPIA) was used to analyze PARD3 expression between cancer tissues and adjacent noncancerous tissues in LIHC, the expression of PARD3 in different LIHC stages, and the correlation between PARD3 expression and LIHC survival. 2.2 Clinical tissue samples 41 cases of LIHC tissues and paracancerous tissues (at least 3 cm away from the tumor) were obtained from patients undergoing LIHC surgery at the Second Affiliated Hospital of Kunming Medical University Hospital during the period January 2020 to August. Inclusion criteria: patients diagnosed with LIHC by biopsy at the Department of Pathology. Patients with complete case data. Patients who did not receive any preoperative therapy. Exclusion criteria: Patients with multiple tumors combined. Patients with other diseases. And patients who have received any preoperative therapy. Post excision specimens were fixed with 4% paraformaldehyde and embedded in paraffin, some specimens were stored in -80 ℃ Celsius refrigerator. This workwas performed in accordance with The Code of Ethics of the World Medical Association (Declaration of Helsinki) for experiments. The manuscript conforms to the Recommendations for the Conduct, Reporting, Editing and Publication of Scholarly Work in Medical Journals and aim for the inclusion of representative human populations. And all the patients gave their consent and signed written informed consent for this experiment. The experiment was approved by the Second Affiliated Hospital of Kunming Medical University Hospital Ethics Committee(approval No.: 2022 − 136) 2.3 RT-qPCR Total RNA from tissues and cells was extracted by TRIzal kit, and cDNA was synthesized by a reverse transcription kit. The cDNA product was used as a template for PCR reactions and GAPDH was used as an internal control. The results were calculated using the 2 −ΔΔCT method. Primers were synthesized by GenePharma (China), PARD3 (F: CAGACAGAACTAACTTCGCC; R: ATGCCTCGAGAGAGTCCT). AREG(F: TGTCGCTT GATACTCCG3; R: AGGCATTTCACTCA GGGG3). GAPDH (F: AGCCACAATCGCTCAGACAC; R: GCCCAATACGACCAAATCC). 2.4 Immunohistochemistry (IHC) Dewaxing with xylene and hydration with gradient ethanol. Blocked with 1.5% goat serum for 1 h, added anti-PARD3 (1:500, Abcom, UK), and incubated overnight at room temperature. Secondary antibody (1:1000, Abcom, UK) was added and incubated for 1 h at room temperature. DAB development, hematoxylin counterstaining. Observe and photograph with an inverted microscope. 2.5 Cell Culture and Transfection Human hepatoma cells HepG2 were purchased from ATCC and cultured in DMEM medium containing 10% FBS at 37°C and 5% CO 2 . GenePharma (China) synthesized OE-PARD3, si-PARD3, OE-TAZ, si-TAZ, OE-AREG and negative controls. Transfection was performed using Lipofectamine™ 2000 (Invitrogen, USA). 2.6 Western blot Total protein in cells was extracted from PIPA lysate, and protein concentration was detected by BCA kit. Equal amounts (100 µg) of protein were separated on a 10% SDS-PAGE gel and transferred to PVDF membranes. Blocked with 5% nonfat dry milk for 1 h, the membrane was blocked with primary antibodies ( anti-PARD3, anti-E-cadherin, anti-Vimentin, anti-α-SMA, anti-Snail, anti-TAZ, anti-Tubulin, anti-PCNA, anti-TEAD, anti-AREG and anti-β-actin) overnight. All antibodies were purchased from Abcom, at a dilution ratio of 1:1000. The membranes were then incubated with the corresponding secondary antibodies for 1 h at room temperature. ECL kit to visualize protein bands. Image J quantification. 2.7 Transwell Cells were seeded on the upper chamber of Transwell (Corning, USA) supplemented with serum-free medium. The lower chamber was added with 500 µ L culture medium containing 10% FBS. After 48 h incubation, the cells on the luminal side of the membrane were removed. They were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. Observe and photograph under the microscope. Image J counts. 2.8 Wound healing experiments A density of 5 × 10 5 cells were seeded in 6-well plates. After 24 h incubation at 37°C, draw a line along the diameter of the well with a pipette tip. PBS wash to remove scratched cells. Serum-free medium was added for 48 h. Observed and photographed under the microscope at 0 h and 48 h. Image J calculates mobility. 2.9 Immunofluorescence HepG2 cells in each group were fixed with 4% paraformaldehyde for 30 min and permeabilized with 0.1% Triton X-100 for 5 min at 4°C. After blocking with 0.5% BSA for 30 min at room temperature, cells were incubated with anti-Smad3 (1:500) overnight at 4°C. The next day, after washing with PBS, cells were incubated with fluorochrome-conjugated secondary antibodies (1:1000) for 1 h. Then DAPI was added dropwise and incubated in the dark for 5 min to stain the specimens. After washing with PBS, photographs were taken under a fluorescence microscope. 2.10 Co-immunoprecipitation (Co-IP) Cells were collected 24–48 h after transfection, appropriate amount of cell lysis buffer containing protease inhibitors was added, lysed at 4℃ for 30 min, and the supernatant was taken after centrifugation at 12000 g for 30 min. A small volume of lysate was collected for subsequent Western blot analysis (input), and the remaining lysate plus 1 µg anti-TAZ and incubated overnight at 4℃. Add 10.0 µL protein A agarose beads (sigma Aldrich, Germany) and incubated for 2–4 h at 4 ° C with slow shaking to couple antibodies to protein A agarose beads. Beads were washed three times with appropriate lysis buffer with centrifugation at 5000 g for 5 min between each wash. Proteins were eluted from the magnetic beads with SDS sample buffer and subjected to Western blot analysis. 2.11 Dual luciferase reporter gene The AREG sequence containing the TEAD binding site was cloned into the pGL4.23 vector to construct a wild-type AREG plasmid (WT). The binding site was changed by a site-directed mutagenesis kit, and a mutant AREG plasmid (MUT) was constructed by the same method. WT and MUT were then transfected into HEK293T cells with OE-TEAD and negative control, respectively. After 48 h, the luciferase activity was detected by a dual-luciferase reporter gene detection system. 2.12 Statistical analysis All experiments in this paper were repeated three or more times, and all results were expressed as mean ± standard deviation. Statistical analysis was performed using SPSS 23. Comparisons between two groups were performed by t-test, and comparisons among multiple groups were performed by one-way ANOVA. P < 0.05 indicated statistical significance. 3. Results 3.1. Clinical data confirm that PARD3 regulates LIHC progression The clinical significance of PARD3 in regulating LIHC progression was analyzed through the GEPIA website ( http://gepia.cancer-pku.cn/index.html ). The results showed that compared with normal liver tissue, PARD3 expression was increased in the liver hepatocellular carcinoma (LIHC) group (Fig. 1 a). Meanwhile, the data also indicated that the expression of PARD3 increased gradually with increasing tumor stage (Fig. 1 b). Moreover, high expression of PARD3 generally means low overall survival in LIHC (Fig. 1 c). We collected 41 clinical samples and used RT-qPCR to detect PARD3 mRNA expression, which showed that PARD3 was highly expressed in LIHC tissues (Fig. 1 d). We also employed IHC to detect PARD3 expression in tissues, and the results also showed that PARD3 is highly expressed in LIHC tissues (Fig. 1 e). 3.2. PARD3 promotes EMT in LIHC First, Western blot was used to detect the transfection efficiency of PARD3. The results showed that the expression of PARD3 was significantly increased after transfection of OE-PARD3, and the expression of PARD3 was significantly decreased after transfection of si-PARD3 (Fig. 2 a). Further, the EMT markers E-cadherin, vimentin, α- SMA and Snail expression were detected by Western blot, the results showed that overexpression of PARD3 decreased E-cadherin expression without statistical difference, meanwhile, overexpression of PARD3 significantly up-regulated vimentin, α-SMA and Snail expression. Knockdown of PARD3 exerted the opposite effect (Fig. 2 b). Transwell was used to detect the invasion ability of HepG2 cells, the results showed that overexpression of PARD3 significantly promoted the cell invasion ability, while knockdown of PARD3 inhibited the cell invasion ability (Fig. 2 c). The migration ability of HepG2 cells was detected by wound healing experiments, and it was found that overexpression of PARD3 significantly promoted cell migration rate, and knockdown of PARD3 significantly inhibited cell migration rate (Fig. 2 d). Therefore, PARD3 promotes the EMT of LIHC. 3.3. PARD3 promotes TAZ nuclear localization and association with TEAD After transfection of OE-PARD3 or si-PARD3 in HepG2 cells, the nucleus and cytoplasm were separated and TAZ expression was detected by Western blot, the results showed that overexpression of PARD3 promoted TAZ expression in the nucleus, and knockdown of PARD3 inhibited TAZ expression in the nucleus, but overexpression and knockdown of PARD3 had no significant effect on TAZ expression in the cytoplasm (Fig. 3 a). Further, immunofluorescence was used to detect the nuclear localization of TAZ, and we found that overexpression of PARD3 promoted TAZ nuclear expression, and knockdown of PARD3 decreased TAZ nuclear expression (Fig. 3 b). Since previous studies have found that TEAD is the primary transcription factor that binds to TAZ through the TEA domain, it acts by binding to transcriptional coactivators, such as TAZ(Yuan, et al. 2019). Therefore, in this study, we used CO-IP to examine the effect of PARD3 on the binding of TAZ to TEAD, and the results showed that overexpression of PARD3 significantly promoted the binding of TAZ to TEAD, whereas knockdown of PARD3 significantly inhibited the binding of TAZ to TEAD (Fig. 3 c). From this, it is known that PARD3 promotes TAZ nuclear localization and association with TEAD. 3.4. TAZ activates AREG transcription We examined the effect of TAZ on AREG transcription by transfecting OE-TAZ and si-TAZ. Western blot was used to detect the transfection efficiency of TAZ. The results showed that the expression of TAZ was significantly increased after transfection of OE-TAZ, and the expression of TAZ was significantly decreased after transfection of si-TAZ (Fig. 4 a). Further, the dual-luciferase reporter gene was used to detect the targeting relationship between TAZ and AREG. The results showed that overexpression of TAZ significantly increased the dual-luciferase activity of the wild-type AREG vector, but had no significant effect on the double luciferase activity of mutant AREG vector (Fig. 4 b). RT-qPCR was used to detect the effect of TAZ on AREG transcription level, and the results showed that overexpression of TAZ significantly up-regulated AREG mRNA expression, while knockdown of TAZ down-regulated AREG mRNA expression (Fig. 4 c). Western blot was used to detect the effect of TAZ on the expression of AREG protein. The results showed that overexpression of TAZ significantly up-regulated the expression of AREG protein, while knockdown of TAZ inhibited the expression of AREG protein (Fig. 4 d). From this, it was found that TAZ activates AREG transcription. 3.5. PARD3 promotes EMT in HepG2 cells by promoting TAZ nuclear localization and AREG transcription To further verify whether PARD3 promotes AREG transcription to promote EMT in HepG2 cells by promoting TAZ nuclear localization, we verified this by co-transfection of si-PARD3 and OE-TAZ, si-PARD3 and OE-AREG. After successful transfection, we used Western blot, Transwell and wound healing assay to detect the expression of EMT related proteins, cell migration ability and invasion ability, respectively, and the results showed that overexpression of TAZ and AREG both reversed the inhibition of EMT, migration and invasion by si-PARD3 in HepG2 cells (Fig. 5 a-c). It can be seen that PARD3 promotes the EMT of HepG2 by promoting the nuclear localization of TAZ and promoting the transcription of AREG. 4. Discussion Tumor metastasis is one of the important causes of high mortality in patients with LIHC. EMT is the initial event of tumor cell invasion and metastasis(Yuan, et al. 2020). EMT in cancer cells typically begins with loss of epithelial cell polarity, E-cadherin downregulation in epithelial cells, and loss of cell-cell adhesion mediated by α-SMA and Vimentin upregulation in mesenchymal cells, which in turn induces tumor cell mobility and increases the risk of lymph node or distant metastases (Gurzu, et al. 2019; Sun, et al. 2020) . At the molecular level, transcription factors such as snail, slug, twist, ZEB1, ZEB2, SIP1 and E12/47 are key genes that down regulate E-cadherin and cytokeratin(Kyung, et al. 2018). In recent years, a large number of studies have found that EMT is one of the important mechanisms of LIHC metastasis, and many potential targets for LIHC metastasis treatment have been found based on EMT signal pathway, but the research and development of corresponding drugs are extremely scarce(Zhang, et al. 2021b ). PARD3 is a member of the partitioning defective protein (Par) family. In the epithelium, PARD3 is localized to tight junctions in the Par complex, forming the boundary between the apical and basolateral domains. It plays a role in processes such as maintaining asymmetric cell division, apical basal polarity, and directional cell migration (Abdi and Kuo 2018 ; Li, et al. 2019). It is well known that PARD3 is an important gene regulating polarity, and loss of cell polarity is a feature of advanced and aggressive cancers. Therefore, PARD3 was confirmed to have invasion and migration inhibitory effects possibly through regulating cell polarity(Dadras, et al. 2021). However, studies have also shown that PARD3 acts as an oncogene in ovarian cancer(Nakamura, et al. 2016), prostate cancer(Zhou, et al. 2017) and other cancers. Furthermore, in skin cancer, PARD3 shows dual roles depending on tumor type(Iden, et al. 2012). Thus, PARD3 exhibits dual functions in tumorigenesis depending on the cancer type. According to the GEPIA website, we found that PARD3 expression was increased in LIHC tumor groups, and the expression of PARD3 gradually increased with the increase of tumor stage, and high expression of PARD3 usually means low overall survival in LIHC. We obtained similar results in clinical samples by RT-qPCR and IHC. In addition, we also found that overexpression of PARD3 promoted HepG2 cell invasion, migration and EMT, whereas knockdown of PARD3 had the opposite effect. TAZs are transcriptional activators that shuttle between the nucleus and cytoplasm. In the nucleus, they recognize cognate cis-regulatory elements by interacting with other transcription factors (especially members of the TEA domain family, TEAD), which in turn drive EMT and EMT transcription program(Zanconato, et al. 2016 ). At the same time, TAZ is released with the delocalization of Scribble during EMT, maintaining the continuous activation of TAZ(Noguchi, et al. 2018 ). In the tumor microenvironment, over activated TAZ has also been reported to promote aerobic glycolysis required for tumor growth by regulating metabolic genes, providing energy for tumor cell proliferation, and at the same time, this effect can drive TAZ activation(Cunningham and Hansen 2022 ). In addition to its proliferation promoting and EMT effects, TAZ has also been reported to promote anchor independent growth, inhibit apoptosis, and promote drug resistance and cancer stem cell traits(Noguchi, et al. 2018 ; Zanconato, et al. 2016 ; Zhao, et al. 2021). Currently, PARD3 is reported to promote TAZ nuclear localization and binding to TEAD4(Liu, et al. 2018; Lv, et al. 2015). We obtained similar results: overexpression of PARD3 promoted TAZ nuclear localization and binding to TEAD, whereas knockdown of PARD3 played the opposite role. Moreover, overexpression of TAZ partially reverted the inhibitory effect of knockdown of PARD3 on EMT, migration and invasion in HepG2 cells. AREG, a ligand for epidermal growth factor receptor (EGFR), is involved in various physiological processes such as bone formation, lung morphogenesis, axonal growth, keratinocyte proliferation, mammary gland development(Steponaitis, et al. 2019; Zaiss, et al. 2015). Currently, AREG has been reported to have autocrine effects in many cancers, enhancing malignant development of both primary and metastatic lesions(Bolitho, et al. 2021; Xu, et al. 2019). For example, in gastric cancer, overexpressed AREG promotes cell proliferation, invasion and migration, inhibits apoptosis, and promotes cell cycle progression by activating ERK/JNK/p38 and PI3K/Akt signaling pathways(Jiang, et al. 2019). In epithelial ovarian cancer, upregulation of AREG promotes AREG transcript and AREG secretion levels, whereas downregulation of endogenous AREG reduces the ability of exogenous AREG to induce cell migration and proliferation(Bolitho, et al. 2021). Studies have shown that TAZ can regulate cancer progression by targeting AREG(Han, et al. 2014). For example, TAZ sensitized EGFR wild-type NSCLC to gefitinib by promoting AREG transcription(Yuan, et al. 2019). In breast cancer, TAZ induces growth factor-independent proliferation by activating EGFR(Yang, et al. 2012). Our study shows that TAZ activates AREG transcription. And overexpression of AREG restored the inhibitory effect of knockdown of PARD3 on EMT, migration and invasion of hepatoma cells. 5. Conclusion In conclusion, our study found that overexpression of PARD3 can promote the localization of TAZ nucleus and the binding with TEAD, activate AREG transcription, and promote EMT, migration and invasion of HepG2 cells. Knockdown of PARD3 inhibited EMT, migration and invasion of HepG2 cells (Fig. 6 ). Declarations Data Availability Statement Our experimental data are available through the corresponding authors with reasonable reason. Ethics Statement We obtained approval for the study from the Ethics Committee of the Second Affiliated Hospital of Kunming Medical University. The study was conducted in accordance with the guidelines of the Declaration of Helsinki. Besides, written informed consent for study was obtained from each patient or their next of kin before study commencement. Author Contributions Yu Luo who is acting as the submission's guarantor; Hai-Yan Fu and Qiu-Hong Wang wrote the paper, they are co-first author, Yu Luo and Jie Li performed the research, Hong-Juan Li, Jian-Peng Gang, Li Liu and Bo Tang finished cell experiment, Dong Wei, Bin Xu and Xin Tong finished clinical experiment, Hai-Yan Fu and Qiu-Hong Wang collected and analysed the data. All authors reviewed the manuscript. Disclosures and Conflicts of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Funding Statement The research was supported by the Science and Technology Department of Yunnan (No. 202101BA070001-100). References Abdi, K., and C. T. Kuo (2018). Laminating the mammalian cortex during development: cell polarity protein function and Hippo signaling. Genes Dev 32(11–12):740–741. https://doi.org/10.1101/gad.316711.118 Ahn, E. Y., et al. (2013). RASSF1A-mediated regulation of AREG via the Hippo pathway in hepatocellular carcinoma. Mol Cancer Res 11(7):748–58. https://doi.org/10.1158/1541-7786.Mcr-12-0665 Bolitho, C., et al. (2021). Amphiregulin increases migration and proliferation of epithelial ovarian cancer cells by inducing its own expression via PI3-kinase signaling. Mol Cell Endocrinol 533:111338. https://doi.org/10.1016/j.mce.2021.111338 Bonastre, E., et al. (2015). PARD3 Inactivation in Lung Squamous Cell Carcinomas Impairs STAT3 and Promotes Malignant Invasion. Cancer Res 75(7):1287–97. https://doi.org/10.1158/0008-5472.Can-14-2444 Cao, J., et al. (2021). Long non-coding RNA-based signature for predicting prognosis of hepatocellular carcinoma. Bioengineered 12(1):673–681. https://doi.org/10.1080/21655979.2021.1878763 Cho, K., et al. (2021). YAP/TAZ Suppress Drug Penetration Into Hepatocellular Carcinoma Through Stromal Activation. Hepatology 74(5):2605–2621. https://doi.org/10.1002/hep.32000 Cunningham, R., and C. G. Hansen (2022). The Hippo pathway in cancer: YAP/TAZ and TEAD as therapeutic targets in cancer. Clin Sci (Lond) 136(3):197–222. https://doi.org/10.1042/cs20201474 Dadras, M. S., et al. (2021). The polarity protein Par3 coordinates positively self-renewal and negatively invasiveness in glioblastoma. Cell Death Dis 12(10):932. https://doi.org/10.1038/s41419-021-04220-7 Gao, R., et al. (2021). YAP/TAZ and ATF4 drive resistance to Sorafenib in hepatocellular carcinoma by preventing ferroptosis. EMBO Mol Med 13(12):e14351. https://doi.org/10.15252/emmm.202114351 Gurzu, S., et al. (2019). Epithelial Mesenchymal and Endothelial Mesenchymal Transitions in Hepatocellular Carcinoma: A Review. Biomed Res Int 2019:2962580. https://doi.org/10.1155/2019/2962580 Han, S. X., et al. (2014). Expression and clinical significance of YAP, TAZ, and AREG in hepatocellular carcinoma. J Immunol Res 2014:261365. https://doi.org/10.1155/2014/261365 Huang, H., et al. (2022). Membrane proteomic analysis identifies the polarity protein PARD3 as a novel antiviral protein against PEDV infection. J Proteomics 253:104462. https://doi.org/10.1016/j.jprot.2021.104462 Iden, S., et al. (2012). Tumor type-dependent function of the par3 polarity protein in skin tumorigenesis. Cancer Cell 22(3):389–403. https://doi.org/10.1016/j.ccr.2012.08.004 Jiang, J., et al. (2019). Over expression of amphiregulin promoted malignant progression in gastric cancer. Pathol Res Pract 215(10):152576. https://doi.org/10.1016/j.prp.2019.152576 Jung, H. Y., et al. (2019). Apical-basal polarity inhibits epithelial-mesenchymal transition and tumour metastasis by PAR-complex-mediated SNAI1 degradation. Nat Cell Biol 21(3):359–371. https://doi.org/10.1038/s41556-019-0291-8 Khamis, Z. I., et al. (2021). Cytochrome P450-2D6: A novel biomarker in liver cancer health disparity. PLoS One 16(10):e0257072. https://doi.org/10.1371/journal.pone.0257072 Kyung, S. Y., et al. (2018). Sulforaphane attenuates pulmonary fibrosis by inhibiting the epithelial-mesenchymal transition. BMC Pharmacol Toxicol 19(1):13. https://doi.org/10.1186/s40360-018-0204-7 Li, J., et al. (2019). Pard3 suppresses glioma invasion by regulating RhoA through atypical protein kinase C/NF-κB signaling. Cancer Med 8(5):2288–2302. https://doi.org/10.1002/cam4.2063 Li, S., et al. (2021). High expression of PARD3 predicts poor prognosis in hepatocellular carcinoma. Sci Rep 11(1):11078. https://doi.org/10.1038/s41598-021-90507-w Lin, X., et al. (2019). RNA m(6)A methylation regulates the epithelial mesenchymal transition of cancer cells and translation of Snail. Nat Commun 10(1):2065. https://doi.org/10.1038/s41467-019-09865-9 Liu, W. A., et al. (2018). PARD3 dysfunction in conjunction with dynamic HIPPO signaling drives cortical enlargement with massive heterotopia. Genes Dev 32(11–12):763–780. https://doi.org/10.1101/gad.313171.118 Lv, X. B., et al. (2015). PARD3 induces TAZ activation and cell growth by promoting LATS1 and PP1 interaction. EMBO Rep 16(8):975–85. https://doi.org/10.15252/embr.201439951 Martini, A., et al. (2017). YAP, TAZ and AREG expression in eighth cranial nerve schwannoma. Int J Biol Markers 32(3):e319-e324. https://doi.org/10.5301/ijbm.5000263 Nakamura, H., et al. (2016). Expression of Par3 polarity protein correlates with poor prognosis in ovarian cancer. BMC Cancer 16(1):897. https://doi.org/10.1186/s12885-016-2929-2 Noguchi, S., A. Saito, and T. Nagase (2018). YAP/TAZ Signaling as a Molecular Link between Fibrosis and Cancer. Int J Mol Sci 19(11). https://doi.org/10.3390/ijms19113674 Raimondo, S., et al. (2019). Multiple myeloma-derived exosomes are enriched of amphiregulin (AREG) and activate the epidermal growth factor pathway in the bone microenvironment leading to osteoclastogenesis. J Hematol Oncol 12(1):2. https://doi.org/10.1186/s13045-018-0689-y Seo, W., et al. (2019). ALDH2 deficiency promotes alcohol-associated liver cancer by activating oncogenic pathways via oxidized DNA-enriched extracellular vesicles. J Hepatol 71(5):1000–1011. https://doi.org/10.1016/j.jhep.2019.06.018 She, M., et al. (2022). AREG is involved in scleral remodeling in form-deprivation myopia via the ERK1/2-MMP-2 pathway. Faseb j 36(5):e22289. https://doi.org/10.1096/fj.202200132R Shimada, H., et al. (2017). Loss of tricellular tight junction protein LSR promotes cell invasion and migration via upregulation of TEAD1/AREG in human endometrial cancer. Sci Rep 7:37049. https://doi.org/10.1038/srep37049 Steponaitis, G., et al. (2019). Significance of Amphiregulin (AREG) for the Outcome of Low and High Grade Astrocytoma Patients. J Cancer 10(6):1479–1488. https://doi.org/10.7150/jca.29282 Sun, L., et al. (2020). KLF5 regulates epithelial-mesenchymal transition of liver cancer cells in the context of p53 loss through miR-192 targeting of ZEB2. Cell Adh Migr 14(1):182–194. https://doi.org/10.1080/19336918.2020.1826216 Tang, Y., et al. (2022). Identification of a Tumor Immunological Phenotype-Related Gene Signature for Predicting Prognosis, Immunotherapy Efficacy, and Drug Candidates in Hepatocellular Carcinoma. Front Immunol 13:862527. https://doi.org/10.3389/fimmu.2022.862527 Temraz, S., et al. (2021). Hepatocellular Carcinoma Immunotherapy and the Potential Influence of Gut Microbiome. Int J Mol Sci 22(15). https://doi.org/10.3390/ijms22157800 Thompson, B. J. (2020). YAP/TAZ: Drivers of Tumor Growth, Metastasis, and Resistance to Therapy. Bioessays 42(5):e1900162. https://doi.org/10.1002/bies.201900162 Wang, L., et al. (2020). AREG mediates the epithelial–mesenchymal transition in pancreatic cancer cells via the EGFR/ERK/NF–κB signalling pathway. Oncol Rep 43(5):1558–1568. https://doi.org/10.3892/or.2020.7523 Wang, L., et al. (2017). Partition-Defective 3 (PARD3) Regulates Proliferation, Apoptosis, Migration, and Invasion in Esophageal Squamous Cell Carcinoma Cells. Med Sci Monit 23:2382–2390. https://doi.org/10.12659/msm.903380 Wang, Y. C., Z. B. Tian, and X. Q. Tang (2021). Bioinformatics screening of biomarkers related to liver cancer. BMC Bioinformatics 22(Suppl 3):521. https://doi.org/10.1186/s12859-021-04411-1 Wang, Z., and J. Jin (2019). LncRNA SLCO4A1-AS1 promotes colorectal cancer cell proliferation by enhancing autophagy via miR-508-3p/PARD3 axis. Aging (Albany NY) 11(14):4876–4889. https://doi.org/10.18632/aging.102081 Wu, H., et al. (2021). DCP1A is an unfavorable prognostic-related enhancer RNA in hepatocellular carcinoma. Aging (Albany NY) 13(19):23020–23035. https://doi.org/10.18632/aging.203593 Xu, Q., et al. (2019). Targeting amphiregulin (AREG) derived from senescent stromal cells diminishes cancer resistance and averts programmed cell death 1 ligand (PD-L1)-mediated immunosuppression. Aging Cell 18(6):e13027. https://doi.org/10.1111/acel.13027 Xu, X., et al. (2021). Substrate Stiffness Drives Epithelial to Mesenchymal Transition and Proliferation through the NEAT1-Wnt/β-Catenin Pathway in Liver Cancer. Int J Mol Sci 22(21). https://doi.org/10.3390/ijms222112066 Yang, N., et al. (2012). TAZ induces growth factor-independent proliferation through activation of EGFR ligand amphiregulin. Cell Cycle 11(15):2922–30. https://doi.org/10.4161/cc.21386 Yeh, H., C. C. Chiang, and T. H. Yen (2021). Hepatocellular carcinoma in patients with renal dysfunction: Pathophysiology, prognosis, and treatment challenges. World J Gastroenterol 27(26):4104–4142. https://doi.org/10.3748/wjg.v27.i26.4104 Yuan, K., et al. (2020). TXNDC12 promotes EMT and metastasis of hepatocellular carcinoma cells via activation of β-catenin. Cell Death Differ 27(4):1355–1368. https://doi.org/10.1038/s41418-019-0421-7 Yuan, W., et al. (2019). TAZ sensitizes EGFR wild-type non-small-cell lung cancer to gefitinib by promoting amphiregulin transcription. Cell Death Dis 10(4):283. https://doi.org/10.1038/s41419-019-1519-z Zaiss, D. M. W., et al. (2015). Emerging functions of amphiregulin in orchestrating immunity, inflammation, and tissue repair. Immunity 42(2):216–226. https://doi.org/10.1016/j.immuni.2015.01.020 Zanconato, F., M. Cordenonsi, and S. Piccolo (2016). YAP/TAZ at the Roots of Cancer. Cancer Cell 29(6):783–803. https://doi.org/10.1016/j.ccell.2016.05.005 Zhang, M. Y., et al. (2021a). A critical role of AREG for bleomycin-induced skin fibrosis. Cell Biosci 11(1):40. https://doi.org/10.1186/s13578-021-00553-0 Zhang, X., et al. (2019). MicroRNA 483-3p targets Pard3 to potentiate TGF-β1-induced cell migration, invasion, and epithelial-mesenchymal transition in anaplastic thyroid cancer cells. Oncogene 38(5):699–715. https://doi.org/10.1038/s41388-018-0447-1 Zhang, Y., W. Ni, and L. Qin (2021b). RUFY3 promotes the progression of hepatocellular carcinoma through activating NF-κB-mediated epithelial-mesenchymal transition. Aging (Albany NY) 13(17):21283–21293. https://doi.org/10.18632/aging.203444 Zhao, W., et al. (2021). Transcriptional co-activators YAP/TAZ: Potential therapeutic targets for metastatic breast cancer. Biomed Pharmacother 133:110956. https://doi.org/10.1016/j.biopha.2020.110956 Zhou, P. J., et al. (2017). Elevated expression of Par3 promotes prostate cancer metastasis by forming a Par3/aPKC/KIBRA complex and inactivating the hippo pathway. J Exp Clin Cancer Res 36(1):139. https://doi.org/10.1186/s13046-017-0609-y Zhu, X., H. Pan, and L. Liu (2021). Long noncoding RNA network: Novel insight into hepatocellular carcinoma metastasis (Review). Int J Mol Med 48(1). https://doi.org/10.3892/ijmm.2021.4967 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1953346","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":128560186,"identity":"fd31b357-3864-459f-b9f0-b958af8ea618","order_by":0,"name":"Hai-Yan Fu","email":"","orcid":"","institution":"the 3rd People’s Hospital of Kunming","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hai-Yan","middleName":"","lastName":"Fu","suffix":""},{"id":128560188,"identity":"ac83c78b-04b9-41bc-87b5-7588618e1a05","order_by":1,"name":"Qiu-Hong Wang","email":"","orcid":"","institution":"Second Affiliated Hospital of Kunming Medical College","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qiu-Hong","middleName":"","lastName":"Wang","suffix":""},{"id":128560190,"identity":"d7278da5-6315-4cef-bde4-83c5e2538dc1","order_by":2,"name":"Hong-Juan Li","email":"","orcid":"","institution":"the 3rd People’s Hospital of Kunming","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hong-Juan","middleName":"","lastName":"Li","suffix":""},{"id":128560191,"identity":"c9272c72-ec53-4041-9fa3-702e993c4827","order_by":3,"name":"Jian-Peng Gao","email":"","orcid":"","institution":"the 3rd People’s Hospital of Kunming","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jian-Peng","middleName":"","lastName":"Gao","suffix":""},{"id":128560192,"identity":"198d74c2-325d-4f0d-b1f7-b8c9e9f15750","order_by":4,"name":"Li Liu","email":"","orcid":"","institution":"the 3rd People’s Hospital of Kunming","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Liu","suffix":""},{"id":128560193,"identity":"89866ecd-a9a3-4420-b605-c39849594fa3","order_by":5,"name":"Bo Tang","email":"","orcid":"","institution":"Second Affiliated Hospital of Kunming Medical College","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Tang","suffix":""},{"id":128560195,"identity":"548cac8c-e9e0-4069-b7c0-ba03b8ac49af","order_by":6,"name":"Dong Wei","email":"","orcid":"","institution":"Second Affiliated Hospital of Kunming Medical College","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Dong","middleName":"","lastName":"Wei","suffix":""},{"id":128560200,"identity":"f3d15743-4df4-4296-96ba-2a9d04a483aa","order_by":7,"name":"Bin Xu","email":"","orcid":"","institution":"the 3rd People’s Hospital of Kunming","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Xu","suffix":""},{"id":128560202,"identity":"88a191b9-4ede-4022-ac90-3a0617b6a6a5","order_by":8,"name":"Xin Tong","email":"","orcid":"","institution":"Second Affiliated Hospital of Kunming Medical College","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Tong","suffix":""},{"id":128560204,"identity":"4e43815e-cbfc-49fb-8852-29ea531ce9ee","order_by":9,"name":"Jie Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyElEQVRIiWNgGAWjYBACPmaGhAMMBjb1bOyNjQ8/EKOFDaylIi2Bn+dws7EEUVrA5JnDCZIz0tsEeIjSws7w8MDHtrQ8g5sP2xgkGOzkdBuIcNjBmW02xQa3E9seFDAkG5sdIELLYd62NMYNtxPbDSQYDiRuI0rL37bDjBtuHmyT4CFaC9D7iTNnMJKg5WBPRZoxP08iMJANiPALP/+Z5A8/DGzk2NiPP3z4ocJOjqAWBgaeBCSOAUHlIMBO2NRRMApGwSgY4QAAcatEUwRMmdoAAAAASUVORK5CYII=","orcid":"","institution":"the 3rd People’s Hospital of Kunming","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Li","suffix":""},{"id":128560207,"identity":"cb7a4134-df05-4a57-af12-2583b2893ce3","order_by":10,"name":"Yu Luo","email":"","orcid":"","institution":"the 3rd People’s Hospital of Kunming","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Luo","suffix":""}],"badges":[],"createdAt":"2022-08-11 15:14:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1953346/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1953346/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":25334302,"identity":"65cd5e51-9e55-4fdc-9236-bcd44254a9df","added_by":"auto","created_at":"2022-08-17 17:32:53","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2463285,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1953346/v1/69d05e1a327dcf20cc8a41a6.jpg"},{"id":25334298,"identity":"6fe6bec7-55b9-4fa3-b1bc-dc9424c2a6d5","added_by":"auto","created_at":"2022-08-17 17:32:53","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2579701,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1953346/v1/53c1d873ece0ba9916c83c5b.jpg"},{"id":25334718,"identity":"c4a1247f-a5a9-4d51-9476-8c319cbe69db","added_by":"auto","created_at":"2022-08-17 17:37:53","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1756198,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1953346/v1/399e6562985f5b628b9ec3e4.jpg"},{"id":25334796,"identity":"ae8d9b47-d242-4097-9ac2-c43e58da4ee9","added_by":"auto","created_at":"2022-08-17 17:42:53","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1136725,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1953346/v1/ebfab4df9081da2f8fa608a0.jpg"},{"id":25334299,"identity":"54a0afab-127f-44c4-9348-1ae4c927b8ce","added_by":"auto","created_at":"2022-08-17 17:32:53","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3879587,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1953346/v1/d79cd1d586af89d038062b0c.jpg"},{"id":25334301,"identity":"11868120-e63e-4a64-9b3b-8bd0a5f191a9","added_by":"auto","created_at":"2022-08-17 17:32:53","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1320772,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-1953346/v1/974d4993a490089ace507934.jpg"},{"id":26205073,"identity":"0a2830fd-d825-4bc1-80aa-aee840f46c90","added_by":"auto","created_at":"2022-09-08 10:14:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1133432,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1953346/v1/7112178b-75c9-4138-af91-19845e6b8631.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Partition defective 3 promotes TAZ nuclear localization and promotes Amphiregulin transcription to promote liver hepatocellular carcinoma cell invasion, migration and epithelial mesenchymal","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eLiver cancer is a major health problem and a cause of death worldwide. It is reported that the incidence rate of liver cancer will rise faster than other cancers, and the 5-year survival rate is only 18% in 2020. It is estimated that the number of liver cancer deaths will exceed 1\u0026nbsp;million in 2030 (Khamis, et al. 2021). In China, liver cancer accounts for 70\u0026ndash;80% of primary liver malignancies and is the second leading cause of cancer-related death(Wang, et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Liver cancer is divided into liver hepatocellular carcinoma (LIHC) and intrahepatic cholangiocarcinoma (CC), of which LIHC accounts for 75\u0026ndash;85% and CC for 10\u0026ndash;15% (Temraz, et al. 2021). Hepatitis virus, cirrhosis, alcohol consumption, metabolic syndrome, alcoholic liver disease, nonalcoholic steatohepatitis are all leading causes of hepatocellular carcinoma (Tang, et al. 2022; Yeh, et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Currently, hepatectomy, percutaneous ablation, liver transplantation, gene therapy, immunotherapy, and genomically targeted therapy are all common treatments for LIHC (Cao, et al. 2021). However, since most LIHC patients are asymptomatic at an early stage and the disease is mainly diagnosed at an advanced stage, many patients do not receive early intervention and treatment, resulting in an overall poor prognosis(Wu, et al. 2021). Therefore, there is an urgent need to identify new effective biomarkers to evaluate the prognosis of LIHC patients, thereby improving the efficacy of treatment strategies and more refined follow-up plans.\u003c/p\u003e \u003cp\u003eLIHC metastasis is considered to be the main reason for the high recurrence rate of LIHC, and epithelial mesenchymal transition (EMT) is important for the metastatic process(Zhu, et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). EMT is a highly conserved and reversible cellular process. In this process, epithelial cells lose apical basal polarity, weaken intercellular junctions and rearrange the cytoskeleton, acquire invasiveness, and become mesenchymal stem cells(Jung, et al. 2019; Lin, et al. 2019). This provides cancer cells with the ability to invade and disseminate during metastasis in the context of the tumor microenvironment, and confers drug resistance to malignancies(Xu, et al. 2021). Therefore, inhibition of EMT is an important means to inhibit tumor metastasis.\u003c/p\u003e \u003cp\u003ePartition defective 3 (PARD3) has been reported to be involved in the development of tight junctions involved in epithelial cell-cell contact(Wang, et al. 2017). Depletion of PARD3 disrupts tight junction assembly(Huang, et al. 2022). However, the cellular functions of PARD3 in cell polarity formation, cell proliferation and migration are easily affected by many factors such as protein dislocation(Nakamura, et al. 2016). Current studies have shown that PARD3 has different roles in different cancer types. For example, in anaplastic thyroid cancer, PARD3 reduces cell invasion, migration and EMT(Zhang, et al. 2019). In lung squamous cell carcinoma, PARD3 plays an anti-cancer role by reducing tumor invasion and metastasis(Bonastre, et al. 2015). Whereas in colorectal cancer tissues PARD3 is overexpressed and inhibition of PARD3 inhibits cell proliferation(Wang and Jin \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). It was also found that PARD3 was highly expressed in LIHC tissues, and high expression of PARD3 was significantly associated with adverse clinicopathological features and lower overall survival(Li, et al. 2021). In this paper, we mainly investigate whether PARD3 regulates EMT in LIHC and the possible mechanisms.\u003c/p\u003e \u003cp\u003eTAZ, a well characterized transcriptional effector of Hippo signaling, is involved in various physiopathological processes, such as cell proliferation and death, and has the effects of promoting tumor growth, metastasis, drug resistance, and tissue regeneration(Gao, et al. 2021; Seo, et al. 2019; Thompson \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Studies have shown that TAZ is closely associated with the development and progression of LIHC, and inhibiting its activity may be a new approach for the treatment of LIHC(Cho, et al. 2021) In melanoma cells and breast cancer cells PARD3 promoted TAZ activity to promote cell growth(Lv, et al. 2015).\u003c/p\u003e \u003cp\u003eAccording to the literature, we found that Amphiregulin (AREG) is a direct target gene of TAZ(Han, et al. 2014; Martini, et al. 2017). AREG has been reported to be involved in various physiopathological processes such as cancer(Steponaitis, et al. 2019), scleral remodeling(She, et al. 2022), skin fibrosis (Zhang, et al. 2021a), bone formation(Raimondo, et al. 2019). In cancer, AREG has been validated as an oncogene(Ahn, et al. 2013). For example, in pancreatic cancer cells AREG has been reported to promote cell invasion, migration and EMT(Wang, et al. 2020). AREG was detected to be up-regulated in human endometrial cancer tissues and inhibition of AREG showed migration and invasion inhibition on cells(Shimada, et al. 2017).\u003c/p\u003e \u003cp\u003eHere, we investigated whether PARD3 regulates EMT process through TAZ-AREG in LIHC.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003e2.1 Database analysis\u003c/h2\u003e\n \u003cp\u003eGene Expression Profiling Interactive Analysis (GEPIA) was used to analyze PARD3 expression between cancer tissues and adjacent noncancerous tissues in LIHC, the expression of PARD3 in different LIHC stages, and the correlation between PARD3 expression and LIHC survival.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003e2.2 Clinical tissue samples\u003c/h2\u003e\n \u003cp\u003e41 cases of LIHC tissues and paracancerous tissues (at least 3 cm away from the tumor) were obtained from patients undergoing LIHC surgery at the Second Affiliated Hospital of Kunming Medical University Hospital during the period January 2020 to August. Inclusion criteria: patients diagnosed with LIHC by biopsy at the Department of Pathology. Patients with complete case data. Patients who did not receive any preoperative therapy. Exclusion criteria: Patients with multiple tumors combined. Patients with other diseases. And patients who have received any preoperative therapy. Post excision specimens were fixed with 4% paraformaldehyde and embedded in paraffin, some specimens were stored in -80 ℃ Celsius refrigerator. This workwas performed in accordance with The Code of Ethics of the World Medical Association (Declaration of Helsinki) for experiments. The manuscript conforms to the Recommendations for the Conduct, Reporting, Editing and Publication of Scholarly Work in Medical Journals and aim for the inclusion of representative human populations. And all the patients gave their consent and signed written informed consent for this experiment. The experiment was approved by the Second Affiliated Hospital of Kunming Medical University Hospital Ethics Committee(approval No.: 2022\u0026thinsp;\u0026minus;\u0026thinsp;136)\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003e2.3 RT-qPCR\u003c/h2\u003e\n \u003cp\u003eTotal RNA from tissues and cells was extracted by TRIzal kit, and cDNA was synthesized by a reverse transcription kit. The cDNA product was used as a template for PCR reactions and GAPDH was used as an internal control. The results were calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;CT\u003c/sup\u003e method. Primers were synthesized by GenePharma (China), PARD3 (F: CAGACAGAACTAACTTCGCC; R: ATGCCTCGAGAGAGTCCT). AREG(F: TGTCGCTT GATACTCCG3; R: AGGCATTTCACTCA GGGG3). GAPDH (F: AGCCACAATCGCTCAGACAC; R: GCCCAATACGACCAAATCC).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003e2.4 Immunohistochemistry (IHC)\u003c/h2\u003e\n \u003cp\u003eDewaxing with xylene and hydration with gradient ethanol. Blocked with 1.5% goat serum for 1 h, added anti-PARD3 (1:500, Abcom, UK), and incubated overnight at room temperature. Secondary antibody (1:1000, Abcom, UK) was added and incubated for 1 h at room temperature. DAB development, hematoxylin counterstaining. Observe and photograph with an inverted microscope.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003ch2\u003e2.5 Cell Culture and Transfection\u003c/h2\u003e\n \u003cp\u003eHuman hepatoma cells HepG2 were purchased from ATCC and cultured in DMEM medium containing 10% FBS at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. GenePharma (China) synthesized OE-PARD3, si-PARD3, OE-TAZ, si-TAZ, OE-AREG and negative controls. Transfection was performed using Lipofectamine\u0026trade; 2000 (Invitrogen, USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003e2.6 Western blot\u003c/h2\u003e\n \u003cp\u003eTotal protein in cells was extracted from PIPA lysate, and protein concentration was detected by BCA kit. Equal amounts (100 \u0026micro;g) of protein were separated on a 10% SDS-PAGE gel and transferred to PVDF membranes. Blocked with 5% nonfat dry milk for 1 h, the membrane was blocked with primary antibodies ( anti-PARD3, anti-E-cadherin, anti-Vimentin, anti-\u0026alpha;-SMA, anti-Snail, anti-TAZ, anti-Tubulin, anti-PCNA, anti-TEAD, anti-AREG and anti-\u0026beta;-actin) overnight. All antibodies were purchased from Abcom, at a dilution ratio of 1:1000. The membranes were then incubated with the corresponding secondary antibodies for 1 h at room temperature. ECL kit to visualize protein bands. Image J quantification.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003e2.7 Transwell\u003c/h2\u003e\n \u003cp\u003eCells were seeded on the upper chamber of Transwell (Corning, USA) supplemented with serum-free medium. The lower chamber was added with 500 \u0026micro; L culture medium containing 10% FBS. After 48 h incubation, the cells on the luminal side of the membrane were removed. They were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. Observe and photograph under the microscope. Image J counts.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec10\"\u003e\n \u003ch2\u003e2.8 Wound healing experiments\u003c/h2\u003e\n \u003cp\u003eA density of 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells were seeded in 6-well plates. After 24 h incubation at 37\u0026deg;C, draw a line along the diameter of the well with a pipette tip. PBS wash to remove scratched cells. Serum-free medium was added for 48 h. Observed and photographed under the microscope at 0 h and 48 h. Image J calculates mobility.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003e2.9 Immunofluorescence\u003c/h2\u003e\n \u003cp\u003eHepG2 cells in each group were fixed with 4% paraformaldehyde for 30 min and permeabilized with 0.1% Triton X-100 for 5 min at 4\u0026deg;C. After blocking with 0.5% BSA for 30 min at room temperature, cells were incubated with anti-Smad3 (1:500) overnight at 4\u0026deg;C. The next day, after washing with PBS, cells were incubated with fluorochrome-conjugated secondary antibodies (1:1000) for 1 h. Then DAPI was added dropwise and incubated in the dark for 5 min to stain the specimens. After washing with PBS, photographs were taken under a fluorescence microscope.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec12\"\u003e\n \u003ch2\u003e2.10 Co-immunoprecipitation (Co-IP)\u003c/h2\u003e\n \u003cp\u003eCells were collected 24\u0026ndash;48 h after transfection, appropriate amount of cell lysis buffer containing protease inhibitors was added, lysed at 4℃ for 30 min, and the supernatant was taken after centrifugation at 12000 g for 30 min. A small volume of lysate was collected for subsequent Western blot analysis (input), and the remaining lysate plus 1 \u0026micro;g anti-TAZ and incubated overnight at 4℃. Add 10.0 \u0026micro;L protein A agarose beads (sigma Aldrich, Germany) and incubated for 2\u0026ndash;4 h at 4 \u0026deg; C with slow shaking to couple antibodies to protein A agarose beads. Beads were washed three times with appropriate lysis buffer with centrifugation at 5000 g for 5 min between each wash. Proteins were eluted from the magnetic beads with SDS sample buffer and subjected to Western blot analysis.\u003c/p\u003e\n \u003ch2\u003e2.11 Dual luciferase reporter gene\u003c/h2\u003e\n \u003cp\u003eThe AREG sequence containing the TEAD binding site was cloned into the pGL4.23 vector to construct a wild-type AREG plasmid (WT). The binding site was changed by a site-directed mutagenesis kit, and a mutant AREG plasmid (MUT) was constructed by the same method. WT and MUT were then transfected into HEK293T cells with OE-TEAD and negative control, respectively. After 48 h, the luciferase activity was detected by a dual-luciferase reporter gene detection system.\u003c/p\u003e\n \u003ch2\u003e2.12 Statistical analysis\u003c/h2\u003e\n \u003cp\u003eAll experiments in this paper were repeated three or more times, and all results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Statistical analysis was performed using SPSS 23. Comparisons between two groups were performed by t-test, and comparisons among multiple groups were performed by one-way ANOVA. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicated statistical significance.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv class=\"Section2\" id=\"Sec14\"\u003e\n \u003ch2\u003e3.1. Clinical data confirm that PARD3 regulates LIHC progression\u003c/h2\u003e\n \u003cp\u003eThe clinical significance of PARD3 in regulating LIHC progression was analyzed through the GEPIA website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia.cancer-pku.cn/index.html\u003c/span\u003e\u003c/span\u003e). The results showed that compared with normal liver tissue, PARD3 expression was increased in the liver hepatocellular carcinoma (LIHC) group (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea). Meanwhile, the data also indicated that the expression of PARD3 increased gradually with increasing tumor stage (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb). Moreover, high expression of PARD3 generally means low overall survival in LIHC (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec). We collected 41 clinical samples and used RT-qPCR to detect PARD3 mRNA expression, which showed that PARD3 was highly expressed in LIHC tissues (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ed). We also employed IHC to detect PARD3 expression in tissues, and the results also showed that PARD3 is highly expressed in LIHC tissues (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ee).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec15\"\u003e\n \u003ch2\u003e3.2. PARD3 promotes EMT in LIHC\u003c/h2\u003e\n \u003cp\u003eFirst, Western blot was used to detect the transfection efficiency of PARD3. The results showed that the expression of PARD3 was significantly increased after transfection of OE-PARD3, and the expression of PARD3 was significantly decreased after transfection of si-PARD3 (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea). Further, the EMT markers E-cadherin, vimentin, \u0026alpha;- SMA and Snail expression were detected by Western blot, the results showed that overexpression of PARD3 decreased E-cadherin expression without statistical difference, meanwhile, overexpression of PARD3 significantly up-regulated vimentin, \u0026alpha;-SMA and Snail expression. Knockdown of PARD3 exerted the opposite effect (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb). Transwell was used to detect the invasion ability of HepG2 cells, the results showed that overexpression of PARD3 significantly promoted the cell invasion ability, while knockdown of PARD3 inhibited the cell invasion ability (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec). The migration ability of HepG2 cells was detected by wound healing experiments, and it was found that overexpression of PARD3 significantly promoted cell migration rate, and knockdown of PARD3 significantly inhibited cell migration rate (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ed). Therefore, PARD3 promotes the EMT of LIHC.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec16\"\u003e\n \u003ch2\u003e3.3. PARD3 promotes TAZ nuclear localization and association with TEAD\u003c/h2\u003e\n \u003cp\u003eAfter transfection of OE-PARD3 or si-PARD3 in HepG2 cells, the nucleus and cytoplasm were separated and TAZ expression was detected by Western blot, the results showed that overexpression of PARD3 promoted TAZ expression in the nucleus, and knockdown of PARD3 inhibited TAZ expression in the nucleus, but overexpression and knockdown of PARD3 had no significant effect on TAZ expression in the cytoplasm (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). Further, immunofluorescence was used to detect the nuclear localization of TAZ, and we found that overexpression of PARD3 promoted TAZ nuclear expression, and knockdown of PARD3 decreased TAZ nuclear expression (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb). Since previous studies have found that TEAD is the primary transcription factor that binds to TAZ through the TEA domain, it acts by binding to transcriptional coactivators, such as TAZ(Yuan, et al. 2019). Therefore, in this study, we used CO-IP to examine the effect of PARD3 on the binding of TAZ to TEAD, and the results showed that overexpression of PARD3 significantly promoted the binding of TAZ to TEAD, whereas knockdown of PARD3 significantly inhibited the binding of TAZ to TEAD (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec). From this, it is known that PARD3 promotes TAZ nuclear localization and association with TEAD.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec17\"\u003e\n \u003ch2\u003e3.4. TAZ activates AREG transcription\u003c/h2\u003e\n \u003cp\u003eWe examined the effect of TAZ on AREG transcription by transfecting OE-TAZ and si-TAZ. Western blot was used to detect the transfection efficiency of TAZ. The results showed that the expression of TAZ was significantly increased after transfection of OE-TAZ, and the expression of TAZ was significantly decreased after transfection of si-TAZ (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea). Further, the dual-luciferase reporter gene was used to detect the targeting relationship between TAZ and AREG. The results showed that overexpression of TAZ significantly increased the dual-luciferase activity of the wild-type AREG vector, but had no significant effect on the double luciferase activity of mutant AREG vector (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb). RT-qPCR was used to detect the effect of TAZ on AREG transcription level, and the results showed that overexpression of TAZ significantly up-regulated AREG mRNA expression, while knockdown of TAZ down-regulated AREG mRNA expression (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec). Western blot was used to detect the effect of TAZ on the expression of AREG protein. The results showed that overexpression of TAZ significantly up-regulated the expression of AREG protein, while knockdown of TAZ inhibited the expression of AREG protein (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed). From this, it was found that TAZ activates AREG transcription.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec18\"\u003e\n \u003ch2\u003e3.5. PARD3 promotes EMT in HepG2 cells by promoting TAZ nuclear localization and AREG transcription\u003c/h2\u003e\n \u003cp\u003eTo further verify whether PARD3 promotes AREG transcription to promote EMT in HepG2 cells by promoting TAZ nuclear localization, we verified this by co-transfection of si-PARD3 and OE-TAZ, si-PARD3 and OE-AREG. After successful transfection, we used Western blot, Transwell and wound healing assay to detect the expression of EMT related proteins, cell migration ability and invasion ability, respectively, and the results showed that overexpression of TAZ and AREG both reversed the inhibition of EMT, migration and invasion by si-PARD3 in HepG2 cells (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea-c). It can be seen that PARD3 promotes the EMT of HepG2 by promoting the nuclear localization of TAZ and promoting the transcription of AREG.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eTumor metastasis is one of the important causes of high mortality in patients with LIHC. EMT is the initial event of tumor cell invasion and metastasis(Yuan, et al. 2020). EMT in cancer cells typically begins with loss of epithelial cell polarity, E-cadherin downregulation in epithelial cells, and loss of cell-cell adhesion mediated by α-SMA and Vimentin upregulation in mesenchymal cells, which in turn induces tumor cell mobility and increases the risk of lymph node or distant metastases\u003csup\u003e(Gurzu, et al. 2019; Sun, et al. 2020)\u003c/sup\u003e. At the molecular level, transcription factors such as snail, slug, twist, ZEB1, ZEB2, SIP1 and E12/47 are key genes that down regulate E-cadherin and cytokeratin(Kyung, et al. 2018). In recent years, a large number of studies have found that EMT is one of the important mechanisms of LIHC metastasis, and many potential targets for LIHC metastasis treatment have been found based on EMT signal pathway, but the research and development of corresponding drugs are extremely scarce(Zhang, et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePARD3 is a member of the partitioning defective protein (Par) family. In the epithelium, PARD3 is localized to tight junctions in the Par complex, forming the boundary between the apical and basolateral domains. It plays a role in processes such as maintaining asymmetric cell division, apical basal polarity, and directional cell migration (Abdi and Kuo \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Li, et al. 2019). It is well known that PARD3 is an important gene regulating polarity, and loss of cell polarity is a feature of advanced and aggressive cancers. Therefore, PARD3 was confirmed to have invasion and migration inhibitory effects possibly through regulating cell polarity(Dadras, et al. 2021). However, studies have also shown that PARD3 acts as an oncogene in ovarian cancer(Nakamura, et al. 2016), prostate cancer(Zhou, et al. 2017) and other cancers. Furthermore, in skin cancer, PARD3 shows dual roles depending on tumor type(Iden, et al. 2012). Thus, PARD3 exhibits dual functions in tumorigenesis depending on the cancer type. According to the GEPIA website, we found that PARD3 expression was increased in LIHC tumor groups, and the expression of PARD3 gradually increased with the increase of tumor stage, and high expression of PARD3 usually means low overall survival in LIHC. We obtained similar results in clinical samples by RT-qPCR and IHC. In addition, we also found that overexpression of PARD3 promoted HepG2 cell invasion, migration and EMT, whereas knockdown of PARD3 had the opposite effect.\u003c/p\u003e \u003cp\u003eTAZs are transcriptional activators that shuttle between the nucleus and cytoplasm. In the nucleus, they recognize cognate cis-regulatory elements by interacting with other transcription factors (especially members of the TEA domain family, TEAD), which in turn drive EMT and EMT transcription program(Zanconato, et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). At the same time, TAZ is released with the delocalization of Scribble during EMT, maintaining the continuous activation of TAZ(Noguchi, et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In the tumor microenvironment, over activated TAZ has also been reported to promote aerobic glycolysis required for tumor growth by regulating metabolic genes, providing energy for tumor cell proliferation, and at the same time, this effect can drive TAZ activation(Cunningham and Hansen \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In addition to its proliferation promoting and EMT effects, TAZ has also been reported to promote anchor independent growth, inhibit apoptosis, and promote drug resistance and cancer stem cell traits(Noguchi, et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Zanconato, et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Zhao, et al. 2021). Currently, PARD3 is reported to promote TAZ nuclear localization and binding to TEAD4(Liu, et al. 2018; Lv, et al. 2015). We obtained similar results: overexpression of PARD3 promoted TAZ nuclear localization and binding to TEAD, whereas knockdown of PARD3 played the opposite role. Moreover, overexpression of TAZ partially reverted the inhibitory effect of knockdown of PARD3 on EMT, migration and invasion in HepG2 cells.\u003c/p\u003e \u003cp\u003eAREG, a ligand for epidermal growth factor receptor (EGFR), is involved in various physiological processes such as bone formation, lung morphogenesis, axonal growth, keratinocyte proliferation, mammary gland development(Steponaitis, et al. 2019; Zaiss, et al. 2015). Currently, AREG has been reported to have autocrine effects in many cancers, enhancing malignant development of both primary and metastatic lesions(Bolitho, et al. 2021; Xu, et al. 2019). For example, in gastric cancer, overexpressed AREG promotes cell proliferation, invasion and migration, inhibits apoptosis, and promotes cell cycle progression by activating ERK/JNK/p38 and PI3K/Akt signaling pathways(Jiang, et al. 2019). In epithelial ovarian cancer, upregulation of AREG promotes AREG transcript and AREG secretion levels, whereas downregulation of endogenous AREG reduces the ability of exogenous AREG to induce cell migration and proliferation(Bolitho, et al. 2021). Studies have shown that TAZ can regulate cancer progression by targeting AREG(Han, et al. 2014). For example, TAZ sensitized EGFR wild-type NSCLC to gefitinib by promoting AREG transcription(Yuan, et al. 2019). In breast cancer, TAZ induces growth factor-independent proliferation by activating EGFR(Yang, et al. 2012). Our study shows that TAZ activates AREG transcription. And overexpression of AREG restored the inhibitory effect of knockdown of PARD3 on EMT, migration and invasion of hepatoma cells.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn conclusion, our study found that overexpression of PARD3 can promote the localization of TAZ nucleus and the binding with TEAD, activate AREG transcription, and promote EMT, migration and invasion of HepG2 cells. Knockdown of PARD3 inhibited EMT, migration and invasion of HepG2 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur experimental data are available through the corresponding authors with reasonable reason.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe obtained approval for the study from the Ethics Committee of the Second Affiliated Hospital of Kunming Medical University. The study was conducted in accordance with the guidelines of the Declaration of Helsinki. Besides, written informed consent for study was obtained from each patient or their next of kin before study commencement.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYu Luo who is acting as the submission\u0026apos;s guarantor; Hai-Yan Fu and Qiu-Hong Wang wrote the paper, they are co-first author, Yu Luo and Jie Li performed the research, Hong-Juan Li, Jian-Peng Gang, Li Liu and Bo Tang finished cell experiment, Dong Wei, Bin Xu and Xin Tong finished clinical experiment, Hai-Yan Fu and Qiu-Hong Wang collected and analysed the data. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosures and Conflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research was supported by the Science and Technology Department of Yunnan (No. 202101BA070001-100).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbdi, K., and C. T. Kuo (2018). Laminating the mammalian cortex during development: cell polarity protein function and Hippo signaling. Genes Dev 32(11\u0026ndash;12):740\u0026ndash;741. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/gad.316711.118\u003c/span\u003e\u003cspan address=\"10.1101/gad.316711.118\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhn, E. Y., et al. (2013). RASSF1A-mediated regulation of AREG via the Hippo pathway in hepatocellular carcinoma. Mol Cancer Res 11(7):748\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/1541-7786.Mcr-12-0665\u003c/span\u003e\u003cspan address=\"10.1158/1541-7786.Mcr-12-0665\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolitho, C., et al. (2021). Amphiregulin increases migration and proliferation of epithelial ovarian cancer cells by inducing its own expression via PI3-kinase signaling. Mol Cell Endocrinol 533:111338. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mce.2021.111338\u003c/span\u003e\u003cspan address=\"10.1016/j.mce.2021.111338\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonastre, E., et al. (2015). PARD3 Inactivation in Lung Squamous Cell Carcinomas Impairs STAT3 and Promotes Malignant Invasion. Cancer Res 75(7):1287\u0026ndash;97. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/0008-5472.Can-14-2444\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.Can-14-2444\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao, J., et al. (2021). Long non-coding RNA-based signature for predicting prognosis of hepatocellular carcinoma. Bioengineered 12(1):673\u0026ndash;681. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/21655979.2021.1878763\u003c/span\u003e\u003cspan address=\"10.1080/21655979.2021.1878763\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCho, K., et al. (2021). YAP/TAZ Suppress Drug Penetration Into Hepatocellular Carcinoma Through Stromal Activation. Hepatology 74(5):2605\u0026ndash;2621. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/hep.32000\u003c/span\u003e\u003cspan address=\"10.1002/hep.32000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCunningham, R., and C. G. Hansen (2022). The Hippo pathway in cancer: YAP/TAZ and TEAD as therapeutic targets in cancer. Clin Sci (Lond) 136(3):197\u0026ndash;222. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/cs20201474\u003c/span\u003e\u003cspan address=\"10.1042/cs20201474\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDadras, M. S., et al. (2021). The polarity protein Par3 coordinates positively self-renewal and negatively invasiveness in glioblastoma. Cell Death Dis 12(10):932. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41419-021-04220-7\u003c/span\u003e\u003cspan address=\"10.1038/s41419-021-04220-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao, R., et al. (2021). YAP/TAZ and ATF4 drive resistance to Sorafenib in hepatocellular carcinoma by preventing ferroptosis. EMBO Mol Med 13(12):e14351. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.15252/emmm.202114351\u003c/span\u003e\u003cspan address=\"10.15252/emmm.202114351\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGurzu, S., et al. (2019). Epithelial Mesenchymal and Endothelial Mesenchymal Transitions in Hepatocellular Carcinoma: A Review. Biomed Res Int 2019:2962580. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2019/2962580\u003c/span\u003e\u003cspan address=\"10.1155/2019/2962580\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan, S. X., et al. (2014). Expression and clinical significance of YAP, TAZ, and AREG in hepatocellular carcinoma. J Immunol Res 2014:261365. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2014/261365\u003c/span\u003e\u003cspan address=\"10.1155/2014/261365\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, H., et al. (2022). Membrane proteomic analysis identifies the polarity protein PARD3 as a novel antiviral protein against PEDV infection. J Proteomics 253:104462. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jprot.2021.104462\u003c/span\u003e\u003cspan address=\"10.1016/j.jprot.2021.104462\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIden, S., et al. (2012). Tumor type-dependent function of the par3 polarity protein in skin tumorigenesis. Cancer Cell 22(3):389\u0026ndash;403. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ccr.2012.08.004\u003c/span\u003e\u003cspan address=\"10.1016/j.ccr.2012.08.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang, J., et al. (2019). Over expression of amphiregulin promoted malignant progression in gastric cancer. Pathol Res Pract 215(10):152576. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.prp.2019.152576\u003c/span\u003e\u003cspan address=\"10.1016/j.prp.2019.152576\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJung, H. Y., et al. (2019). Apical-basal polarity inhibits epithelial-mesenchymal transition and tumour metastasis by PAR-complex-mediated SNAI1 degradation. Nat Cell Biol 21(3):359\u0026ndash;371. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41556-019-0291-8\u003c/span\u003e\u003cspan address=\"10.1038/s41556-019-0291-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhamis, Z. I., et al. (2021). Cytochrome P450-2D6: A novel biomarker in liver cancer health disparity. PLoS One 16(10):e0257072. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0257072\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0257072\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKyung, S. Y., et al. (2018). Sulforaphane attenuates pulmonary fibrosis by inhibiting the epithelial-mesenchymal transition. BMC Pharmacol Toxicol 19(1):13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s40360-018-0204-7\u003c/span\u003e\u003cspan address=\"10.1186/s40360-018-0204-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, J., et al. (2019). Pard3 suppresses glioma invasion by regulating RhoA through atypical protein kinase C/NF-κB signaling. Cancer Med 8(5):2288\u0026ndash;2302. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/cam4.2063\u003c/span\u003e\u003cspan address=\"10.1002/cam4.2063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, S., et al. (2021). High expression of PARD3 predicts poor prognosis in hepatocellular carcinoma. Sci Rep 11(1):11078. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-021-90507-w\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-90507-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin, X., et al. (2019). RNA m(6)A methylation regulates the epithelial mesenchymal transition of cancer cells and translation of Snail. Nat Commun 10(1):2065. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-019-09865-9\u003c/span\u003e\u003cspan address=\"10.1038/s41467-019-09865-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, W. A., et al. (2018). PARD3 dysfunction in conjunction with dynamic HIPPO signaling drives cortical enlargement with massive heterotopia. Genes Dev 32(11\u0026ndash;12):763\u0026ndash;780. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/gad.313171.118\u003c/span\u003e\u003cspan address=\"10.1101/gad.313171.118\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLv, X. B., et al. (2015). PARD3 induces TAZ activation and cell growth by promoting LATS1 and PP1 interaction. EMBO Rep 16(8):975\u0026ndash;85. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.15252/embr.201439951\u003c/span\u003e\u003cspan address=\"10.15252/embr.201439951\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartini, A., et al. (2017). YAP, TAZ and AREG expression in eighth cranial nerve schwannoma. Int J Biol Markers 32(3):e319-e324. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5301/ijbm.5000263\u003c/span\u003e\u003cspan address=\"10.5301/ijbm.5000263\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakamura, H., et al. (2016). Expression of Par3 polarity protein correlates with poor prognosis in ovarian cancer. BMC Cancer 16(1):897. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12885-016-2929-2\u003c/span\u003e\u003cspan address=\"10.1186/s12885-016-2929-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoguchi, S., A. Saito, and T. Nagase (2018). YAP/TAZ Signaling as a Molecular Link between Fibrosis and Cancer. Int J Mol Sci 19(11). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms19113674\u003c/span\u003e\u003cspan address=\"10.3390/ijms19113674\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaimondo, S., et al. (2019). Multiple myeloma-derived exosomes are enriched of amphiregulin (AREG) and activate the epidermal growth factor pathway in the bone microenvironment leading to osteoclastogenesis. J Hematol Oncol 12(1):2. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13045-018-0689-y\u003c/span\u003e\u003cspan address=\"10.1186/s13045-018-0689-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo, W., et al. (2019). ALDH2 deficiency promotes alcohol-associated liver cancer by activating oncogenic pathways via oxidized DNA-enriched extracellular vesicles. J Hepatol 71(5):1000\u0026ndash;1011. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jhep.2019.06.018\u003c/span\u003e\u003cspan address=\"10.1016/j.jhep.2019.06.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShe, M., et al. (2022). AREG is involved in scleral remodeling in form-deprivation myopia via the ERK1/2-MMP-2 pathway. Faseb j 36(5):e22289. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1096/fj.202200132R\u003c/span\u003e\u003cspan address=\"10.1096/fj.202200132R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShimada, H., et al. (2017). Loss of tricellular tight junction protein LSR promotes cell invasion and migration via upregulation of TEAD1/AREG in human endometrial cancer. Sci Rep 7:37049. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep37049\u003c/span\u003e\u003cspan address=\"10.1038/srep37049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteponaitis, G., et al. (2019). Significance of Amphiregulin (AREG) for the Outcome of Low and High Grade Astrocytoma Patients. J Cancer 10(6):1479\u0026ndash;1488. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7150/jca.29282\u003c/span\u003e\u003cspan address=\"10.7150/jca.29282\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun, L., et al. (2020). KLF5 regulates epithelial-mesenchymal transition of liver cancer cells in the context of p53 loss through miR-192 targeting of ZEB2. Cell Adh Migr 14(1):182\u0026ndash;194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/19336918.2020.1826216\u003c/span\u003e\u003cspan address=\"10.1080/19336918.2020.1826216\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang, Y., et al. (2022). Identification of a Tumor Immunological Phenotype-Related Gene Signature for Predicting Prognosis, Immunotherapy Efficacy, and Drug Candidates in Hepatocellular Carcinoma. Front Immunol 13:862527. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2022.862527\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.862527\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTemraz, S., et al. (2021). Hepatocellular Carcinoma Immunotherapy and the Potential Influence of Gut Microbiome. Int J Mol Sci 22(15). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms22157800\u003c/span\u003e\u003cspan address=\"10.3390/ijms22157800\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThompson, B. J. (2020). YAP/TAZ: Drivers of Tumor Growth, Metastasis, and Resistance to Therapy. Bioessays 42(5):e1900162. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/bies.201900162\u003c/span\u003e\u003cspan address=\"10.1002/bies.201900162\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, L., et al. (2020). AREG mediates the epithelial\u0026ndash;mesenchymal transition in pancreatic cancer cells via the EGFR/ERK/NF\u0026ndash;κB signalling pathway. Oncol Rep 43(5):1558\u0026ndash;1568. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/or.2020.7523\u003c/span\u003e\u003cspan address=\"10.3892/or.2020.7523\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, L., et al. (2017). Partition-Defective 3 (PARD3) Regulates Proliferation, Apoptosis, Migration, and Invasion in Esophageal Squamous Cell Carcinoma Cells. Med Sci Monit 23:2382\u0026ndash;2390. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.12659/msm.903380\u003c/span\u003e\u003cspan address=\"10.12659/msm.903380\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Y. C., Z. B. Tian, and X. Q. Tang (2021). Bioinformatics screening of biomarkers related to liver cancer. BMC Bioinformatics 22(Suppl 3):521. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12859-021-04411-1\u003c/span\u003e\u003cspan address=\"10.1186/s12859-021-04411-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Z., and J. Jin (2019). LncRNA SLCO4A1-AS1 promotes colorectal cancer cell proliferation by enhancing autophagy via miR-508-3p/PARD3 axis. Aging (Albany NY) 11(14):4876\u0026ndash;4889. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/aging.102081\u003c/span\u003e\u003cspan address=\"10.18632/aging.102081\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, H., et al. (2021). DCP1A is an unfavorable prognostic-related enhancer RNA in hepatocellular carcinoma. Aging (Albany NY) 13(19):23020\u0026ndash;23035. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/aging.203593\u003c/span\u003e\u003cspan address=\"10.18632/aging.203593\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, Q., et al. (2019). Targeting amphiregulin (AREG) derived from senescent stromal cells diminishes cancer resistance and averts programmed cell death 1 ligand (PD-L1)-mediated immunosuppression. Aging Cell 18(6):e13027. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/acel.13027\u003c/span\u003e\u003cspan address=\"10.1111/acel.13027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, X., et al. (2021). Substrate Stiffness Drives Epithelial to Mesenchymal Transition and Proliferation through the NEAT1-Wnt/β-Catenin Pathway in Liver Cancer. Int J Mol Sci 22(21). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms222112066\u003c/span\u003e\u003cspan address=\"10.3390/ijms222112066\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, N., et al. (2012). TAZ induces growth factor-independent proliferation through activation of EGFR ligand amphiregulin. Cell Cycle 11(15):2922\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4161/cc.21386\u003c/span\u003e\u003cspan address=\"10.4161/cc.21386\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYeh, H., C. C. Chiang, and T. H. Yen (2021). Hepatocellular carcinoma in patients with renal dysfunction: Pathophysiology, prognosis, and treatment challenges. World J Gastroenterol 27(26):4104\u0026ndash;4142. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3748/wjg.v27.i26.4104\u003c/span\u003e\u003cspan address=\"10.3748/wjg.v27.i26.4104\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan, K., et al. (2020). TXNDC12 promotes EMT and metastasis of hepatocellular carcinoma cells via activation of β-catenin. Cell Death Differ 27(4):1355\u0026ndash;1368. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41418-019-0421-7\u003c/span\u003e\u003cspan address=\"10.1038/s41418-019-0421-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan, W., et al. (2019). TAZ sensitizes EGFR wild-type non-small-cell lung cancer to gefitinib by promoting amphiregulin transcription. Cell Death Dis 10(4):283. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41419-019-1519-z\u003c/span\u003e\u003cspan address=\"10.1038/s41419-019-1519-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZaiss, D. M. W., et al. (2015). Emerging functions of amphiregulin in orchestrating immunity, inflammation, and tissue repair. Immunity 42(2):216\u0026ndash;226. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.immuni.2015.01.020\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2015.01.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZanconato, F., M. Cordenonsi, and S. Piccolo (2016). YAP/TAZ at the Roots of Cancer. Cancer Cell 29(6):783\u0026ndash;803. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ccell.2016.05.005\u003c/span\u003e\u003cspan address=\"10.1016/j.ccell.2016.05.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, M. Y., et al. (2021a). A critical role of AREG for bleomycin-induced skin fibrosis. Cell Biosci 11(1):40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13578-021-00553-0\u003c/span\u003e\u003cspan address=\"10.1186/s13578-021-00553-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, X., et al. (2019). MicroRNA 483-3p targets Pard3 to potentiate TGF-β1-induced cell migration, invasion, and epithelial-mesenchymal transition in anaplastic thyroid cancer cells. Oncogene 38(5):699\u0026ndash;715. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41388-018-0447-1\u003c/span\u003e\u003cspan address=\"10.1038/s41388-018-0447-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Y., W. Ni, and L. Qin (2021b). RUFY3 promotes the progression of hepatocellular carcinoma through activating NF-κB-mediated epithelial-mesenchymal transition. Aging (Albany NY) 13(17):21283\u0026ndash;21293. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/aging.203444\u003c/span\u003e\u003cspan address=\"10.18632/aging.203444\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao, W., et al. (2021). Transcriptional co-activators YAP/TAZ: Potential therapeutic targets for metastatic breast cancer. Biomed Pharmacother 133:110956. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2020.110956\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2020.110956\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, P. J., et al. (2017). Elevated expression of Par3 promotes prostate cancer metastasis by forming a Par3/aPKC/KIBRA complex and inactivating the hippo pathway. J Exp Clin Cancer Res 36(1):139. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13046-017-0609-y\u003c/span\u003e\u003cspan address=\"10.1186/s13046-017-0609-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu, X., H. Pan, and L. Liu (2021). Long noncoding RNA network: Novel insight into hepatocellular carcinoma metastasis (Review). Int J Mol Med 48(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/ijmm.2021.4967\u003c/span\u003e\u003cspan address=\"10.3892/ijmm.2021.4967\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"liver hepatocellular carcinoma, epithelial mesenchymal transition, PARD3 TAZ, AREG","lastPublishedDoi":"10.21203/rs.3.rs-1953346/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1953346/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003ePartition defective 3 (PARD3) regulates cell polarity and functions as a cancer promoting or tumor suppressor in different cancer types. PARD3 was reported to be highly expressed in liver hepatocellular carcinoma (LIHC) tissues and high expression of PARD3 was significantly associated with poor clinicopathological features and lower overall survival, but whether PARD3 regulated invasion, migration and epithelial mesenchymal transition (EMT) in LIHC has not been reported.\u003c/p\u003e\u003ch2\u003eObjectives\u003c/h2\u003e \u003cp\u003eTo investigate the effect and mechanism of PARD3 on LIHC cell invasion, migration and EMT.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003ePARD3 expression in LIHC tumor group and relationship with survival were queried according to the GEPIA website. PARD3 mRNA and protein expression in 41 clinical samples were determined by RT-qPCR and immunohistochemistry (IHC), respectively. PARD3, transcriptional coactivator with PDZ-binding motif (TAZ)and amphiregulin ༈AREG༉expression in HepG2 cells with overexpression or knockdown, and the expression of PARD3, TAZ, AREG and EMT related proteins were determined by Western blot. Transwell assay for HepG2cell invasion ability. The migration ability of HepG2 cells was detected by wound healing experiments. TAZ localization was detected by immunofluorescence. Co-IP detected the effect of PARD3 on TAZ and TAZ TEAD binding. The effect of TAZ on AREG transcript levels was examined by RT-qPCR.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003ePARD3 was found to be highly expressed in LIHC tumor group by GEPIA website query, and the expression of PARD3 gradually increased with increasing tumor stage, and high expression of PARD3 usually means low overall survival in LIHC. We also found that PARD3 was highly expressed in LIHC tissues. Knockdown of PARD3 inhibited HepG2 cell invasion, migration and EMT, while overexpression of PARD3 played the opposite role. Moreover, PARD3 promotes AREG transcription by promoting TAZ nuclear localization, which in turn promotes LIHC cell invasion, migration and EMT.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003ePARD3 promotes TAZ nuclear localization and promotes AREG transcription to promote epithelial mesenchymal transition in LIHC.\u003c/p\u003e","manuscriptTitle":"Partition defective 3 promotes TAZ nuclear localization and promotes Amphiregulin transcription to promote liver hepatocellular carcinoma cell invasion, migration and epithelial mesenchymal","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-08-17 17:32:51","doi":"10.21203/rs.3.rs-1953346/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b0a3289f-b530-43ac-99fb-5f77f6438184","owner":[],"postedDate":"August 17th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-09-08T10:14:32+00:00","versionOfRecord":[],"versionCreatedAt":"2022-08-17 17:32:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1953346","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1953346","identity":"rs-1953346","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}