Full text
64,234 characters
· extracted from
preprint-html
· click to expand
OsPIP2;1 impacts root hydraulic conductance and is a candidate gene for a drought avoidance QTL on rice chromosome 7. | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 5 June 2025 V1 Latest version Share on OsPIP2;1 impacts root hydraulic conductance and is a candidate gene for a drought avoidance QTL on rice chromosome 7. Authors : Zainab Abubakar , Farkhanda Khowaja S , Tapash Dasgupta , Delphine Mieulet , emmanuel guiderdoni , Gareth Norton , and Adam H. Price 0000-0003-3094-0485 [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.174910932.26184078/v1 197 views 114 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Mapping drought avoidance qualitative trait loci (QTLs) in the Bala x Azucena population has revealed a locus on chromosome 7 where the Azucena allele increases leaf rolling but reduces leaf drying. A cluster of four aquaporin genes OsPIP2;1 , OsPIP2;4, OsPIP2;5 , OsPIP2;9 co-locate with this QTL. The hypothesis that this gene cluster and the QTL are functionally related was tested, assuming that aquaporin would be linked to drought avoidance via an impact on root hydraulic conductance. Bioinformatic analysis reveals that Bala has relatively rare haplotypes for each of these genes that are associated with the aus subgroup of rice, and it shares these with the aus cultivar N22 which was one of the two parents in its breeding. A novel technique for assessing root hydraulic flow using osmotic swelling of roots was developed. When paired near isogenic lines for the QTL were grown in the same pot, allelic variation in root hydraulic flow and conductance was revealed using the osmotic method and a purpose-built two-plant pressure chamber. Notably, the allelic difference in hydraulic flow/conductance was only strongly evident when plants were droughted. RNAi lines with reduced expression of OsPIP2;1 were identified which had a commensurate reduction in root hydraulic flow and conductance. These studies confirm the role of OsPIP2:1 in root hydraulic flow in rice, and highlight the presence of aus-specific allelic variation that appears to impact root hydraulic conductance and drought avoidance in rice. OsPIP2;1 impacts root hydraulic conductance and is a candidate gene for a drought avoidance QTL on rice chromosome 7. Zainab Abubakar *1,4 , Farkhanda S Khowaja *1,5 , Tapash Dasgupta 1,6 , Delphine Mieulet 2,3,7 Emmanuel Guiderdoni 2,3 , Gareth J Norton 1 , Adam H Price 1 . For Plant Cell and Environment?? 1 School of Biological Sciences, University of Aberdeen, AB24 3SZ 2 CIRAD, UMR AGAP Institut, F-34398 Montpellier, France 3 University of Montpellier, CIRAD-INRAE-Institut Agro, University of Montpellier, Montpellier, France Current address 4 Department of Biological Sciences, Gombe State University, P.M.B 127, Nigeria (deceased). 5 308 - 7445 120 Street, Delta, BC, V4C 0B3, Canada 6 School of Agriculture and Rural Development, Ramakrishna Mission Vivekananda University Kolkata 7000103, West Bengal, India 7 CIRAD, UMR DIADE, 911 Avenue Agropolis, BP 64501, 34394 Montpellier, France * ZA and FSK are joint first authors Abstract Mapping drought avoidance qualitative trait loci (QTLs) in the Bala x Azucena population has revealed a locus on chromosome 7 where the Azucena allele increases leaf rolling but reduces leaf drying. A cluster of four aquaporin genes OsPIP2;1 , OsPIP2;4, OsPIP2;5 , OsPIP2;9 co-locate with this QTL. The hypothesis that this gene cluster and the QTL are functionally related was tested, assuming that aquaporin would be linked to drought avoidance via an impact on root hydraulic conductance. Bioinformatic analysis reveals that Bala has relatively rare haplotypes for each of these genes that are associated with the aus subgroup of rice, and it shares these with the aus cultivar N22 which was one of the two parents in its breeding. A novel technique for assessing root hydraulic flow using osmotic swelling of roots was developed. When paired near isogenic lines for the QTL were grown in the same pot, allelic variation in root hydraulic flow and conductance was revealed using the osmotic method and a purpose-built two-plant pressure chamber. Notably, the allelic difference in hydraulic flow/conductance was only strongly evident when plants were droughted. RNAi lines with reduced expression of OsPIP2;1 were identified which had a commensurate reduction in root hydraulic flow and conductance. These studies confirm the role of OsPIP2:1 in root hydraulic flow in rice, and highlight the presence of aus-specific allelic variation that appears to impact root hydraulic conductance and drought avoidance in rice. Keywords Aquaporin; drought; OsPIP2:1; Oryza sativa; hydraulic conductance; RNAi Introduction As with many crops, drought is considered one of the most important abiotic constraints on productivity of rice. For example, almost half of the 52 million hectares of rainfed lowland rice is considered drought prone (Serraj et al., 2011). The importance of drought has prompted research on genetic mapping of loci that determine cultivar differences in performance under drought, with these featuring among the first applications of the earliest rice mapping populations (Champoux et al., 1995, Yadav et al., 1997). The cultivar Azucena is a Philippines landrace with deep roots from the tropical japonica subgroup while Bala is an improved variety bred in India for drought resistance from the indica cultivar TN1 and the well-studied drought and heat resistant aus cultivar N22 (ref). The Bala x Azucena mapping population has been tested for drought in the field in the Philippines and the Cote D’Ivoire (Price et al., 2002) revealing several notable loci. The results from that study plus further field drought experiments on the population (in the Philippines (Lafitte et al., 2004) and Tamil Nadu, India (Gomez et al., 2006)) formed a part of a meta-analysis of QTLs in the Bala x Azucena population (Khowaja et al., 2009). In that analysis, eight independent drought screens of the population were used to locate some loci of particular note for drought avoidance. Of these, one included a region on chromosome 7 at 50.5 cM, with a 10 cM confidence interval. The physical position of the locus is approximately 15.0 Mbp. A curious feature of this locus, however, that distinguishes it from the other drought avoidance loci detected in this population is the observation that the direction of some trait effects seems to contradict others. This is clearly seen in the Price et al., (2002) study where the Azucena allele here increased leaf rolling (indicative of increased drought stress), but decreased leaf drying, probably a better indication of drought-induced physiological harm (Price et al. 2002). This opposition of allelic effects suggests this locus reflects an underlying difference in plant physiology that impacts on the traits measured. Yield QTLs were detected here but they are of conflicting direction depending on conditions, such that the Azucena allele increased yield in two drought screens but decreased yield in another two (Khowaja et al. 2009). The confidence interval revealed by meta-analysis of QTLs in this region (Khowaja et al., 2009) covers 406 genes in the Nipponbare annotated reference (on the Rice Genome Annotation Project, http://rice.plantbiology.msu.edu), including 241 that are not mobile elements (29 annotated as hypothetical and 93 annotated as expressed). Most notable in this region is a cluster of four genes annotated as aquaporins; LOC_Os07g26630, 40, 60 and 90. These four genes are located between 15.35 and 15.41 Mbp on chromosome 7. Three of these have been characterised; OsPIP2;1 (LOC_Os07g26690), OsPIP2;4 (LOC_Os07g26630) and OsPIP2;5 (LOC_Os07g26660) (Sakurai et al. 2005). LOC_Os07g26640 is not homologous to the well characterised PIPs of rice (as presented by Sakuri et al., 2005) and in MSU annotation it has no full length cDNA or EST homology suggesting it might be a pseudogene. A recent review of aquaporins (Sun et al. 2024) does not mention this gene. However, in the Rice Annotation Project annotation (https://rapdb.dna.affrc.go.jp) (Os07g0448200) there is expression evidence from roots that is labelled OsPIP2;9 while this gene is not described in literature. Aquaporins are a ubiquitous and extensively studied family of proteins that form membrane pores which facilitate the transmembrane movement of water and some other small molecules (Chaumont and Tyerman 2014). Aquaporins have a special role in plants because of the critical role that water plays in the regulation of plant physiology, including the conductivity of the plant and its differentiated tissues to water (Chaumont and Tyerman 2014). Variation in hydraulic conductance has been suggested as a key component in determining adaptation to drought in chickpea (Sivasakthi et al. 2017) and mulberry (Reddy et al. 2017) and in both cases aquaporins have been implicated. In 2005 the study of Sakurai et al., (2005) identified 33 aquaporins in rice which includes a subfamily of 11 plasma membrane intrinsic proteins (PIPs). It is these PIPs that are thought to be primarily related to plant water relations and are further subdivided into three genes in the PIP1 family ( PIP1;1 , PIP1;2 and PIP1;3 ) and eight genes in the PIP2 family ( PIP2;1 … PIP2;8 ). The functional role of each of these genes has been studied (Sakurai et al., 2005, 2008, Sakurai- Ishikawa 2011). Those studies on the Japanese rice cultivar Akitakomachi reveal that OsPIP2;1 is heavily expressed in roots and moderately expressed in shoots and is less diurnally regulated than most PIPs (2-3 fold higher in day than night), while OsPIP2;4 and OsPIP2;5 are predominantly expressed in roots and are substantially diurnally regulated (28 and 145 fold higher in day than night respectively) (Sakurai- Ishikawa et al. 2011). Sakurai-Ishikawa et al., (2011) also suggest that, while OsPIP2;4 and OsPIP2;5 expression is also regulated by transpiration demand, OsPIP2;1 is not. Importantly, OsPIP2;1 is the most expressed PIP in rice roots, with expression levels of OsPIP2;4 and OsPIP2;5 very much lower, even at midday (Sakurai-Ishikawa et al., 2011). The same study indicates that in the root both PIP2;1 and PIP2;5 are heavily expressed in the endodermis where their influence on whole-root water movement can be speculated to be greatest. Recently, OsPIP2;1 was targeted for RNAi downregulation by Ding et al., (2019) because it was demonstrated to be highly effective in water transport when expressed in yeast (compared to six other PIPs) and because of previous studies linking it or its ortholog to plant water relations. The authors demonstrated a four-fold reduction in rice root hydraulic conductance and increased sensitively to PEG-induced drought stress when expression of PIP2;1 was reduced by 50-70%. Given the central role of aquaporins in the regulation of water movement in rice, these genes ( OsPIP2;1 , OsPIP2;4 , OsPIP2;5 and OsPIP2;9 ) are considered excellent functional positional candidate genes for the drought QTL on chromosome 7 in the Bala x Azucena mapping population. We hypothesise that variation in root hydraulic conductance, controlled by the cluster of PIP genes, is the mechanism behind the drought avoidance QTLs detected on chromosome 7. It could be hypothesised that an allele with lower conductance (if water supply to the shoot was slower than demand) would induce greater leaf rolling but might provide a protection against leaf drying if it allowed the provision of water for an extended period during the drought period (i.e. if low root hydraulic conductance promoted a conservative use of soil water resources). Using available genome sequence and transcriptomic data, near isogenic lines derived from the Bala x Azucena population and novel RNAi lines for PIP2;1 , this study aimed to test the candidacy of these genes. Specifically it aimed to show; i) there is allelic variation between Bala and Azucena in OsPIP2;1 , OsPIP2;4 , OsPIP2;5 and PIP2;9 ; sufficient to support the candidacy of these genes, ii) that natural allelic variation in this region affects plant water relations and root hydraulic conductance and iii) that this natural variation can be phenocopied by using RNAi to reduce the expression of OsPIP2;1 . In order to do that we have developed a simple novel method for assessing hydraulic flow in roots. 2 Methods Bioinformatics in OsPIP2;1 , OsPIP2;4 , OsPIP2;5 and OsPIP2;9 not-yet-known not-yet-known not-yet-known unknown Azucena and Bala genome sequence is available (data have been deposited in the NCBI Short Read Archive Acc_ID SRX9735769 (Azucena) and SRX128324 (Bala)). The spacio-temporal display of RiceXPro (Sato et al., 2011) was used to reveal the tissue specificity of expression of the PIPs in Nipponbare. Affymetrix array data available for expression of Azucena and Bala in hydroponic rice roots (Norton et al. 2008; NCBI GEO series GSE4471) or in leaves under control and drought (Norton et al., 2010, NCBI GEO Series GSE24048). Haplotype variation in the 4 genes was examined using RiceVarMapv2.0 (Zhao et al., 2015) which contains sequence data for Azucena, Bala and the parents used to breed Bala (TN1 and N22). In OsPIP2;1 the Nipponbare and Azucena sequence but not the Bala sequence, has 100% sequence homology to a microRNA osa-miR1436 identified by Sunkar et al., (2008). This site appears missing in Bala because of a 238 bp deletion in the 3’ UTR. This indel was surveyed using PCR primers CATCGCGGCGTTCTACCACCAGTA and TGGAAACTTGGAACCCCAGCAGTAGC (which gives a 859 or 618 bp products) in the Rice Diversity Panel 1 (Zhao et al. 2011) where the deletion has the following frequencies among the subgroups; Aus = 90%, Indica = 88%, Tropical Japonica = 74% and Temperate Japonica = 20%. not-yet-known not-yet-known not-yet-known unknown Development of recombinant inbred near isogenic lines (RINILs) In order to generate near isogenic lines, residual heterozygousity in the Bala x Azucena recombinant inbred line (RIL) population was exploited. Since the population was developed from seed collected from F5 plants (Price et al. 2000) each RIL has an expected 6.25% heterzygousity remaining. Examining the 165 markers used to genotype the population, one of the RILs was selected as it was heterozygous for four markers on chromosome 7 (G338 38.6 cM; C39 42.8 cM; R1440 52.3 cM and G20 54.7 cM) representing a 10.4 Mbp region around the centromere (from 7.1 to 17.5 Mbp). This RIL was also heterozygous for non-target markers G39, RG139, RM221 and RM6 covering a 24 cM (2.6 Mbp) region of chromosome 2 and single markers G187 on chromosome 8, R79 on chromosome 9 and C223 on chromosome 10. From this line recombinant inbred near isogenic lines (RINILs) were produced through two phases of selfing to reduce the chance of segregation at non-target regions. In the first phase, plants were selected as heterozygous for marker RM214 (12.78 Mbp on chromosome 7), seeds collected and sown and then in the second phase they were selected with the same maker to be homozygous for Azucena or Bala. A further marker AB0702 (also named “PIP” in genetic maps of Bala x Azucena) was used which targets a 7 bp insertion within the OsPIP2;1 gene in indica accession Pin Gaew 56 (Malz and Sauter 1999) relative to Nipponbare. The primers were forward 5’ CTTCGCCGTGTTCATGGT 3’ and reverse 5’ CTCCTGCTTGTCGTGTGTGT 3’. The 7 bp size polymorphism was detected with high resolution agarose electrophoresis. Development of RNAi lines In order to down-regulate OsPIP2;1 (Os07g26690) in cv. Azucena, two artificial micro-RNAs (amiRNA) T-DNA constructs (TD3C8 and TD4C8) were prepared. Using the MicroRNA designer website WMD3, two 21-bp miRNA sequences were selected on the basis of an unique AAGACACATACATTCTACTAC site in the coding sequence of OsPIP2;1 , for targeting RNAi of OsPIP2;1 transcripts. The two identified 21-mers differed by a single nucleotide change in position 1 while the miRNA* sequences differed from the miRNA sequence by changes of nucleotides in positions 12 and 16, creating mismatches in the amiRNA folded structure that triggers the RNA interference process. These miRNA and miRNA* sequences were used to replace by modification PCR the endogenous miRNA and miRNA* of the rice miRNA precursor osa-MiR528. The final PCR fragment of the modified precursor with flanking attB1 and attB2 sites was inserted by BP cloning into the attP1 and attP2 sites and placed under the control of the maize ubiquitin promoter and the tnos terminator in the pNW55/pCambia 5300 plasmid (Warthmann et al. 2008), according to a procedure similar to that detailed in Koegel et al 2017. The two constructs were mobilized in an EHA 105 Agrobacterium strain suspension that was used for co-culture with Azucena mature seed embryo-derived calli. Procedures for deriving hygromycin-resistant cell lines and regenerating primary transformants followed those of Sallaud et al 2003. Copy number of the transgene was assessed using RT-PCR in the T0 plants. For each of the TD3C8 and TD4C8, up to 10 T1 seeds of eight independent T0 plants (regenerated from independent co-cultured calli) were grown in hydroponics and assessed for expression of PIP2.1 using RT-PCR with primers CCGCTGGTCGTTTTGTTTC and TACAGGCTAAACACATGAGACATCC using three technical replicates. For both TC3C8 and TD4C8, a pair of plants from the same T1 seed (i.e. coming from same T0 plant) contrasting for expression were grown for T2 seeds (see supplementary methods). These were designated TD3C8 5.1/E (low expression), TD3C8 5.1/I (high expression), TD4C8 1.2/G (low expression) and TD4C8 1.2/I (high expression of PIP2.1 ). To clarify the nomenclature, TD stands for the Tapash Dasgupta who designed the constructs and made the transgenics, the number 3 or 4 refers to the 21mer used, the C8 refers to the genotype transformed (Azucena in this case), the number after the – indicates the T0 plant (the callus) it comes from (i.e. the original seed packet) and the letter after the number is individual T1 plant number selected based on RT-PCR results. Hydraulic flow of root pieces The traditional method of measuring hydraulic conductance using a pressure chamber is very time consuming, so a new rapid method of measuring hydraulic flow was developed. This method uses the rate of osmotic expansion when root pieced swell after they have been osmotically shrunken and then placed in water. Root tips were carefully cut from plants soil removed. Root thickness was measured using a dissection microscope with eyepiece graticule and then the cut end was sealed with superglue before being treated with plasmolysis solution, 1M D-Sorbitol and 1 mM CaCl 2 , for several minutes. The roots were removed from the solution and root thickness was quickly measured again as time zero. Deionized distilled was gently added to the samples and the diameter recorded at every 5 s. Hydraulic flow was calculated from the initial slope of the plot of diameter against time with the diameter at time zero being used to calculate the surface area and volume. To demonstrate that the flow rate into the roots was through aquaporins, 0.5 mM HgCl (as used in Maggio and Joly 1995) was included in all solutions for six replicates, which resulted in an 74% reduction in flow rate (P = 0.001). Root hydraulic conductance of RINILs using the pressure chamber and osmotic swelling Experiments were conducted using 18 cm tall, 10 cm diameter tubes filled to a dry bulk density of 1.1 g cm -1 with subsoil from an Insch soil association (a sandy loam pH 5.5 as described in MacMillan et al. (2006)) that had been air-dried to 10% gravimetric water content (GWC) and then wetted to 21% gravimetric water content (GWC) using 25 x strength Yoshida’s nutrient solution (Yoshida et al. 1976) and then sieved to 2 mm. In each pot two small holes were made 5 cm apart and into each was sown 2 seeds of one or the other RINILs. After germination the seeds in each hole were thinned so that the pot contained one plant of both RINILs 5 cm apart (Figure 2 a). Plants were grown aerobically in a greenhouse, with a day/night temperature of 30/25 o C and a relative humidity of ~70% with 12 hrs supplementary light of 100 µmol m 2 s -1 PAR. For the first three weeks the GWC was maintained at 21% by weighing. After that, half of the pots were subjected to a drought by reducing the GWC to 10% (approximately -600 KPa matric suction in this soil) for a further three weeks. It took six days to reach the target weights which were then maintained by weighing. Hydraulic conductance was measured simultaneously on both plants in a pot using a specially designed pressure chamber with a two-holed lid. The plant pot was immersed in water at least one hour before measurement and excess water was drained from the soil through the bottom of tube. All lateral tillers were cut off below the level of the lid of pressure chamber, leaving only the main stem above the level of the lid. The gap between the main stems and the walls of the lid surrounding the main stem in the holes were tightly sealed using the bungs made of silicon rubber dental impression material (Blend-a-med Forschung, Schwalbach, Germany or Affinis Perfect Impressions REF 6610, Colten/Whaldent AG, Switzerland). The hydrostatic pressure in the chamber was raised in steps of 0.2 MPa from 0.3 up to 1.1 MPa above atmospheric. At each pressure the volume of liquid exuded over 10 min period was collected at the cut surface of the main stem of both plants simultaneously (Figure 1b). Transverse sections of the stem taken on several stems after measurements indicated no damage to xylem. After measuring hydraulic flow, roots were washed, separated and root surface area was measured by computerised scanning using an image analysis system (WinRHIZO; Regent Instrument). The gradient of the flow rate to the pressure was used to calculate the hydraulic conductance by dividing by the root surface area. Finally, dry weights of roots were recorded. A strong correlation between root surface area and root dry weight measured on 18 plants (r=0.867) indicated that in future, root dry weight could be used to assess root surface area using the equation; root surface area (m 2 ) = 4.76 x 10 -5 root dry weight (g) + 0.00217. Additional experiments using methods described were conducted where instead of the pressure chamber, the root osmotic swelling method was used to assess hydraulic flow. To test the impact of mild drought, an experiment was conducted using the same conditions as above except the pots had a 9.5 cm diameter (and contained 1.1 l of the same soil at 1.1 g/l dry bulk density) but after three weeks well watered, three treatments were applied; 21% (control), 13% (mild drought) and 10% (severe drought) GWC water treatments for three weeks. It took 14 and 16 days to gradually reach the 13% and 10% target GWCs (respectively). They were harvested at 8 weeks when relative water content was assessed on the youngest fully expanded leaf while root and shoot length and mass were assessed. Hydraulic flow was assess osmotically on cut root tips. Assessment of OsPIP2;1 gene expression and hydraulic flow in hydroponically grown RNAi lines Three day old germinated seedlings were grown in a hydroponic system essentially the same as described in Price et al. 1997. Briefly, up to 42 plants were sown into plug trays suspended over 45 l tubs containing ½ strength Yoshida’s nutrient solution for the first two weeks, then full strength solution for the final week. Nutrient was replaced every week and pH adjusted to 5.5 every day. Plants were grown in the greenhouse with 100 µmol m 2 s-1 PAR of supplementary light. At harvest, roots were sampled for osmotic assessment of hydraulic conductance in root pieces as described in 2.3 above, and for OsPIP2;1 gene expression. For expression, RNA was extracted using a Qiagen RNeasy Mini Kit. Quantitative real time PCR (qRT-PCR) was conducted on an Opticon DNA Engine 2 (MJ Research, now Bi-Rad) using the DyNamo HS SYBER Green qPCR kit (Thermo Scientific). Primers for PIP2.1 were CCGCTGGTCGTTTTGTTTC and TACAGGCTAAACACATGAGACATCC giving a 119 bp product. Expression was expressed relative to the rice actin (RAC1) control using primers of Sakurai et al., (2005) TGGTCGTACCACAGGTATTGTGTT and AAGGTCGAGACGAAGGATAGCAT which gave a 105 bp product. In all qRT-PCR there were five biological replicates each with three technical replicates. Expression of each gene was calibrated against qRT-PCR conducted on serial dilutions of PCR amplicons of known concentration. not-yet-known not-yet-known not-yet-known unknown Assessment of hydraulic flow using the pressure chamber in soil grown RNAi lines Pots used were 18 cm tall cylinders filled with 1.225 g dry weight (1.1 g/l) of the same subsoil used previously also saturated with Yoshida’s nutrient solution (as described above). In each pot two plants were established, one of both matching pairs of T2 lines generated through the RNAi pipeline (either TD4C8 1.2/G and I or TD3C8 5.1/ E and I) in the greenhouse described above in February and March 2013. These were grown under 21% soil GWC for 3 weeks after which they were subjected to one of three treatments, 21%, 13% or 10% GWC achieved by withholding water essentially as described in 2.6. At six weeks of age (at the end of the third week of the drought treatment) the hydraulic conductivity was assessed as described in 2.5 above. Results Sequence and expression differences between Azucena and Bala . Sequence of Azucena (25x) and Bala (55x) aligned to Nipponbare was examined for the four PIP genes and is summarised in figures 1 (for OsPIP2;1) and supplementary figure 1 (for OsPIP2;4, 5 and 9 ). The Azucena OsPIP2;1 allele has two synonymous SNPs relative to Nipponbare in the first intron while Bala has 25 SNPs with Nipponbare plus four small deletions, a 7 bp and a 1 bp insertion while a 238 bp deletion. This large deletion that includes the sequence of microRNA osa-miR1436 and its presence in Azucena and absence in Bala has been validated using PCR and sequencing PCR products. The deletion removes the last 65 bp of the 3’ UTR (Figure 1a). However, none of these variations (in Azucena or Bala) change the predicted protein sequence. Surveying the frequency of the 238 bp deletion in the Rice Diversity Panel 1 revealed it to be dominant in indica, aus and temperate japonica accessions (88, 90 and 73% of accessions respectively have the deletion) while it was much rarer in tropical japonicas (only 21%). Haplotype variation using RiceVarMap2 revealed one dominant variant in the first exon and Azucena and Bala were the same (Figure 1b). However, analysis of the end of the gene revealed Bala had a rare aus-dominated haplotype while Azucena shared a quite different japonica-dominated haplotype with Nipponbare (figure 1c). Bala has the same allele as its N22 parent while its other parent TN1 has a common, indica-dominated haplotype. Expression data from RiceXPro indicate that OsPIP2;1 is heavily expressed in most tissues but especially in sheaths and roots (figure 1d). Transcriptomics data indicate higher expression in leaves than roots, but do not suggest differences in the expression of OsPIP2;1 between Azucena and Bala (Figure 1e). For OsPIP2;4 the sequence of both Azucena and Bala are very different to Nipponbare with more than 40 SNPs including 11 in the exons, six deletions and three insertions (Supplementary Figure 1a). Importantly, both Bala and Azucena appear to share a very similar allele for this gene although in the 500 bp immediately upstream of the gene, Bala has several SNPs (including within 100 bp) that are not shared with Azucena suggesting the regulation of expression of this genes might be different between Bala and Azucena. Haplotype analysis of the gene indicate that Bala shares a rare aus-dominated haplotype with N22, which is slightly different to the japonica-dominated allele of Azucena (Supplementary Figure 1b) that is very different to that of Nipponbare. The expression of this gene is predominantly in roots according to RiceXPro (Supplementary Figure 1c) which is confirmed in Bala and Azucena (Supplementary Figure1xd) which reveals 10x higher expression in Bala, than Azucena. For OsPIP2;5 Azucena has 7 SNPs with Nipponbare all of which fall in exons (6 in first exon, 1 in last) and two of which are non-synonymous and one (aa18 P Q) causes a change in a conserved region (Supplementary Figure 2a). Bala shares only two of these SNPs but has 2 different SNPs in the first intron, a SNP in the 5’UTR and two in the 3’UTR. Importantly, it has a 33 bp deletion in the 5’UTR. Only one polymorphism is non-synonymous, and is the same as Azucena. It is not the non-synonymous SNP of Azucena that appears to be in a conserved part of the sequence. Azucena has a japonica-dominated haplotype for this gene similar to Nippobare which is quite distinct from that of most indicas while Bala and N22 have a rare, aus-dominate haplotype (Supplementary Figure 2b). Like OsPIP2;4 , this gene appears to be largely root specific as revealed in RiceXPro (Supplementary Figure 2c) and array transcriptomics (Supplementary Figure 2d) while the later do not suggest differences in the expression of OsPIP2;5 between Azucena and Bala. For OsPIP2;9 Azucena has 12 SNPs a 4 bp deletion and two insertions (21 bp and 4 bp) relative to Nipponbare. Bala has all of these polymorphism except one SNP, but has four other SNPs (Supplementary Figure 3a). As with the other PIPs, Bala and N22 share a rare aus-dominate haplotype, while Azucena has one that is similar to the most common and indica dominant haplotype that TN1 has and quite different to the Nipponbare haplotype that is also japonica-dominated (Supplementary figure 3b). The tissue expression pattern of OsPIP2;9 appears almost identical to OsPIP2;4 (Supplementary Figure 3c) but it is not different between Azucena and Bala (Supplementary Figure 3d). Root hydraulic conductance of RINILs Assessing root hydraulic conductance using a pressure chamber reveal variable results between pots but the trait did not differ between water treatments (Figure 2c). The genotypes were not different in root surface area in either treatment (data not shown) or in hydraulic conductivity under control conditions. However, in all but two droughted pots the hydraulic conductivity was higher in the Bala allele than the Azucena allele, and overall this difference was significant at P = 0.006 in paired T test. When using root swelling to assess hydraulic flow, 1 M sorbitol reduced the diameter of control roots by 18-28% (Figure 2e). On rehydration, diameter increases rapidly over the course of about 60 seconds before plateauing. In roots from droughted plants, the magnitude of diameter increase is commonly (but not always) much less than in control plants (Figure 2f), but the time scale over which the diameter increases appears similar. Using the initial slope of the rapid increase in diameter to measure hydraulic flow revealed variation between genotypes only in the droughted treatment (Figure 2d). In the control treatments no genotypic pattern was revealed. In contrast, however, in every droughted pot the hydraulic flow was higher in the Bala RINIL than the Azucena RINIL, and in 6 out of 12 droughted pots the hydraulic flow of the Azucena RINIL was zero. Statistically, the hydraulic flow of droughted Azucena RINILs was lower than Bala RINILs (paired t-test P < 0.001). In order to confirm the observations made on root hydraulic flow in experiments above, the paired RINIIL approach was applied to an experiment with three levels of water treatment. During the water stress treatments, stomatal conductance was measured on day 40, 47 and 54. The treatment reduced conductance but no difference was detected between the RINILs (data not shown). At harvest RWC did not differ between RINILs and was only slightly reduced by the severe stress treatment. Plant dry weight was different between RINILs (figure 3a) being almost significantly (P = 0.077; paired t-test) higher in the Bala RINIL in control conditions and higher (P = 0.003) in the Azucena RINIL in the severe stress. These differences in total plant mass were reflected in both the root and shoot dry weight, while root:shoot ratios did not differ between genotypes (or treatments). The treatments reduced hydraulic flow of root pieces (Figure 3b) (ANOVA P = 0.022) with severe drought lower than controls (Tukey’s test). Across all treatments, root hydraulic flow was significantly lower in the Azucena RINIL than the Bala RINIL (paired t-test for all data P = 0.001), and was lower for the Azucena RINIL in the mild stress alone (P=0.029) and the severe drought (P = 0.020) but the genetic difference was not significant for the control treatment. Gene expression and hydraulic flow in hydroponically grown OsPIP2;1 RNAi lines Because OsPIPs on chromosome 7 were candidate genes for the drought QTL detected there and the genetic differences in root hydraulic conductance measured in near isogenic lines (above), efforts were made to produce RNAi knockdown transgenics of OsPIP2;1 since it is the most highly expressed of the candidate aquaporins. Using quantitative PCR for OsPIP2;1 on the roots of hydroponically-grown plants, two pairs of transgenics either with low or normal OsPIP2;1 expression from two independent transformation were recovered (Figure 4a). The same roots were used to measure root hydraulic flow using the osmotic cut root method and revealed strong genotypic differences of about a 40% reduction in flow which matched the expression pattern of PIP2;1 (Figure 4a). not-yet-known not-yet-known not-yet-known unknown Hydraulic conductance using the pressure chamber in soil grown RNAi lines The same RNAi lines identified in hydroponic above were grown in soil-filled pots for 6 weeks under well-watered conditions and subsequently root hydraulic conductance measured with a pressure chamber using the paired genotype approach used for the RINILs. In every pot, the RNAi line with reduced expression had reduced hydraulic flow, with about a 10% reduction in the TD4C8 1.2pair (Figure 4b; almost significant P = 0.084; paired t-test) and 25% in the TD3C8 5.1 pair (P = 0.015) (Figure 4c). With both pair comparisons combined, the significance of the difference in hydraulic conductance between the high expressing and the low expressing lines was P = 0.004 (paired t-test). Discussion A drought avoidance QTL almost invariably detected around 50 cM of chromosome 7 in the Bala x Azucena mapping population (Khowaja et al., 2009) was notable for the opposing direction of allelic effects for leaf rolling and leaf drying, where the Azucena allele increased leaf rolling and decreased leaf drying (Price et al. 2002). In this genome region there is a cluster of PIP aquaporins allowing a hypothesis to be formulated that theorises they are functional candidate genes for the QTL. The logic was, (i) allelic variation in aquaporins in this location altered root hydraulic conductance, (ii) the reduced hydraulic flow of one allele might lead to higher leaf rolling when the plant was under drought stress (because of a greater difference in transpiration demand and root supply of water), (iii) but it would results in reduced leaf drying (which occurs after rolling) because of a more conservative use of water. If true, the direction of allelic effects in leaf rolling and leaf drying traits suggested that the Azucena allele should be the one that is more conservative in water use, and hence the allele with lower hydraulic conductance, at least under drought. The four genes annotated as aquaporin above the QTL are OsPIP2;1 , OsPIP2;4 , OsPIP2;5 and OsPIP2;9 . All of the PIPs are considered to function in the hydraulic flow in plants (although no direct evidence for OsPIP2;9 currently exists) but determining a relative importance of each is complicated by the way their basic property (water flow) is regulated by expression, cellular trafficking, heterotetramer formation and gating (Chaumont and Tyerman 2014). Examination of Bala and Azucena sequence data suggests there may be important variation between Bala and Azucena in all of them. For OsPIP2;1 it is the presence of a large deletion in the 3’UTR which is considered most noteworthy since there is no evidence of non-synonymous polymorphism within the coding region of the gene itself. Of particular interest is the fact that the sequence deleted has a recognition site for a microRNA suggesting that there is allelic variation in the way this gene is trans-regulated. This microRNA (osa-miR1436) has been linked to heat stress response (Mangrauthia et al. 2017). For OsPIP2;4 substantial sequence variation upstream seems to be reflected in differences in expression levels in Azucena and Bala which are easily detected (root expression is 10 lower in Azucena than Bala). For Azucena and Bala, OsPIP2;5 have several polymorphisms, but no evidence of differences in expression. It is a non-synonymous SNP in Azucena in a conserved region of the protein not shared by Bala that is considered the most noteworthy. OsPIP2;9 is considered the least likely causative gene because there is no direct evidence of its function, the sequence polymorphism between Azucena and Bala is limited and their expression seems the same. In order to test physiologically the hypothesis of PIP gene candidacy, near isogenic lines were produced using the residual heterozygousity available in the recombinant inbred lines of the Bala x Azucena population. RINILs differing in this region of chromosome 7 were shown to have altered root hydraulic conductance as measured using a pressure chamber, but only when droughted (Figure 2). There was high variability in hydraulic conductance between replicate pots (as clearly seen in figure 2c), which we speculate relates to interactions between the soil and the root. This makes studying root hydraulic conductance in soil-grown plants difficult. For that reason it was decided to assess the genetic differences using pairs of genotypes in the same pot which was facilitated by a pressure chamber with a double opening. Of critical importance for supporting the candidacy of aquaporins for the drought avoidance QTL, the Azucena allele has reduced hydraulic conductance. matching the hypothesis that original linked PIPs to QTLs for leaf rolling and leaf drying under drought in the field. The pot experiments reported in figure 2c do not reveal an impact of drought on root hydraulic conductance but rather a genotype by drought interaction where the Azucena RINIL had lower hydraulic conductance only under drought. Probably because of the difficulty in measurement, there has been limited studies of root hydraulic conductance in rice in response to drought. However, Grondin et al. (2016), examined the impact of drought stress on six rice cultivars including Azucena, showed a reduction of root hydraulic conductance by 8-70% by drought treatment. Infusing the soil-filled pots with azide to inhibit aquaporins demonstrated that the majority of hydraulic flow was through aquaporins. They also measured root expression of eight PIPs including OsPIP2;1 and OsPIP2;4 . While expression varied considerably between cultivars, in Azucena OsPIP2;4 expression was not detected (confirming the array results in Norton et al. 2008). In general PIP expression was decreased by drought. Henry et al. (2016) has shown that root hydraulic conductance of rice is lowered by drought, differs between rice cultivars and high vapour pressure deficit can reduce it in well-watered plants. Cultivar differences in the expression of OsPIP2;1 and responsiveness to drought have been reported in leaves of mature pot-grown rice plants (Yooyongwech et al., 2013) with cultivar KDML 105 being higher than MT 401 and PT1 under control conditions, and with KDML 105 and PT1 reducing very markedly under drought. Together the research links aquaporin expression and function to root (and perhaps also shoot) hydraulic conductance and drought response in rice. Because measuring hydraulic conductance is time consuming to measure (4 pots in a day in our experiments), a cut root method was developed that used osmotic swelling rate to measure hydraulic flow that was approximately 8 times faster (Figure 2e and f). The demonstration that adding the aquaporin-selective blocker mercury reduced the hydraulic flow by 76% is strong evidence that most of the swelling was from water that passed through an aquaporin. Importantly, using this method clearly revealed differences in trait values (figure 2d) that agree very strongly (in terms of treatment and genotype affects) with the pressure chamber measures of hydraulic conductance (figure 2c). This strongly suggests the root swelling method is a relatively easy measure of root hydraulic properties that should be valuable to the research community especially since it could be speeded up with image capture instrumentation. The authors are not aware of other published reports of using this method. Because of the importance of the observations suggesting that hydraulic conductance differed between RINILs, but only under droughted conditions, the experiments were repeated again but including a mild as well as a severe drought (Figure 4b). This experiment confirmed the genetic difference in osmotically measured hydraulic flow, that was revealed in both mild and severe drought but not well watered conditions. Importantly, the plant growth data of this experiment (Figure 4a) suggested that reduced hydraulic flow improves growth under severe drought, but impairs it under well-watered conditions. The experiments above support the overall hypothesis that allelic variation within PIPs located at 15 Mbp on chromosome 7 are functionally related to the drought QTLs. Given the observations of Sakuari-Ishakawa et al., (2011) of the relative importance of OsPIP2;1 over OsPIP2;4 and OsPIP2;5 based on expression, we focused on altering the expression of OsPIP2;1 using RNAi. We isolated two pairs of transgenics, based on independent transformation events, where one of the pair displayed reduced OsPIP2;1 expression and the other did not (Figure 4a). As expected for RNAi, we did not find knockouts, but rather lines with expression reduced by 35% and 82%. Root hydraulic flow was reduced in the lower-expressing transgenics when grown hydroponically (Figure 4b and c) and showed a clear linear association with OsPIP2:1 expression (Figure 4a). This work confirms that of Ding et al. (2019) who demonstrated 50-70% lower expression of Nippionbare RNAi lines of OsPIP2;1 which had an approximately 80% reduction in root hydraulic conductance. Huang et al., (2021) have created a CRISPR knockout of OsPIP2;1 in Nipponbare. While this did not impact growth under well-watered conditions, they demonstrated a decrease in stomatal conductance. The authors did not measure hydraulic properties of the root or impose drought. There are reasonably numerous studies on the overexpression of OsPIP2;1 in plants. For example, overexpression of PIP2;1 from Vetiver grass increased transpiration of soybean under PEG-induced osmotic stress (Hu et al. 2016). There are also a few studies on knockout mutants, such as that of Da Ines et al., (2010) who showed 20% reduction in rosette water flux in Arabidopsis lacking AtPIP2;1 which was likely related to reduced hydraulic conductance. Together the functional studies on PIP2;1 demonstrate a role in water transport where lower expression reduces hydraulic conductance. Interestingly Chen et al (2022) showed that OsRINGxf1 confers drought resistance in rice by targeting the degradation of OsPIP2;1 which slows water use. Importantly, the results presented here strongly suggest that natural allelic variation in PIP2s, and quite likely OsPIP2;1 specifically, impact root hydraulic conductance and performance under drought. In conclusion, we present good evidence of allelic variation in hydraulic conductance between Azucena x Bala near isogenic lines that differ on chromosome 7 making the trait a good physiological candidate for the drought avoidance QTL located there. We demonstrate an osmotic swelling method for assessing root hydraulic flow that is much faster than the pressure chamber normally used. We show that there is allelic variation at the sequence and expression level in four PIP aquaporin under this QTL. Using near isogenic lines we demonstrate allelic variation at this QTL affects root hydraulic flow that is observable only under drought. Furthermore, we demonstrate that modification of the expression of the OsPIP2:1 using RNAi alters root hydraulic conductance, providing compelling evidence that allelic variation in this gene might be functionally related to the drought avoidance QTL. This possibility should be further studied. Acknowledgements Funding supported the experiment work as follow; FK funds from Ministry of Education, the Government of Pakistan and EU FP6 Project no. 015468 ”CEDROME”; ZA funds from the Tertiary Education Trust Fund, Nigeria; TD funds from EU FP7-PEOPLE-IIF-2008 project 236901 “LowAsRice”. The authors acknowledge the work of Cathy Lewis (assisted on one experiment) and Adam Hinds (tested HgCl sensitivity of osmotic method). The rice transformation work was conducted in the Rice Functional Genomics Platform (REFUGE) at CIRAD, Montpellier and benefited of the support of the Agropolis Foundation. Contribution ZA co-designed and conducted half of the experiments FK co-designed and conducted half of the experiments TD designed the RNAi constructs and co-conducted the molecular work on the RNAi lines DM assisted TD in the creation of the RNAi lines EG oversaw the RNAi line production including design, seed production and transport of seed GN co-designed and supervised experiments, analysed data, produced figures AP co-designed and supervised experiments, analysed data, conducted bioinformatics, produced figures and wrote the first draft. All authors contributed to editing. not-yet-known not-yet-known not-yet-known unknown References Champoux M.C., Wang G., Sarkarung S., Mackill D.J., O’Toole J.C., Huang N. and McCouch S.R. 1995. Locating genes associated with root morphology and drought avoidance in rice via linkage to molecular markers. Theor Appl Genet 90:969-981. Chaumont F and Tyerman SD 2014. Aquaporins: Highly Regulated Channels Controlling Plant Water Relations. Plant Physiology 164: 1600–1618. Chen S, Xu, K, Kong D, Wu, L, Chen Q, Ma X, Ma S, Li T, Xie Q, Liu H, Luo L (2022) Ubiquitin ligase OsRINGzf1 regulates drought resistance by controlling the turnover of OsPIP2;1. Plant Biotechnology Journal 20; 1743-1755 https://doi.org/10.1111/pbi.13857 Da Ines O, Graf W, Franck KI, Albert A, Winkler JB, Scherb H, Stichler W, Schaffner AR 2010. Kinetic analyses of plant water relocation using deuterium as tracer – reduced water flux of Arabidopsis pip2 aquaporin knockout mutants. Plant Biology 12: 129-139 doi:10.1111/j.1438-8677.2010.00385.x Ding L, Uehlein N, Kaldenhoff R, Guo S, Zhu Y, Kai L 2019 Aquaporin PIP2;1 affects water transport and root growth in rice (Oryza sativa L.). Plant Physiology and Biochemistry 139: 152-160 doi.org/10.1016/j.plaphy.2019.03.017 Gomez SM, Kumar SS, Jeyaprakash P, Suresh R, Biji KR, Boopathi NM, Price AH and Chandra Babu R (2006) Mapping QTLs linked to physio-morphological and plant production traits under drought stress in rice (Oryza sativa L.) in the target environment. American Journal of Biochemistry and Biotechnology 2: 161-169 Grondin A, Mauleon R, Vadez V, Henry A 2016. Root aquaporins contribute to whole plant water fluxes under drought stress in rice (Oryza sativa L.). Plant Cell and Environment 39: 347-365 DOI: 10.1111/pce.12616 Henry A, Wehler R, Grondin A, Franke R, Quintana, M 2016. Environmental and physiological effects on grouping of drought-tolerant and susceptible rice varieties related to rice (Oryza sativa) root hydraulics under drought. Annals of Botany 118: 711-724. 10.1093/aob/mcw068 Hu SB, Zhou Q, An J, Yu BJ 2016 Cloning PIP genes in drought-tolerant vetiver grass and responses of transgenic VzPIP2;1 soybean plants to water stress. Biologia Plantarum 60:655-666 DOI 10.1007/s10535-016-0631-5 Huang X, Wang Z, Huang J, Peng S, Xiong D (2021) Mesophyll conductance variability of rice aquaporin knockout lines at different growth stages and growing environments. The Plant Journal 107, 1503–1512 doi: 10.1111/tpj.15397 Khowaja FS, Norton GJ, Courtois B, Price AH (2009) Improved resolution in the position of drought-related QTLs in a single mapping population of rice by meta-analysis. BMC Genomics 10: 276 (doi:10.1186/1471-2164-10-276) Koegel S, Mieulet D, Baday S, Chatagnier O, Lehmann MF, Wiemken A, Boller T, Wipf D, Bernèche S, Guiderdoni E, Courty PE (2017) Phylogenetic, structural, and functional characterization of AMT3;1, an ammonium transporter induced by mycorrhization among model grasses. Mycorrhiza. 27(7):695-708. doi: 10.1007/s00572-017-0786-8. Lafitte HR, Price AH and Courtois B (2004) Yield response to water deficit in an upland rice mapping population: associations among traits and genetic markers. Theoretical and Applied Genetics 109: 1237-1246 MacMillan K, Emrich K, Piepho H-P, Mullins CE and Price AH (2006) Assessing the importance of genotype x environment interaction for root traits in rice using a mapping population I: A soil-filled box screen. Theoretical and Applied Genetics 113: 977-986 Maggio A, Joly RJ (1995) Effects of mercuric-chloride on the hydraulic conductivity of tomato root systems - evidence for a channel-mediated water pathway. Plant Physiology 109: 331-335, doi.org/10.1104/pp.109.1.331 Malz S, Sauter M 1999 Expression of two PIP genes in rapidly growing internodes of rice is not primarily controlled by meristem activity or cell expansion. Plant Molecular Biology 40: 985-995 Mangrauthia SK, Bhogireddy S, Agarwal S, Prasanth VV, Voleti SR, Neelamraju S, Subrahmanyam D (2017) Genome-wide changes in microRNA expression during short and prolonged heat stress and recovery in contrasting rice cultivars. Journal of Experimental Botany 68: 2399-2412 DOI10.1093/jxb/erx111 Norton GJ, Lou-Hing DE, Meharg AA and Price AH (2008) Rice-arsenate interactions in hydroponics: Whole genome transcriptional analysis. J. Ex. Bot 59: 2267–2276. Price AH, Jones HG, Norton GJ, Huang S, Xiong L (2010) Expression data from field droughted rice plants. NCBI GEO submission GSE24048 Price AH, Steele KA, Moore BJ, Barraclough PB and Clark LJ (2000) A combined RFLP and AFLP linkage map of upland rice (Oryza sativa L.) used to identify QTLs for root penetration ability. Theoretical and Applied Genetics 100: 49-56 Price AH, Tomos AD and Virk DS (1997) Genetic dissection of root growth in rice (Oryza sativa L.) I: A hydroponic screen. Theoretical and Applied Genetics 95: 132-142 Price AH, Townend J, Jones MP, Audebert A and Courtois B (2002) Mapping QTLs associated with drought avoidance in upland rice grown in the Philippines and West Africa. Plant Molecular Biology 48 683-695 Reddy KS, Sekhar KM, Reddy, Attipalli R 2017 Genotypic variation in tolerance to drought stress is highly coordinated with hydraulic conductivity-photosynthesis interplay and aquaporin expression in field-grown mulberry (Morus spp.) Tree Physiology 37: 926-937 Sakurai, J., Ahamed, A., Murai, M., Maeshima, M. and Uemura, M. (2008) Tissue and cell-specific localization of rice aquaporins and their water transport activities. Plant and Cell Physiology, 49(1), 30-39. Sakurai, J., Ishikawa, F., Yamaguchi, T., Uemura, M. and Maeshima, M. (2005) Identification of 33 rice aquaporin genes and analysis of their expression and function. Plant Cell Physiol., 46(9), 1568-1577. Sakurai‐Ishikawa, J., Murai‐Hatano, M., Hayashi, H., Ahamed, A., Fukushi, K., Matsumoto, T. and Kitagawa, Y. (2011) Transpiration from shoots triggers diurnal changes in root aquaporin expression. Plant, Cell Environ., 34(7), 1150-1163. Sallaud C, Meynard D, van Boxtel J, Gay C, Bès M, Brizard J-P, Larmande P, Ortega D, Raynal M, Portefaix M, Ouwerkerk PBF, Rueb S, Delseny M, Guiderdoni E (2003) Highly efficient production and characterization of T-DNA plants for rice (Oryza sativa L.) functional genomics. Theor Appl Genet 106: 1396–1408. Sato Y, Antonio B, Namiki N, Takehisa H, Minami H, Kamatsuki K, Sugimoto K, Shimizu Y, Hirochika H, Nagamura Y (2011) RiceXPro: a platform for monitoring gene expression in japonica rice grown under natural field conditions. Nucleic Acids Research 39:D1141-1148. Serraj R, McNally K L, Slamet-Loedin I, Kohli A, Haefele S M, Atlin G, Kumar A. 2011. Drought resistance improvement in rice: An integrated genetic and resource management strategy. Plant Prod Sci, 14(1): 1–14. Sivasakthi K, Tharanya M, Kholova J, Muriuki RW, Thirunalasundari T, Vadez V 2017 Chickpea Genotypes Contrasting for Vigor and Canopy Conductance Also Differ in Their Dependence on Different Water Transport Pathways Frontiers in Plant Science 8: 1663 Sun Q, Liu X, Kitagawa Y, Calamita G, Din X 2024 Plant aquaporins: Their roles beyond water transport. The Crop Journal 12: 641-653 doi.org/10.1016/j.cj.2024.04.005 Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK 2008 Identification of novel and candidate miRNAs in rice by high throughput sequencing BMC Plant Biol. 8:25 Warthmann N, Chen H, Ossowski S, Weigel D, Hervé P (2008) Highly Specific Gene Silencing by Artificial miRNAs in Rice. PLoS ONE 3(3): e1829. https://doi.org/10.1371/journal.pone.0001829 Yadav R., Courtois B., Huang N. and McLaren G. 1997. Mapping genes controlling root morphology and root distribution on a double-haploid population of rice. Theor Appl Genet 94:619-632. Yoshida, S., Forno, D.A., Lock, J.H. and Gomez, K.A. (1976) A Laboratory manual for the Physiological Studies of Rice. IRRI, Manilla, pp. 61-66. Yooyongwech S, Cha-um S, Supaibulwatana K. 2013. Water relation and aquaporin genes (PIP1;2 and PIP2;1) expression at the reproductive stage of rice (Oryza sativa L. spp. indica) mutant subjected to water deficit stress Plant Omics Journal 6: 79-85 Zhao H, Yao W, Ouyang Y, Yang W, Wang G, Lian X, Xing Y, Chen L, Xie W. (2015) RiceVarMap: a comprehensive database of rice genomic variations. Nucleic Acids Res, 43: D1018-1022 Zhao K, Tung CW, Eizenga GC, Wright MH, Ali ML, Price AH, Norton GJ, Islam MR, Reynolds A, Mezey J, McClung AM, Bustamante CD, McCouch SR. 2011. Genome-wide association mapping reveals rich genetic architecture of complex traits in Oryza sativa . Nature Communications. 2, 467-475. Figure legends Figure 1 Polymorphism, haplotype diversity and expression in OsPIP2;1 A) The two splice variants of OsPIP2;1 in Nipponbare based on MSU annotation showing SNPs (vertical lines), insertions (up-pointing triangles) and deletions (down-pointing arrows) where red = Azucena, orange = Bala and green is both. Numbers in triangles indicate number of bases. B) Haplotype network of rice from RiceVarMap2 based on 11 Exon1 SNPs. C) Haplotype network of rice from RiceVar based on 26 SNPs from the start of exon 2 to the end of the 238 bp deletion. D) reproduction of Spacio-temporal expression profile in RiceXPro. E) Expression of Affymetrix probe Os.11330.1.S1_a_at in field grown leaves and hydroponic roots (see methods). Figure 2 Hydraulic conductance/flow in the roots of near isogenic lines of rice. A Photograph of the paired pot system for growing contrasting genotypes; B the double-holed pressure chamber; C hydraulic conductance (using pressure chamber) in Azucena (left) and Bala (right) recombinant inbred near isogenic lines (RINILs) under control (solid line) and drought (dashed line) (the paired plants in the same pot are joined by line); D hydraulic flow (using osmotic swelling) in Azucena (left) and Bala (right) recombinant inbred near isogenic lines (RINILs) under control (solid line) and drought (dashed line) (the paired plants in the same pot are joined by line); E example plots of osmotic swelling of root of well watered plants; F example plots of osmotic swelling of root of droughted plants. Figure 3 Plant biomass and hydraulic flow (by osmotic swelling) of contrasting recombinant inbred near isogenic lines (RINILs) under three water treatments . Biomass (top) and hydraulic flow as assessed by osmotic swelling (bottom) of contrasting Azucena and Bala in well watered (left), mild (middle) and severe (right) grown in paired pots. The solid line links the two plants in each pot. Figure 4 Expression and hydraulic conductance/flow in RNAi lines of OsPIP2;1 . A plot of the relative gene expression of OsPIP2;1 and hydraulic flow (using osmotic swelling) of four RNAi lines from two target 21mer (TD3 and TD4) and Azucena (the cultivar the lines are developed in) grown in hydroponics. B, C hydraulic conductance (using pressure chamber) of the same lines grown in soil grown in paired-plant pots where the contrasting genotype of the same pot are joined by a solid line. Pairs selected within the same transformation to be high vs low in expression in hydroponic roots; (TD4C8 1.2/I vs TD4C8 1.2/G B and TD3C8 5.1/I vs TD3C8 5.1/E C). Supplementary Figure 1 Polymorphism, haplotype diversity and expression in OsPIP2;4 A) OsPIP2;4 in Nipponbare based on MSU annotation showing SNPs (vertical lines), insertions (up-pointing triangles) and deletions (down-pointing arrows) where red = Azucena, orange = Bala and green is both. Numbers in triangles indicate number of bases. B) Haplotype network of rice from RiceVarMap2 based on 53 SNPs. C) reproduction of Spacio-temporal expression profile in RiceXPro. D) Expression of Affymetrix probe Os.8118.1.S1_at in field grown leaves and hydroponic roots (see methods). * Insertion in 3’UTR is difficult to size due to poor sequence read alignment. Supplementary Figure 2 Polymorphism, haplotype diversity and expression in OsPIP2;5 A) OsPIP2;5 in Nipponbare based on MSU annotation showing SNPs (vertical lines) and deletions (down-pointing arrows) where red = Azucena, orange = Bala and green is both. Numbers in triangles indicate number of bases. * is SNP 15,377,054 indicated as “probably damaging” in RiceVarMap2. B) Haplotype network of rice from RiceVarMap2 based on 34 SNPs. C) reproduction of Spacio-temporal expression profile in RiceXPro. D) Expression of Affymetrix probe Os.31191.2.S1_x_at in field grown leaves and hydroponic roots (see methods). Supplementary Figure 3 Polymorphism, haplotype diversity and expression in OsPIP2;9 A) OsPIP2;9 in Nipponbare based on MSU annotation showing SNPs (vertical lines), insertions (up-pointing triangles) and deletions (down-pointing arrows) where red = Azucena, orange = Bala and green is both. Numbers in triangles indicate number of bases. B) Haplotype network of rice from RiceVarMap2 based on 22 SNPs. C) reproduction of Spacio-temporal expression profile in RiceXPro. D) Expression of Affymetrix probe Os.44151.1.S1_x_at in field grown leaves and hydroponic roots (see methods). Information & Authors Information Version history V1 Version 1 05 June 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords aquaporin drought hydraulic conductance oryza sativa water relations Authors Affiliations Zainab Abubakar University of Aberdeen School of Biological Sciences View all articles by this author Farkhanda Khowaja S University of Aberdeen School of Biological Sciences View all articles by this author Tapash Dasgupta University of Aberdeen School of Biological Sciences View all articles by this author Delphine Mieulet CIRAD Direction Regionale Montpellier-Occitanie View all articles by this author emmanuel guiderdoni CIRAD Direction Regionale Montpellier-Occitanie View all articles by this author Gareth Norton University of Aberdeen School of Biological Sciences View all articles by this author Adam H. Price 0000-0003-3094-0485 [email protected] University of Aberdeen School of Biological Sciences View all articles by this author Metrics & Citations Metrics Article Usage 197 views 114 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Zainab Abubakar, Farkhanda Khowaja S, Tapash Dasgupta, et al. OsPIP2;1 impacts root hydraulic conductance and is a candidate gene for a drought avoidance QTL on rice chromosome 7.. Authorea . 05 June 2025. DOI: https://doi.org/10.22541/au.174910932.26184078/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.174910932.26184078/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9ffc5b9389bf8650',t:'MTc3OTQ1ODUzNw=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.