Synergistic effects of Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. RKDAS1 as a probiotic functional feed (PFF) in Nile tilapia: Insights into growth, hemato-biochemical, and immune responses in the face of Vibrio challenges

Synergistic effects of Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. RKDAS1 as a probiotic functional feed (PFF) in Nile tilapia: Insights into growth, hemato-biochemical, and immune responses in the face of Vibrio challenges | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Synergistic effects of Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. RKDAS1 as a probiotic functional feed (PFF) in Nile tilapia: Insights into growth, hemato-biochemical, and immune responses in the face of Vibrio challenges Bhavani Paramashivan, Rajkumar Thamarai, Rajkumar Prabhakaran, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5202048/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Probiotics offer significant health advantages as they enter the digestive system via diet or water intake, playing a crucial role in enhancing immunity, growth, gastrointestinal microbiota, and feed attribute. The main objective of study to focusing in the impact of Probiotic Functional Feed (PFF) on Nile tilapia ( Oreochromis niloticus ) exposed to challenges from Vibrio harveyi and Vibrio parahaemolyticus . The investigation aims to analyze the genes linked to immunity, hemato-biochemical indices, and the immunological response in tilapia. PFF is a vital component of fish feed production, providing suitable nutrition for various ages and stages to promote healthy growth. The study comprises five treatments: Negative Control (NC), Positive Control (PC), Rossellomorea marisflavi sp. DAS-SCF02, Agrococcus sp. RKDAS1, and a dual probiotic mix. A total of 150 Nile tilapia juveniles, weighing 2.56 ± 1.26 g, were administered PFF in triplicates. Significant improvements were observed in hematological indices, encompassing white blood cells (WBC), hemoglobin (Hb), red blood cells (RBC), hematocrit (Htc), and blood performance (BP) in probiotic-treated groups compared to control. Biochemical analysis revealed lower levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in fish fed with probiotics, accompanied by increased total protein, albumin, and globulin levels. Furthermore, probiotic-fed fish exhibited heightened blood glucose, total cholesterol, and triglyceride levels. Immunological assessments demonstrated increased lysozyme activity, intracellular superoxide anion production, reactive nitrogen species synthesis, and myeloperoxidase activity in probiotic-fed groups. Immune gene expression analysis revealed up-regulation of stress response, cytokine signaling, and immune defense-related genes ( HSP70, IL-1β, I C3, IFN-α, IFN-γ, GF1, GH, IL-1 , and Lyz ). In a Vibrio challenge study, probiotic-fed fish exhibited improved survival rates, underscoring the protective effects of probiotics against bacterial infections. Overall, this research underscores the multifaceted benefits of probiotic supplementation in enhancing the health and immunity of tilapia. Biological sciences/Biotechnology Biological sciences/Microbiology Biological sciences/Molecular biology Probiotic Functional Feed Nile tilapia Hemato-biochemical indices Immunological response Vibrio challenge Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The fish farming sector is experiencing steady growth in response to the world's increasing population. The adoption of intensive aquaculture strategies aims to meet the rising demand, with the Nile tilapia ( Oreochromis niloticus ), currently ranking as the third-highest-farmed fish globally in terms of volume (4.5 Mmt) due to continuous advancements in farming practices [ 1 ]. Despite the success of tilapia farming, challenges have emerged, particularly the excessive feed requirements [ 2 – 4 ]. Consequently, there is a growing focus on researching feed formulations and feeding methods to enhance fish gastrointestinal and health while continuing a balanced inhabitation of stomach bacteria. These approaches aim to boosting productivity in the sector of fish farming. As aquaculture intensifies, the facility's capacity to address various illnesses and health issues becomes crucial. Ongoing investigations into fish immune responses and physical development seek to develop sustainable and environmentally friendly methods to ensure the well-being of the fish [ 5 – 8 ]. Notably, research on immune-stimulating probiotics for fish healthcare shows promising potential in boosting immunity and treating diseases. These immunopotentiators can enhance fish growth, immunological response, intestinal health, and fillet quality [ 5 , 8 , 9 ]. Probiotics, active microbes, can thrive and proliferate in the animal's stomach, contributing to its overall well-being [ 10 – 13 ]. They promote fish development by improving gastrointestinal architecture and microbial diversity, influencing the gastrointestinal ecology through the secretion of extracellular digestive enzymes like protease and amylase and the production of compounds such as short-chain fatty acids [ 14 ]. Researchers have proven the efficacy of functional dietary additives, highlighting the detrimental effects of excessive excreta levels on fish and shrimp. Evidence suggests that nutritive yeast hydrolysate and baker's yeast supplements can improve the hostility of Litopenaeus vannamei to nitrogen toxicity [ 15 ]. In laboratory-cultured common carp ( Cyprinus carpio ) juveniles, a probiotic functional feed containing Pediococcus acidilactici and formic acid influenced growth, blood biochemical parameters, immune gene upregulation, and survival [ 16 ]. Rossellomorea marisflavi , an aerobic Gram-positive organism, exhibits non-mobile filaments, non-swollen spores, and terminally oval endospores [ 17 ]. When cultured on TSA (tryptic soy agar, M1968-Himedia, Mumbai, India) plates complemented with 2.5% NaCl (w/v) at pH 7.0 and 37°C for 24 hours, this strain demonstrated robust growth conditions, thriving between pH 6.0 and 9.0, at temperatures ranging from 15 to 45°C, and tolerating NaCl concentrations from 0 to 25% (w/v) [ 17 ]. The genus Rossellomorea , proposed by [ 18 ], is closely related to the Lactobacillaceae genus of lactic acid-producing bacteria and belongs to the Bacillaceae family within the phylum Firmicutes. Notably, Rossellomorea was part of a bacterial consortium that enhanced the potential of the halophyte Arthrocaulon macrostachyum for phytoremediation applications by improving seed development, growth, and heavy metal preservation in the root system, particularly in heavy metal-polluted soils [ 17 , 19 , 20 , 21 ]. Agrococcus lahaulensis , an aerobic, non-acid-fast, Gram-positive bacterium, forms distinctly margined, opaque, round, lemon-colored colonies on TSA media. The colonies range in size from 0.7 to 3.0 mm, exhibit resilience to up to 7.0% NaCl, and thrive optimally at temperatures ranging from 25 to 37°C. Growth occurs within the pH range of 6.0 to 10.0, with the ideal pH being 8.0 [ 22 ]. Agrococcus sp. SD01-s17, a bioactive variant of Agrococcus , possesses diverse pharmacological and biocidal activities. It functions as an antioxidant, demonstrates anticancer, antibiotic, and antifungal properties, and has the potential to inhibit the growth of harmful bacteria, as reported by [ 23 ]. The antibacterial properties of Agrococcus lahaulensis against S. aureus and B. cereus [ 24 ]. Notably, the combination of Rossellomorea marisflavi sp. and Agrococcus lahaulensis sp. has not been previously reported for improving fish health. This groundbreaking discovery indicates that the production of sufficient quantities of antagonistic bioactive properties against pathogenic bacteria and their infections can enhance the aquatic environment, promoting fish health by boosting immunity. Materials and Methods Preparation of Nutrient-Enriched Probiotic Feed The probiotic functional diet, designed to provide essential nutrients for juvenile tilapia, utilized feed materials sourced from CP Aquaculture (India) Pvt Ltd at 104, GNT Road, Nallur, Red Hills, Chennai, Tamil Nadu, India. The materials underwent crushing and sieving before meticulous blending. Dried ingredients were thoroughly mixed before the addition of liquid components. Employing a feed processing machine, the feed was produced, cut into appropriate sizes, and subjected to a two-hour oven-drying at 60°C. After cooling, the feed was sealed in plastic bags for storage until required (Table 1 ). Table 1 PFF nutritional preparation and organic composition (g/kg). Ingredients CPF1 PFF2 PFF3 PFF4 Soybean meal 448 448 448 448 Yellow corn 170 170 170 170 Corn gluten 60 60 60 60 Rice bran 100 100 100 100 Wheat bran 150 150 150 150 Fish meal 40 40 40 40 Soya oil 1 1 1 1 Fish oil 1 1 1 1 Vitamin C 5 5 5 5 Vitamin & Mineral mix 25 25 25 25 Chemical analysis (g/kg) Dry matter 895.3 895.3 895.3 895.3 Crude Protein 293.2 293.2 293.2 293.2 Crude Lipid 60.6 60.6 60.6 60.6 Fiber 257 257 257 257 Ash 50.7 50.7 50.7 50.7 200g of Rossellomorea marisflavi sp . (DAS-SCF02) 0 1×10 4 0 0 200g of Agrococcus sp. (RKDAS1) 0 0 1×10 6 0 200 + 200g of Dual strain mix ( Rossellomorea marisflavi sp. (DAS-SCF02) + Agrococcus sp. (RKDAS1) 0 0 0 1×10 7 Probiotics culture preparation The probiotics were derived from two novel strains of bacteria: Agrococcus spp. RKDAS1 and Rossellomorea marisflavi spp . DAS-SCF02, which were isolated from Indian Snakehead fish ( Channa straiata ) in freshwater lakes and the Tamiraparani River at Tirunelveli, and sludge from the Muttukadu boat house in Kanchipuram, Tamil Nadu. Isolates of Agrococcus spp. RKDAS1 and Rossellomorea marisflavi spp . DAS-SCF02 were cultivated for a full day in NB (nutrient broth) to produce the probiotic cultures. The probiotic cells were centrifuged, cleaned, and suspended in 0.85% saline solution. Using a spectrophotometer, their concentrations were then adjusted to an absorbance OD of 600. Then, the washed probiotic strain suspensions were added to the basal feeds in a ratio of 20: 100 (w/w) between probiotic strain suspensions and basal supplementations for sustaining probiotics viability [ 25 , 26 ]. Experimental Grouping and Preparation of Probiotic-Enriched Feeds The study involved the production of four distinct feed types: Probiotic feeds PFF2, PFF3, and PFF4 incorporated probiotic isolates, namely Agrococcus spp. RKDAS1 and Rossellomorea marisflavi spp. DAS-SCF02, along with dual probiotic strains mix containing Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. RKDAS1, respectively. The control feed (CF1) served as the baseline without probiotic additives. Each experimental group consisted of three replicates, with each tank accommodating ten tilapia fish. The base feed underwent autoclaving, and subsequent blending with the prepared probiotic culture was followed by serial dilution with a 0.85% sterile saline solution to quantify the probiotic concentration in the feed. To enumerate viable probiotics, 100 µL samples from specified dilutions were cultured on nutrient agar plates and incubated for 24 hours. After preparation, all feeds were stored under refrigeration to maintain the probiotic dosage integrity [ 27 ]. Experimental design Fish collection Juvenile Oreochromis niloticus was obtained from the Freshwater Aquaculture Sector of the University of Fisheries, weighing 2.56 ± 1.26 g. Before the experiment, the general health of each animal was evaluated based on its swimming ability in the tank, regular feeding patterns, the absence of blemishes, the presence of undamaged and vibrant scales, the absence of protruding eyes, and the integrity of fins without tears or ragged edges Feeding Practices and Maintenance Protocols in a Juvenile Fish Study As part of Probiotic functional feed (PFF) trial, the fish were hand-fed a basal diet twice a day after being placed into ten twenty/100-L plastic tanks. They underwent a seven-day acclimatization phase to adapt to the experimental environment. The experiment divided into four groups, CPF-1 (control group, diet included solely of basal fish feed), the 20% of PFF2 ( Rossellomorea marisflavi sp. (DAS-SCF02–1×10 4 ), PFF3 ( Agrococcus sp. (RKDAS1-1×10 6 ), and PFF4- (DAS-SCF02–1×10 4 + RKDAS1 (1×10 7 ) respectively, were equally distributed among each treatment group. Each tank housed twenty juvenile fish in static water, with a routine refresh of approximately half the water volume through a flow-through aquarium system and clearing of accumulated excrement was conducted. The probiotics functional feeds (PFF2, PFF3, and PFF4) were administered for eight weeks, providing the animals with 3% of their daily feed allocation in three meals at 9:00, 15:00, and 21:00 [ 28 ]. Comprehensive Assessment of Hematological, Biochemical, and Environmental Parameters in Tilapia during Long-Term PFF Supplementation At 20-days intervals, various hematological and biochemical indices were assayed, including total albumin, globulin, hemoglobin (Hb), albumin–globulin ratio, total serum protein, total leukocyte count (TLC), total erythrocyte count (TEC), acetylcholine esterase (AChE), alanine aminotransferase (ALT), lactate dehydrogenase (LDH), aspartate aminotransferase (AST), and total adenosine triphosphatase (ATPase). The water quality was maintained within acceptable limits, and environmental indices such as dissolved oxygen (O 2 ), pH, ammonia, and nitrite were assessed using readily available kits (Water Quality Test Kit - HI3817) during the investigation. The water temperature was maintained between 28 and 29°C. Hemato-biochemical indices assessment In order to collect plasma and perform enzyme assays, the fish were anesthetized with 100 mg/L of 3-aminobenzoic acid ethyl ester (MS-222, Sigma-Aldrich, St. Louis, MO, USA) on days 20, 40, and 60 of the experiment. The first portion of the blood sample was obtained using an anticoagulant 10% ethylene diamine tetra acetate (EDTA) to estimate the hematocrit (Htc) and white blood cells (WBCs). To harvest plasma samples, five fish from each treatment duplicate were euthanized. Tissue homogenization was carried out in a cold sucrose buffer (0.25 M) using a Teflon-coated mechanical tissue homogenizer (Remi, India), the samples were centrifugation for 10 minutes at 5000 g at 4°C followed by lysis. The enzyme activity was assessed using the supernatant obtained as the enzyme resource. All steps of the enzyme synthesis process were conducted in a refrigerated environment, with sample dilution performed where necessary. For blood extraction, a sterilized 2-milliliter BD syringe cleaned with EDTA buffer (2.7%) was utilized. Blood was drawn into small glass vials containing 20 µl of EDTA buffer (2.7%) as an anticoagulant. The TEC and TLC were determined according to the method outlined by [ 29 ]. A hemocytometer (Feinoptik, Germany) was employed for cell counting, with results reported as follows: \(\:RBC\:Count=\:\frac{NrX\text{10,000}}{{mm}^{3}}\) \(\:WBC\:Count=\:\frac{500}{{mm}^{3}}\) Here, Nr represents the total number of RBC measured in each square of the hemocytometer, and Nw indicates the total amount of WBC determined in each square. The factor acquired after accounting for the initial dilution factors is 10,000. The blood Hb content was determined using Darbkins fluid and the Cyanmethemoglobin technique with a commercial kit (Qualigens, Mumbai, India). Hematic indices The blood collection procedure involved using a 2 mL BD sterilized syringe with 0.2 mL of anticoagulant, drawing blood from the caudal part of the fingerling fish, and transferring it to a fresh 1.5 mL Eppendorf centrifuge tube. The blood was permitted to clot for 45 minutes at room temperature with the tube tilted, followed by a 30-minute incubation at 4°C. Subsequently, the tube was centrifuged for 10 minutes at 3000g at 4°C. Blood plasma was then collected in sterile Eppendorf centrifuge tubes and analyzed using Qualigens diagnostic kits in a semi-automated analyzer (AR 601, Qualigens, Mumbai, India) for various serum indices. The examined serum indices included LDL, HDL, triglyceride, albumin (using the bromocresol green binding method) (ALB), cholesterol (CHO), and total serum protein (using the biuret method employing biuret reagent and buffered dye reagent). Globulin - albumin ratios were calculated by dividing albumin concentration by globulin content, and globulin content by albumin concentration. Immunological evaluates Lysozyme activity Lysozyme performance was evaluated with slight modifications following the procedure outlined by Parry et al., 1965 [ 30 ]. In brief, a 96-well microplate was filled in triplicate with 25 µL of plasma. Subsequently, each well received 0.2 mg mL − 1 of Micrococcus lysodeikticus solution in a buffered sodium phosphate solution (pH 6.2), totaling 175 µL. The reaction was monitored using a spectrophotometer set to measure reactions at 540 nm, with readings taken and recorded every minute for ten minutes. The blood activity of lysozyme was quantified as a 0.001 min − 1 reduction at 540 nm and reported in units of mL − 1 . Intracellular superoxide anion (SOA) The assessment of intracellular superoxide anion (SOA) and respiratory burst activity involved conducting NBT (nitroblue tetrazolium) reduction reactions, adapted from the Secombes method (Secombes, 1990). In brief, microplates (96-well) were utilized to contain three batches of WBCs (6 × 10^6 cells). To each well, 25µL of NBT was added, and the plates were protected at room temperature for two hours. After the incubation, 150µL of absolute methanol was introduced to each well, and the residual fluid was discarded. Subsequently, the wells underwent repeated cleaning with a 70% methanol solution. Finally, 100µL of DMSO and 150µL of 2M KOH were added to each well. Following thorough mixing, the absorbance value, indicative of the reaction, was measured at 540 nm using a UV-Vis spectrophotometer (201/220, Thermo Scientific). Production of reactive nitrogen species (RNS) analysis The Griess reagent technique, which is related to the change of nitrite from nitric oxide, was used to assess the nitric oxide (NO) in the plasma of tilapia [ 31 ]. Using a conventional curve representing the level of nitrate in the serum of tilapia, the amount of nitrite present was determined. MPO (myeloperoxidase) The MPO activity in plasma was assessed using [ 32 ]. An absorption change was considered to be one unit, and the activity was represented as U mg plasma − 1 . Immune-related gene expression Isolation of RNA and cDNA Construction For total RNA isolations, liver samples were dissected from three animals per treatment group. A concentration of 20 ng µL − 1 was targeted for liver RNA. Total RNA was isolated using a commercial Kit (RNA mini kit, Cat No. 74,104, Qiagen, Germany) according to the manufacturer's guidelines. The purity of the RNA was assessed through gel electrophoresis (1.2% agarose gel) and NanoDrop spectrophotometry (NanoDrop 2000, Thermo Scientific). Subsequently, cDNA synthesis was performed using a cDNA RT Kit (Applied Biosystems, Cat# no. 4368813, USA), adhering to the manufacturer's instructions. Quantitative (qPCR) RT-PCR examination Quantitative RT-PCR analysis was conducted using the Applied Biosystems 96 Real-time qPCR System, USA, to assess the expression of genes, including β-actin household genes, hsp70, IL-1β, IC3, TNF-α, IFN-γ, GF1, GH, IL-1, and Lyz. The DNA primer sequences used for amplification are presented in Table 2 . The SYBR green technique with the SensiFast SYBR Lo-Rox kit (Bioline) was employed for RT-PCR. Amplification conditions consisted of 45 cycles: 10 seconds at 95°C, 30 seconds at 63°C, and 30 seconds at 72°C. Subsequently, the 2 −∆∆CT method was applied to determine the relative expression levels of the target genes. Table 2 List of primers employed to quantify immune relative gene expression. Gene Sequence (5′-3′) GB. Accession No. Annealing Temp. (°C) R 2 Efficiency (%) A. size (bp) β-actin F:CAGCAAGCAGGAGTACGATGAG R: TGTGTGGTGTGTGGTTGTTTTG XM_003455949.2 62 0.994 19.2 136 Interleukin-1β (IL-1β) F:CAAGGATGACGACAAGCCAACC R: AGCGGACAGACATGAGAGTGC XM_019365844.2 60 0.991 96.66 149 Interleukin-IL1 F:CTGTGAAGGCATGGGTGTGGAG R:TCGCAGTGGGAGTTGGGAAG NM_001279704.1 60 0.979 96.49 111 complement component (IC3) F: GGTGTGGATGCACCTGAGAA R: GGGAAATCGGTACTTGGCCT XM_013274267.2 60 0.998 97.22 196 Heat shock protein 70 (Hsp70) F: CATCGCCTACGGTCTGGACAA R: TGCCGTCTTCAATGGTCAGGAT FJ207463.1 62 0.995 99.15 238 Tumor necrosis factor- α (TNF-α) F:AAGCCAAGGCAGCCATCCAT R:TTGACCATTCCTCCACTCCAGA NM_001279533.1 58 0.993 98.67 184 Interferon (IFN-γ) F: TGGGTGGTGTTTTGGAGTCG R: TAGCGAGCCTGAGTTGTTGG NM_001287402.1 60 0.998 99.54 138 Growth factor (GF1) F-AAGGGAAGCAGCAGCAGTTGTG R-CGTCCATGCCGTTAGCCTTGAG NM_001279708.4 58 0.989 98.96 151 Growth hormone (GH) F:ACATCATCAGCCCGATCGAC R:TCAGCAGCAAGATTCCCGTT XM_003442542.5 62 0.994 98.38 183 Lysozyme (Lyz) F-AGGGAAGCAGCAGCAGTTGTG R-CGTCCATGCCGTTAGCCTTGAG XM_003460550.2 60 0.997 94.98 107 F: forward; R: Reverse; GB: Gene bank; Temp: Temperature Vibrio challenge The Vibrio strains of V. harveyi and V. parahaemolyticus were isolated from the infected Tilapia fish at Ramayanpatti, in the Tamil Nadu district of Tirunelveli, India. The conventional morphological, biochemical, and pathogenicity assays identified the Vibrio bacterial isolates. The isolates were pre-enriched with an alkaline peptone solution (APS) before being diluted in conventional saline (0.85% NaCl w/v). Each isolate was surface dispersed on three agar media: TCBS (thiosulphate citrate bile salt sucrose agar), SWC (seawater complex agar), and Vibrio specific agar medium (VSAM). A dark room at 30°C was the perfect temperature for finding bio-luminous colonies on SWC agar. The Vibrio isolates were compared to strains of V. harveyi (MTCC 3438) and V. parahaemolyticus (MTCC 443) as positive and negative controls, respectively, and then further confirmed by PCR. The PCR confirmed Vibrio isolates were used in this study. To prepare separately fresh V. harveyi and V. parahaemolyticus , a single colony of Vibrio was inoculated into Nutrient Broth with 2% of NaCl and cultured for 24 h at 30°C. Cell harvesting was performed by centrifuge at 5,000 rpm and 4°C for 10 minutes, after that three washing and re-suspending of the cells in a 0.85% saline buffer. The suspension of V. harveyi and V. parahaemolyticus was modified to 10 6 CFU/ml with 0.85% saline buffer before injection. After the feeding trial, ten fish from each group were randomly selected and intraperitoneally injected with 0.1 ml of V. harveyi and V. parahaemolyticus (10 6 CFU/ml) based on the procedure outlined by Fatima et al., 2022 [ 33 ]. Statistical analyses To assess variances among treatments, we employed an ANOVA (one-way analysis of variance) along with the Duncan multiple range test. A significance level of 0.05 was set for the analyses. The standard deviation was calculated using a similar approach. Results and Discussion Hematological indices The Fig. 1 depicts each of the four treatment groups and their respective hematological indices findings. The evaluated hematological indices exhibited significantly increased levels (P < 0.05) in the comparison of the fish treated with all three types of probiotics to those treated with an untreated diet. Fish raised in the Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. RKDAS1 (PFF3) treatment demonstrated much greater levels ( P < 0.05 ) of Hb, WBC, RBC, Htc, and BP relation to the control group (CF). Likewise, after the trial, adding PFF4 to the feed led to a substantial increase ( P < 0.05 ) in the numbers of neutrophils, lymphocytes, and monocytes compared to the control group. The present study results are agreed well with the reports of [ 34 , 35 , 36 ]. Hematological Biochemical Indices In tilapia supplemented with probiotics, specifically Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. DASRK1 (PFF3) and Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. DASRK1 (PFF4), serum levels of ALT, and AST were lower (Fig. 2 a). However, the CF3 diet resulted in the least significant ( P < 0.05 ) values of AST and ALT. Fish-fed PFF2, PFF3, and PFF4 exhibited higher serum concentrations of total protein, albumin, and globulin compared to other diets ( P < 0.05 ). The CF4 diet, containing Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. DASRK1 showed the highest levels of total globulin, albumin, and protein. Furthermore, tilapia fish treated with three types of probiotics functional feed (PFF) additive mixed probiotics had expressively (P < 0.05) greater glucose, total cholesterol, and triglyceride levels than the control group. In comparison to fish fed the CP diet, all groups administered dietary PFF showed significantly lower plasma TG levels (P 0.05 ). Additionally, with dietary supplementation of PFF, plasma LDL content was lowered, although no significant difference was observed (P > 0.05). The dual probiotics mix added to the feed dramatically raised albumin, globulin, and total protein levels in the serum, with PFF2 and PFF3 showing superiority over the CF1 control group (Fig. 2 b). The present study results are well agreed with [ 37 , 38 ] studies. Furthermore, one plausible explanation for this lowering effect on plasma lipid profiles could be the fermentation of indigestible carbohydrates derived from intestinal food to produce short-chain fatty acids, inhibiting the synthesis of cholesterol in the liver and/or returning cholesterol to the liver [ 39 ]. Immunological indices Lysozyme Activity Lysozyme, a bactericidal peptide crucial for the fish's innate immune response, plays a significant role in inhibiting biofilm formation by promoting phagocytes and the complement system [ 40 ]. It also prevents microbial adhesion and colonization [ 41 ]. In this study, during the 20th, 40th, and 60th days of dietary probiotic feeding, tilapia serum exhibited a substantial enhance (p < 0.05) in lysozyme related to the untreated experiment (Fig. 3 a). The PFF4 group, in particular, demonstrated a significant (p < 0.05) boost in serum lysozyme activity after the 60th day of dietary probiotic feeding. Notably, plasma exhibited the highest lysozyme activity after the 60th day when compared to the 40th day. Intracellular superoxide anion (SOA) Following the 20th, 40th, and 60th day of dietary probiotic feeding, the SOA production in serum improved significantly (p < 0.05) in the dietary probiotic experiments in assessment with the untreated fish (Fig. 3 b). In comparison with serum, SOA generation had been boosted in all dietary probiotic experimental feeds. In both the dietary probiotic experiments, the highest SOA generation occurred following the 60th day of feeding instead of the 20th day. The PFF4 group had the greatest enhancement, whereas the CP1 showed minimal enhancement. [ 42 , 43 ]. Production of Reactive Nitrogen Species (RNS) Analysis On the 20th, 40th, and 60th days of the dietary probiotic feeding experiment, there was a significant improvement in RNS synthesis in the serum of tilapia ( p < 0.05 ), as compared to the untreated fish (Fig. 3 c). Aligned with the formation of Reactive Oxygen Species (ROS), all dietary probiotic experiments exhibited stronger plasma RNS production on the 60th day than on the 40th day. The PFF4 feed demonstrated the highest activity of RNS generation, while the untreated fish showed a limited quantity. Similar results were observed by [ 44 ]. MPO (Myeloperoxidase) After the 20th, 40th, and 60th days of dietary probiotic experiment feeding, dramatic improvement in MPO activity in plasma was observed (p < 0.05), contrasting with the untreated group (Fig. 3 d). The MPO activity in serum increased for dietary PFF2, PFF3, and PFF4. Across all PFF2, PFF3, and PFF4 groups, the peak MPO activity was observed after the 60th day of feeding compared to the 40th day. These findings align well with the study conducted by [ 34 ]. Immune gene expression Probiotics have a well-established ability to non-specifically alter the immune system [ 45 , 46 ]. In the present study, supplementation with Rossellomorea marisflavi spp. DAS-SCF02, Agrococcus spp. DASRK1, Rossellomorea marisflavi spp. DAS-SCF02, and Agrococcus spp. DASRK1 increased the expression of HSP70, IL-1β, IC3, IFN-α, IFN-γ, GF1, GH, IL-1, and Lyz genes, with the highest expression observed in fish fed a PFF4 diet. Figure 4 (a-i) presents the transcript of immune-related gene expression experiments conducted on tilapia liver. In the liver of tilapia fed CF4 and those fed Rossellomorea marisflavi spp. DAS-SCF02, Agrococcus spp. DASRK1 additive diets (CF2, CF3, and CF4), H SP70, IL-1β, IC3, IFN-α, IFN-γ, GF1, GH, IL-1, and Lyz genes were significantly up-regulated ( P < 0.05 ) ( Fig. 4 a-i ) . Compared to CP1 tilapia fingerlings, those fed with PFF3 and PFF4 showed up-regulated expression of the immune gene SOD ( P < 0.05 ). The levels of TNF-α gene expression in fish-fed probiotic feed and all Rossellomorea marisflavi spp. DAS-SCF02, Agrococcus spp. DASRK1 treatment groups were considerably higher (P < 0.05) when compared to the other treatment groups and control group (CF2 and G3). Additionally, fish-fed CF4 exhibited increased TFN-γ gene expression compared to the control group and all treatment groups ( P < 0.05 ). Vibrio challenge study Twenty-five days after PFF2, PFF3, and PFF4 were exposed by intraperitoneal administration of fingerling tilapia fish with respectively V. harveyi and V. parahaemolyticus , the Vibrio challenge test was carried out, as illustrated in Fig. 5 a & b . Seven days’ post-challenge, the relative percentage survival (RPS) and cumulative mortality were recorded. Fish fed with dietary probiotics PFF2, PFF3, and PFF4 for 24 days exhibited a significantly reduced cumulative mortality rate compared to those fed with CF1. Cumulative mortality rates for fish fed CF1, PFF2, PFF3, and PFF4 were 92.44%, 13.65%, 11.18%, and 10.77%, respectively, at the end of the challenge test. A comparison of Tilapia fish that received functional probiotics versus those that did not show no significant difference in survival rates ( P > 0.05 ). Fingerling fish with the infection displayed abnormal diving, darker pigmentation, and a lack of appetite. Moreover, it was observed that the hemorrhages on their bodies, both in flesh and livers, were more pronounced than those observed in typical fish. The results of the Vibrio challenge test indicate that the dietary probiotics PFF2, PFF3, and PFF4 can significantly reduce the cumulative mortality rate in fingerling tilapia fish infected with V. harveyi and V. parahaemolyticus . This was consistent with previous studies that have shown the beneficial effects of probiotics in enhancing shellfish health and disease resistance [ 47 ]. According to a recent study by [ 48 ], intraperitoneal exposure to kill V. harveyi enhanced the resistance and antibody response of marine red hybrid tilapia to Vibriosis . However, it is worth noting that there were no significant differences in survival rates between fish that received probiotics and those that did not, suggesting that other factors may also influence fish survival in the presence of these pathogens. Further research is needed to explore the potential mechanisms underlying the observed effects of probiotics on fish health and to optimize their application in aquaculture practices. Survival rate after Vibrio challenge (SR) On days five and six following the V. harveyi and V. parahaemolyticus challenge, the tilapia fish began to perish. The affected fish exhibited increased mucus discharges, scale detachment, and hemorrhages on numerous areas of their external body surface. Autopsy investigation revealed a pale, swollen liver with colorless nodules dispersed across its surface and a bloated gallbladder. The internal organs of the diseased fish were used to re-isolate Vibrio sp. In a dose-dependent manner, tilapia fish raised with any of the probiotic feed treatments-PFF2, PFF3, and PFF4-showed greater survival levels than those raised in the un-treatment fish group. Significant differences in survival rates were observed between the PFF administrated groups and the control after two weeks of the Vibrio sp . challenge [ 49 , 50 ]. Notably, a dual probiotic mixed feed (PFF4) led to an increased survival rate among tilapia fish exposed to Vibrio sp. compared to the control fish. Fish fed with PFF4 exhibited the highest survival rate (89.23%), followed by those fed with PFF3 (88.82%), PFF2 (86.35%), and CF1 (7.56%), as shown in Fig. 5 b. Figure 6 showed the schematic representations of Probiotic Functional Feed (PFF) on Nile tilapia ( Oreochromis niloticus ) exposed to challenges from Vibrio harveyi and Vibrio parahaemolyticus . Conclusion In conclusion, the supplementation of Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. RKDAS1 probiotics significantly improved hematological, biochemical, and immunological parameters in tilapia. The observed increases in hematological indices, including Hb, WBC, RBC, Htc, and BP, suggest enhanced overall fish health. Biochemical analysis indicated improved liver function, as reflected by lower ALT and AST levels and increased total protein, globulin, and albumin concentrations. Furthermore, the immunological responses, as evidenced by increased lysozyme activity, superoxide anion production, reactive nitrogen species synthesis, and myeloperoxidase activity, point towards enhanced immune defenses in probiotic-fed fish. The gene expression analysis revealed the up-regulation of genes associated with stress response, cytokine signaling, and immune defense, indicating the activation of key pathways ( hsp70, IL-1β, I C3, IFN-α, IFN-γ, GF1, GH, IL-1, and Lyz) in response to probiotic supplementation. Importantly, the probiotic-fed fish exhibited improved survival rates in a Vibrio challenge study, demonstrating the practical relevance of these findings in disease resistance. Overall, this study provides valuable insights into the comprehensive benefits of probiotic supplementation in tilapia aquaculture, emphasizing its potential to enhance fish health, immunity, and resilience against bacterial challenges. These findings contribute to the growing body of knowledge supporting the sustainable and effective use of probiotics in aquaculture practices Declarations Ethics approval and consent to participate The experiment was conducted following the protocol involving animal use approved by the experiment was ethically reviewed and approved by the Department of Animal Science and Animal Ethical Committee, through the Animal and Welfare Ethical Review Body by the Manonmaniam Sundaranar University Animal Care and Use Committee MSU-ACUC (BP, PhD, Reg. No. 17214012272124). All fish handling procedures and regulations followed the ARRIVE guidelines for Animal Care and Use. Furthermore, all relevant organizational and government rules and regulations governing the ethical use of the experimental animals were followed. Written informed consent was obtained from the owners of all animals involved in the study. Competing Interests No competing interest Author Contribution B.P.: Formal and experimental analysis, Documentation & Formal analysis, Writing– original draft. R. T.: Investigation, Writing, review & editing – original draft, Conceptualization, Investigation, Visualization, Project administration. R. P.: Data curation & Review, K. S.: Supervision, Project administration, editing & review. K. A. A.G. & C. K.: Formal analysis, writing, review, & editing. All authors have read and agreed to the published version of the manuscript. Acknowledgement The authors acknowledge the Manonmaniam Sundaranar University, Tirunelveli, Tamil Nadu, India for their constant support and the grant support from UGC DR. D. S. Kothari Postdoctoral Fellowship (Normal Fellowship): No. F. 4-2/2006 (BSR)/BL/19-20/0298 New Delhi. The authors express their sincere appreciation to the Researchers supporting Project Number (RSP2025R48), King Saud University, Riyadh, Saudi Arabia. Data Availability The results presented are adequate to support the conclusion of this study. However, the lead author (B. P.) can provide extra data upon request. References FAO. The state of world fisheries and aquaculture. Food and Agriculture Organization of the United Nations, Rome, Italy. ISBN 978-92-5–132692-3. (2020). Ali, M. M. et al. Dietary alphamonolaurin for Nile tilapia ( Oreochromis niloticus ): stimulatory effects on growth, immunohematological indices, and immune-related gene expressions, Aquac. Res. May 11. (2023). Li, M. Y. et al. Effects of dietary Allium mongolicum Regel polysaccharide on growth, lipopolysaccharide-induced antioxidant responses and immune responses in Channa argus . Mol. Biol. Rep. 46 , 2221–2230 (2019). Soltan, N. M., Soaudy, M. R., Abdella, M. M. & Hassaan, M. S. Partial dietary fishmeal replacement with mixture of plant protein sources supplemented with exogenous enzymes modify growth performance, digestibility, intestinal morphology, haemato-biochemical and immune responses for Nile tilapia, Oreochromis niloticus . Anim. Feed Sci. Technol. 299 , 115642 (2023). Mohammady, E. Y. et al. Response of Nile tilapia under biofloc system to floating or sinking feed and feeding rates: Water quality, plankton community, growth, intestinal enzymes, serum biochemical and antioxidant status. Aquac Rep. 29 , 101489 (2023). Saleh, R. S., Mohammady, E. Y., El-Haroun, E. & Hassaan, M. S. Dietary dried periphyton can improve growth, digestive enzyme, serum biochemical, antioxidant response and intestinal morphometric of Nile tilapia. Aquac Res. 53 (18), 6463–6477 (2022). Kesarcodi-Watson, A., Kaspar, H., Lategan, M. J. & Gibson, L. Probiotics in aquaculture: the need, principles and mechanisms of action and screening processes. Aquac . 274 (1), 14 (2008). Yanbo, W. & Zirong, X. Effect of probiotics for common carp ( Cyprinus carpio ) based on growth performance and digestive enzyme activities. Anim. Feed Sci. Technol. 299 127 (3–4), 283–292 (2006). Shams, S. M., Dastar, B., Zerehdaran, S., Khomeiri, M. & Moradi, A. Effects of using plant extracts and a probiotic on performance, intestinal morphology, and microflora population in broilers. J. Appl. Poult. Res. 21 (2), 201–208 (2012). Abou-El-Atta, M. E., Abdel-Tawwab, M., Abdel-Razek, N. & Abdelhakim, T. M. Effects of dietary probiotic Lactobacillus plantarum and whey protein concentrate on the productive parameters, immunity response and susceptibility of Nile tilapia, Oreochromis niloticus (L.), to Aeromonas sobria infection. Aquac Nutr. 25 , 1367–1377. doi.org/10.1111/anu.12957 (2019). Martínez Cruz, P., Ib´a˜nez, A. L. & Monroy Hermosillo, O. A. H. C. Ramírez Saad, Use of probiotics in aquaculture. ISRN Microbiol. 1–13. (2012). Hassaan, M. S., Soltan, M. A., Jarmołowicz, S. & Abdo, H. S. Combined effects of dietary malic acid and Bacillus subtilis on growth, gut microbiota and blood parameters of Nile tilapia ( Oreochromis niloticus ). Aquac Nutr. 24 (1), 83–93 (2018). Dawood, M. A. et al. Physiological response, blood chemistry profile and mucus secretion of red sea bream ( Pagrus major ) fed diets supplemented with Lactobacillus rhamnosus under low salinity stress. Fish. Physiol. Biochem. 43 , 179–192 (2017). Abdo, H. S., Mohammady, E. Y., Tonsy, H. D., Ibrahim, A. & Hassaan, M. S. The potential synergistic action of quercetin and/or Pediococcus acidilactici on Nile tilapia, Oreochromis niloticus performance. Aquac . 581 , 740353 (2024). Jin, M. et al. Dietary yeast hydrolysate and brewer's yeast supplementation could enhance growth performance, innate immunity capacity and ammonia nitrogen stress resistance ability of Pacific white shrimp ( Litopenaeus vannamei ). fish shellfish immunol. 82, 121–129. (2018). Heshmatfar, F. et al. The effects of combined or singular administration of formic acid and Pediococcus acidilactici on stress resistance, growth performance, immune responses and related genes expression in common carp, Cyprinus carpio . Aquac Rep. 29 , 101474 (2023). Navarro-Torre, S., Carro, L., Igual, J. M. & Montero-Calasanz, M. D. C. Rossellomorea arthrocnemi sp. nov., a novel plant growth-promoting bacterium used in heavy metal polluted soils as a phytoremediation tool. Int. J. Syst. Evol. Microbiol. 71 (10), 005015 (2021). Gupta, R. S., Patel, S., Saini, N. & Chen, S. Robust demarcation of 17 distinct Bacillus species clades, proposed as novel Bacillaceae genera, by phylogenomics and comparative genomic analyses: description of Robertmurraya kyonggiensis sp. nov. and proposal for an emended genus Bacillus limiting it only to the members of the Subtilis and Cereus clades of species. Int. Int. J. Syst. Evol. Microbiol. 70 (11), 5753–5798 (2020). Navarro-Torre, S., Mateos-Naranjo, E., Caviedes, M. A., Pajuelo, E. & Rodríguez-Llorente, I. D. Isolation of plant-growth-promoting and metal-resistant cultivable bacteria from Arthrocnemum macrostachyum in the Odiel marshes with potential use in phytoremediation. Mar. Pollut Bull. 110 (1), 133–142 (2016). Navarro-Torre, S. et al. Mateos-Naranjo, Bioaugmentation with bacteria selected from the microbiome enhances Arthrocnemum macrostachyum metal accumulation and tolerance. Mar. Pollut Bull. 117 (1–2), 340–347 (2017). Navarro-Torre, S. et al. Sustainable agricultural management of saline soils in arid and semi-arid Mediterranean regions through halophytes, microbial and soil-based technologies. Environ. Exp. Bot. 105397. (2023). Mayilraj, S., Suresh, K., Schumann, P., Kroppenstedt, R. M. & Saini, H. S. Agrococcus lahaulensis sp. nov., isolated from a cold desert of the Indian Himalayas. International journal of systematic and evolutionary microbiology, 56 (8), 1807–1810. (2006). Gatinho, P. et al. From Cultural and Natural Heritage to Biomedicine: Prospection of Bioactive Compounds Produced by Bacterial Isolates from Caves. Int. Biodeterior. Biodegrad . 190 , 105773 (2024). Tavarideh, F., Pourahmad, F. & Nemati, M. Diversity and antibacterial activity of endophytic bacteria associated with medicinal plant, Scrophularia striata . Vet. Res. Forum . 13 , 409–415 (2022). Selim, K. M., El-Sayed, M. H., El-Hady, M. A. & Reda, R. R. In-vitro evaluation of the probiotic candidtes isolated from the gut of Clarias Gariepinus with special reference to the in vivo assessment of live and heat-inactivated Leuconostoc mesenteroides and Edwardsiella sp. Aquac Int. 27 , 33–51 (2019). Salam, A. M. et al. Gut probiotic bacteria of Barbonymus gonionotus improve growth, hematological parameters and reproductive performances of the host. Sci. Rep. 11 , 10692 (2021). Aly, S. M., Ahmed, Y. A. G., Ghareeb, A. A. A. & Mohamed, M. F. Studies on Bacillus subtilis and Lactobacillus acidophilus , as potential probiotics, on the immune response and resistance of Tilapia nilotica ( Oreochromis niloticus ) to challenge infections. Fish Shellfish Immunol. 25 (1–2), 128–136 (2008). Silva, T. A. et al. Effects of the probiotic Bacillus amyloliquefaciens on growth performance, hematology and intestinal morphometry in cagereared Nile tilapia. Lat Am. J. Aquat. Res. 43 (5), 963–971 (2015). Schaperclaus, W., Kulow, H. & Schreckenbach, K. Hematological and serological technique. Fish. dis. 1 (56), 71–108 (1991). Parry, R. M., Chandan, R. C. & Shahani, K. M. A rapid and sensitive assay of muramidase, Proc. Soc. Exp. Biol. Med. 119 384–386. (1965). Green, L. C. et al. Analysis of nitrate, nitrite, and [15N] nitrate in biological fluids. Anal. Biochem. 126 (1), 131–138 (1982). Kumari, J. & Sahoo, P. K. Dietary β-1, 3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L). J. Fish. Dis. 29 , 95–101 (2006). Fatima, R. et al. Enhancement of immune response and resistance to Vibrio parahaemolyticus in Tilapia fish ( Oreochromis mossambicus ) by dietary supplementation of Portieria hornemannii . Aquac . 547 , 737448 (2022). Dawood, M. A., Magouz, F. I., Salem, M. F. & Abdel-Daim, H. A. Modulation of digestive enzyme activity, blood health, oxidative responses and growth-related gene expression in GIFT by heat-killed Lactobacillus plantarum (L-137). Aquac . 505 , 127–136 (2019). Hassaan, M. S. et al. Partial dietary fish meal replacement with cotton seed meal and supplementation with exogenous protease alters growth, feed performance, hematological indices and associated gene expression markers (GH, IGF-I) for Nile tilapia, Oreochromis niloticus . Aquac . 503 , 282–292 (2019). Hassaan, M. S., Mohammady, E. Y., Soaudy, M. R. & Abdel Rahman, A. A. Exogenous xylanase improves growth, protein digestibility and digestive enzymes activities in Nile tilapia, Oreochromis niloticus , fed different ratios of fish meal to sunflower meal. Aquac Nutr. 25 (4), 841–853 (2019). Jia, R. et al. Effects of dietary baicalin supplementation on growth performance, antioxidative status and protection against oxidative stress-induced liver injury in GIFT tilapia ( Oreochromis niloticus ), Comp. Biochem. Physiol. C Toxicol. Pharmacol. 240 , 108914 (2021). Dawood, M. A., Abo-Al-Ela, H. G. & Hasan, M. T. Modulation of transcriptomic profile in aquatic animals: Probiotics, prebiotics and synbiotics scenarios. Fish. Shellfish Immunol. 97 , 268–282 (2020). Shen, C. et al. Fecal short chain fatty acids modify therapeutic effects of sleeve gastrectomy. Front. Endocrinol. 14 , 1277035 (2023). Abirami, G. et al. Pyrogallol downregulates the expression of virulence-associated proteins in Acinetobacter baumannii and showing anti-infection activity by improving non-specific immune response in zebrafish model. Int. J. Biol. Macromol. 226 , 853–869 (2023). Ferraboschi, P., Ciceri, S. & Grisenti, P. Applications of lysozyme, an innate immune defense factor, as an alternative antibiotic. Antibiotics . 10 (12), 1534 (2021). Lim, K. C., Yusoff, F. M., Shariff, M. & Kamarudin, M. S. Dietary astaxanthin augments disease resistance of Asian seabass, Lates calcarifer (Bloch, 1790), against Vibrio alginolyticus infection. Fish. Shellfish Immunol. 114 , 90–101 (2021). Lee, P. T., Tran, H. T. Q., Huang, H. T., Nan, F. H. & Lee, M. C. Sargassum horneri extracts stimulate innate immunity, enhance growth performance, and upregulate immune genes in the white shrimp Litopenaeus vannamei . Fish. shellfish immunol. 102 , 276–285 (2020). Panase, A., Thirabunyanon, M., Promya, J. & Chitmanat, C. Influences of Bacillus subtilis and fructooligosaccharide on growth performances, immune responses, and disease resistance of Nile tilapia, Oreochromis niloticus . Front. Veterinary Sci. 9 , 1094681 (2023). Khan, M. I. R. Biotechnological Interventions in Coldwater Aquaculture Health Management. In Coldwater Fisheries and Aquaculture Management. 147–177. Apple Academic. eBook: ISBN9781003369905. (2024). Cave, N., Delaney, S. J. & Larsen, J. A. Nutritional management of gastrointestinal diseases. Appl. veterinary Clin. Nutr. , 235–298. (2023). Harrison, J. et al. The increased prevalence of Vibrio species and the first reporting of Vibrio jasicida and Vibrio rotiferianus at UK shellfish sites. Water Res. 211 , 117942 (2022). Abu Nor, N. et al. Efficacy of whole cell inactivated Vibrio harveyi vaccine against vibriosis in a marine red hybrid tilapia ( Oreochromis niloticus × O. mossambicus ) model. Vaccines . 8 (4), 734 (2020). Addo, S. et al. Effects of Bacillus subtilis strains on growth, immune parameters, and Streptococcus iniae susceptibility in Nile tilapia, Oreochromis niloticus . J. World Aquaculture Soc. 48 (2), 257–267 (2017). Abarike, E. D. et al. Effects of a commercial probiotic BS containing Bacillus subtilis and Bacillus licheniformis on growth, immune response and disease resistance in Nile tilapia, Oreochromis niloticus . Fish. shellfish Immunol. 82 , 229–238 (2018). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 01 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 06 Nov, 2024 Reviews received at journal 04 Nov, 2024 Reviews received at journal 29 Oct, 2024 Reviewers agreed at journal 21 Oct, 2024 Reviewers agreed at journal 21 Oct, 2024 Reviewers invited by journal 21 Oct, 2024 Editor assigned by journal 21 Oct, 2024 Editor invited by journal 20 Oct, 2024 Submission checks completed at journal 18 Oct, 2024 First submitted to journal 04 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5202048","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":367632947,"identity":"6ad830fb-e8e3-4778-ba3b-f92d71dcdc9f","order_by":0,"name":"Bhavani Paramashivan","email":"","orcid":"","institution":"Manonmaniam Sundaranar University","correspondingAuthor":false,"prefix":"","firstName":"Bhavani","middleName":"","lastName":"Paramashivan","suffix":""},{"id":367632951,"identity":"823ae092-c03d-4c21-a46f-3df93d2115ea","order_by":1,"name":"Rajkumar Thamarai","email":"","orcid":"","institution":"Manonmaniam Sundaranar University","correspondingAuthor":false,"prefix":"","firstName":"Rajkumar","middleName":"","lastName":"Thamarai","suffix":""},{"id":367632952,"identity":"02d12d67-bfda-4906-bde4-609c24d47e74","order_by":2,"name":"Rajkumar Prabhakaran","email":"","orcid":"","institution":"Santosh Deemed to be University","correspondingAuthor":false,"prefix":"","firstName":"Rajkumar","middleName":"","lastName":"Prabhakaran","suffix":""},{"id":367632953,"identity":"6cdef4ed-9352-44fc-8a23-f1583b97aa9b","order_by":3,"name":"Kalidass Subramaniam","email":"","orcid":"","institution":"Manonmaniam Sundaranar University","correspondingAuthor":false,"prefix":"","firstName":"Kalidass","middleName":"","lastName":"Subramaniam","suffix":""},{"id":367632954,"identity":"d354dc21-e6dc-4de0-8038-e6d46438d969","order_by":4,"name":"Khalid A. Al-Ghanim","email":"","orcid":"","institution":"King Saud University","correspondingAuthor":false,"prefix":"","firstName":"Khalid","middleName":"A.","lastName":"Al-Ghanim","suffix":""},{"id":367632955,"identity":"2c600d8d-e483-4baa-89bb-6fa787fd4b92","order_by":5,"name":"Chinnaperumal Kamaraj","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYBACCQjFxsAPohIYoGQCMVokG8CKDYjWwsBgcABCMeBXDwSS7acTP1fU8Mkbnz/7dMODP38Y+NlzDBge7sCtRZond7PkmWNshttupJvdSGwzYJDseWPAkHgGtxY5htwNkg1sbAlmN9jYbiQ2GDAY3ADaktiGRwv/280/G/6xJRj3H2O7kfDHgMGekBZpidxtko1tbAkGDGlALWxAWyQIaJGc8XabZWMfm+GMG0AtiW3GPBJnnhUcwKdF4nzu5psN347J8wMddvPHHzk5/vbkjQ9/4tECBcfgLB4QcYCgBgaGGiLUjIJRMApGwYgFACpUUI6H5/KfAAAAAElFTkSuQmCC","orcid":"","institution":"Interdisciplinary Institute of Indian System of Medicine, SRM Institute of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Chinnaperumal","middleName":"","lastName":"Kamaraj","suffix":""}],"badges":[],"createdAt":"2024-10-04 07:08:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5202048/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5202048/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-03715-z","type":"published","date":"2025-07-01T15:57:49+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":67140256,"identity":"b9731ac4-a34b-42d9-884b-ab475256b2c7","added_by":"auto","created_at":"2024-10-21 14:28:25","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":291303,"visible":true,"origin":"","legend":"\u003cp\u003eShows the alterations in hematological parameters among Nile tilapia juveniles following a 60-day dietary supplementation with PFF. The means and standard errors are depicted for each of the three replications, with (*, **) asterisk denoting significant differences (\u003cem\u003eP \u0026lt; 0.05\u003c/em\u003e) between the treatments.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5202048/v1/bf474d95526861ac6703f3a9.jpeg"},{"id":67140258,"identity":"c956c3c8-3af1-4592-9ab8-080104a88dcb","added_by":"auto","created_at":"2024-10-21 14:28:25","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":319446,"visible":true,"origin":"","legend":"\u003cp\u003eDepict alterations in hematological biochemical indices among Nile tilapia juveniles following a 60-day dietary supplementation with PFF. (\u003cstrong\u003eA\u003c/strong\u003e) LDL, HDL, globulin, total protein and albumin. (\u003cstrong\u003eB\u003c/strong\u003e) Glucose, ALT, AST, cholesterol and triglyceride. For each of the three replications, the means and standard errors are provided, with (*, **) asterisk indicating significant differences (\u003cem\u003eP \u0026lt; 0.05\u003c/em\u003e) between the treatments.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5202048/v1/918c74d37b8aeeaab345f978.jpeg"},{"id":67140261,"identity":"d58de818-5be5-4fd5-b2d1-02da525fc25a","added_by":"auto","created_at":"2024-10-21 14:28:25","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":451481,"visible":true,"origin":"","legend":"\u003cp\u003eIllustrates the changes in important immunological indices among Nile tilapia juveniles following a 60-day dietary supplementation with PFF. The indices include lysozyme activity (\u003cstrong\u003eA\u003c/strong\u003e), reactive oxygen (\u003cstrong\u003eB\u003c/strong\u003e), reactive nitrogen (\u003cstrong\u003eC\u003c/strong\u003e), and myeloperoxidase (\u003cstrong\u003eD\u003c/strong\u003e). For each of the three replications, the means and standard errors are presented, with (*, **) asteriskindicating significant differences (\u003cem\u003eP \u0026lt; 0.05\u003c/em\u003e) between the treatments.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5202048/v1/28f5557966e57384b5ec568d.jpeg"},{"id":67140257,"identity":"2c5c8567-b635-47c2-a390-3a6b4317af21","added_by":"auto","created_at":"2024-10-21 14:28:25","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":743158,"visible":true,"origin":"","legend":"\u003cp\u003eThe changes in significant immune-related genes in Nile tilapia juveniles following a 60-day dietary supplementation with PFF. The genes examined include HSP70 (\u003cstrong\u003ea\u003c/strong\u003e), IL-1β (\u003cstrong\u003eb\u003c/strong\u003e), IC3 (\u003cstrong\u003ec\u003c/strong\u003e), IFN-α (\u003cstrong\u003ed\u003c/strong\u003e), IFN-γ (\u003cstrong\u003ee\u003c/strong\u003e), GF1 (\u003cstrong\u003ef\u003c/strong\u003e), GH (\u003cstrong\u003eg\u003c/strong\u003e), Lyz (\u003cstrong\u003eh\u003c/strong\u003e), and IL-1 (\u003cstrong\u003ei\u003c/strong\u003e). Means and standard errors are provided for each of the three replications, with (*, **) asteriskrepresenting significant differences (\u003cem\u003eP \u0026lt; 0.05\u003c/em\u003e) between the treatments.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5202048/v1/b57b1e4dc3c4d87e66062d0e.jpeg"},{"id":67140600,"identity":"a1f18f36-ce64-4d30-b3be-46fb3de47de5","added_by":"auto","created_at":"2024-10-21 14:36:25","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":348697,"visible":true,"origin":"","legend":"\u003cp\u003eDepicts the post-challenge cumulative mortality (\u003cstrong\u003ea\u003c/strong\u003e) and post-challenge survival rate (\u003cstrong\u003eb\u003c/strong\u003e) of Nile tilapia juveniles fed with PFF after 24 days from \u003cem\u003eV. harveyi and V. parahaemolyticus\u003c/em\u003echallenge. Means and standard errors are provided for each of the three replications, with (*, **) asterisk representing significant differences (\u003cem\u003eP \u0026lt; 0.0001\u003c/em\u003e) between the treatments.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5202048/v1/99587d74707ce2bde141b84c.jpeg"},{"id":67141874,"identity":"d61f46dd-7457-4cf7-b9e7-f72d75c5df35","added_by":"auto","created_at":"2024-10-21 14:44:25","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":734595,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representations of Probiotic Functional Feed (PFF) on Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) exposed to challenges from \u003cem\u003eVibrio harveyi\u003c/em\u003e and \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5202048/v1/b1e328de9046f0d252453c29.jpeg"},{"id":86179101,"identity":"81f1c1e5-aa20-413c-97b2-6c7a50c9bfb9","added_by":"auto","created_at":"2025-07-07 16:15:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4275115,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5202048/v1/9aa41aa7-9410-45db-b32e-87c678034a79.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Synergistic effects of Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. RKDAS1 as a probiotic functional feed (PFF) in Nile tilapia: Insights into growth, hemato-biochemical, and immune responses in the face of Vibrio challenges","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe fish farming sector is experiencing steady growth in response to the world's increasing population. The adoption of intensive aquaculture strategies aims to meet the rising demand, with the Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e), currently ranking as the third-highest-farmed fish globally in terms of volume (4.5 Mmt) due to continuous advancements in farming practices [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Despite the success of tilapia farming, challenges have emerged, particularly the excessive feed requirements [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Consequently, there is a growing focus on researching feed formulations and feeding methods to enhance fish gastrointestinal and health while continuing a balanced inhabitation of stomach bacteria. These approaches aim to boosting productivity in the sector of fish farming.\u003c/p\u003e \u003cp\u003eAs aquaculture intensifies, the facility's capacity to address various illnesses and health issues becomes crucial. Ongoing investigations into fish immune responses and physical development seek to develop sustainable and environmentally friendly methods to ensure the well-being of the fish [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Notably, research on immune-stimulating probiotics for fish healthcare shows promising potential in boosting immunity and treating diseases. These immunopotentiators can enhance fish growth, immunological response, intestinal health, and fillet quality [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Probiotics, active microbes, can thrive and proliferate in the animal's stomach, contributing to its overall well-being [\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. They promote fish development by improving gastrointestinal architecture and microbial diversity, influencing the gastrointestinal ecology through the secretion of extracellular digestive enzymes like protease and amylase and the production of compounds such as short-chain fatty acids [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eResearchers have proven the efficacy of functional dietary additives, highlighting the detrimental effects of excessive excreta levels on fish and shrimp. Evidence suggests that nutritive yeast hydrolysate and baker's yeast supplements can improve the hostility of \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e to nitrogen toxicity [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In laboratory-cultured common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e) juveniles, a probiotic functional feed containing \u003cem\u003ePediococcus acidilactici\u003c/em\u003e and formic acid influenced growth, blood biochemical parameters, immune gene upregulation, and survival [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e, an aerobic Gram-positive organism, exhibits non-mobile filaments, non-swollen spores, and terminally oval endospores [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. When cultured on TSA (tryptic soy agar, M1968-Himedia, Mumbai, India) plates complemented with 2.5% NaCl (w/v) at pH 7.0 and 37\u0026deg;C for 24 hours, this strain demonstrated robust growth conditions, thriving between pH 6.0 and 9.0, at temperatures ranging from 15 to 45\u0026deg;C, and tolerating NaCl concentrations from 0 to 25% (w/v) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe genus \u003cem\u003eRossellomorea\u003c/em\u003e, proposed by [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], is closely related to the Lactobacillaceae genus of lactic acid-producing bacteria and belongs to the \u003cem\u003eBacillaceae\u003c/em\u003e family within the phylum Firmicutes. Notably, \u003cem\u003eRossellomorea\u003c/em\u003e was part of a bacterial consortium that enhanced the potential of the halophyte \u003cem\u003eArthrocaulon macrostachyum\u003c/em\u003e for phytoremediation applications by improving seed development, growth, and heavy metal preservation in the root system, particularly in heavy metal-polluted soils [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. \u003cem\u003eAgrococcus lahaulensis\u003c/em\u003e, an aerobic, non-acid-fast, Gram-positive bacterium, forms distinctly margined, opaque, round, lemon-colored colonies on TSA media. The colonies range in size from 0.7 to 3.0 mm, exhibit resilience to up to 7.0% NaCl, and thrive optimally at temperatures ranging from 25 to 37\u0026deg;C. Growth occurs within the pH range of 6.0 to 10.0, with the ideal pH being 8.0 [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. \u003cem\u003eAgrococcus\u003c/em\u003e sp. SD01-s17, a bioactive variant of \u003cem\u003eAgrococcus\u003c/em\u003e, possesses diverse pharmacological and biocidal activities. It functions as an antioxidant, demonstrates anticancer, antibiotic, and antifungal properties, and has the potential to inhibit the growth of harmful bacteria, as reported by [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The antibacterial properties of \u003cem\u003eAgrococcus lahaulensis\u003c/em\u003e against \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eB. cereus\u003c/em\u003e [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Notably, the combination of \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e sp. and \u003cem\u003eAgrococcus lahaulensis\u003c/em\u003e sp. has not been previously reported for improving fish health. This groundbreaking discovery indicates that the production of sufficient quantities of antagonistic bioactive properties against pathogenic bacteria and their infections can enhance the aquatic environment, promoting fish health by boosting immunity.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of Nutrient-Enriched Probiotic Feed\u003c/h2\u003e \u003cp\u003eThe probiotic functional diet, designed to provide essential nutrients for juvenile tilapia, utilized feed materials sourced from CP Aquaculture (India) Pvt Ltd at 104, GNT Road, Nallur, Red Hills, Chennai, Tamil Nadu, India. The materials underwent crushing and sieving before meticulous blending. Dried ingredients were thoroughly mixed before the addition of liquid components. Employing a feed processing machine, the feed was produced, cut into appropriate sizes, and subjected to a two-hour oven-drying at 60\u0026deg;C. After cooling, the feed was sealed in plastic bags for storage until required (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePFF nutritional preparation and organic composition (g/kg).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIngredients\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCPF1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePFF2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePFF3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePFF4\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e448\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e448\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e448\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e448\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYellow corn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e170\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e170\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e170\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e170\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn gluten\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRice bran\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWheat bran\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoya oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin \u0026amp; Mineral mix\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eChemical analysis (g/kg)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDry matter\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e895.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e895.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e895.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e895.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude Protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e293.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e293.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e293.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e293.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude Lipid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e60.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e60.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFiber\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e257\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e257\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e257\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e257\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAsh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e50.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e50.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e200g of \u003cem\u003eRossellomorea marisflavi sp\u003c/em\u003e. (DAS-SCF02)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u0026times;10\u003csup\u003e4\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e200g of \u003cem\u003eAgrococcus\u003c/em\u003e sp. (RKDAS1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u0026times;10\u003csup\u003e6\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e200\u0026thinsp;+\u0026thinsp;200g of Dual strain mix (\u003cem\u003eRossellomorea marisflavi\u003c/em\u003e sp. (DAS-SCF02)\u0026thinsp;+\u0026thinsp;\u003cem\u003eAgrococcus\u003c/em\u003e sp. (RKDAS1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u0026times;10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eProbiotics culture preparation\u003c/h3\u003e\n\u003cp\u003eThe probiotics were derived from two novel strains of bacteria: \u003cem\u003eAgrococcus\u003c/em\u003e spp. RKDAS1 and \u003cem\u003eRossellomorea marisflavi spp\u003c/em\u003e. DAS-SCF02, which were isolated from Indian Snakehead fish (\u003cem\u003eChanna straiata\u003c/em\u003e) in freshwater lakes and the Tamiraparani River at Tirunelveli, and sludge from the Muttukadu boat house in Kanchipuram, Tamil Nadu. Isolates of \u003cem\u003eAgrococcus\u003c/em\u003e spp. RKDAS1 and \u003cem\u003eRossellomorea marisflavi spp\u003c/em\u003e. DAS-SCF02 were cultivated for a full day in NB (nutrient broth) to produce the probiotic cultures. The probiotic cells were centrifuged, cleaned, and suspended in 0.85% saline solution. Using a spectrophotometer, their concentrations were then adjusted to an absorbance OD of 600. Then, the washed probiotic strain suspensions were added to the basal feeds in a ratio of 20: 100 (w/w) between probiotic strain suspensions and basal supplementations for sustaining probiotics viability [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eExperimental Grouping and Preparation of Probiotic-Enriched Feeds\u003c/h3\u003e\n\u003cp\u003eThe study involved the production of four distinct feed types: Probiotic feeds PFF2, PFF3, and PFF4 incorporated probiotic isolates, namely \u003cem\u003eAgrococcus\u003c/em\u003e spp. RKDAS1 and \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02, along with dual probiotic strains mix containing \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02 and \u003cem\u003eAgrococcus\u003c/em\u003e spp. RKDAS1, respectively. The control feed (CF1) served as the baseline without probiotic additives. Each experimental group consisted of three replicates, with each tank accommodating ten tilapia fish. The base feed underwent autoclaving, and subsequent blending with the prepared probiotic culture was followed by serial dilution with a 0.85% sterile saline solution to quantify the probiotic concentration in the feed. To enumerate viable probiotics, 100 \u0026micro;L samples from specified dilutions were cultured on nutrient agar plates and incubated for 24 hours. After preparation, all feeds were stored under refrigeration to maintain the probiotic dosage integrity [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eExperimental design\u003c/h3\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eFish collection\u003c/h2\u003e \u003cp\u003eJuvenile \u003cem\u003eOreochromis niloticus\u003c/em\u003e was obtained from the Freshwater Aquaculture Sector of the University of Fisheries, weighing 2.56\u0026thinsp;\u0026plusmn;\u0026thinsp;1.26 g. Before the experiment, the general health of each animal was evaluated based on its swimming ability in the tank, regular feeding patterns, the absence of blemishes, the presence of undamaged and vibrant scales, the absence of protruding eyes, and the integrity of fins without tears or ragged edges\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eFeeding Practices and Maintenance Protocols in a Juvenile Fish Study\u003c/h2\u003e \u003cp\u003eAs part of Probiotic functional feed (PFF) trial, the fish were hand-fed a basal diet twice a day after being placed into ten twenty/100-L plastic tanks. They underwent a seven-day acclimatization phase to adapt to the experimental environment. The experiment divided into four groups, CPF-1 (control group, diet included solely of basal fish feed), the 20% of PFF2 (\u003cem\u003eRossellomorea marisflavi\u003c/em\u003e sp. (DAS-SCF02\u0026ndash;1\u0026times;10\u003csup\u003e4\u003c/sup\u003e), PFF3 (\u003cem\u003eAgrococcus\u003c/em\u003e sp. (RKDAS1-1\u0026times;10\u003csup\u003e6\u003c/sup\u003e), and PFF4- (DAS-SCF02\u0026ndash;1\u0026times;10\u003csup\u003e4\u003c/sup\u003e + RKDAS1 (1\u0026times;10\u003csup\u003e7\u003c/sup\u003e) respectively, were equally distributed among each treatment group. Each tank housed twenty juvenile fish in static water, with a routine refresh of approximately half the water volume through a flow-through aquarium system and clearing of accumulated excrement was conducted. The probiotics functional feeds (PFF2, PFF3, and PFF4) were administered for eight weeks, providing the animals with 3% of their daily feed allocation in three meals at 9:00, 15:00, and 21:00 [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eComprehensive Assessment of Hematological, Biochemical, and Environmental Parameters in Tilapia during Long-Term PFF Supplementation\u003c/h3\u003e\n\u003cp\u003eAt 20-days intervals, various hematological and biochemical indices were assayed, including total albumin, globulin, hemoglobin (Hb), albumin\u0026ndash;globulin ratio, total serum protein, total leukocyte count (TLC), total erythrocyte count (TEC), acetylcholine esterase (AChE), alanine aminotransferase (ALT), lactate dehydrogenase (LDH), aspartate aminotransferase (AST), and total adenosine triphosphatase (ATPase). The water quality was maintained within acceptable limits, and environmental indices such as dissolved oxygen (O\u003csub\u003e2\u003c/sub\u003e), pH, ammonia, and nitrite were assessed using readily available kits (Water Quality Test Kit - HI3817) during the investigation. The water temperature was maintained between 28 and 29\u0026deg;C.\u003c/p\u003e\n\u003ch3\u003eHemato-biochemical indices assessment\u003c/h3\u003e\n\u003cp\u003eIn order to collect plasma and perform enzyme assays, the fish were anesthetized with 100 mg/L of 3-aminobenzoic acid ethyl ester (MS-222, Sigma-Aldrich, St. Louis, MO, USA) on days 20, 40, and 60 of the experiment. The first portion of the blood sample was obtained using an anticoagulant 10% ethylene diamine tetra acetate (EDTA) to estimate the hematocrit (Htc) and white blood cells (WBCs). To harvest plasma samples, five fish from each treatment duplicate were euthanized. Tissue homogenization was carried out in a cold sucrose buffer (0.25 M) using a Teflon-coated mechanical tissue homogenizer (Remi, India), the samples were centrifugation for 10 minutes at 5000 g at 4\u0026deg;C followed by lysis. The enzyme activity was assessed using the supernatant obtained as the enzyme resource. All steps of the enzyme synthesis process were conducted in a refrigerated environment, with sample dilution performed where necessary.\u003c/p\u003e \u003cp\u003eFor blood extraction, a sterilized 2-milliliter BD syringe cleaned with EDTA buffer (2.7%) was utilized. Blood was drawn into small glass vials containing 20 \u0026micro;l of EDTA buffer (2.7%) as an anticoagulant.\u003c/p\u003e \u003cp\u003eThe TEC and TLC were determined according to the method outlined by [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. A hemocytometer (Feinoptik, Germany) was employed for cell counting, with results reported as follows:\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:RBC\\:Count=\\:\\frac{NrX\\text{10,000}}{{mm}^{3}}\\)\u003c/span\u003e\u003c/span\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:WBC\\:Count=\\:\\frac{500}{{mm}^{3}}\\)\u003c/span\u003e\u003c/span\u003e\u003c/h2\u003e \u003cp\u003eHere, Nr represents the total number of RBC measured in each square of the hemocytometer, and Nw indicates the total amount of WBC determined in each square. The factor acquired after accounting for the initial dilution factors is 10,000.\u003c/p\u003e \u003cp\u003eThe blood Hb content was determined using Darbkins fluid and the Cyanmethemoglobin technique with a commercial kit (Qualigens, Mumbai, India).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHematic indices\u003c/h2\u003e \u003cp\u003eThe blood collection procedure involved using a 2 mL BD sterilized syringe with 0.2 mL of anticoagulant, drawing blood from the caudal part of the fingerling fish, and transferring it to a fresh 1.5 mL Eppendorf centrifuge tube. The blood was permitted to clot for 45 minutes at room temperature with the tube tilted, followed by a 30-minute incubation at 4\u0026deg;C. Subsequently, the tube was centrifuged for 10 minutes at 3000g at 4\u0026deg;C. Blood plasma was then collected in sterile Eppendorf centrifuge tubes and analyzed using Qualigens diagnostic kits in a semi-automated analyzer (AR 601, Qualigens, Mumbai, India) for various serum indices. The examined serum indices included LDL, HDL, triglyceride, albumin (using the bromocresol green binding method) (ALB), cholesterol (CHO), and total serum protein (using the biuret method employing biuret reagent and buffered dye reagent). Globulin - albumin ratios were calculated by dividing albumin concentration by globulin content, and globulin content by albumin concentration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eImmunological evaluates\u003c/h2\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003eLysozyme activity\u003c/h2\u003e \u003cp\u003eLysozyme performance was evaluated with slight modifications following the procedure outlined by Parry et al., 1965 [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In brief, a 96-well microplate was filled in triplicate with 25 \u0026micro;L of plasma. Subsequently, each well received 0.2 mg mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e of \u003cem\u003eMicrococcus lysodeikticus\u003c/em\u003e solution in a buffered sodium phosphate solution (pH 6.2), totaling 175 \u0026micro;L. The reaction was monitored using a spectrophotometer set to measure reactions at 540 nm, with readings taken and recorded every minute for ten minutes. The blood activity of lysozyme was quantified as a 0.001 min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e reduction at 540 nm and reported in units of mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eIntracellular superoxide anion (SOA)\u003c/h2\u003e \u003cp\u003eThe assessment of intracellular superoxide anion (SOA) and respiratory burst activity involved conducting NBT (nitroblue tetrazolium) reduction reactions, adapted from the Secombes method (Secombes, 1990). In brief, microplates (96-well) were utilized to contain three batches of WBCs (6 \u0026times; 10^6 cells). To each well, 25\u0026micro;L of NBT was added, and the plates were protected at room temperature for two hours. After the incubation, 150\u0026micro;L of absolute methanol was introduced to each well, and the residual fluid was discarded. Subsequently, the wells underwent repeated cleaning with a 70% methanol solution. Finally, 100\u0026micro;L of DMSO and 150\u0026micro;L of 2M KOH were added to each well. Following thorough mixing, the absorbance value, indicative of the reaction, was measured at 540 nm using a UV-Vis spectrophotometer (201/220, Thermo Scientific).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eProduction of reactive nitrogen species (RNS) analysis\u003c/h2\u003e \u003cp\u003eThe Griess reagent technique, which is related to the change of nitrite from nitric oxide, was used to assess the nitric oxide (NO) in the plasma of tilapia [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Using a conventional curve representing the level of nitrate in the serum of tilapia, the amount of nitrite present was determined.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eMPO (myeloperoxidase)\u003c/h2\u003e \u003cp\u003eThe MPO activity in plasma was assessed using [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. An absorption change was considered to be one unit, and the activity was represented as U mg plasma\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eImmune-related gene expression\u003c/h2\u003e \u003cdiv id=\"Sec19\" class=\"Section3\"\u003e \u003ch2\u003eIsolation of RNA and cDNA Construction\u003c/h2\u003e \u003cp\u003eFor total RNA isolations, liver samples were dissected from three animals per treatment group. A concentration of 20 ng \u0026micro;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was targeted for liver RNA. Total RNA was isolated using a commercial Kit (RNA mini kit, Cat No. 74,104, Qiagen, Germany) according to the manufacturer's guidelines. The purity of the RNA was assessed through gel electrophoresis (1.2% agarose gel) and NanoDrop spectrophotometry (NanoDrop 2000, Thermo Scientific). Subsequently, cDNA synthesis was performed using a cDNA RT Kit (Applied Biosystems, Cat# no. 4368813, USA), adhering to the manufacturer's instructions.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative (qPCR) RT-PCR examination\u003c/h2\u003e \u003cp\u003eQuantitative RT-PCR analysis was conducted using the Applied Biosystems 96 Real-time qPCR System, USA, to assess the expression of genes, including \u003cem\u003eβ-actin\u003c/em\u003e household genes, \u003cem\u003ehsp70, IL-1β, IC3, TNF-α, IFN-γ, GF1, GH, IL-1, and Lyz.\u003c/em\u003e The DNA primer sequences used for amplification are presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The SYBR green technique with the SensiFast SYBR Lo-Rox kit (Bioline) was employed for RT-PCR. Amplification conditions consisted of 45 cycles: 10 seconds at 95\u0026deg;C, 30 seconds at 63\u0026deg;C, and 30 seconds at 72\u0026deg;C. Subsequently, the 2\u003csup\u003e\u0026minus;∆∆CT\u003c/sup\u003e method was applied to determine the relative expression levels of the target genes.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers employed to quantify immune relative gene expression.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGB. Accession No.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAnnealing Temp. (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eEfficiency\u003c/p\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eA. size (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CAGCAAGCAGGAGTACGATGAG\u003c/p\u003e \u003cp\u003eR: TGTGTGGTGTGTGGTTGTTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_003455949.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.994\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e19.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e136\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInterleukin-1β (IL-1β)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CAAGGATGACGACAAGCCAACC\u003c/p\u003e \u003cp\u003eR: AGCGGACAGACATGAGAGTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_019365844.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.991\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e96.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e149\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInterleukin-IL1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CTGTGAAGGCATGGGTGTGGAG\u003c/p\u003e \u003cp\u003eR:TCGCAGTGGGAGTTGGGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001279704.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.979\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e96.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e111\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecomplement component (IC3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGTGTGGATGCACCTGAGAA\u003c/p\u003e \u003cp\u003eR: GGGAAATCGGTACTTGGCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_013274267.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.998\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e97.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e196\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHeat shock protein 70 (Hsp70)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CATCGCCTACGGTCTGGACAA\u003c/p\u003e \u003cp\u003eR: TGCCGTCTTCAATGGTCAGGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFJ207463.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.995\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e99.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e238\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTumor necrosis factor- α (TNF-α)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:AAGCCAAGGCAGCCATCCAT\u003c/p\u003e \u003cp\u003eR:TTGACCATTCCTCCACTCCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001279533.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.993\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e98.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e184\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInterferon (IFN-γ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGGGTGGTGTTTTGGAGTCG\u003c/p\u003e \u003cp\u003eR: TAGCGAGCCTGAGTTGTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001287402.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.998\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e99.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e138\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrowth factor (GF1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-AAGGGAAGCAGCAGCAGTTGTG\u003c/p\u003e \u003cp\u003eR-CGTCCATGCCGTTAGCCTTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001279708.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.989\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e98.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrowth hormone (GH)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:ACATCATCAGCCCGATCGAC\u003c/p\u003e \u003cp\u003eR:TCAGCAGCAAGATTCCCGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_003442542.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.994\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e98.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e183\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysozyme (Lyz)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-AGGGAAGCAGCAGCAGTTGTG\u003c/p\u003e \u003cp\u003eR-CGTCCATGCCGTTAGCCTTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_003460550.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.997\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e94.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e107\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003e\u003cem\u003eF: forward; R: Reverse; GB: Gene bank; Temp: Temperature\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eVibrio\u003c/b\u003e \u003cb\u003echallenge\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe Vibrio strains of \u003cem\u003eV. harveyi\u003c/em\u003e and \u003cem\u003eV. parahaemolyticus\u003c/em\u003e were isolated from the infected Tilapia fish at Ramayanpatti, in the Tamil Nadu district of Tirunelveli, India. The conventional morphological, biochemical, and pathogenicity assays identified the \u003cem\u003eVibrio\u003c/em\u003e bacterial isolates. The isolates were pre-enriched with an alkaline peptone solution (APS) before being diluted in conventional saline (0.85% NaCl w/v). Each isolate was surface dispersed on three agar media: TCBS (thiosulphate citrate bile salt sucrose agar), SWC (seawater complex agar), and \u003cem\u003eVibrio\u003c/em\u003e specific agar medium (VSAM). A dark room at 30\u0026deg;C was the perfect temperature for finding bio-luminous colonies on SWC agar. The \u003cem\u003eVibrio\u003c/em\u003e isolates were compared to strains of \u003cem\u003eV. harveyi\u003c/em\u003e (MTCC 3438) and \u003cem\u003eV. parahaemolyticus\u003c/em\u003e (MTCC 443) as positive and negative controls, respectively, and then further confirmed by PCR. The PCR confirmed \u003cem\u003eVibrio\u003c/em\u003e isolates were used in this study. To prepare separately fresh \u003cem\u003eV. harveyi\u003c/em\u003e and \u003cem\u003eV. parahaemolyticus\u003c/em\u003e, a single colony of \u003cem\u003eVibrio\u003c/em\u003e was inoculated into Nutrient Broth with 2% of NaCl and cultured for 24 h at 30\u0026deg;C. Cell harvesting was performed by centrifuge at 5,000 rpm and 4\u0026deg;C for 10 minutes, after that three washing and re-suspending of the cells in a 0.85% saline buffer. The suspension of \u003cem\u003eV. harveyi\u003c/em\u003e and \u003cem\u003eV. parahaemolyticus\u003c/em\u003e was modified to 10\u003cem\u003e6\u003c/em\u003e CFU/ml with 0.85% saline buffer before injection. After the feeding trial, ten fish from each group were randomly selected and intraperitoneally injected with 0.1 ml of \u003cem\u003eV. harveyi\u003c/em\u003e and \u003cem\u003eV. parahaemolyticus\u003c/em\u003e (10\u003csup\u003e6\u003c/sup\u003e CFU/ml) based on the procedure outlined by Fatima et al., 2022 [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analyses\u003c/h2\u003e \u003cp\u003eTo assess variances among treatments, we employed an ANOVA (one-way analysis of variance) along with the Duncan multiple range test. A significance level of 0.05 was set for the analyses. The standard deviation was calculated using a similar approach.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results and Discussion","content":"\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003eHematological indices\u003c/h2\u003e \u003cp\u003eThe Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e depicts each of the four treatment groups and their respective hematological indices findings. The evaluated hematological indices exhibited significantly increased levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the comparison of the fish treated with all three types of probiotics to those treated with an untreated diet. Fish raised in the \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02 and Agrococcus spp. RKDAS1 (PFF3) treatment demonstrated much greater levels (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) of Hb, WBC, RBC, Htc, and BP relation to the control group (CF). Likewise, after the trial, adding PFF4 to the feed led to a substantial increase (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) in the numbers of neutrophils, lymphocytes, and monocytes compared to the control group. The present study results are agreed well with the reports of [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eHematological Biochemical Indices\u003c/h2\u003e \u003cp\u003eIn tilapia supplemented with probiotics, specifically \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02 and \u003cem\u003eAgrococcus\u003c/em\u003e spp. DASRK1 (PFF3) and \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02 and \u003cem\u003eAgrococcus\u003c/em\u003e spp. DASRK1 (PFF4), serum levels of ALT, and AST were lower (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). However, the CF3 diet resulted in the least significant (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) values of AST and ALT. Fish-fed PFF2, PFF3, and PFF4 exhibited higher serum concentrations of total protein, albumin, and globulin compared to other diets (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). The CF4 diet, containing \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02 and \u003cem\u003eAgrococcus\u003c/em\u003e spp. DASRK1 showed the highest levels of total globulin, albumin, and protein.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFurthermore, tilapia fish treated with three types of probiotics functional feed (PFF) additive mixed probiotics had expressively (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) greater glucose, total cholesterol, and triglyceride levels than the control group. In comparison to fish fed the CP diet, all groups administered dietary PFF showed significantly lower plasma TG levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and all PFF-fed fish exhibited little variation in CHO or TG (\u003cem\u003eP\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/em\u003e). Additionally, with dietary supplementation of PFF, plasma LDL content was lowered, although no significant difference was observed (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The dual probiotics mix added to the feed dramatically raised albumin, globulin, and total protein levels in the serum, with PFF2 and PFF3 showing superiority over the CF1 control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). The present study results are well agreed with [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] studies. Furthermore, one plausible explanation for this lowering effect on plasma lipid profiles could be the fermentation of indigestible carbohydrates derived from intestinal food to produce short-chain fatty acids, inhibiting the synthesis of cholesterol in the liver and/or returning cholesterol to the liver [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eImmunological indices\u003c/h2\u003e \u003cdiv id=\"Sec26\" class=\"Section4\"\u003e \u003ch2\u003eLysozyme Activity\u003c/h2\u003e \u003cp\u003eLysozyme, a bactericidal peptide crucial for the fish's innate immune response, plays a significant role in inhibiting biofilm formation by promoting phagocytes and the complement system [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. It also prevents microbial adhesion and colonization [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In this study, during the 20th, 40th, and 60th days of dietary probiotic feeding, tilapia serum exhibited a substantial enhance (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in lysozyme related to the untreated experiment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). The PFF4 group, in particular, demonstrated a significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) boost in serum lysozyme activity after the 60th day of dietary probiotic feeding. Notably, plasma exhibited the highest lysozyme activity after the 60th day when compared to the 40th day.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eIntracellular superoxide anion (SOA)\u003c/h2\u003e \u003cp\u003eFollowing the 20th, 40th, and 60th day of dietary probiotic feeding, the SOA production in serum improved significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the dietary probiotic experiments in assessment with the untreated fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). In comparison with serum, SOA generation had been boosted in all dietary probiotic experimental feeds. In both the dietary probiotic experiments, the highest SOA generation occurred following the 60th day of feeding instead of the 20th day. The PFF4 group had the greatest enhancement, whereas the CP1 showed minimal enhancement. [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eProduction of Reactive Nitrogen Species (RNS) Analysis\u003c/h2\u003e \u003cp\u003eOn the 20th, 40th, and 60th days of the dietary probiotic feeding experiment, there was a significant improvement in RNS synthesis in the serum of tilapia (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e), as compared to the untreated fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Aligned with the formation of Reactive Oxygen Species (ROS), all dietary probiotic experiments exhibited stronger plasma RNS production on the 60th day than on the 40th day. The PFF4 feed demonstrated the highest activity of RNS generation, while the untreated fish showed a limited quantity. Similar results were observed by [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003eMPO (Myeloperoxidase)\u003c/h2\u003e \u003cp\u003eAfter the 20th, 40th, and 60th days of dietary probiotic experiment feeding, dramatic improvement in MPO activity in plasma was observed (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), contrasting with the untreated group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). The MPO activity in serum increased for dietary PFF2, PFF3, and PFF4. Across all PFF2, PFF3, and PFF4 groups, the peak MPO activity was observed after the 60th day of feeding compared to the 40th day. These findings align well with the study conducted by [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eImmune gene expression\u003c/h3\u003e\n\u003cp\u003eProbiotics have a well-established ability to non-specifically alter the immune system [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In the present study, supplementation with \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02, \u003cem\u003eAgrococcus\u003c/em\u003e spp. DASRK1, \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02, and Agrococcus spp. DASRK1 increased the expression of \u003cem\u003eHSP70, IL-1β, IC3, IFN-α, IFN-γ, GF1, GH, IL-1, and Lyz\u003c/em\u003e genes, with the highest expression observed in fish fed a PFF4 diet. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e \u003cb\u003e(a-i)\u003c/b\u003e presents the transcript of immune-related gene expression experiments conducted on tilapia liver. In the liver of tilapia fed CF4 and those fed \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02, \u003cem\u003eAgrococcus\u003c/em\u003e spp. DASRK1 additive diets (CF2, CF3, and CF4), H\u003cem\u003eSP70, IL-1β, IC3, IFN-α, IFN-γ, GF1, GH, IL-1, and Lyz\u003c/em\u003e genes were significantly up-regulated (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-i\u003cb\u003e)\u003c/b\u003e. Compared to CP1 tilapia fingerlings, those fed with PFF3 and PFF4 showed up-regulated expression of the immune gene SOD (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e). The levels of TNF-α gene expression in fish-fed probiotic feed and all \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02, \u003cem\u003eAgrococcus\u003c/em\u003e spp. DASRK1 treatment groups were considerably higher (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) when compared to the other treatment groups and control group (CF2 and G3). Additionally, fish-fed CF4 exhibited increased TFN-γ gene expression compared to the control group and all treatment groups (\u003cem\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/em\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eVibrio\u003c/b\u003e \u003cb\u003echallenge study\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTwenty-five days after PFF2, PFF3, and PFF4 were exposed by intraperitoneal administration of fingerling tilapia fish with respectively \u003cem\u003eV. harveyi\u003c/em\u003e and \u003cem\u003eV. parahaemolyticus\u003c/em\u003e, the \u003cem\u003eVibrio\u003c/em\u003e challenge test was carried out, as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea \u0026amp; \u003cb\u003eb\u003c/b\u003e. Seven days\u0026rsquo; post-challenge, the relative percentage survival (RPS) and cumulative mortality were recorded. Fish fed with dietary probiotics PFF2, PFF3, and PFF4 for 24 days exhibited a significantly reduced cumulative mortality rate compared to those fed with CF1. Cumulative mortality rates for fish fed CF1, PFF2, PFF3, and PFF4 were 92.44%, 13.65%, 11.18%, and 10.77%, respectively, at the end of the challenge test. A comparison of Tilapia fish that received functional probiotics versus those that did not show no significant difference in survival rates (\u003cem\u003eP\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/em\u003e). Fingerling fish with the infection displayed abnormal diving, darker pigmentation, and a lack of appetite. Moreover, it was observed that the hemorrhages on their bodies, both in flesh and livers, were more pronounced than those observed in typical fish. The results of the Vibrio challenge test indicate that the dietary probiotics PFF2, PFF3, and PFF4 can significantly reduce the cumulative mortality rate in fingerling tilapia fish infected with \u003cem\u003eV. harveyi\u003c/em\u003e and \u003cem\u003eV. parahaemolyticus\u003c/em\u003e. This was consistent with previous studies that have shown the beneficial effects of probiotics in enhancing shellfish health and disease resistance [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. According to a recent study by [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], intraperitoneal exposure to kill \u003cem\u003eV. harveyi\u003c/em\u003e enhanced the resistance and antibody response of marine red hybrid tilapia to \u003cem\u003eVibriosis\u003c/em\u003e. However, it is worth noting that there were no significant differences in survival rates between fish that received probiotics and those that did not, suggesting that other factors may also influence fish survival in the presence of these pathogens. Further research is needed to explore the potential mechanisms underlying the observed effects of probiotics on fish health and to optimize their application in aquaculture practices.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSurvival rate after\u003c/b\u003e \u003cb\u003eVibrio\u003c/b\u003e \u003cb\u003echallenge (SR)\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOn days five and six following the \u003cem\u003eV. harveyi\u003c/em\u003e and \u003cem\u003eV. parahaemolyticus\u003c/em\u003e challenge, the tilapia fish began to perish. The affected fish exhibited increased mucus discharges, scale detachment, and hemorrhages on numerous areas of their external body surface. Autopsy investigation revealed a pale, swollen liver with colorless nodules dispersed across its surface and a bloated gallbladder. The internal organs of the diseased fish were used to re-isolate \u003cem\u003eVibrio\u003c/em\u003e sp. In a dose-dependent manner, tilapia fish raised with any of the probiotic feed treatments-PFF2, PFF3, and PFF4-showed greater survival levels than those raised in the un-treatment fish group. Significant differences in survival rates were observed between the PFF administrated groups and the control after two weeks of the \u003cem\u003eVibrio sp\u003c/em\u003e. challenge [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Notably, a dual probiotic mixed feed (PFF4) led to an increased survival rate among tilapia fish exposed to \u003cem\u003eVibrio\u003c/em\u003e sp. compared to the control fish. Fish fed with PFF4 exhibited the highest survival rate (89.23%), followed by those fed with PFF3 (88.82%), PFF2 (86.35%), and CF1 (7.56%), as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb. Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e showed the schematic representations of Probiotic Functional Feed (PFF) on Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) exposed to challenges from \u003cem\u003eVibrio harveyi\u003c/em\u003e and \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, the supplementation of \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e spp. DAS-SCF02 and \u003cem\u003eAgrococcus\u003c/em\u003e spp. RKDAS1 probiotics significantly improved hematological, biochemical, and immunological parameters in tilapia. The observed increases in hematological indices, including Hb, WBC, RBC, Htc, and BP, suggest enhanced overall fish health. Biochemical analysis indicated improved liver function, as reflected by lower ALT and AST levels and increased total protein, globulin, and albumin concentrations. Furthermore, the immunological responses, as evidenced by increased lysozyme activity, superoxide anion production, reactive nitrogen species synthesis, and myeloperoxidase activity, point towards enhanced immune defenses in probiotic-fed fish. The gene expression analysis revealed the up-regulation of genes associated with stress response, cytokine signaling, and immune defense, indicating the activation of key pathways (\u003cem\u003ehsp70, IL-1β, I C3, IFN-α, IFN-γ, GF1, GH, IL-1, and Lyz)\u003c/em\u003e in response to probiotic supplementation. Importantly, the probiotic-fed fish exhibited improved survival rates in a \u003cem\u003eVibrio\u003c/em\u003e challenge study, demonstrating the practical relevance of these findings in disease resistance. Overall, this study provides valuable insights into the comprehensive benefits of probiotic supplementation in tilapia aquaculture, emphasizing its potential to enhance fish health, immunity, and resilience against bacterial challenges. These findings contribute to the growing body of knowledge supporting the sustainable and effective use of probiotics in aquaculture practices\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e \u003cp\u003e The experiment was conducted following the protocol involving animal use approved by the experiment was ethically reviewed and approved by the Department of Animal Science and Animal Ethical Committee, through the Animal and Welfare Ethical Review Body by the Manonmaniam Sundaranar University Animal Care and Use Committee MSU-ACUC (BP, PhD, Reg. No. 17214012272124). All fish handling procedures and regulations followed the ARRIVE guidelines for Animal Care and Use. Furthermore, all relevant organizational and government rules and regulations governing the ethical use of the experimental animals were followed. Written informed consent was obtained from the owners of all animals involved in the study.\u003c/p\u003e\u003ch2\u003eCompeting Interests\u003c/h2\u003e \u003cp\u003eNo competing interest\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eB.P.: Formal and experimental analysis, Documentation \u0026amp; Formal analysis, Writing\u0026ndash; original draft. R. T.: Investigation, Writing, review \u0026amp; editing \u0026ndash; original draft, Conceptualization, Investigation, Visualization, Project administration. R. P.: Data curation \u0026amp; Review, K. S.: Supervision, Project administration, editing \u0026amp; review. K. A. A.G. \u0026amp; C. K.: Formal analysis, writing, review, \u0026amp; editing. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors acknowledge the Manonmaniam Sundaranar University, Tirunelveli, Tamil Nadu, India for their constant support and the grant support from UGC DR. D. S. Kothari Postdoctoral Fellowship (Normal Fellowship): No. F. 4-2/2006 (BSR)/BL/19-20/0298 New Delhi. The authors express their sincere appreciation to the Researchers supporting Project Number (RSP2025R48), King Saud University, Riyadh, Saudi Arabia.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe results presented are adequate to support the conclusion of this study. However, the lead author (B. P.) can provide extra data upon request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFAO. The state of world fisheries and aquaculture. Food and Agriculture Organization of the United Nations, Rome, Italy. ISBN 978-92-5\u0026ndash;132692-3. (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAli, M. M. et al. Dietary alphamonolaurin for Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e): stimulatory effects on growth, immunohematological indices, and immune-related gene expressions, Aquac. Res. May 11. (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, M. Y. et al. Effects of dietary \u003cem\u003eAllium mongolicum\u003c/em\u003e Regel polysaccharide on growth, lipopolysaccharide-induced antioxidant responses and immune responses in \u003cem\u003eChanna argus\u003c/em\u003e. \u003cem\u003eMol. Biol. Rep.\u003c/em\u003e \u003cb\u003e46\u003c/b\u003e, 2221\u0026ndash;2230 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoltan, N. M., Soaudy, M. R., Abdella, M. M. \u0026amp; Hassaan, M. S. Partial dietary fishmeal replacement with mixture of plant protein sources supplemented with exogenous enzymes modify growth performance, digestibility, intestinal morphology, haemato-biochemical and immune responses for Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e. \u003cem\u003eAnim. Feed Sci. Technol.\u003c/em\u003e \u003cb\u003e299\u003c/b\u003e, 115642 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohammady, E. Y. et al. Response of Nile tilapia under biofloc system to floating or sinking feed and feeding rates: Water quality, plankton community, growth, intestinal enzymes, serum biochemical and antioxidant status. \u003cem\u003eAquac Rep.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 101489 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaleh, R. S., Mohammady, E. Y., El-Haroun, E. \u0026amp; Hassaan, M. S. Dietary dried periphyton can improve growth, digestive enzyme, serum biochemical, antioxidant response and intestinal morphometric of Nile tilapia. \u003cem\u003eAquac Res.\u003c/em\u003e \u003cb\u003e53\u003c/b\u003e (18), 6463\u0026ndash;6477 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKesarcodi-Watson, A., Kaspar, H., Lategan, M. J. \u0026amp; Gibson, L. Probiotics in aquaculture: the need, principles and mechanisms of action and screening processes. \u003cem\u003eAquac\u003c/em\u003e. \u003cb\u003e274\u003c/b\u003e (1), 14 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYanbo, W. \u0026amp; Zirong, X. Effect of probiotics for common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e) based on growth performance and digestive enzyme activities. \u003cem\u003eAnim. Feed Sci. Technol.\u003c/em\u003e \u003cb\u003e299 127\u003c/b\u003e (3\u0026ndash;4), 283\u0026ndash;292 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShams, S. M., Dastar, B., Zerehdaran, S., Khomeiri, M. \u0026amp; Moradi, A. Effects of using plant extracts and a probiotic on performance, intestinal morphology, and microflora population in broilers. \u003cem\u003eJ. Appl. Poult. Res.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e (2), 201\u0026ndash;208 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbou-El-Atta, M. E., Abdel-Tawwab, M., Abdel-Razek, N. \u0026amp; Abdelhakim, T. M. Effects of dietary probiotic \u003cem\u003eLactobacillus plantarum\u003c/em\u003e and whey protein concentrate on the productive parameters, immunity response and susceptibility of Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e (L.), to \u003cem\u003eAeromonas sobria\u003c/em\u003e infection. \u003cem\u003eAquac Nutr.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 1367\u0026ndash;1377. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1111/anu.12957\u003c/span\u003e\u003cspan address=\"10.1111/anu.12957\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMart\u0026iacute;nez Cruz, P., Ib\u0026acute;a˜nez, A. L. \u0026amp; Monroy Hermosillo, O. A. H. C. Ram\u0026iacute;rez Saad, Use of probiotics in aquaculture. \u003cem\u003eISRN Microbiol.\u003c/em\u003e 1\u0026ndash;13. (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHassaan, M. S., Soltan, M. A., Jarmołowicz, S. \u0026amp; Abdo, H. S. Combined effects of dietary malic acid and \u003cem\u003eBacillus subtilis\u003c/em\u003e on growth, gut microbiota and blood parameters of Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e). \u003cem\u003eAquac Nutr.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e (1), 83\u0026ndash;93 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDawood, M. A. et al. Physiological response, blood chemistry profile and mucus secretion of red sea bream (\u003cem\u003ePagrus major\u003c/em\u003e) fed diets supplemented with \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e under low salinity stress. \u003cem\u003eFish. Physiol. Biochem.\u003c/em\u003e \u003cb\u003e43\u003c/b\u003e, 179\u0026ndash;192 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdo, H. S., Mohammady, E. Y., Tonsy, H. D., Ibrahim, A. \u0026amp; Hassaan, M. S. The potential synergistic action of quercetin and/or \u003cem\u003ePediococcus acidilactici\u003c/em\u003e on Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e performance. \u003cem\u003eAquac\u003c/em\u003e. \u003cb\u003e581\u003c/b\u003e, 740353 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin, M. et al. Dietary yeast hydrolysate and brewer's yeast supplementation could enhance growth performance, innate immunity capacity and ammonia nitrogen stress resistance ability of Pacific white shrimp (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e). fish shellfish immunol. 82, 121\u0026ndash;129. (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeshmatfar, F. et al. The effects of combined or singular administration of formic acid and \u003cem\u003ePediococcus acidilactici\u003c/em\u003e on stress resistance, growth performance, immune responses and related genes expression in common carp, \u003cem\u003eCyprinus carpio\u003c/em\u003e. \u003cem\u003eAquac Rep.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 101474 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNavarro-Torre, S., Carro, L., Igual, J. M. \u0026amp; Montero-Calasanz, M. D. C. \u003cem\u003eRossellomorea arthrocnemi\u003c/em\u003e sp. nov., a novel plant growth-promoting bacterium used in heavy metal polluted soils as a phytoremediation tool. \u003cem\u003eInt. J. Syst. Evol. Microbiol.\u003c/em\u003e \u003cb\u003e71\u003c/b\u003e (10), 005015 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta, R. S., Patel, S., Saini, N. \u0026amp; Chen, S. Robust demarcation of 17 distinct \u003cem\u003eBacillus\u003c/em\u003e species clades, proposed as novel \u003cem\u003eBacillaceae\u003c/em\u003e genera, by phylogenomics and comparative genomic analyses: description of \u003cem\u003eRobertmurraya kyonggiensis\u003c/em\u003e sp. nov. and proposal for an emended genus \u003cem\u003eBacillus\u003c/em\u003e limiting it only to the members of the \u003cem\u003eSubtilis\u003c/em\u003e and \u003cem\u003eCereus clades\u003c/em\u003e of species. \u003cem\u003eInt. Int. J. Syst. Evol. Microbiol.\u003c/em\u003e \u003cb\u003e70\u003c/b\u003e (11), 5753\u0026ndash;5798 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNavarro-Torre, S., Mateos-Naranjo, E., Caviedes, M. A., Pajuelo, E. \u0026amp; Rodr\u0026iacute;guez-Llorente, I. D. Isolation of plant-growth-promoting and metal-resistant cultivable bacteria from \u003cem\u003eArthrocnemum macrostachyum\u003c/em\u003e in the Odiel marshes with potential use in phytoremediation. \u003cem\u003eMar. Pollut Bull.\u003c/em\u003e \u003cb\u003e110\u003c/b\u003e (1), 133\u0026ndash;142 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNavarro-Torre, S. et al. Mateos-Naranjo, Bioaugmentation with bacteria selected from the microbiome enhances \u003cem\u003eArthrocnemum macrostachyum\u003c/em\u003e metal accumulation and tolerance. \u003cem\u003eMar. Pollut Bull.\u003c/em\u003e \u003cb\u003e117\u003c/b\u003e (1\u0026ndash;2), 340\u0026ndash;347 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNavarro-Torre, S. et al. Sustainable agricultural management of saline soils in arid and semi-arid Mediterranean regions through halophytes, microbial and soil-based technologies. \u003cem\u003eEnviron. Exp. Bot.\u003c/em\u003e 105397. (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayilraj, S., Suresh, K., Schumann, P., Kroppenstedt, R. M. \u0026amp; Saini, H. S. \u003cem\u003eAgrococcus lahaulensis\u003c/em\u003e sp. nov., isolated from a cold desert of the Indian Himalayas. International journal of systematic and evolutionary microbiology, 56 (8), 1807\u0026ndash;1810. (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGatinho, P. et al. From Cultural and Natural Heritage to Biomedicine: Prospection of Bioactive Compounds Produced by Bacterial Isolates from Caves. \u003cem\u003eInt. Biodeterior. Biodegrad\u003c/em\u003e. \u003cb\u003e190\u003c/b\u003e, 105773 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTavarideh, F., Pourahmad, F. \u0026amp; Nemati, M. Diversity and antibacterial activity of endophytic bacteria associated with medicinal plant, \u003cem\u003eScrophularia striata\u003c/em\u003e. \u003cem\u003eVet. Res. Forum\u003c/em\u003e. \u003cb\u003e13\u003c/b\u003e, 409\u0026ndash;415 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelim, K. M., El-Sayed, M. H., El-Hady, M. A. \u0026amp; Reda, R. R. In-vitro evaluation of the probiotic candidtes isolated from the gut of \u003cem\u003eClarias Gariepinus\u003c/em\u003e with special reference to the in vivo assessment of live and heat-inactivated \u003cem\u003eLeuconostoc mesenteroides\u003c/em\u003e and \u003cem\u003eEdwardsiella\u003c/em\u003e sp. \u003cem\u003eAquac Int.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e, 33\u0026ndash;51 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalam, A. M. et al. Gut probiotic bacteria of \u003cem\u003eBarbonymus gonionotus\u003c/em\u003e improve growth, hematological parameters and reproductive performances of the host. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 10692 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAly, S. M., Ahmed, Y. A. G., Ghareeb, A. A. A. \u0026amp; Mohamed, M. F. Studies on \u003cem\u003eBacillus subtilis\u003c/em\u003e and \u003cem\u003eLactobacillus acidophilus\u003c/em\u003e, as potential probiotics, on the immune response and resistance of Tilapia nilotica (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) to challenge infections. \u003cem\u003eFish Shellfish Immunol.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e (1\u0026ndash;2), 128\u0026ndash;136 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilva, T. A. et al. Effects of the probiotic \u003cem\u003eBacillus amyloliquefaciens\u003c/em\u003e on growth performance, hematology and intestinal morphometry in cagereared Nile tilapia. \u003cem\u003eLat Am. J. Aquat. Res.\u003c/em\u003e \u003cb\u003e43\u003c/b\u003e (5), 963\u0026ndash;971 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaperclaus, W., Kulow, H. \u0026amp; Schreckenbach, K. Hematological and serological technique. \u003cem\u003eFish. dis.\u003c/em\u003e \u003cb\u003e1\u003c/b\u003e (56), 71\u0026ndash;108 (1991).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParry, R. M., Chandan, R. C. \u0026amp; Shahani, K. M. A rapid and sensitive assay of muramidase, Proc. Soc. Exp. Biol. Med. 119 384\u0026ndash;386. (1965).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreen, L. C. et al. Analysis of nitrate, nitrite, and [15N] nitrate in biological fluids. \u003cem\u003eAnal. Biochem.\u003c/em\u003e \u003cb\u003e126\u003c/b\u003e (1), 131\u0026ndash;138 (1982).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumari, J. \u0026amp; Sahoo, P. K. Dietary β-1, 3 glucan potentiates innate immunity and disease resistance of Asian catfish, \u003cem\u003eClarias batrachus\u003c/em\u003e (L). \u003cem\u003eJ. Fish. Dis.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 95\u0026ndash;101 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFatima, R. et al. Enhancement of immune response and resistance to \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e in Tilapia fish (\u003cem\u003eOreochromis mossambicus\u003c/em\u003e) by dietary supplementation of \u003cem\u003ePortieria hornemannii\u003c/em\u003e. \u003cem\u003eAquac\u003c/em\u003e. \u003cb\u003e547\u003c/b\u003e, 737448 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDawood, M. A., Magouz, F. I., Salem, M. F. \u0026amp; Abdel-Daim, H. A. Modulation of digestive enzyme activity, blood health, oxidative responses and growth-related gene expression in GIFT by heat-killed \u003cem\u003eLactobacillus plantarum\u003c/em\u003e (L-137). \u003cem\u003eAquac\u003c/em\u003e. \u003cb\u003e505\u003c/b\u003e, 127\u0026ndash;136 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHassaan, M. S. et al. Partial dietary fish meal replacement with cotton seed meal and supplementation with exogenous protease alters growth, feed performance, hematological indices and associated gene expression markers (GH, IGF-I) for Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e. \u003cem\u003eAquac\u003c/em\u003e. \u003cb\u003e503\u003c/b\u003e, 282\u0026ndash;292 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHassaan, M. S., Mohammady, E. Y., Soaudy, M. R. \u0026amp; Abdel Rahman, A. A. Exogenous xylanase improves growth, protein digestibility and digestive enzymes activities in Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e, fed different ratios of fish meal to sunflower meal. \u003cem\u003eAquac Nutr.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e (4), 841\u0026ndash;853 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJia, R. et al. Effects of dietary baicalin supplementation on growth performance, antioxidative status and protection against oxidative stress-induced liver injury in GIFT tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e), Comp. \u003cem\u003eBiochem. Physiol. C Toxicol. Pharmacol.\u003c/em\u003e \u003cb\u003e240\u003c/b\u003e, 108914 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDawood, M. A., Abo-Al-Ela, H. G. \u0026amp; Hasan, M. T. Modulation of transcriptomic profile in aquatic animals: Probiotics, prebiotics and synbiotics scenarios. \u003cem\u003eFish. Shellfish Immunol.\u003c/em\u003e \u003cb\u003e97\u003c/b\u003e, 268\u0026ndash;282 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen, C. et al. Fecal short chain fatty acids modify therapeutic effects of sleeve gastrectomy. \u003cem\u003eFront. Endocrinol.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 1277035 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbirami, G. et al. Pyrogallol downregulates the expression of virulence-associated proteins in \u003cem\u003eAcinetobacter baumannii\u003c/em\u003e and showing anti-infection activity by improving non-specific immune response in zebrafish model. \u003cem\u003eInt. J. Biol. Macromol.\u003c/em\u003e \u003cb\u003e226\u003c/b\u003e, 853\u0026ndash;869 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerraboschi, P., Ciceri, S. \u0026amp; Grisenti, P. Applications of lysozyme, an innate immune defense factor, as an alternative antibiotic. \u003cem\u003eAntibiotics\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e (12), 1534 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim, K. C., Yusoff, F. M., Shariff, M. \u0026amp; Kamarudin, M. S. Dietary astaxanthin augments disease resistance of Asian seabass, \u003cem\u003eLates calcarifer\u003c/em\u003e (Bloch, 1790), against \u003cem\u003eVibrio alginolyticus\u003c/em\u003e infection. \u003cem\u003eFish. Shellfish Immunol.\u003c/em\u003e \u003cb\u003e114\u003c/b\u003e, 90\u0026ndash;101 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, P. T., Tran, H. T. Q., Huang, H. T., Nan, F. H. \u0026amp; Lee, M. C. \u003cem\u003eSargassum horneri\u003c/em\u003e extracts stimulate innate immunity, enhance growth performance, and upregulate immune genes in the white shrimp \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e. \u003cem\u003eFish. shellfish immunol.\u003c/em\u003e \u003cb\u003e102\u003c/b\u003e, 276\u0026ndash;285 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePanase, A., Thirabunyanon, M., Promya, J. \u0026amp; Chitmanat, C. Influences of \u003cem\u003eBacillus subtilis\u003c/em\u003e and fructooligosaccharide on growth performances, immune responses, and disease resistance of Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e. \u003cem\u003eFront. Veterinary Sci.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 1094681 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan, M. I. R. Biotechnological Interventions in Coldwater Aquaculture Health Management. In Coldwater Fisheries and Aquaculture Management. 147\u0026ndash;177. Apple Academic. eBook: ISBN9781003369905. (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCave, N., Delaney, S. J. \u0026amp; Larsen, J. A. Nutritional management of gastrointestinal diseases. \u003cem\u003eAppl. veterinary Clin. Nutr.\u003c/em\u003e, 235\u0026ndash;298. (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarrison, J. et al. The increased prevalence of \u003cem\u003eVibrio\u003c/em\u003e species and the first reporting of \u003cem\u003eVibrio jasicida\u003c/em\u003e and \u003cem\u003eVibrio rotiferianus\u003c/em\u003e at UK shellfish sites. \u003cem\u003eWater Res.\u003c/em\u003e \u003cb\u003e211\u003c/b\u003e, 117942 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbu Nor, N. et al. Efficacy of whole cell inactivated \u003cem\u003eVibrio harveyi\u003c/em\u003e vaccine against vibriosis in a marine red hybrid tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e\u0026times; \u003cem\u003eO. mossambicus\u003c/em\u003e) model. \u003cem\u003eVaccines\u003c/em\u003e. \u003cb\u003e8\u003c/b\u003e (4), 734 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAddo, S. et al. Effects of \u003cem\u003eBacillus subtilis\u003c/em\u003e strains on growth, immune parameters, and \u003cem\u003eStreptococcus iniae\u003c/em\u003e susceptibility in Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e. \u003cem\u003eJ. World Aquaculture Soc.\u003c/em\u003e \u003cb\u003e48\u003c/b\u003e (2), 257\u0026ndash;267 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbarike, E. D. et al. Effects of a commercial probiotic BS containing \u003cem\u003eBacillus subtilis\u003c/em\u003e and \u003cem\u003eBacillus licheniformis\u003c/em\u003e on growth, immune response and disease resistance in Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e. \u003cem\u003eFish. shellfish Immunol.\u003c/em\u003e \u003cb\u003e82\u003c/b\u003e, 229\u0026ndash;238 (2018).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Probiotic Functional Feed, Nile tilapia, Hemato-biochemical indices, Immunological response, Vibrio challenge","lastPublishedDoi":"10.21203/rs.3.rs-5202048/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5202048/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eProbiotics offer significant health advantages as they enter the digestive system via diet or water intake, playing a crucial role in enhancing immunity, growth, gastrointestinal microbiota, and feed attribute. The main objective of study to focusing in the impact of Probiotic Functional Feed (PFF) on Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) exposed to challenges from \u003cem\u003eVibrio harveyi\u003c/em\u003e and \u003cem\u003eVibrio parahaemolyticus\u003c/em\u003e. The investigation aims to analyze the genes linked to immunity, hemato-biochemical indices, and the immunological response in tilapia. PFF is a vital component of fish feed production, providing suitable nutrition for various ages and stages to promote healthy growth. The study comprises five treatments: Negative Control (NC), Positive Control (PC), \u003cem\u003eRossellomorea marisflavi\u003c/em\u003e sp. DAS-SCF02, \u003cem\u003eAgrococcus\u003c/em\u003e sp. RKDAS1, and a dual probiotic mix. A total of 150 Nile tilapia juveniles, weighing 2.56\u0026thinsp;\u0026plusmn;\u0026thinsp;1.26 g, were administered PFF in triplicates. Significant improvements were observed in hematological indices, encompassing white blood cells (WBC), hemoglobin (Hb), red blood cells (RBC), hematocrit (Htc), and blood performance (BP) in probiotic-treated groups compared to control. Biochemical analysis revealed lower levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in fish fed with probiotics, accompanied by increased total protein, albumin, and globulin levels. Furthermore, probiotic-fed fish exhibited heightened blood glucose, total cholesterol, and triglyceride levels. Immunological assessments demonstrated increased lysozyme activity, intracellular superoxide anion production, reactive nitrogen species synthesis, and myeloperoxidase activity in probiotic-fed groups. Immune gene expression analysis revealed up-regulation of stress response, cytokine signaling, and immune defense-related genes (\u003cem\u003eHSP70, IL-1β, I C3, IFN-α, IFN-γ, GF1, GH, IL-1\u003c/em\u003e, and \u003cem\u003eLyz\u003c/em\u003e). In a Vibrio challenge study, probiotic-fed fish exhibited improved survival rates, underscoring the protective effects of probiotics against bacterial infections. Overall, this research underscores the multifaceted benefits of probiotic supplementation in enhancing the health and immunity of tilapia.\u003c/p\u003e","manuscriptTitle":"Synergistic effects of Rossellomorea marisflavi spp. DAS-SCF02 and Agrococcus spp. RKDAS1 as a probiotic functional feed (PFF) in Nile tilapia: Insights into growth, hemato-biochemical, and immune responses in the face of Vibrio challenges","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-21 14:28:20","doi":"10.21203/rs.3.rs-5202048/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-06T08:30:08+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-04T13:59:17+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-29T06:17:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"247239780774785747194707216388630864956","date":"2024-10-22T03:34:35+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"219224220829979839257652449277901711633","date":"2024-10-21T06:29:31+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-21T04:11:32+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-21T04:03:34+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-10-21T03:06:27+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-10-18T10:31:42+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-10-04T06:55:30+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"94191262-44c5-46af-80d1-3a164f532f36","owner":[],"postedDate":"October 21st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":39120107,"name":"Biological sciences/Biotechnology"},{"id":39120108,"name":"Biological sciences/Microbiology"},{"id":39120109,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2025-07-07T16:03:39+00:00","versionOfRecord":{"articleIdentity":"rs-5202048","link":"https://doi.org/10.1038/s41598-025-03715-z","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-07-01 15:57:49","publishedOnDateReadable":"July 1st, 2025"},"versionCreatedAt":"2024-10-21 14:28:20","video":"","vorDoi":"10.1038/s41598-025-03715-z","vorDoiUrl":"https://doi.org/10.1038/s41598-025-03715-z","workflowStages":[]},"version":"v1","identity":"rs-5202048","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5202048","identity":"rs-5202048","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}