Identification of a genomic locus of Verticillium dahliae linked to pathogenicity on sweet pepper

preprint OA: closed
Full text JSON View at publisher
Full text 53,129 characters · extracted from preprint-html · click to expand
Identification of a genomic locus of Verticillium dahliae linked to pathogenicity on sweet pepper | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification of a genomic locus of Verticillium dahliae linked to pathogenicity on sweet pepper Ningning Zhang, Zheng Chen, Toshiyuki USAMI This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7033374/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Sep, 2025 Read the published version in Journal of General Plant Pathology → Version 1 posted 4 You are reading this latest preprint version Abstract Although the host range of vascular wilt pathogen Verticillium dahliae can vary among strains, the host-determining mechanisms involved remain unclear. We aimed to identify the genomic region involved in the pathogenicity on sweet pepper using parasexual recombination between pathogenic and nonpathogenic strains, HR26 and GR12. The recombinants were analyzed by codominant DNA markers capable of distinguishing the genomic sequence of each parental strain. This assay identified DNA markers on a genetic locus on the short arm of chromosome 3 of the V. dahliae reference strain JR2 that was linked to pathogenicity of parental and recombinant strains on sweet pepper. Capsicum annuum Parasexual recombination Protoplast fusion Verticillium wilt Figures Figure 1 Figure 2 Full Text Verticillium dahliae is a soilborne fungal pathogen that causes wilt disease (i.e., Verticillium wilt) on various dicotyledonous crops, leading to severe economic losses worldwide (Pegg and Brady 2002; Fradin and Thomma 2006; Inderbitzin and Subbarao 2014). V. dahliae produces a survival structure, a microsclerotium, which is highly viable and can survive for at least 14 years in the soil (Wilhelm 1955). After germination of the microsclerotium, V. dahliae invades root tissue, colonizes xylem vessels, and subsequently induces wilt symptoms on host plants. Although the host range of this pathogen is wide, the pathogenicity differs among strains. For example, some isolates are pathogenic on pepper ( Capsicum annuum ), while others are not (Bhat and Subbarao 1999; Bhat et al. 2003; Tsror et al. 1998; Usami and Amemiya 2005). However, the mechanisms that determine the pathogenicity of V. dahliae on a specific plant species remain poorly understood. Elucidating pathogenicity-determining mechanisms on host plant species is therefore important for effective disease management. Genetic crosses between fungal isolates are often used to investigate the pathogenicity and virulence of plant pathogenic fungi. Although Verticillium spp. are asexual, it is known that they can recombine via parasexual cycle (Hastie 1964; Typas and Heale 1978). Previous studies have examined the parasexual recombination of V. albo-atrum hop isolates (Clarkson and Heale 1985) and V. dahliae tomato isolates (O’Garro and Clarkson 1992). The virulence of the recombinants obtained in these studies was different from that of the parental isolates used for each recombination. Moreover, McGeary and Hastie (1982) as well as Usami and Amemiya (2005) reported that the host range of recombinants expanded to include the pathogenicity of both parental strains. However, these studies were unable to examine the genes involved in fungal pathogenicity and virulence on specific plant species. Identification of those genes in V. dahliae is important for furthering our understanding and management of the disease. To this end, Usami et al. (2020) conducted parasexual recombination (induced by protoplast fusion) between strains of V. dahliae to identify the genomic region responsible for its pathogenicity; they successfully discovered a genomic marker linked to the fungal pathogenicity on tomato. Similarly, in this study, parasexual recombination was demonstrated between pathogenic and nonpathogenic strains of V. dahliae on sweet pepper ( Capsicum annuum ), another isolate-specific host species of V. dahliae . Specifically, we performed a genetic cross between strains HR26 (pathogenic on sweet pepper) and GR12 (nonpathogenic on sweet pepper) using the protocol described by Usami et al. (2020). HR26 is a hygromycin B-resistant transformant strain generated from the strain Vdp4 (Usami and Amemiya 2005; Usami et al. 2007), while GR12 is a G418-resistant transformant strain generated from the strain Chr208 (Usami et al. 2007). Parasexual recombination was induced by protoplast fusion between parental strains HR26 and GR12, resulting in 27 (HGR1–27) recombinants that showed resistance to both hygromycin B and G418. Single-conidium isolates of these recombinants were then used for pathogenicity tests on sweet pepper and for PCR-based genetic analyses. Pathogenicity tests were performed according to the following procedure. First, the parental strains and recombinants were shake-cultured in potato sucrose broth (made from fresh potatoes) for 1 week at 25°C in the dark. Each culture was then filtered through a single layer of KimWipe (Nippon Paper Crecia Co. Ltd., Tokyo, Japan) to remove mycelia. Conidia were collected by centrifugation (1,500 × g ) at room temperature and subsequently resuspended in sterile distilled water. A total of five 4-week-old sweet pepper seedlings (cv. Ace; Takii & Co. Ltd., Kyoto, Japan) were inoculated with V. dahliae by dipping their roots in conidial suspension (10 7 conidia / mL). Inoculated plants were then planted in commercial potting soil (Genkikun Kasai 200; Katakura and Co-op Agri Corporation, Tokyo, Japan) and cultivated under a 12-h photoperiod at 25°C. The severity of foliar (i.e., yellowing, wilting, and/or defoliating) and vascular symptoms (i.e., vascular discoloration) was evaluated 1 month after inoculation. Foliar symptoms were evaluated on a 3-point scale (0–3), wherein 0 = no symptoms, 1 = symptoms were observed only on lower leaves, 2 = symptoms extended to middle leaves, and 3 = symptoms extended to upper leaves. Vascular symptoms of hypocotyls were also evaluated on a 3-point scale (0–3), where 0 = no discoloration, 1 = slight discoloration, 2 = moderate discoloration, and 3 = severe discoloration. Next, the severity of foliar and vascular symptoms was calculated using the following formula: (Σ S i N i ⁄ 3 N t ) × 100, where S i is the symptom severity score, N i is the number of plants with the S i , and N t represents the total number of plants. The pathogenicity test results are presented in Table 1. The pathogenicity of each recombinant was judged based on statistically significant differences (Steel tests, P < 0.05) in the severity of foliar and vascular symptoms between the recombinant and nonpathogenic parent strain GR12. The foliar symptom severity associated with the recombinant HGR25 was not statistically significant because one seedling exhibited no symptoms despite clear symptoms being readily observed on the remaining four seedlings. On the other hand, vascular symptoms were observed in all five seedlings inoculated with HGR25 and found to be statistically significant. Therefore, we determined that the recombinant HGR25 strain was pathogenic on sweet pepper. Moreover, the significance of the foliar and vascular symptom severity was similar to that observed in other recombinants. In conclusion, 14 out of 27 recombinants were pathogenic on sweet pepper, while 13 were nonpathogenic. Similar results were obtained during repeated pathogenicity tests. Next, genomic DNA of 2 parental strains and 27 recombinants was extracted as described by Usami et al. (2002). These samples were then used as templates for PCR assays. Similar to the recombinant analyses used by Usami et al. (2020), microsatellite DNA markers and PCR conditions reported by Almany et al. (2009) were used for PCR assays to explore the genomic region linked to the pathogenicity on sweet pepper. In these assays, the PCR amplification pattern by the microsatellite marker VD12 (F: TAGAATTTTCGGGACGCTGT, R: AGCTGCATCGTTTTCTGACC) (Almany et al. 2009) completely corresponds to the degree of pathogenicity on sweet pepper (Fig. 1). By using this primer pair, a PCR product of identical length with a pathogenic (or nonpathogenic) parental strain was amplified in each pathogenic (or nonpathogenic) recombinant. The microsatellite marker VD12 was located on the short arm of chromosome 3 of V. dahliae JR2, a reference strain (de Jonge et al. 2012, 2013; https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_000400815.2/) (Fig. 2). Subsequently, additional codominant DNA markers were designed in regions surrounding VD12 on chromosome 3 to specify pathogenicity-linked genomic sequences. Next, the PCR primers that can amplify different product sizes from the genomic DNA of each parental strain were designed based on the observed differences in nucleotide sequence between parental strains HR26 and GR12. The position of DNA markers and their primer sequences are presented in Fig. 2 and Table 2. In brief, PCR assays using codominant markers were performed according to the following program: 95°C for 5 min, (95°C for 30 s, 58°C for 30 s, and 72°C for 30 s) × 30 cycles and 72°C for 5 min. The results of these assays are presented in Table 3, and representative banding patterns are indicated in Fig. 1. The banding patterns by the DNA markers Ch3sa-F, Ch3sa-G, and Ch3sa-H indicated pathogenicity on sweet pepper, similar to the results observed for VD12. In contrast, some bands did not correspond to pathogenicity (indicated by orange asterisks in Fig. 1) were observed in DNA markers flanking the above markers. For example, DNA marker Ch3-F8 (on the long arm of chromosome 3) showed amplified bands in 4 of 27 recombinants that did not correspond to pathogenicity. Ch3-F8 is located near Ch3-TV11, a DNA marker linked to the pathogenicity of V. dahliae on tomato (Usami et al. 2020). However, the genomic region flanking these markers does not appear to be linked to pathogenicity on sweet pepper. Accordingly, we concluded that the genomic region between the DNA markers Ch3sa-E and Ch3sa-I (approx. 368 kb) may contain a DNA sequence that is responsible for the difference in pathogenicity on sweet pepper between the parental strains HR26 and GR12. In this study, we generated stable genetic recombinants between two strains of the asexual fungus V. dahliae . In the PCR assays using codominant DNA markers (Fig. 1, Table 3), we observed no recombinants with two bands amplified from the genomic sequences of both parental strains. This indicates that the process of haploidization after karyogamy in the parasexual cycle was nearly complete in each recombinant. Furthermore, using genomic Southern hybridization with a telomeric sequence probe, Usami et al. (2020) confirmed that recombinants can easily haploidize during parasexual recombination; our results are consistent with this report. Next, we successfully identified a genomic locus linked to the pathogenicity on sweet pepper by performing genetic recombination between the strains that differ in pathogenicity. O’Garro and Clarkson (1992) performed parasexual recombination between different strains of V. dahliae that were both pathogenic on tomato. In their experiments, fungal virulence on tomato appeared to be controlled polygenetically. In contrast, the results of this study and some previous studies (McGeary and Hastie 1982; Usami et al. 2020) showed that recombinants were divided equally into pathogenic (or highly virulent) and nonpathogenic (or low virulent) isolates. In these cases, differences in pathogenicity or virulence between parental strains used for genetic recombination may be controlled by a single gene or by a small number of genes. In V. dahliae , two Avr genes, i.e., VdAve1 (de Jonge et al. 2012) and Av2 (Chavarro-Carrero et al. 2021), have been identified; these genes determine avirulence in interactions between fungal races and tomato cultivars. Moreover, various effectors associated with pathogenicity and virulence have also been identified (Yang et al. 2025). However, the specific genetic factors that are responsible for host range differences among strains remain unelucidated. Effectors involved in host-specific pathogenicity (Li et al. 2020) are possible candidates for these genetic factors. In addition, avirulence genes that determine incompatibility with plant species (Inoue et al. 2017; Bourras et al. 2019) are also possible candidates. Further investigation is required to investigate the genes that are located in the genomic region identified in this study and involved in host determination. We anticipate that such findings may help us to elucidate the mechanisms responsible for host specificity of V. dahliae strains. Declarations Acknowledgments This work was supported by JSPS KAKENHI grant numbers JP15K07309, JP18K05641, JP21K05594, and JP25K09118. Compliance with ethical standards Conflict of interest The authors declare that they have no conflicts of interest related to this study. Human and animal rights statement No human participants or animals were used in this study. References Almany GR, De Arruda MP, Arthofer W, Atallah ZK, Beissinger SR et al (2009) Permanent genetic resources added to molecular ecology resources database 1 May 2009–31 July 2009. Mol Ecol Resour 9:1460–1466 https://doi.org/10.1111/j.1755-0998.2009.02759.x Bhat RG, Subbarao KV (1999) Host range specificity in Verticillium dahliae . Phytopathology 89:1218–1225 https://doi.org/10.1094/PHYTO.1999.89.12.1218 Bhat R, Smith R, Koike S, Wu B, Subbarao K (2003) Characterization of Verticillium dahliae isolates and wilt epidemics of pepper. Plant Dis 87:789–797 https://doi.org/10.1094/PDIS.2003.87.7.789 Bourras S, Kunz L, Xue M, Praz CR, Müller MC, Kälin C, Schläfli M, Ackermann P, Flückiger S, Parlange F, Menardo F, Schaefer LK, Ben-David R, Roffler S, Oberhaensli S, Widrig V, Lindner S, Isaksson J, Wicker T, Yu D, Keller B (2019) The AvrPm3-Pm3 effector-NLR interactions control both race-specific resistance and host-specificity of cereal mildews on wheat. Nat Commun 10:2292 https://doi.org/10.1038/s41467-019-10274-1 Chavarro-Carrero EA, Vermeulen JP, Torres DE, Usami T, Schouten HJ, Bai Y, Seidl MF, Thomma BPHJ (2021) Comparative genomics reveals the in planta-secreted Verticillium dahliae Av2 effector protein recognized in tomato plants that carry the V2 resistance locus. Environ Microbiol 23:1941–1958 https://doi.org/10.1111/1462-2920.15288 Clarkson JM, Heale JB (1985) Heterokaryon compatibility and genetic recombination within a host plant between hop wilt isolates of Verticillium albo-atrum . Plant Pathol 34:129–138 https://doi.org/10.1111/j.1365-3059.1985.tb02769.x de Jonge R, van Esse HP, Maruthachalam K, Bolton MD, Santhanam P, Saber MK, Zhang Z, Usami T, Lievens B, Subbarao KV, Thomma BPHJ (2012) Tomato immune receptor Ve1 recognizes effector of multiple tomato fungal pathogens uncovered by genome and RNA sequencing. Proc Natl Acad Sci USA 109:5110–5115 https://doi.org/10.1073/pnas.1119623109 de Jonge R, Bolton MD, Kombrink A, van den Berg GCM, Yadeta KA, Thomma BPHJ (2013) Extensive chromosomal reshuffling drives evolution of virulence in an asexual pathogen. Genome Res 23:1271–1282 http://www.genome.org/cgi/doi/10.1101/gr.152660.112 Fradin EF, Thomma BPHJ (2006) Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. alboatrum . Mol Plant Pathol 7:71–86 https://doi.org/10.1111/j.1364-3703.2006.00323.x Hastie AC (1964) The parasexual cycle in Verticillium albo-atrum . Genet Res 5:305–315 https://doi.org/10.1017/S0016672300001245 Inderbitzin P, Subbarao KV (2014) Verticillium systematics and evolution: how confusion impedes Verticillium wilt management and how to resolve it. Phytopathology 104:564–574 https://doi.org/10.1094/PHYTO-11-13-0315-IA Inoue Y, Vy TTP, Yoshida K, Asano H, Mitsuoka C, Asuke S, Anh VL, Cumagun CJR, Chuma I, Terauchi R, Kato K, Mitchell T, Valent B, Farman M, Tosa Y (2017) Evolution of the wheat blast fungus through functional losses in a host specificity determinant. Science 357:80–83 https://doi.org/10.1126/science.aam9654 Li J, Cornelissen B, Rep M (2020) Host-specificity factors in plant pathogenic fungi. Fungal Genet Biol 144:103447 https://doi.org/10.1016/j.fgb.2020.103447. McGeary FM, Hastie AC (1982) Hybridization of Verticillium albo-atrum strains from tomato and lucerne. Physiol Plant Pathol 21:437–444 https://doi.org/10.1016/0048-4059(82)90077-7 O’Garro LW, Clarkson JM (1992) Variation for pathogenicity on tomato among parasexual recombinants of Verticillium dahliae . Plant Pathol 41:141–147 https://doi.org/10.1111/j.1365-3059.1992.tb02331.x Pegg GF, Brady BL (2002) Verticillium wilts. CAB International, Wallingford, UK https://www.cabidigitallibrary.org/doi/book/10.1079/9780851995298.0000 Seidl MF, Kramer HM, Cook DE, Fiorin GL, van den Berg GCM, Faino L, Thomma BPHJ (2020) Repetitive elements contribute to the diversity and evolution of centromeres in the fungal genus Verticillium . mBio 11:e01714­-20 https://doi.org/10.1128/mbio.01714-20 Tsror L, Erlich O, Amitai S, Hazanovsky M (1998) Verticillium wilt of paprika caused by a highly virulent isolate of Verticillium dahliae . Plant Dis 82:437–439 https://doi.org/10.1094/PDIS.1998.82.4.437 Typas MA, Heale JB (1978) Heterozygous diploid analyses via the parasexual cycle and a cytoplasmic pattern of inheritance in Verticillium spp. Genet Res 31:131–144 https://doi.org/10.1017/S0016672300017894 Usami T, Amemiya Y (2005) Genetic recombination between two pathotypes of Verticillium dahliae (in Japanese with English abstract). Jpn J Phytopathol 71:319–325 https://doi.org/10.3186/jjphytopath.71.319 Usami T, Abiko M, Shishido M, Amemiya Y (2002) Specific detection of tomato pathotype of Verticillium dahliae by PCR assays. J Gen Plant Pathol 68:134–140 https://doi.org/10.1007/PL00013066 Usami T, Iida N, Nakao K, Hamano A, Suzuki N, Ohmura, Y, Komiya Y (2020) Identifcation of the chromosome region responsible for pathogenicity of Verticillium dahliae on tomato using genetic recombination through protoplast fusion. J Gen Plant Pathol 86:477–485 https://doi.org/10.1007/s10327-020-00955-x Usami T, Ishigaki S, Takashina H, Matsubara Y, Amemiya Y (2007) Cloning of DNA fragments specific to the pathotype and race of Verticillium dahliae . J Gen Plant Pathol 73:89–95 https://doi.org/10.1007/s10327-006-0334-4 Wilhelm S (1955) Longevity of the Verticillium wilt fungus in the laboratory and field. Phytopathology 45:180–181 Yang L, Fu T, Sha R, Wei G, Shen Y, Jiao Z, Li B (2025) Role of Verticillium dahliae effectors in interaction with cotton plants. Phytopathol Res 7:1 https://doi.org/10.1186/s42483-024-00288-z Tables Tables 1 to 3 are available in the Supplementary Files section Supplementary Files Table1.xlsx Table2.xlsx Table3.xlsx Cite Share Download PDF Status: Published Journal Publication published 19 Sep, 2025 Read the published version in Journal of General Plant Pathology → Version 1 posted Reviewers agreed at journal 10 Jul, 2025 Reviewers invited by journal 10 Jul, 2025 Editor assigned by journal 03 Jul, 2025 First submitted to journal 02 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7033374","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":483768445,"identity":"9afe259a-0502-4cd8-8492-a60ef19b2b2d","order_by":0,"name":"Ningning Zhang","email":"","orcid":"","institution":"Chiba University: Chiba Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Ningning","middleName":"","lastName":"Zhang","suffix":""},{"id":483768446,"identity":"47a29a13-c1a7-4449-801d-90abebcb56ef","order_by":1,"name":"Zheng Chen","email":"","orcid":"","institution":"Chiba University: Chiba Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Zheng","middleName":"","lastName":"Chen","suffix":""},{"id":483768447,"identity":"71701e0e-da2b-4939-9324-e0249bde7f02","order_by":2,"name":"Toshiyuki USAMI","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYLCChAo5IMncAGazSYDF2AhoOWMMJBkbG4jXwtiGpIVBgoCbDM4ffrrh4TwDef4Zie2PeRjs8vikmx8w8zDw5eHUciPN7EbiNgPDGTcSG5t5GJKL2WSOGQC1sBXj1sIA0vKHcYMEWMuBxDaJBPPfQC2JDTgddvzbjcQ5BvZIWtI/MOPVciAHaEuDQSKSlhwDvFokb+SU3Ug4ZpA848zDxplzDJIT22TOFDDOMcDtF77zx7fd/FFjYNvfnnzgw5sKu8T5s9s3MLypOIYzxFAAE48B3MHHEojSwvgDwa4hTssoGAWjYBSMBAAAmGhZQ2m3eocAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-8071-8167","institution":"Chiba University Graduate School of Horticulture Faculty of Horticulture: Chiba Daigaku Daigakuin Engeigaku Kenkyuka Engei Gakubu","correspondingAuthor":true,"prefix":"","firstName":"Toshiyuki","middleName":"","lastName":"USAMI","suffix":""}],"badges":[],"createdAt":"2025-07-03 02:18:04","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7033374/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7033374/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10327-025-01252-1","type":"published","date":"2025-09-19T15:57:22+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":86756806,"identity":"b1370c5a-ae0e-474c-9a9a-3931badc0f06","added_by":"auto","created_at":"2025-07-15 09:33:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":810524,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative results of PCR amplification of genomic DNA from parental and recombinant \u003cem\u003eVerticillium dahliae\u003c/em\u003e using primers of DNA markers. Names of the DNA markers are indicated on the right of the electrophoresis photographs. H: HR26 (hygromycin B-resistant transformant, which is derived from strain Vdp4 and pathogenic on sweet pepper).G: GR12 G418-resistant transformant, which is derived from strain Chr208 and nonpathogenic on sweet pepper). Lane numbers indicate respective recombinants HGR1–27. The strains that are pathogenic on sweet pepper are indicated in bold red letters. Amplified bands that are not consistent with the pathogenicity of recombinants on sweet pepper are indicated by orange asterisks.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-7033374/v1/3e5b6853de9bdf8c24e4c2ae.png"},{"id":86756210,"identity":"0e8ac799-d0f3-4ac7-b222-2673499a7666","added_by":"auto","created_at":"2025-07-15 09:25:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":88382,"visible":true,"origin":"","legend":"\u003cp\u003eThe position of each DNA marker on the map of chromosome 3 of the \u003cem\u003eVerticillium dahliae\u003c/em\u003ereference strain JR2 (de Jonge et al. 2012, 2013). The white box on the chromosome indicates the centromere sequence reported by Seidl et al. (2020). Ch3-TV11 is a DNA marker linked to pathogenicity on tomato (Usami et al. 2020). VD12 is a microsatellite marker reported by Almany et al.(2009). Other markers were designed and used for this study (see Table 2). The map also indicates a genomic region containing a pathogenicity-linked sequence (approximately 368 kb in length).\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-7033374/v1/b61d68447a1fe9cfdb019154.png"},{"id":91889789,"identity":"d779ad91-89ca-4cdd-9099-da2837861243","added_by":"auto","created_at":"2025-09-22 16:02:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1154315,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7033374/v1/5b5fcde7-f28c-454f-a5c5-951c0e006dba.pdf"},{"id":86756211,"identity":"42e3149e-16f9-4376-be4c-f32bb74daabd","added_by":"auto","created_at":"2025-07-15 09:25:29","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":12649,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7033374/v1/448fda17409347e844d600fb.xlsx"},{"id":86756807,"identity":"9eadaca2-ccbd-4bda-89eb-e892a5665b90","added_by":"auto","created_at":"2025-07-15 09:33:29","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":11685,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7033374/v1/1fc3e6cd172da52aac086666.xlsx"},{"id":86756213,"identity":"b1fd1779-0a60-4585-aca5-43badbc7b695","added_by":"auto","created_at":"2025-07-15 09:25:29","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":14358,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7033374/v1/6dd8b2b7586800a0c30ad357.xlsx"}],"financialInterests":"","formattedTitle":"Identification of a genomic locus of Verticillium dahliae linked to pathogenicity on sweet pepper","fulltext":[{"header":"Full Text","content":"\u003cp\u003e\u003cem\u003eVerticillium dahliae\u003c/em\u003e is a soilborne fungal pathogen that causes wilt disease (i.e., Verticillium wilt) on various dicotyledonous crops, leading to severe economic losses worldwide (Pegg and Brady 2002; Fradin and Thomma 2006; Inderbitzin and Subbarao 2014).\u0026nbsp;\u003cem\u003eV. dahliae\u003c/em\u003e produces a survival structure, a microsclerotium, which is highly viable and can survive for at least 14 years in the soil (Wilhelm 1955). After germination of the microsclerotium, \u003cem\u003eV. dahliae\u003c/em\u003e invades root tissue, colonizes xylem vessels, and subsequently induces wilt symptoms on host plants. Although the host range of this pathogen is wide, the pathogenicity differs among strains. For example, some isolates are pathogenic on pepper (\u003cem\u003eCapsicum annuum\u003c/em\u003e), while others are not (Bhat and Subbarao 1999;\u0026nbsp;Bhat et al. 2003;\u0026nbsp;Tsror et al. 1998;\u0026nbsp;Usami and Amemiya 2005). However, the mechanisms that determine the pathogenicity of \u003cem\u003eV. dahliae\u003c/em\u003e on a specific plant species remain poorly understood. Elucidating pathogenicity-determining mechanisms\u0026nbsp;on host plant species is therefore important for effective disease management.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Genetic crosses between fungal isolates are often used to investigate the pathogenicity and virulence of plant pathogenic fungi. Although \u003cem\u003eVerticillium\u003c/em\u003e spp. are asexual, it is known that they can recombine via parasexual cycle (Hastie 1964;\u0026nbsp;Typas and Heale 1978). Previous studies have examined the parasexual recombination of \u003cem\u003eV. albo-atrum\u003c/em\u003e hop isolates (Clarkson and Heale 1985) and \u003cem\u003eV. dahliae\u003c/em\u003e tomato isolates (O\u0026rsquo;Garro and Clarkson 1992). The virulence of the recombinants obtained in these studies was different from that of the parental isolates used for each recombination. Moreover, McGeary and Hastie (1982) as well as Usami and Amemiya (2005) reported that the host range of recombinants expanded to include the pathogenicity of both parental strains. However, these studies were unable to examine the genes involved in fungal pathogenicity and virulence on specific plant species. Identification of those genes in \u003cem\u003eV. dahliae\u003c/em\u003e is important for furthering our understanding and management of the disease. To this end, Usami et al. (2020) conducted parasexual recombination (induced by protoplast fusion) between strains of \u003cem\u003eV. dahliae\u003c/em\u003e to identify the genomic region responsible for its pathogenicity; they successfully discovered a genomic marker linked to the fungal pathogenicity on tomato. Similarly, in this study, parasexual recombination was demonstrated between pathogenic and nonpathogenic strains of \u003cem\u003eV. dahliae\u003c/em\u003e on sweet pepper (\u003cem\u003eCapsicum annuum\u003c/em\u003e), another isolate-specific host species of \u003cem\u003eV. dahliae\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eSpecifically, we performed a genetic cross between strains HR26 (pathogenic on sweet pepper) and GR12 (nonpathogenic on sweet pepper) using the protocol described by Usami et al. (2020). HR26 is a hygromycin B-resistant transformant strain generated from the strain Vdp4 (Usami and Amemiya 2005; Usami et al. 2007), while GR12 is a G418-resistant transformant strain generated from the strain Chr208 (Usami et al. 2007). Parasexual recombination was induced by protoplast fusion between parental strains HR26 and GR12, resulting in 27\u0026nbsp;(HGR1\u0026ndash;27)\u0026nbsp;recombinants that showed resistance to both hygromycin B and G418. Single-conidium isolates of these recombinants were then used for pathogenicity tests on sweet pepper and for PCR-based genetic analyses.\u003c/p\u003e\n\u003cp\u003ePathogenicity tests were performed according to the following procedure. First, the parental strains and recombinants were shake-cultured in potato sucrose broth (made from fresh potatoes) for 1 week at 25\u0026deg;C in the dark. Each culture was then filtered through a single layer of KimWipe (Nippon Paper Crecia Co. Ltd., Tokyo, Japan) to remove mycelia. Conidia were collected by centrifugation (1,500 \u0026times; \u003cem\u003eg\u003c/em\u003e) at room temperature and subsequently resuspended in sterile distilled\u0026nbsp;water. A total of five 4-week-old sweet pepper seedlings (cv. Ace; Takii \u0026amp; Co. Ltd., Kyoto, Japan) were inoculated with \u003cem\u003eV. dahliae\u003c/em\u003e by dipping their roots in conidial suspension (10\u003csup\u003e7\u003c/sup\u003e conidia / mL). Inoculated plants were then planted in commercial potting soil (Genkikun Kasai 200; Katakura and Co-op Agri Corporation, Tokyo, Japan) and cultivated under a 12-h photoperiod at 25\u0026deg;C. The severity of foliar (i.e.,\u0026nbsp;yellowing, wilting, and/or defoliating) and vascular symptoms (i.e.,\u0026nbsp;vascular discoloration) was evaluated 1 month after inoculation.\u0026nbsp;Foliar symptoms were evaluated on a 3-point scale (0\u0026ndash;3), wherein 0 = no symptoms, 1 = symptoms were observed only on lower leaves, 2 = symptoms extended to middle leaves, and 3 = symptoms extended to upper leaves. Vascular symptoms of hypocotyls were also evaluated on a 3-point scale (0\u0026ndash;3), where 0 = no discoloration, 1 = slight discoloration, 2 = moderate discoloration, and 3 = severe discoloration. Next, the severity of foliar and vascular symptoms was calculated using the following formula: (\u0026Sigma;\u003cem\u003eS\u003csub\u003ei\u003c/sub\u003eN\u003csub\u003ei\u003c/sub\u003e\u003c/em\u003e \u0026frasl; 3\u003cem\u003eN\u003csub\u003et\u003c/sub\u003e\u003c/em\u003e) \u0026times; 100, where \u003cem\u003eS\u003csub\u003ei\u003c/sub\u003e\u003c/em\u003e is the symptom severity score, \u003cem\u003eN\u003csub\u003ei\u003c/sub\u003e\u003c/em\u003e is the number of plants with the \u003cem\u003eS\u003csub\u003ei\u003c/sub\u003e\u003c/em\u003e, and \u003cem\u003eN\u003csub\u003et\u003c/sub\u003e\u003c/em\u003e represents the total number of plants.\u003c/p\u003e\n\u003cp\u003eThe pathogenicity test results are presented in Table 1. The pathogenicity of each recombinant was judged based on statistically significant differences (Steel tests, \u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05) in the severity of foliar and vascular symptoms between the recombinant and nonpathogenic parent strain GR12. The foliar symptom severity associated with the recombinant HGR25 was not statistically significant because one seedling exhibited no symptoms despite clear symptoms being readily observed on the remaining four seedlings. On the other hand, vascular symptoms were observed in all five seedlings inoculated with HGR25 and found to be statistically significant. Therefore, we determined that the recombinant HGR25 strain was pathogenic on sweet pepper. Moreover, the significance of the foliar and vascular symptom severity was similar to that observed in other recombinants.\u0026nbsp;In conclusion, 14 out of 27 recombinants were pathogenic on sweet pepper, while 13 were nonpathogenic. Similar results were obtained during repeated pathogenicity tests.\u003c/p\u003e\n\u003cp\u003eNext, genomic DNA of 2 parental strains and 27 recombinants was extracted as described by Usami et al. (2002). These samples were then used as templates for PCR assays. Similar to the recombinant analyses used by Usami et al. (2020), microsatellite DNA markers and PCR conditions reported by Almany et al. (2009) were used for PCR assays to explore the genomic region linked to the pathogenicity on sweet pepper. In these assays, the PCR amplification pattern by the microsatellite marker VD12 (F: TAGAATTTTCGGGACGCTGT, R: AGCTGCATCGTTTTCTGACC) (Almany et al. 2009) completely corresponds to the degree of pathogenicity on sweet pepper (Fig. 1). By using this primer pair, a PCR product of identical length with a pathogenic (or nonpathogenic) parental strain was amplified in each pathogenic (or nonpathogenic) recombinant. The microsatellite marker VD12 was located on the short arm of chromosome 3 of \u003cem\u003eV. dahliae\u003c/em\u003e JR2, a reference strain (de Jonge et al. 2012, 2013;\u0026nbsp;https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_000400815.2/) (Fig. 2).\u003c/p\u003e\n\u003cp\u003eSubsequently, additional codominant DNA markers were designed in regions surrounding VD12 on chromosome 3 to specify pathogenicity-linked genomic sequences. Next, the PCR primers that can amplify different product sizes from the genomic DNA of each parental strain were designed based on the observed differences in nucleotide sequence between parental strains HR26 and GR12. The position of DNA markers and their primer sequences are presented in Fig. 2 and Table 2. In brief, PCR assays using codominant markers\u0026nbsp;were performed according to the following program: 95\u0026deg;C\u0026nbsp;for 5 min, (95\u0026deg;C\u0026nbsp;for 30 s, 58\u0026deg;C\u0026nbsp;for 30 s, and 72\u0026deg;C\u0026nbsp;for 30 s) \u0026times; 30 cycles and 72\u0026deg;C\u0026nbsp;for 5 min. The results of these assays are presented in Table 3, and representative banding patterns are indicated in Fig. 1.\u0026nbsp;The banding patterns by the DNA markers Ch3sa-F, Ch3sa-G, and Ch3sa-H indicated pathogenicity on sweet pepper, similar to the results observed for VD12. In contrast, some bands did not correspond to pathogenicity (indicated by orange asterisks in Fig. 1) were observed in\u0026nbsp;DNA markers flanking the above markers. For example, DNA marker Ch3-F8 (on the long arm of chromosome 3) showed amplified bands in 4 of 27 recombinants that did not correspond to pathogenicity. Ch3-F8 is located near Ch3-TV11, a DNA marker linked to the pathogenicity of \u003cem\u003eV. dahliae\u003c/em\u003e on tomato (Usami et al. 2020). However, the genomic region flanking these markers does not appear to be linked to pathogenicity on sweet pepper. Accordingly, we concluded that the genomic region between the DNA markers Ch3sa-E and Ch3sa-I (approx. 368 kb) may contain a DNA sequence that is responsible for the difference in pathogenicity on sweet pepper between the parental strains HR26 and GR12.\u003c/p\u003e\n\u003cp\u003eIn this study, we generated stable genetic recombinants between two strains of the asexual fungus \u003cem\u003eV. dahliae\u003c/em\u003e. In the PCR assays using codominant DNA markers (Fig. 1, Table 3), we observed no recombinants with two bands amplified from the genomic sequences of both parental strains. This indicates that the process of haploidization after karyogamy in the parasexual cycle was nearly complete in each recombinant. Furthermore, using genomic Southern hybridization with a telomeric sequence probe, Usami et al. (2020) confirmed that recombinants can easily haploidize during parasexual recombination; our results are consistent with this report. Next, we successfully identified a genomic locus linked to the pathogenicity on sweet pepper by performing genetic recombination between the strains that differ in pathogenicity.\u003c/p\u003e\n\u003cp\u003eO\u0026rsquo;Garro and Clarkson (1992) performed parasexual recombination between different strains of \u003cem\u003eV. dahliae\u003c/em\u003e that were both pathogenic on tomato. In their experiments, fungal virulence on tomato appeared to be controlled polygenetically.\u0026nbsp;In contrast, the results of this study and some previous studies (McGeary and Hastie 1982; Usami et al. 2020) showed that recombinants were divided equally into pathogenic (or highly virulent) and nonpathogenic (or low virulent) isolates. In these cases, differences in pathogenicity or virulence between parental strains used for genetic recombination may be controlled by a single gene or by a small number of genes. In \u003cem\u003eV. dahliae\u003c/em\u003e, two \u003cem\u003eAvr\u003c/em\u003e genes, i.e., \u003cem\u003eVdAve1\u003c/em\u003e (de Jonge et al. 2012) and \u003cem\u003eAv2\u003c/em\u003e (Chavarro-Carrero et al. 2021), have been identified; these genes determine avirulence in interactions between fungal races and tomato cultivars. Moreover, various effectors associated with pathogenicity and virulence have also been identified\u0026nbsp;(Yang et al. 2025). However, the specific genetic factors that are responsible for host range differences among strains remain unelucidated. Effectors involved in host-specific pathogenicity (Li et al. 2020) are possible candidates for these genetic factors. In addition, avirulence genes that determine incompatibility with plant species (Inoue et al. 2017;\u0026nbsp;Bourras et al. 2019) are also possible candidates. Further investigation is required to investigate the genes that are located in the genomic region identified in this study and involved in host determination. We anticipate that such findings may help us to elucidate the mechanisms responsible for host specificity of \u003cem\u003eV. dahliae\u003c/em\u003e strains.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by JSPS KAKENHI grant numbers JP15K07309, JP18K05641,\u0026nbsp;JP21K05594, and JP25K09118.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompliance with ethical standards\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflicts of interest related to this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman and animal rights statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo human participants or animals were used in this study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAlmany GR, De Arruda MP, Arthofer W, Atallah ZK, Beissinger SR et al (2009) Permanent genetic resources added to molecular ecology resources database 1 May 2009\u0026ndash;31 July 2009. Mol Ecol Resour 9:1460\u0026ndash;1466 https://doi.org/10.1111/j.1755-0998.2009.02759.x\u003c/li\u003e\n \u003cli\u003eBhat RG, Subbarao\u0026nbsp;KV (1999) Host range specificity in \u003cem\u003eVerticillium dahliae\u003c/em\u003e. Phytopathology 89:1218\u0026ndash;1225 https://doi.org/10.1094/PHYTO.1999.89.12.1218\u003c/li\u003e\n \u003cli\u003eBhat R, Smith R, Koike S, Wu B, Subbarao K (2003) Characterization of \u003cem\u003eVerticillium dahliae\u003c/em\u003e isolates and wilt epidemics of pepper. Plant Dis 87:789\u0026ndash;797 https://doi.org/10.1094/PDIS.2003.87.7.789\u003c/li\u003e\n \u003cli\u003eBourras S, Kunz L, Xue M, Praz CR, M\u0026uuml;ller MC, K\u0026auml;lin C, Schl\u0026auml;fli M, Ackermann P, Fl\u0026uuml;ckiger S, Parlange F, Menardo F, Schaefer LK, Ben-David R, Roffler S, Oberhaensli S, Widrig V, Lindner S, Isaksson J, Wicker T, Yu D, Keller B (2019) The \u003cem\u003eAvrPm3-Pm3\u003c/em\u003e effector-NLR interactions control both race-specific resistance and host-specificity of cereal mildews on wheat. Nat Commun 10:2292 https://doi.org/10.1038/s41467-019-10274-1\u003c/li\u003e\n \u003cli\u003eChavarro-Carrero EA, Vermeulen JP, Torres DE, Usami T, Schouten HJ, Bai Y, Seidl MF, Thomma BPHJ (2021) Comparative genomics reveals the in planta-secreted \u003cem\u003eVerticillium dahliae\u003c/em\u003e Av2 effector protein recognized in tomato plants that carry the \u003cem\u003eV2\u003c/em\u003e resistance locus. Environ Microbiol 23:1941\u0026ndash;1958 https://doi.org/10.1111/1462-2920.15288\u003c/li\u003e\n \u003cli\u003eClarkson JM, Heale JB (1985) Heterokaryon compatibility and genetic recombination within a host plant between hop wilt isolates of \u003cem\u003eVerticillium albo-atrum\u003c/em\u003e. Plant Pathol 34:129\u0026ndash;138 https://doi.org/10.1111/j.1365-3059.1985.tb02769.x\u003c/li\u003e\n \u003cli\u003ede Jonge R, van Esse HP, Maruthachalam K, Bolton MD, Santhanam P, Saber MK, Zhang Z, Usami T, Lievens B, Subbarao KV, Thomma BPHJ (2012) Tomato immune receptor Ve1 recognizes effector of multiple tomato fungal pathogens uncovered by genome and RNA sequencing. Proc Natl Acad Sci USA 109:5110\u0026ndash;5115 https://doi.org/10.1073/pnas.1119623109\u003c/li\u003e\n \u003cli\u003ede Jonge R, Bolton MD, Kombrink A, van den Berg GCM, Yadeta KA, Thomma BPHJ (2013) Extensive chromosomal reshuffling drives evolution of virulence in an asexual pathogen. Genome Res 23:1271\u0026ndash;1282 http://www.genome.org/cgi/doi/10.1101/gr.152660.112\u003c/li\u003e\n \u003cli\u003eFradin EF, Thomma BPHJ (2006) Physiology and molecular aspects of Verticillium wilt diseases caused by \u003cem\u003eV. dahliae\u003c/em\u003e and \u003cem\u003eV. alboatrum\u003c/em\u003e. Mol Plant Pathol 7:71\u0026ndash;86 https://doi.org/10.1111/j.1364-3703.2006.00323.x\u003c/li\u003e\n \u003cli\u003eHastie AC (1964) The parasexual cycle in \u003cem\u003eVerticillium albo-atrum\u003c/em\u003e. Genet Res 5:305\u0026ndash;315 https://doi.org/10.1017/S0016672300001245\u003c/li\u003e\n \u003cli\u003eInderbitzin P, Subbarao KV (2014) \u003cem\u003eVerticillium\u003c/em\u003e systematics and evolution: how confusion impedes Verticillium wilt management and how to resolve it. Phytopathology 104:564\u0026ndash;574 https://doi.org/10.1094/PHYTO-11-13-0315-IA\u003c/li\u003e\n \u003cli\u003eInoue Y, Vy TTP, Yoshida K, Asano H, Mitsuoka C, Asuke S, Anh VL, Cumagun CJR, Chuma I, Terauchi R, Kato K, Mitchell T, Valent B, Farman M, Tosa Y (2017) Evolution of the wheat blast fungus through functional losses in a host specificity determinant. Science 357:80\u0026ndash;83 https://doi.org/10.1126/science.aam9654\u003c/li\u003e\n \u003cli\u003eLi J, Cornelissen B, Rep M (2020) Host-specificity factors in plant pathogenic fungi. Fungal Genet Biol 144:103447 https://doi.org/10.1016/j.fgb.2020.103447.\u003c/li\u003e\n \u003cli\u003eMcGeary FM, Hastie AC (1982) Hybridization of \u003cem\u003eVerticillium albo-atrum\u003c/em\u003e strains from tomato and lucerne. Physiol Plant Pathol 21:437\u0026ndash;444 https://doi.org/10.1016/0048-4059(82)90077-7\u003c/li\u003e\n \u003cli\u003eO\u0026rsquo;Garro LW, Clarkson JM (1992) Variation for pathogenicity on tomato among parasexual recombinants of \u003cem\u003eVerticillium dahliae\u003c/em\u003e. Plant Pathol 41:141\u0026ndash;147 https://doi.org/10.1111/j.1365-3059.1992.tb02331.x\u003c/li\u003e\n \u003cli\u003ePegg GF, Brady BL (2002)\u0026nbsp;\u003cem\u003eVerticillium\u003c/em\u003e wilts. CAB International, Wallingford, UK https://www.cabidigitallibrary.org/doi/book/10.1079/9780851995298.0000\u003c/li\u003e\n \u003cli\u003eSeidl MF, Kramer HM, Cook DE, Fiorin GL, van den Berg GCM, Faino L, Thomma BPHJ (2020) Repetitive elements contribute to the diversity and evolution of centromeres in the fungal genus \u003cem\u003eVerticillium\u003c/em\u003e. mBio 11:e01714\u0026shy;-20 https://doi.org/10.1128/mbio.01714-20\u003c/li\u003e\n \u003cli\u003eTsror L, Erlich O, Amitai S, Hazanovsky M (1998) Verticillium wilt of paprika caused by a highly virulent isolate of \u003cem\u003eVerticillium dahliae\u003c/em\u003e. Plant Dis 82:437\u0026ndash;439 https://doi.org/10.1094/PDIS.1998.82.4.437\u003c/li\u003e\n \u003cli\u003eTypas MA, Heale JB (1978) Heterozygous diploid analyses via the parasexual cycle and a cytoplasmic pattern of inheritance in \u003cem\u003eVerticillium\u003c/em\u003e spp. Genet Res 31:131\u0026ndash;144 https://doi.org/10.1017/S0016672300017894\u003c/li\u003e\n \u003cli\u003eUsami T, Amemiya Y (2005) Genetic recombination between two pathotypes of \u003cem\u003eVerticillium dahliae\u003c/em\u003e (in Japanese with English abstract). Jpn J Phytopathol 71:319\u0026ndash;325 https://doi.org/10.3186/jjphytopath.71.319\u003c/li\u003e\n \u003cli\u003eUsami T, Abiko M, Shishido M, Amemiya Y (2002) Specific detection of tomato pathotype of \u003cem\u003eVerticillium dahliae\u0026nbsp;\u003c/em\u003eby PCR assays. J Gen Plant Pathol 68:134\u0026ndash;140 https://doi.org/10.1007/PL00013066\u003c/li\u003e\n \u003cli\u003eUsami T, Iida N, Nakao K, Hamano A, Suzuki N, Ohmura, Y, Komiya Y (2020) Identifcation of the chromosome region responsible for pathogenicity of \u003cem\u003eVerticillium dahliae\u003c/em\u003e on tomato using genetic recombination through protoplast fusion. J Gen Plant Pathol 86:477\u0026ndash;485\u0026nbsp;https://doi.org/10.1007/s10327-020-00955-x\u003c/li\u003e\n \u003cli\u003eUsami T, Ishigaki S, Takashina H, Matsubara Y, Amemiya Y (2007) Cloning of DNA fragments specific to the pathotype and race of \u003cem\u003eVerticillium dahliae\u003c/em\u003e. J Gen Plant Pathol 73:89\u0026ndash;95 https://doi.org/10.1007/s10327-006-0334-4\u003c/li\u003e\n \u003cli\u003eWilhelm S (1955) Longevity of the Verticillium wilt fungus in the laboratory and field. Phytopathology 45:180\u0026ndash;181\u003c/li\u003e\n \u003cli\u003eYang L, Fu T, Sha R, Wei G, Shen Y, Jiao Z, Li B (2025) Role of \u003cem\u003eVerticillium dahliae\u003c/em\u003e effectors in interaction with cotton plants. Phytopathol Res 7:1 https://doi.org/10.1186/s42483-024-00288-z\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 to 3 are available in the Supplementary Files section\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-general-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jgpp","sideBox":"Learn more about [Journal of General Plant Pathology](http://link.springer.com/journal/10327)","snPcode":"10327","submissionUrl":"https://www.editorialmanager.com/jgpp/default2.aspx","title":"Journal of General Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Capsicum annuum, Parasexual recombination, Protoplast fusion, Verticillium wilt ","lastPublishedDoi":"10.21203/rs.3.rs-7033374/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7033374/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAlthough the host range of vascular wilt pathogen \u003cem\u003eVerticillium dahliae\u003c/em\u003e can vary among strains, the host-determining mechanisms involved remain unclear. We aimed to identify the genomic region involved in the pathogenicity on sweet pepper using parasexual recombination between pathogenic and nonpathogenic strains, HR26 and GR12. The recombinants were analyzed by codominant DNA markers capable of distinguishing the genomic sequence of each parental strain. This assay identified DNA markers on a genetic locus on the short arm of chromosome 3 of the \u003cem\u003eV. dahliae\u003c/em\u003e reference strain JR2 that was linked to pathogenicity of parental and recombinant strains on sweet pepper.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e","manuscriptTitle":"Identification of a genomic locus of Verticillium dahliae linked to pathogenicity on sweet pepper","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-15 09:25:24","doi":"10.21203/rs.3.rs-7033374/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-07-11T02:20:30+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-11T02:17:23+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-03T07:17:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of General Plant Pathology","date":"2025-07-02T22:17:22+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-general-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jgpp","sideBox":"Learn more about [Journal of General Plant Pathology](http://link.springer.com/journal/10327)","snPcode":"10327","submissionUrl":"https://www.editorialmanager.com/jgpp/default2.aspx","title":"Journal of General Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"3193e1ba-d848-4d90-af9c-ef50d559f9ca","owner":[],"postedDate":"July 15th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-09-22T15:59:18+00:00","versionOfRecord":{"articleIdentity":"rs-7033374","link":"https://doi.org/10.1007/s10327-025-01252-1","journal":{"identity":"journal-of-general-plant-pathology","isVorOnly":false,"title":"Journal of General Plant Pathology"},"publishedOn":"2025-09-19 15:57:22","publishedOnDateReadable":"September 19th, 2025"},"versionCreatedAt":"2025-07-15 09:25:24","video":"","vorDoi":"10.1007/s10327-025-01252-1","vorDoiUrl":"https://doi.org/10.1007/s10327-025-01252-1","workflowStages":[]},"version":"v1","identity":"rs-7033374","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7033374","identity":"rs-7033374","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00