Effects of intranasal long-acting insulin pretreatment on postoperative delirium and the NLRP3/caspase-1/IL-1β pathway in older patients with esophageal cancer Running title: intranasal long-acting insulin and postoperative delirium

Effects of intranasal long-acting insulin pretreatment on postoperative delirium and the NLRP3/caspase-1/IL-1β pathway in older patients with esophageal cancer Running title: intranasal long-acting insulin and postoperative delirium | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of intranasal long-acting insulin pretreatment on postoperative delirium and the NLRP3/caspase-1/IL-1β pathway in older patients with esophageal cancer Running title: intranasal long-acting insulin and postoperative delirium YONG ZHANG, WEI WU, ZULING ZHONG, yinghai liu, GU GONG, QINGQING HUANG This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8658457/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Apr, 2026 Read the published version in Inflammation and Regeneration → Version 1 posted 9 You are reading this latest preprint version Abstract Background Insulin exhibits neuroprotective and anti-inflammatory properties. Preoperative intranasal insulin preconditioning is a potential strategy to prevent postoperative delirium (POD), but prior studies mainly used rapid-acting formulations. This investigation focused on intranasal long-acting insulin, which ensures sustained central nervous system exposure, in elderly patients undergoing radical esophagectomy. We assessed its impact on POD incidence and the NLRP3/caspase-1/IL-1β pathway. Methods Sixty older patients scheduled for elective radical esophagectomy were randomized into two groups. The intervention group (n = 30) received a single intranasal dose of long-acting insulin (30U) one day preoperatively, while the control group (n = 30) received an equivalent volume of physiological saline. POD was evaluated using the Confusion Assessment Method for the ICU on postoperative days 1, 2, and 3. Peripheral blood samples were collected before surgery and postoperatively to measure IL-1β concentrations and NLRP3/caspase-1 mRNA expression in mononuclear cells. Results Compared to controls, long-acting insulin pretreatment significantly reduced POD incidence (16.7% vs. 46.7%, P = 0.012) and suppressed the postoperative rise in peripheral IL-1β levels ( P < 0.05). Additionally, NLRP3 and caspase-1 mRNA expression were notably lower in the insulin group during the postoperative period ( P < 0.05). Conclusion Preoperative intranasal long-acting insulin effectively decreases POD incidence in the first 3 days after radical esophagectomy in older patients. This protective effect is likely mediated through sustained downregulation of the NLRP3/caspase-1 signaling pathway, emphasizing the advantage of long-acting formulations for continuous neuroprotection during the critical postoperative phase. Intranasal administration Long-acting insulin Postoperative delirium NLRP3 inflammasome Elderly patients Esophageal cancer Figures Figure 1 Figure 2 Introduction Esophageal cancer (EC) is a common gastrointestinal malignancy in older individuals, with radical surgery remaining the primary treatment approach [1]. However, older patients are more prone to postoperative complications, particularly postoperative delirium (POD) due to age-related physiological reserve decline [2]. POD delays postoperative recovery, prolongs hospital stay, increases healthcare costs, and is associated with a significant increased risk of adverse events such as falls, tube dislodgement, and infection. In severe cases, POD may lead to long-term cognitive impairment [3]. Recent evidence has shown that insulin exerts significant neuroprotective and anti-inflammatory effects beyond its role in glycemic control. These include enhancing synaptic plasticity, inhibiting neuronal apoptosis, and suppressing proinflammatory cytokine release [4,5]. Intranasal administration of insulin, a non-invasive route with rapid access to the central nervous system, has shown considerable advantages in both animal and clinical studies. This method bypasses the blood-brain barrier and delivers insulin directly to the brain tissue via the olfactory and trigeminal perivascular pathways, effectively targeting key regions such as the hippocampus [6]. Compared with intravenous administration, intranasal delivery avoids peripheral accumulation and reduces the risk of systemic hypoglycemia. It also enables more efficient and direct targeting of the CNS, enhancing its neuroprotective potential [7]. Therefore, intranasal insulin pretreatment is emerging as a promising strategy to reduce POD risk in older patients undergoing esophagectomy [8]. We previously demonstrated that multiple preoperative intranasal rapid-acting insulin administrations (30 U twice daily for 2 days preoperatively) significantly reduced the incidence of POD and peripheral levels of interleukin-1β (IL-1β) in older patients with gastrointestinal tumors [9]. However, the requirement for repeated dosing in such regimens may pose challenges for clinical implementation. In contrast, the use of long-acting insulin formulations, such as insulin detemir, offers the potential for sustained central nervous system exposure with a simplified single-dose preoperative administration, which may improve practicality and adherence while maintaining efficacy. The distinct pharmacokinetic profile of long-acting insulin could lead to more prolonged modulation of neuroinflammatory pathways, a hypothesis that remains to be rigorously tested. The NLRP3/caspase-1/IL-1β signaling pathway is a key mediator of inflammatory responses and plays an important role in POD pathogenesis [10]. Perioperative stressors, such as infection, surgical trauma, and tissue injury, can activate the NLRP3 inflammasome, which in turn promotes caspase-1-mediated cleavage of pro-IL-1β and pro-IL-18 into their active forms. These cytokines may then cross a disrupted BBB, activate microglia and astrocytes, and initiate a neuroinflammatory cascade. The cascade contributes to synaptic dysfunction, altered glutamate metabolism, and neuronal injury—ultimately impairing cognitive functions such as learning, memory, and attention [11,12]. Therefore, elucidating how intranasal insulin modulates the NLRP3/caspase-1/IL-1β axis may provide crucial mechanistic insights into its role in preventing POD and support the development of individualized perioperative immunomodulatory strategies. Building upon our previous clinical findings [8,9], the present study was conducted in an independently recruited cohort of elderly esophageal cancer patients, using a single 40 U preoperative dose of intranasal long-acting insulin detemir [13]. This regimen contrasts with the multi-dose, rapid-acting insulin approach used in prior studies and aims to evaluate the feasibility and efficacy of a simplified dosing strategy. Furthermore, unlike our earlier investigations that primarily focused on serum inflammatory or neurodegenerative biomarkers, this work further examined the dynamic expression of NLRP3 and caspase-1 mRNA in peripheral blood mononuclear cells (PBMCs), aiming to elucidate the molecular mechanism by which intranasal long-acting insulin downregulates the NLRP3/caspase-1/IL-1βinflammasome pathway and exerts neuroprotective effects. Materials and Methods Ethics statement This study adhered to the principles of the Declaration of Helsinki, followed the Comprehensive Standards for Trial Reporting (CONSORT) guidelines, and was approved by the Ethics Committee of the General Hospital of Western Theater (Ethics Approval No. 2019ky64). The study was registered in the Chinese Clinical Trials Registry (http://www.trialregister.nl, date: 22/02/2022; Number: ChiCTR2200056906). All participants provided written informed consent. Participants We enrolled 60 older patients who underwent radical resection of esophageal cancer at our hospital from February 2022 to October 2022. The inclusion criteria were: age ≥ 65 years, American Society of Anesthesiologists (ASA) grade I–III, body mass index (BMI) ≤ 28 kg/m2, planned radical esophagectomy under general anesthesia, and provision of written informed consent. The following exclusion criteria applied: current participation or participation in another interventional clinical trial within the past 3 months, patients with contraindications to intranasal insulin administration (such as nasal defects and lesions), history of hypertension or diabetes, history of insulin allergy, history of alcoholism or drug abuse, inability to communicate before surgery (coma, deep dementia, language impairment, or severe visual and hearing impairment), low Mini-Mental State Examination (MMSE) score (defined as < 17 for illiterate individuals, < 20 for those with a primary school education, and < 24 for those with a secondary school [including technical secondary school] education), severe liver and kidney dysfunction, and cardiovascular and cerebrovascular diseases. The exit criteria were as follows: insulin administered non-nasally during the study, reoperation or endotracheal intubation performed within 3 days post-surgery, unexpected adverse events (including drug allergies, anesthesia, and surgical complications), and loss to follow-up. Randomization , i nterventions and blinding Computer-generated randomization tables were employed for patient allocation. The resulting assignment sequence was concealed using sequentially numbered, sealed, opaque envelopes. Participants were randomly assigned to one of two groups: the control group (Group C; n=30) received 0.3 ml of 0.9% saline solution, and the intervention group (Group I; n=30) received 0.4 ml of long-acting insulin detemir (30 U), both administered via the nasal route. At 17:00 on the day preceding surgery, all patients received their respective preparations through a nasal mucosal nebulization device with a syringe (Wuxi Meihao Life Technology Co., Ltd., Jiangsu, China). The study medications were prepared by an independent researcher not involved in patient anesthesia or outcome assessment. Long-acting insulin (3 ml, 300 U) was supplied by Novo Nordisk (China) Pharmaceutical Co., Ltd (Tianjin, China). To ensure blinding, participants, anesthesiologists, surgeons, nursing staff, follow-up personnel, and data analysts remained unaware of group assignments throughout the study period. The allocation details were disclosed only after database lock and completion of all statistical analyses. Method of anesthesia Before anesthesia, we established peripheral venous access, performed electrocardiography, and attached a pulse oximetry probe to the patient. Blood pressure was monitored via radial artery puncture and catheterization. We performed central venous puncture catheterization to monitor central venous pressure and guide transfusion. Bispectral index (BIS) and regional oxygen saturation were measured intraoperatively. Anesthesia induction: sufentanil 0.4 μg/kg, etomidate 0.3 mg/kg, and rocuronium 0.6 mg/kg were administered as muscle relaxants. Mechanical ventilation was performed via endotracheal intubation under guidance by a video laryngoscope. The tidal volume was 8–10 ml/kg (6–10 ml/kg for pneumothorax), with a positive end-expiratory pressure at 5 cm H 2 O (1 cm H 2 O=0.098 kp-A). The inhalation-to-breath ratio was 1:2. The inhaled oxygen concentration fraction was 0.6. After intubation, the patient was placed in the left lateral position. At the beginning of the procedure, we simultaneously established CO 2 artificial pneumothorax and single-lung ventilation, maintaining the intrathoracic pressure at 8–10 mmHg. During the thoracoscopic phase, PetCO 2 was maintained within the target range by adjusting the tidal volume and respiratory rate. Artificial pneumothorax was discontinued, and double-lung ventilation was resumed following intrathoracic esophageal free dissection and lymph node dissection. Anesthesia maintenance: Propofol 3 mg/(kg·h) and remifentanil 10–20 μg/(kg·h) were administered via continuous intravenous infusion, rocuronium 0.2 mg/kg was administered intermittently via intravenous injection, and 1%–2% sevoflurane was administered via inhalation to maintain the BIS value between 40 and 60. During surgery, each patient was insulated with an inflatable thermal blanket to maintain body temperature at approximately 37°C. After stabilization of vital signs and respiratory recovery, the tracheal catheter was removed, and the patients were transferred to the post-anesthesia care unit for follow-up diagnosis and treatment. All patients who underwent surgery were administered intravenous controlled analgesia: sufentanil (100 μg+), ondansetron (16 mg), and butorphanol (5 mg), diluted to 100 ml in a medical-grade 0.9% sodium chloride injection. Parameter settings included no background infusion, a basal rate of 3 ml/h, a patient-controlled analgesia dose of 0.5 ml, and a lockout interval of 15 min. Data collection The clinical characteristics and demographic data of all patients were recorded, including age, sex, BMI, MMSE score, surgery time, ASA classification, preoperative hemoglobin concentration, total fluid infusion volume during surgery, intraoperative blood transfusion volume, intraoperative bleeding volume, intraoperative urine volume, and digital rating scale score for the first 3 days after surgery. Primary endpoint Patients completed a preoperative cognitive status assessment based on the MMSE score prior to surgery. The main outcome was the incidence of delirium within the first 3 days after surgery. The researchers underwent professional training before participating in the study, and the patients were evaluated by medical personnel who were proficient in the Confusion Assessment Method for the Intensive Care Unit (CAM-ICU). Two assessments were conducted twice (8:00–10:00 am and 18:00–20:00 pm) for 3 days post-surgery. The CAM-ICU [14] criteria comprise four aspects: acute changes or repeated fluctuations in consciousness status, attention deficit, thinking disorder, and changes in consciousness clarity. A positive delirium diagnosis was determined by the presence of the first two features, combined with either the third or fourth feature. Secondary endpoints Enzyme-linked immunosorbent assay Before intervention (T0) and at 1–3 days post-surgery (T1–T3), peripheral venous blood samples were collected from the patients and centrifuged at 3000 × g for 15 min to separate the serum. The serum was stored at -80°C until analysis. The concentration of IL-1 β was determined using an enzyme-linked immunosorbent assay kit (Thermo Fisher, USA), in accordance with the manufacturer’s instructions. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis A total of 3 ml of venous blood was collected from patients at T0–T3 into EDTA anticoagulant tubes. Human peripheral blood was mixed with lymphocyte separation solution (Sigma, USA) at a 1:1 ratio and centrifuged (LB-5000 medical centrifuge; Shanghai Zhaodi Biotechnology Co., Ltd.) at 3000 g/m for 10 min to separate peripheral blood mononuclear cells (Figure 1). TRIzol reagent (Invitrogen) was added to lyse the cells and total RNA was extracted. RNasin was added to samples with OD260/280 values between 1.6 and 2.0, and the samples were stored in a -80°C freezer until analysis. Next, 1 μg RNA was used as a template for cDNA synthesis. The reaction mixture volume was 20 μl. The reaction conditions were as follows: 37°C for 60 min and 95°C for 5 min. The obtained cDNA was stored at -20°C. The experiment was performed according to the instructions of a reverse transcription kit (Shanghai Sangong Biotechnology Co., LTD). The primers were designed and synthesized by Shanghai Sangong Biotechnology Co., LTD. The primer sequences are shown in Table I. Real-time PCR was performed using a PCR kit (Shanghai Sangong Biotechnology Co., LTD) with a reaction system of volume 20 μl containing 10 μl of 2x real-time PCR buffer, 0.4 μl of upstream and downstream primers, 2 μl of cDNA template, and 20 μl of water treated with diethylpyrocarbonate. The reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 93°C for 20 sec, annealing at 56°C for 20 sec, and extension at 75°C for 30 sec (40 cycles). Two replicates were performed for each sample, with GAPDH as the internal reference gene. The results were analyzed using the CFX Manager Dx Software version 3.0. The expression of the target gene was reflected by the integrated optical density value, and the fold of expression change was calculated using 2 - △△ Ct (△△Ct=average △ Ct of Group I - average △Ct of Group C). The 2 - △△ Ct method was used to determine the expression level of the target gene relative to that of the reference gene [15]. The primer sequences used for gene amplification are listed in Table I. Adverse reactions A continuous blood glucose monitoring system (Changsha Sinocare Biosensing Co., Ltd., China) was used to dynamically monitor blood glucose levels during the study period. Based on the American Diabetes Association dynamic blood glucose standard, a blood glucose level below 3.9 mmol/l was defined as hypoglycemia [16]. The blood glucose meter was used to record the time of hypoglycemia and the average blood glucose level. Statistical analysis At our hospital, over the past 3 years, the incidence of POD among older patients undergoing radical resection for esophageal cancer has reached 48%. In the pre-experiment, the incidence of POD was 10% after intranasal administration of 40 U of long-acting insulin. A significance level of α=0.05 (two-tailed) and a power of 1-β=0.9 were used to calculate the required sample. Power Analysis and Sample Size (PASS) software, version 11.0 (NCSS Statistical Software, Kaysville, UT, USA) was used, yielding a sample size of 50. To account for an anticipated 20% loss to follow-up, the sample size was adjusted to 60 patients. Data analysis was performed using IBM SPSS Statistics version 26.0 (IBM Corp., Armonk, NY, USA). Analyses were based on the intent-to-treat outcomes. For quantitative data, the Shapiro–Wilk test and Levene's test were used to examine the normal distribution and homogeneity of variance. Quantitative data that conform to normal distribution are expressed as mean±standard deviation and were analyzed using an independent sample t-test. Quantitative data that do not follow a normal distribution are presented as median (interquartile range) and were analyzed using the Mann–Whitney U test. Count data are presented as frequency and percentage and were analyzed using the χ2 test or Fisher's exact test. Repeated measures analysis of variance was used to determine the significance of differences in the average NLRP3 mRNA and caspase-1 mRNA expression and IL-1β concentration over time among the groups. Comparisons between the groups were performed using Dunnett's t -test. For all tests, results with P <0.05 were considered statistically significant. Results Participants’ characteristics A total of 67 patients were screened for eligibility. Of these, seven declined to participate and were subsequently excluded. The remaining 60 eligible patients were randomly assigned to the control group (Group C, n = 30) or the insulin group (Group I, n = 30). Three patients were excluded from the per-protocol analysis: two in Group C who received insulin through alternative routes and one in Group I who underwent surgery with a duration of over 6 hours. However, all 60 randomized patients were included in the intention-to-treat analysis (Fig. 2 ). Baseline demographic and clinical characteristics were comparable between groups, confirming successful randomization (Table II). Prevalence of POD Patients who received preoperative intranasal insulin exhibited a lower incidence of POD across multiple time points compared with those in the control group. On postoperative day 1, the incidence of POD was significantly reduced in Group I at both morning and evening assessments (16.7% vs. 46.7%, P = 0.012; and 16.7% vs. 43.3%, P = 0.024, respectively). This protective effect persisted on day 2, with Group I again showing fewer cases in both time periods (13.3% vs. 36.7%, P = 0.037; and 6.7% vs. 26.7%, P = 0.038). Although differences on day 3 were not statistically significant, the cumulative incidence of POD over the first three postoperative days remained significantly lower in the insulin group (16.7% vs. 46.7%, P = 0.012) (Table III). These results suggest that intranasal insulin pretreatment may offer short-term neuroprotective benefits in preventing POD among elderly patients. Comparison of NLRP3 mRNA and caspase-1 mRNA expression levels and IL-1β concentration between the groups at different time points Compared with Group C, the expression of NLRP3 mRNA and caspase-1 mRNA and the concentration of IL-1β were significantly downregulated in Group I at T1, T2, and T3 ( P < 0.05). Compared to T0, the expression of NLRP3 mRNA and caspase-1 mRNA and the concentration of IL-1β were upregulated in both patient groups at T1, T2, and T3, with significant differences observed ( P < 0.05) (Table IV). These findings imply that intranasal insulin may suppress peripheral inflammatory responses, possibly through inhibition of the NLRP3/caspase-1/IL-1β signaling pathway, which has been implicated in the pathogenesis of neuroinflammation and POD. Adverse events No episodes of hypoglycemia were reported in either group throughout the study period. Mean blood glucose levels remained stable and comparable between the two groups before the first intervention and during the entire observation period ( P > 0.05) (Table V). These data confirm that intranasal delivery of rapid-acting insulin is safe and well tolerated in elderly surgical patients, without exerting significant effects on systemic glucose homeostasis. Discussion POD involves impaired consciousness resulting from both surgical and individual factors. It is a common postoperative complication in older individuals, usually occurring within 1–3 days postoperatively [ 17 ]. POD is characterized by impaired orientation, decreased attention, and changes in cognitive function [ 17 ]. POD increases the risk of further complications, prolongs hospitalization, and increases healthcare costs [ 18 ]. At present, esophageal cancer is the eighth most common malignant tumor globally and the sixth most common cause of cancer-related deaths [ 19 ]. Multidisciplinary comprehensive treatment based on radical resection of esophageal cancer has become an important approach for managing POD [ 20 ]. Central nervous system complications in older patients after radical surgery for esophageal cancer remain a common concern [ 21 ]. In this study, 14 patients (46.7%) developed POD within 3 days of surgery, which is consistent with previous findings [ 8 ]. It is important to emphasize that the present study represents a methodological and mechanistic extension, rather than a repetition, of our previous work. Earlier trials established the feasibility and optimal 30 U intranasal insulin dose for POD prevention using a multiple-dose regimen of rapid-acting insulin (twice daily for 2 days preoperatively) [ 8 – 9 ]. In contrast, the current study employed a single preoperative dose of long-acting insulin detemir (30 U), which not only simplifies the clinical workflow and improves patient compliance but may also provide more sustained central nervous system exposure. The current study, conducted in a newly enrolled and independent patient cohort in 2022, confirmed the protective trend of this simplified long-acting insulin regimen and, importantly, demonstrated for the first time that NLRP3 and caspase-1 mRNA expression in PBMCs decreased significantly following single-dose long-acting insulin pretreatment, consistent with the reduction in serum IL-1β. These findings suggest that this optimized single-dose long-acting insulin regimen may attenuate perioperative neuroinflammation by suppressing NLRP3/caspase-1 inflammasome activation, thus providing a mechanistic link between systemic inflammation and neurocognitive protection. Compared with our earlier research, which focused mainly on serum cytokines or neurodegenerative markers (Tau/Aβ) using multiple rapid-acting insulin doses, the present study offers cellular-level and pathway-specific evidence, clarifying the causal chain from single-dose long-acting insulin pretreatment to inflammasome inhibition and reduced POD incidence. It is particularly noteworthy that although recent research indicates long-term use of regular insulin provides superior cognitive improvement compared to insulin detemir[ 22 ], the single-dose regimen of long-acting insulin detemir employed in this study also demonstrated significant efficacy in preventing POD. When compared to the effectiveness rates reported in our team's previous studies utilizing a multiple-dose rapid-acting insulin regimen, the single-dose approach in the current study demonstrates a comparable protective trend. This finding provides new support for the practicality and clinical value of long-acting insulin formulations in perioperative applications, while suggesting that the selection of different insulin preparations requires comprehensive consideration based on specific clinical scenarios and treatment objectives. Insulin pretreatment was initiated as a single dose on the day preceding surgery, a decision based on clinical feasibility and the pharmacokinetic profile of long-acting insulin detemir. This approach aligns with standard practice, as patients are typically admitted 1–2 days before surgery in most clinical settings, making this timeframe both practical and representative of real-world clinical workflows. The single-dose regimen with long-acting insulin represents a significant simplification compared to the multiple-dose rapid-acting insulin schedules used in previous studies, potentially enhancing clinical adoption. Moreover, the approach aligns with the principles of Enhanced Recovery After Surgery, which emphasize timely, targeted, and efficient preoperative interventions [ 23 ]. The single-dose long-acting insulin regimen used in this study particularly exemplifies these principles by minimizing preoperative interventions while maintaining efficacy. While a longer duration of pretreatment might further enhance the therapeutic effects, our regimen balances biological plausibility with clinical practicality. Notably, there is currently no universally accepted gold standard for the assessment of POD. The CAM-ICU remains one of the most widely used tools in clinical research [ 24 ]. In our study, all evaluators underwent standardized training to ensure consistency and reliability in their assessments. Given that POD most commonly occurs within the first 1–3 days postoperatively, and considering the constraints of routine clinical care, we conducted assessments twice daily during this critical postoperative period. Although this frequency of assessments may have missed some transient or fluctuating symptoms, a meaningful reduction in POD incidence was observed in the insulin-treated group. Future studies may benefit from incorporating more frequent or even continuous patient monitoring, potentially through interdisciplinary collaboration, to better characterize the temporal relationship between single-dose long-acting insulin pretreatment and the onset or progression of POD and its ongoing impact on neurocognitive function.Currently, various pathophysiological mechanisms underlying the occurrence of POD have been proposed, with the inflammatory response increasingly recognized as a key contributor [ 25 , 26 ]. The innate immunity of the central nervous system is primarily mediated by microglia, which is essential in immune surveillance and communication between the immune system and brain. After being stimulated by ischemia or infection, microglia secrete pro-inflammatory cytokines such as IL-1β and TNF-α [ 27 , 28 ]. These pro-inflammatory cytokines interact with astrocytes, neurons, and oligodendrocytes to regulate neuroinflammation. While transient activation of microglia is beneficial in responding to peripheral infection, aging can impair the function of microglia, increase their sensitivity to pro-inflammatory activation, and subsequently trigger an inflammatory cascade reaction, leading to disruption of the central nervous system microenvironment and ultimately affecting cognitive function [11.29]. In summary, a moderate increase in central nervous system inflammation and changes in microglial cell function during aging can affect behavior and cognition, leading to a higher risk of POD in older patients [ 30 ]. The NLRP3 inflammasome is an intracellular multiprotein complex composed of the nucleotide-binding oligomerization domain-like receptor protein, pro-caspase-1, and apoptosis-associated spike-like protein containing a caspase recruitment domain, with a molecular weight of approximately 700 kDa [ 31 ]. It is an important component of the innate immune response. NLRP3 can regulate the activation of caspase-1 and promote the cleavage, maturation, and secretion of cytokine precursors—pro-IL-1β and pro-IL-18—during natural immune defense [ 32 ]. A recent study [ 33 ] revealed that the NLRP3 inflammasome plays a critical role in the inflammatory pathway, leading to cognitive impairment. Wang et al. [ 11 ]exposed healthy male C57BL/6 mice aged 6–8 months and 14 months to 1.5% isoflurane for 2 h. Some mice underwent intraperitoneal injection with the caspase-1 specific inhibitor Ac-Tyr-Val-Ala-Asp-chloromethylketone (8 mg/kg) 30 min before isoflurane exposure. Brain tissue was collected 24 hours later for western blotting to determine the expression of NLRP3, IL-1β, and IL-18 in the hippocampus. One week later, the mice were subjected to the Morris water maze test. The results indicated that NLRP3 activation in the brains of older mice may be associated with isoflurane-induced hippocampal inflammation and cognitive impairment. Shao et al. [ 31 ] also evaluated the neuroprotective activity of chitohexaose (ChIV) on sevoflurane-induced cognitive impairment in older rats and found that ChIV can exert neuroprotective effects by blocking the NLRP3/caspase-1 pathway. In summary, the NLRP3 inflammasome plays an important role in the inflammatory response associated with POD. In this study, both groups of patients experienced POD. The expression of NLRP3 mRNA and caspase-1 mRNA in monocytes was upregulated, and the concentration of IL-1β in peripheral blood increased, indicating that the NLRP3/caspase-1 pathway is involved in the occurrence of POD. In the present study, POD was observed in both groups of patients. We detected a significant upregulation of NLRP3 and caspase-1 mRNA expression in peripheral blood mononuclear cells (PBMCs), accompanied by elevated levels of IL-1β in the peripheral circulation. These findings suggest that activation of the NLRP3/caspase-1 signaling pathway may be involved in the pathogenesis of POD. Although our study primarily focused on peripheral immune activation and did not directly assess neuroinflammation, growing evidence indicates that the peripheral immune system and the CNS are closely interconnected through multiple bidirectional mechanisms [ 34 ]. Under physiological conditions, the BBB serves as a selective barrier that effectively limits the entry of large molecules and immune cells into the brain. However, under pathological states such as stress, systemic inflammation, surgical trauma, or aging, the permeability of the BBB can be compromised [ 35 ]. This disruption allows proinflammatory mediators, including IL-1β, IL-6, and TNF-α, to gain access to the CNS, where they activate glial cells and initiate neuroinflammatory cascades [ 35 ]. In addition to humoral transmission, peripheral immune signals can influence the CNS via neural routes—such as the vagus nerve—or through secondary messengers released by cerebrovascular endothelial cells [ 36 – 39 ]. Importantly, peripheral inflammation is frequently associated with CNS dysfunction [ 35 , 40 ]. Postoperative increases in circulating cytokines correlate with cognitive decline and the upregulation of neuroinflammatory markers [ 41 , 42 ]. Conversely, CNS inflammation can result in the release of cytokines into the peripheral bloodstream, establishing a bidirectional inflammatory feedback loop between the brain and the periphery [ 43 – 45 ]. Within this context, PBMCs function as crucial immune sensors and effectors. The expression of inflammasome components (e.g., NLRP3, caspase-1) and proinflammatory cytokines such as IL-1β by PBMCs reflects the systemic immune status and may also serve as an indirect indicator of CNS inflammation [ 46 , 47 ]. Therefore, PBMC-derived molecular markers may represent accessible and informative peripheral biomarkers for investigating postoperative neuroinflammation and its related complications, including POD, with potential value in both clinical monitoring and mechanistic research. Study limitations This study has several limitations. First, it focused solely on the expression of NLRP3/caspase-1/IL-1β pathway-related markers in PBMCs, without directly assessing inflammatory responses within the central nervous system or evaluating NLRP3 and caspase-1 expression at the protein level. Given the complex interplay between peripheral and central immune responses, and the importance of confirming transcriptional findings at the translational level, future studies should include simultaneous assessment of inflammatory markers in both compartments and at both mRNA and protein levels to better elucidate the mechanisms of inflammasome activation. Secondly, this is a single-center study with a small cohort size. It is necessary to further verify the universality of the research results through multi-center, large-sample clinical trials. Conclusion Preoperative single-dose intranasal insulin administration reduces the incidence of POD and inflammatory response in older patients undergoing radical esophagectomy for esophageal cancer. This effect may be associated with the downregulation of the NLRP3/caspase-1 signaling pathway. Abbreviations bispectral index (BIS) body mass index (BMI) chitohexaose (ChIV) Comprehensive Standards for Trial Reporting (CONSORT) Confusion Assessment Method for the Intensive Care Unit (CAM ICU) esophageal cancer (EC) interleukin (IL) Mini Mental State Examination (MMSE) nucleoside binding oligomerization domain-like receptor protein 3 (NLRP3) postoperative delirium (POD) Power Analysis and Sample Size (PASS) quantitative reverse transcription polymerase chain reaction (qRT-PCR) Enhanced Recovery After Surgery (ERAS) Declarations Acknowledgements We would like to thank Editage (www.Editage.com) for English language editing. Funding This study was supported by the Hospital Management Project of the General Hospital of the Western Theater Command (grant number 2024-YGLC-B12), the Neurosurgery Anesthesia Specialist Center and the Key disciplines of joint logistics support . Availability of data and materials The raw data of this study have been uploaded to www.medresman.org.cn. They are also available from the corresponding author on reasonable request. The data have not been previously presented orally or by poster at scientific meetings Authors' contributions Conceptualization: YZ, QQH, ZLZ, WW, GG Supervision: DL: YHL,ZLZ Formal analysis: WW, ZLZ, YHL, Writing – original draft: YZ, QQH, ZLZ, YHL, LL, WW, GG Writing – review & editing: GG, QQH All authors have contributed significantly to this work, reviewed and approved the final manuscript for publication, agreed on the journal to which the manuscript has been submitted, and accept responsibility for all aspects of the research. Ethics approval and consent to participate This study adhered to the tenets of the Declaration of Helsinki, followed the Comprehensive Standards for Trial Reporting (CONSORT) guidelines, and was approved by the Ethics Committee of the General Hospital of Western Theater (Ethics Approval No. 2019ky64). The study was registered at the Chinese Clinical Trials Registry (http://www.trialregister.nl, date: 22/02/2022; Number: ChiCTR2200056906). All participants provided written informed consent. Availability of data and materials The raw data for this study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. References Satapathy P, Gaidhane AM, Vadia N, et al. Prevalence of recurrent nerve injury among esophageal cancer patients undergoing esophagectomy: A systematic review and meta-analysis. Surg Open Sci. 2025;27:68–80. doi: 10.1016/j.sopen.2025.05.009 . Baranov NS, Slootmans C, van Workum F, Klarenbeek BR, Schoon Y, Rosman C. Outcomes of curative esophageal cancer surgery in elderly: A meta-analysis. World J Gastrointest Oncol. 2021;13(2):131–146. doi: 10.4251/wjgo.v13.i2.131 . Foley KA, Djaiani G. Update of the European Society of Anaesthesiology and Intensive Care Medicine evidence-based and consensus-based guideline on postoperative delirium in adult patients. Eur J Anaesthesiol. 2025;42(1):86–87. doi: 10.1097/EJA.0000000000002043 . Fenaroli F, Valerio A, Ingrassia R. Ischemic Neuroprotection by Insulin with Down-Regulation of Divalent Metal Transporter 1 (DMT1) Expression and Ferrous Iron-Dependent Cell Death. Biomolecules. 2024;14(7):856. doi: 10.3390/biom14070856 . Arda DB, Tunç KC, Bozkurt MF, Bora ES, Çiğel A, Erbaş O. Intranasal Insulin Eases Autism in Rats via GDF-15 and Anti-Inflammatory Pathways. Curr Issues Mol Biol. 2024;46(9):10530–10544. doi: 10.3390/cimb46090624 . Shpakov AO, Zorina II, Derkach KV. Hot Spots for the Use of Intranasal Insulin: Cerebral Ischemia, Brain Injury, Diabetes Mellitus, Endocrine Disorders and Postoperative Delirium. Int J Mol Sci. 2023;24(4):3278. doi: 10.3390/ijms24043278 . Badenes R, Qeva E, Giordano G, Romero-García N, Bilotta F. Intranasal Insulin Administration to Prevent Delayed Neurocognitive Recovery and Postoperative Neurocognitive Disorder: A Narrative Review. Int J Environ Res Public Health. 2021;18(5):2681. doi: 10.3390/ijerph18052681 . Huang Q, Shi Q, Yi X, Eet al. Effect of Repeated Intranasal Administration of Different Doses of Insulin on Postoperative Delirium, Serum τ and Aβ Protein in Elderly Patients Undergoing Radical Esophageal Cancer Surgery. Neuropsychiatr Dis Treat. 2023;19:1017–1026. doi: 10.2147/NDT.S405426 . Huang Q, Li Q, Qin F, et al. Repeated Preoperative Intranasal Administration of Insulin Decreases the Incidence of Postoperative Delirium in Elderly Patients Undergoing Laparoscopic Radical Gastrointestinal Surgery: A Randomized, Placebo-Controlled, Double-Blinded Clinical Study. Am J Geriatr Psychiatry. 2021;29(12):1202–1211. Li J, Li L, He J, Xu J, Bao F. The NLRP3 inflammasome is a potential mechanism and therapeutic target for perioperative neurocognitive disorders. Front Aging Neurosci. 2023;14:1072003. doi: 10.3389/fnagi.2022.1072003 . Wang Z, Meng S, Cao L, Chen Y, Zuo Z, Peng S. Critical role of NLRP3-caspase-1 pathway in age-dependent isoflurane-induced microglial inflammatory response and cognitive impairment. J Neuroinflammation. 2018;15(1):109. doi: 10.1186/s12974-018-1137-1 . Zhao S, Chen F, Wang D, Han W, Zhang Y, Yin Q. NLRP3 inflammasomes are involved in the progression of postoperative cognitive dysfunction: from mechanism to treatment. Neurosurg Rev. 2021;44(4):1815–1831. doi: 10.1007/s10143-020-01387-z . Epub 2020 Sep 12. Claxton A, Baker LD, Hanson A, et al. Long-acting intranasal insulin detemir improves cognition for adults with mild cognitive impairment or early-stage Alzheimer's disease dementia. J Alzheimers Dis. 2015;44(3):897–906. doi: 10.3233/JAD-141791. Erratum in: J Alzheimers Dis. 2015;45(4):1269-70. Rieck KM, Pagali S, Miller DM. Delirium in hospitalized older adults. Hosp Pract (1995). 2020;48(sup1):3–16. doi: 10.1080/21548331.2019.1709359. Epub 2020 Jan 18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. doi: 10.1006/meth.2001.1262 . Frias JP, Deenadayalan S, Erichsen L, et al. Efficacy and safety of co-administered once-weekly cagrilintide 2·4 mg with once-weekly semaglutide 2·4 mg in type 2 diabetes: a multicentre, randomised, double-blind, active-controlled, Phase 2 trial. Lancet. 2023;402(10403):720–730. doi: 10.1016/S0140-6736(23)01163-7 . Epub 2023 Jun 23. Xiao MZ, Liu CX, Zhou LG, Yang Y, Wang Y. Postoperative delirium, neuroinflammation, and influencing factors of postoperative delirium: A review. Medicine (Baltimore). 2023;102(8):e32991. doi: 10.1097/MD.0000000000032991 . Qureshi O, Arthur ME. Recent advances in predicting, preventing, and managing postoperative delirium. Fac Rev. 2023;12:19. doi: 10.12703/r/12-19 . Wang L, Han H, Dong L, Wang Z, Qin Y. Function of p21 and its therapeutic effects in esophageal cancer. Oncol Lett. 2021;21(2):136. doi: 10.3892/ol.2020.12397 . Epub 2020 Dec 20. Yang AJ, Choi SH, Byun HK, et al. Management of Clinical T1N0M0 Esophageal Cancer. Gut Liver. 2019;13(3):315–324. doi: 10.5009/gnl18254 . Sato H, Miyawaki Y, Lee S. [ESSENSE Concept and Perioperative Management in Esophageal Cancer Treatment]. Kyobu Geka. 2023;76(10):904–907. Craft S, Claxton A, Baker LD, et al. Effects of Regular and Long-Acting Insulin on Cognition and Alzheimer's Disease Biomarkers: A Pilot Clinical Trial. J Alzheimers Dis. 2017;57(4):1325–1334. doi: 10.3233/JAD-161256 . doi: 10.3233/JAD-161256. Powers BK, Ponder HL, Findley R, Wolfe R, Patel GP, Parrish RH 2nd; Enhanced Recovery Comparative Pharmacotherapy Collaborative. Enhanced recovery after surgery (ERAS®) Society abdominal and thoracic surgery recommendations: A systematic review and comparison of guidelines for perioperative and pharmacotherapy core items. World J Surg. 2024;48(3):509–523. doi: 10.1002/wjs.12101 . Epub 2024 Feb 13. Chen TJ, Chung YW, Chang HR, et al. Diagnostic accuracy of the CAM-ICU and ICDSC in detecting intensive care unit delirium: A bivariate meta-analysis. Int J Nurs Stud. 2021;113:103782. doi: 10.1016/j.ijnurstu.2020.103782 . Epub 2020 Oct 3. Tang Y, Le W. Differential Roles of M1 and M2 Microglia in Neurodegenerative Diseases. Mol Neurobiol. 2016;53(2):1181–1194. doi: 10.1007/s12035-014-9070-5 . Epub 2015 Jan 20. Thedim M and Vacas S: Anesthetic sensitivity and resilience in the aging brain: Implications for perioperative neurocognitive disorders. Anesthesiol Perioper Sci 3: 11, 2025. Norden DM, Godbout JP. Review: microglia of the aged brain: primed to be activated and resistant to regulation. Neuropathol Appl Neurobiol. 2013;39(1):19–34. doi: 10.1111/j.1365-2990.2012.01306.x . Franceschi C, Campisi J. Chronic inflammation (inflammaging) and its potential contribution to age-associated diseases. J Gerontol A Biol Sci Med Sci. 2014;69 Suppl 1:S4-9. doi: 10.1093/gerona/glu057 . van den Boogaard M, Slooter AJ, Brüggemann RJ,et al. Prevention of ICU delirium and delirium-related outcome with haloperidol: a study protocol for a multicenter randomized controlled trial. Trials. 2013;14:400. doi: 10.1186/1745-6215-14-400 . Walker KA, Basisty N, Wilson DM 3rd, Ferrucci L. Connecting aging biology and inflammation in the omics era. J Clin Invest. 2022;132(14):e158448. doi: 10.1172/JCI158448 . Shao A, Fei J, Feng S, Weng J. Chikusetsu saponin IVa alleviated sevoflurane-induced neuroinflammation and cognitive impairment by blocking NLRP3/caspase-1 pathway. Pharmacol Rep. 2020;72(4):833–845. doi: 10.1007/s43440-020-00078-2 . Epub 2020 Mar 2. Cho I, Koo BN, Kim SY, et al. Neuroprotective Effect of Dexmedetomidine against Postoperative Cognitive Decline via NLRP3 Inflammasome Signaling Pathway. Int J Mol Sci. 2022;23(15):8806. doi: 10.3390/ijms23158806 . Schneider E, Spetter MS, Martin E, et al, Thomas JM, Lee M, Hallschmid M, Rotshtein P, Dourish CT, Higgs S. The effect of intranasal insulin on appetite and mood in women with and without obesity: an experimental medicine study. Int J Obes (Lond). 2022;46(7):1319–1327. doi: 10.1038/s41366-022-01115-1 . Wang Y, Wang D, Yin K, et al. Lycopene attenuates oxidative stress, inflammation, and apoptosis by modulating Nrf2/NF-κB balance in sulfamethoxazole-induced neurotoxicity in grass carp (Ctenopharyngodon Idella). Fish Shellfish Immunol. 2022;121:322–331. doi: 10.1016/j.fsi.2022.01.012. Epub 2022 Jan 13. Alam A, Hana Z, Jin Z, Suen KC, Ma D. Surgery, neuroinflammation and cognitive impairment. EBioMedicine. 2018;37:547–556. doi: 10.1016/j.ebiom.2018.10.021 . Lerman I, Davis B, Huang M, et al. Noninvasive vagus nerve stimulation alters neural response and physiological autonomic tone to noxious thermal challenge. PLoS One. 2019;14(2):e0201212. doi: 10.1371/journal.pone.0201212 . Yagi M, Morishita K, Ueno A, et al. Electrical stimulation of the vagus nerve improves intestinal blood flow after trauma and hemorrhagic shock. Surgery. 2020;167(3):638–645. doi: 10.1016/j.surg.2019.09.024 . Epub 2019 Nov 21. Chao CC, Yang WK, Yeh TY, et al. Transthyretin variants impact blood-nerve barrier and neuroinflammation in amyloidotic neuropathy. Brain. 2025;148(7):2537–2550. doi: 10.1093/brain/awaf028 . Förstermann U, Sessa WC. Nitric oxide synthases: regulation and function. Eur Heart J. 2012;33(7):829 – 37, 837a-837d. doi: 10.1093/eurheartj/ehr304 . Epub 2011 Sep 1. D'Mello C, Swain MG. Immune-to-Brain Communication Pathways in Inflammation-Associated Sickness and Depression. Curr Top Behav Neurosci. 2017;31:73–94. doi: 10.1007/7854_2016_37 . Peng W, Lu W, Jiang X, et al. Current Progress on Neuroinflammation-mediated Postoperative Cognitive Dysfunction: An Update. Curr Mol Med. 2023;23(10):1077–1086. doi: 10.2174/1566524023666221118140523 . Yang XD, Wang LK, Wu HY, Jiao L. Effects of prebiotic galacto-oligosaccharide on postoperative cognitive dysfunction and neuroinflammation through targeting of the gut-brain axis. BMC Anesthesiol. 2018;18(1):177. doi: 10.1186/s12871-018-0642-1 . Dahm T, Rudolph H, Schwerk C, Schroten H, Tenenbaum T. Neuroinvasion and Inflammation in Viral Central Nervous System Infections. Mediators Inflamm. 2016;2016:8562805. doi: 10.1155/2016/8562805 . Epub 2016 May 25. Hoffmann O, Zipp F, Weber JR. Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) in central nervous system inflammation. J Mol Med (Berl). 2009;87(8):753–63. doi: 10.1007/s00109-009-0484-x . Epub 2009 May 17. Rodriguez-Smith J, Lin YC, Tsai WL, et al. Cerebrospinal Fluid Cytokines Correlate With Aseptic Meningitis and Blood-Brain Barrier Function in Neonatal-Onset Multisystem Inflammatory Disease: Central Nervous System Biomarkers in Neonatal-Onset Multisystem Inflammatory Disease Correlate With Central Nervous System Inflammation. Arthritis Rheumatol. 2017;69(6):1325–1336. doi: 10.1002/art.40055 . Epub 2017 May 10. Fan Z, Pan YT, Zhang ZY, et al. Systemic activation of NLRP3 inflammasome and plasma α-synuclein levels are correlated with motor severity and progression in Parkinson's disease. J Neuroinflammation. 2020;17(1):11. doi: 10.1186/s12974-019-1670-6 . Szabo A, O'Connell KS, Akkouh IA, et al. Elevated levels of peripheral and central nervous system immune markers reflect innate immune dysregulation in autism spectrum disorder. Psychiatry Res. 2024;342:116245. doi: 10.1016/j.psychres.2024.116245 . Epub 2024 Oct 30. Unsectioned Tables Table I. Sequence of primers used for gene amplification Gene Primer sequence (5′→3′) NLRP3 (NCBI: MK697677.1) F: CTCTGCTCAGCACCACGAG R: CTCCACATGCCGAGGATGG Caspase-1 (NCBI: NM033294.3) F: CCTGCCGTGGTGATAATGTT R: TCCACATCACAGGAACAGGC GAPDH (NCBI: NM_002046.7) F: GGAGCGAGATCCCTCCAAAAT R: GGCTGTTGTCATACTTCTCATGG Note: All primers were designed based on published sequences and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). Table II. Patient demographics and clinical data Characteristic Group C (n=30) Group I (n=30) P -value Age (years) 67 (6) 68.5 (7) 0.306 $ Sex (male) 27 (90%) 25 (83.3%) 0.706 * Body mass index (kg/m²) 21.90±2.86 23.06±2.59 0.105 & Education level 0.485 * Illiterate 25 (83.3%) 26 (86.7%) Primary 2 (6.7%) 3 (10%) Secondary 3 (10%) 1 (3.3%) MMSE score 21.00 (3) 21.00 (2) 0.706 $ ASA classification 0.605 ＃ II 17 (56.7%) 15 (50%) III 13 (43.3%) 15 (50%) Operation time (min) 265.93±54.35 265.83±37.63 0.993 & Preoperative hemoglobin concentration (g/l) 124.90±11.75 129.00±11.71 0.181 & Total intraoperative infusion (ml) 2600 (600) 2300 (925) 0.733 $ Intraoperative blood loss (ml) 200 (200) 200 (100) 0.318 $ Urine output (ml) 200 (113) 200 (200) 0.400 $ NRS score T1 2.50 (1) 3.00 (1) 0.447 $ T2 1.50 (1) 2.00 (1) 0.650 $ T3 1.00 (1) 1.00 (1) 0.861 $ Notes: Data are presented as mean ± SD, median (interquartile range), or percentage (proportion). $ Mann–Whitney U test; *Fisher’s exact test; & Independent t -test; ＃ Pearson χ 2 test. Abbreviations: T1: postoperative day 1; T2: postoperative day 2; T3: postoperative day 3. MMSE: Mini-Mental State Examination; ASA: American Society of Anesthesiologists; NRS: numerical rating scale Table III. Incidence of POD during the first three postoperative days Postoperative day Group C (n=30) Group I (n=30) cOR (95% CI) P -value 1 AM 14 (46.7%) 5 (16.7%) 4.38 (1.32–14.50) 0.012 a ＃ 1 PM 13 (43.3%) 5 (16.7%) 3.82 (1.15–12.71) 0.024 a ＃ 2 AM 11 (36.7%) 4 (13.3%) 3.76 (1.04–13.65) 0.037 a ＃ 2 PM 8 (26.7%) 2 (6.7%) 5.09 (0.98–26.43) 0.038 a ＃ 3 AM 4 (13.3%) 1 (3.3%) 4.46 (0.47–42.51) 0.351＊ 3 PM 2 (6.7%) 1 (3.3%) 2.07 (0.18–24.15) 1.00＊ Within 3 days of surgery 14 (46.7%) 5 (16.7%) 4.38 (1.32–14.50) 0.012 a ＃ Notes: Data are presented as percentage (proportion). a P < 0.05 for comparison between two groups. ＃ Pearson χ 2 test; *Fisher’s exact test. Abbreviations: POD: postoperative delirium Table IV. Expression levels of key molecules in the NLRP3/caspase-1/IL-1 β pathway Group C (n=30) Group I (n=30) F (Group)/ P -value F (Time) / P- value F (Group×Time) / P- value NLRP3 mRNA T0 25.40±1.50 26.02±2.26 F =29.76 P <0.001 F =231.91 P <0.001 F =29.27 P <0.001 T1 35.66±2.02 a 30.88±1.44 ab T2 31.41±1.46 a 28.80±3.18 ab T3 28.04±2.88 a 27.61±2.90 a Caspase-1 mRNA T0 23.98±3.60 23.10±3.37 F =10.31 P= 0.004 F =107.50 P <0.001 F =4.09 P= 0.002 T1 31.05±2.09 a 28.70±1.80 ab T2 28.09±4.49 a 25.67±4.11 ab T3 25.12±1.47 24.84±1.92 a IL-1β (pg/ml) T0 31.01±1.91 31.21±2.10 F =105.17 P <0.001 F =338.75 P <0.001 F =30.46 P <0.001 T1 51.39±3.82 a 43.15±3.66 ab T2 45.32±3.70 a 37.73±2.68 ab T3 34.80±4.12 a 34.05±3.66 a Notes: Data are expressed as mean ± SD. Comparisons between the groups were performed using the Dunnett -t test. Repeated measurements were compared using repeated measure ANOVA. a P <0.05 vs. T0; b P <0.05 vs. Group C; * multiplication symbol. Abbreviations: T0: before the first intervention; T1: postoperative day 1; T2: postoperative day 2; T3: postoperative day 3. Table V. Average blood glucose values at different time points (mmol/l) Time point Group C (n=30) Group I (n=30) P -value T0 5.41+0.28 5.35+0.30 0.406 T4 5.70+0.43 5.82+0.44 0.286 Notes: Data are expressed as mean ± SD. Comparisons between the groups were performed using the independent t -test. Abbreviations: T0: before the first intervention; T4: the period from the first intervention to the last intervention. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 18 Apr, 2026 Read the published version in Inflammation and Regeneration → Version 1 posted Editorial decision: Revision requested 09 Mar, 2026 Reviews received at journal 08 Mar, 2026 Reviews received at journal 12 Feb, 2026 Reviewers agreed at journal 10 Feb, 2026 Reviewers agreed at journal 05 Feb, 2026 Reviewers invited by journal 05 Feb, 2026 Editor assigned by journal 29 Jan, 2026 Submission checks completed at journal 28 Jan, 2026 First submitted to journal 21 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8658457","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":586347780,"identity":"75d41eed-f31b-46be-85d1-978eedcbdb71","order_by":0,"name":"YONG ZHANG","email":"","orcid":"","institution":"The General Hospital of Western Theater Command","correspondingAuthor":false,"prefix":"","firstName":"YONG","middleName":"","lastName":"ZHANG","suffix":""},{"id":586347781,"identity":"a56693ce-a24a-4959-8c25-5cddc577c2e8","order_by":1,"name":"WEI WU","email":"","orcid":"","institution":"The General Hospital of Western Theater Command","correspondingAuthor":false,"prefix":"","firstName":"WEI","middleName":"","lastName":"WU","suffix":""},{"id":586347782,"identity":"b5919b39-1cc5-4369-8cd8-8d40f4c4897d","order_by":2,"name":"ZULING ZHONG","email":"","orcid":"","institution":"The General Hospital of Western Theater Command","correspondingAuthor":false,"prefix":"","firstName":"ZULING","middleName":"","lastName":"ZHONG","suffix":""},{"id":586347783,"identity":"a2a1fb9b-024f-4cb0-a170-7424e72917bc","order_by":3,"name":"yinghai liu","email":"","orcid":"","institution":"The General Hospital of Western Theater Command","correspondingAuthor":false,"prefix":"","firstName":"yinghai","middleName":"","lastName":"liu","suffix":""},{"id":586347784,"identity":"da9de1b7-26c6-4e2d-9d25-5f74d263dddd","order_by":4,"name":"GU GONG","email":"","orcid":"","institution":"The General Hospital of Western Theater Command","correspondingAuthor":false,"prefix":"","firstName":"GU","middleName":"","lastName":"GONG","suffix":""},{"id":586347785,"identity":"7510c7d4-fdb9-4ba4-92a2-db668601179b","order_by":5,"name":"QINGQING HUANG","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYBACfvmHzQ8+/mOTY2NvIFKLZEPyMcMZbHzGfDwHiNRicCAtQZqHTS5xnkQC0VrOGBjw8JgZs0k+3niDocYmmrDDDvYYPJCQSJNjk04rtmA4lpbbQEgL32EeAyA4ZswmnWMmwdhwmLAWhmM8BhIJCf8T2yTPEKlF4AxbgsSBA2yJbRI8RGqRnMF8zLCxgc2YjQfolwRi/MIvwdj8+G8Dm5x8++GNNz7U2BDhFyRgQHTUIGkhVccoGAWjYBSMDAAApGg8PpI3peoAAAAASUVORK5CYII=","orcid":"","institution":"The General Hospital of Western Theater Command","correspondingAuthor":true,"prefix":"","firstName":"QINGQING","middleName":"","lastName":"HUANG","suffix":""}],"badges":[],"createdAt":"2026-01-21 10:46:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8658457/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8658457/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s41232-026-00418-4","type":"published","date":"2026-04-18T15:59:12+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":102214580,"identity":"66fb0a14-e8a7-43b1-b0fd-c0466e0680fb","added_by":"auto","created_at":"2026-02-09 12:43:49","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":51443,"visible":true,"origin":"","legend":"\u003cp\u003eExtraction of peripheral blood mononuclear cells\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8658457/v1/5958d4982835f1be288132bc.jpg"},{"id":102214579,"identity":"a2dec43d-8a6b-406d-b1bc-a35a9fa28a32","added_by":"auto","created_at":"2026-02-09 12:43:49","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":99373,"visible":true,"origin":"","legend":"\u003cp\u003eStudy flow diagram\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8658457/v1/96775dee420fb8e026d73f09.jpg"},{"id":107350981,"identity":"acc556f0-98ce-41dd-96b4-51d46e74bc5d","added_by":"auto","created_at":"2026-04-20 16:07:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":793968,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8658457/v1/4b76cb23-af9a-4944-a5ee-7135c1223bc0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effects of intranasal long-acting insulin pretreatment on postoperative delirium and the NLRP3/caspase-1/IL-1β pathway in older patients with esophageal cancer Running title: intranasal long-acting insulin and postoperative delirium","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEsophageal cancer (EC) is a common gastrointestinal malignancy in older individuals, with radical surgery remaining the primary treatment approach [1]. However, older patients are more prone to postoperative complications, particularly postoperative delirium (POD) due to age-related physiological reserve decline [2]. POD delays postoperative recovery, prolongs hospital stay, increases healthcare costs, and is associated with a significant increased risk of adverse events such as falls, tube dislodgement, and infection. In severe cases, POD may lead to long-term cognitive impairment [3].\u003c/p\u003e\n\u003cp\u003eRecent evidence has shown that insulin exerts significant neuroprotective and anti-inflammatory effects beyond its role in glycemic control. These include enhancing synaptic plasticity, inhibiting neuronal apoptosis, and suppressing proinflammatory cytokine release [4,5]. Intranasal administration of insulin, a non-invasive route with rapid access to the central nervous system, has shown considerable advantages in both animal and clinical studies. This method bypasses the blood-brain barrier and delivers insulin directly to the brain tissue via the olfactory and trigeminal perivascular pathways, effectively targeting key regions such as the hippocampus [6]. Compared with intravenous administration, intranasal delivery avoids peripheral accumulation and reduces the risk of systemic hypoglycemia. It also enables more efficient and direct targeting of the CNS, enhancing its neuroprotective potential [7]. Therefore, intranasal insulin pretreatment is emerging as a promising strategy to reduce POD risk in older patients undergoing esophagectomy [8]. We previously demonstrated that multiple preoperative intranasal rapid-acting insulin administrations (30 U twice daily for 2 days preoperatively) significantly reduced the incidence of POD and peripheral levels of interleukin-1β\u0026nbsp;(IL-1β) in older patients with gastrointestinal tumors\u0026nbsp;[9]. However, the requirement for repeated dosing in such regimens may pose challenges for clinical implementation. In contrast, the use of long-acting insulin formulations, such as insulin detemir, offers the potential for sustained central nervous system exposure with a simplified single-dose preoperative administration, which may improve practicality and adherence while maintaining efficacy. The distinct pharmacokinetic profile of long-acting insulin could lead to more prolonged modulation of neuroinflammatory pathways, a hypothesis that remains to be rigorously tested.\u003c/p\u003e\n\u003cp\u003eThe NLRP3/caspase-1/IL-1β\u0026nbsp;signaling pathway is a key mediator of inflammatory responses and plays an important role in POD pathogenesis [10]. Perioperative stressors, such as infection, surgical trauma, and tissue injury, can activate the NLRP3 inflammasome, which in turn promotes caspase-1-mediated cleavage of pro-IL-1β\u0026nbsp;and pro-IL-18 into their active forms. These cytokines may then cross a disrupted BBB, activate microglia and astrocytes, and initiate a neuroinflammatory cascade. The cascade contributes to synaptic dysfunction, altered glutamate metabolism, and neuronal injury—ultimately impairing cognitive functions such as learning, memory, and attention [11,12].\u003c/p\u003e\n\u003cp\u003eTherefore, elucidating how intranasal insulin modulates the NLRP3/caspase-1/IL-1β\u0026nbsp;axis may provide crucial mechanistic insights into its role in preventing POD and support the development of individualized perioperative immunomodulatory strategies. Building upon our previous clinical findings [8,9], the present study was conducted in an independently recruited cohort of elderly esophageal cancer patients, using a single 40 U preoperative dose of intranasal long-acting insulin detemir [13]. This regimen contrasts with the multi-dose, rapid-acting insulin approach used in prior studies and aims to evaluate the feasibility and efficacy of a simplified dosing strategy. Furthermore, unlike our earlier investigations that primarily focused on serum inflammatory or neurodegenerative biomarkers, this work further examined the dynamic expression of NLRP3 and caspase-1 mRNA in peripheral blood mononuclear cells (PBMCs), aiming to elucidate the molecular mechanism by which intranasal long-acting insulin downregulates the NLRP3/caspase-1/IL-1βinflammasome pathway and exerts neuroprotective effects.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study adhered to the principles of the Declaration of Helsinki, followed the Comprehensive Standards for Trial Reporting (CONSORT) guidelines, and was approved by the Ethics Committee of the General Hospital of Western Theater (Ethics Approval No. 2019ky64). The study was registered in the Chinese Clinical Trials Registry (http://www.trialregister.nl, date: 22/02/2022; Number: ChiCTR2200056906). All participants provided written informed consent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eParticipants\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe enrolled 60 older patients who underwent radical resection of esophageal cancer at our hospital from February 2022 to October 2022. The inclusion criteria were: age ≥ 65 years, American Society of Anesthesiologists (ASA) grade I–III, body mass index (BMI) ≤ 28 kg/m2, planned radical esophagectomy under general anesthesia, and provision of written informed consent. The following exclusion criteria applied: current participation or participation in another interventional clinical trial within the past 3 months, patients with contraindications to intranasal insulin administration (such as nasal defects and lesions), history of hypertension or diabetes, history of insulin allergy, history of alcoholism or drug abuse, inability to communicate before surgery (coma, deep dementia, language impairment, or severe visual and hearing impairment), low Mini-Mental State Examination (MMSE) score (defined as \u0026lt; 17 for illiterate individuals, \u0026lt; 20 for those with a primary school education, and \u0026lt; 24 for those with a secondary school [including technical secondary school] education), severe liver and kidney dysfunction, and cardiovascular and cerebrovascular diseases. The exit criteria were as follows: insulin administered non-nasally during the study, reoperation or endotracheal intubation performed within 3 days post-surgery, unexpected adverse events (including drug allergies, anesthesia, and surgical complications), and loss to follow-up.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRandomization\u003c/strong\u003e\u003cstrong\u003e, i\u003c/strong\u003e\u003cstrong\u003enterventions\u003c/strong\u003e\u003cstrong\u003eand blinding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eComputer-generated randomization tables were employed for patient allocation. The resulting assignment sequence was concealed using sequentially numbered, sealed, opaque envelopes. Participants were randomly assigned to one of two groups: the control group (Group C; n=30) received 0.3 ml of 0.9% saline solution, and the intervention group (Group I; n=30) received 0.4 ml of long-acting insulin detemir (30 U), both administered via the nasal route. At 17:00 on the day preceding surgery, all patients received their respective preparations through a nasal mucosal nebulization device with a syringe (Wuxi Meihao Life Technology Co., Ltd., Jiangsu, China).\u003c/p\u003e\n\u003cp\u003eThe study medications were prepared by an independent researcher not involved in patient anesthesia or outcome assessment. Long-acting insulin (3 ml, 300 U) was supplied by Novo Nordisk (China) Pharmaceutical Co., Ltd (Tianjin, China). To ensure blinding, participants, anesthesiologists, surgeons, nursing staff, follow-up personnel, and data analysts remained unaware of group assignments throughout the study period. The allocation details were disclosed only after database lock and completion of all statistical analyses.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethod of anesthesia\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBefore anesthesia, we established peripheral venous access, performed electrocardiography, and attached a pulse oximetry probe to the patient. Blood pressure was monitored via radial artery puncture and catheterization. We performed central venous puncture catheterization to monitor central venous pressure and guide transfusion. Bispectral index (BIS) and regional oxygen saturation were measured intraoperatively.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAnesthesia induction: sufentanil 0.4 μg/kg, etomidate 0.3 mg/kg, and rocuronium 0.6 mg/kg were administered as muscle relaxants. Mechanical ventilation was performed via endotracheal intubation under guidance by a video laryngoscope. The tidal volume was 8–10 ml/kg (6–10 ml/kg for pneumothorax), with a positive end-expiratory pressure at 5 cm H\u003csub\u003e2\u003c/sub\u003eO (1 cm H\u003csub\u003e2\u003c/sub\u003eO=0.098 kp-A). The inhalation-to-breath ratio was 1:2. The inhaled oxygen concentration fraction was 0.6. After intubation, the patient was placed in the left lateral position. At the beginning of the procedure, we simultaneously established CO\u003csub\u003e2\u003c/sub\u003e artificial pneumothorax and single-lung ventilation, maintaining the intrathoracic pressure at 8–10 mmHg. During the thoracoscopic phase, PetCO\u003csub\u003e2\u003c/sub\u003e was maintained within the target range by adjusting the tidal volume and respiratory rate. Artificial pneumothorax was discontinued, and double-lung ventilation was resumed following intrathoracic esophageal free dissection and lymph node dissection.\u003c/p\u003e\n\u003cp\u003eAnesthesia maintenance: Propofol 3 mg/(kg·h) and remifentanil 10–20 μg/(kg·h) were administered via continuous intravenous infusion, rocuronium 0.2 mg/kg was administered intermittently via intravenous injection, and 1%–2% sevoflurane was administered via inhalation to maintain the BIS value between 40 and 60. During surgery, each patient was insulated with an inflatable thermal blanket to maintain body temperature at approximately 37°C. After stabilization of vital signs and respiratory recovery, the tracheal catheter was removed, and the patients were transferred to the post-anesthesia care unit for follow-up diagnosis and treatment. All patients who underwent surgery were administered intravenous controlled analgesia: sufentanil (100 μg+), ondansetron (16 mg), and butorphanol (5 mg), diluted to 100 ml in a medical-grade 0.9% sodium chloride injection. Parameter settings included no background infusion, a basal rate of 3 ml/h, a patient-controlled analgesia dose of 0.5 ml, and a lockout interval of 15 min.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe clinical characteristics and demographic data of all patients were recorded, including age, sex, BMI, MMSE score, surgery time, ASA classification, preoperative hemoglobin concentration, total fluid infusion volume during surgery, intraoperative blood transfusion volume, intraoperative bleeding volume, intraoperative urine volume, and digital rating scale score for the first 3 days after surgery.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimary endpoint\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePatients completed a preoperative cognitive status assessment based on the MMSE score prior to surgery. The main outcome was the incidence of delirium within the first 3 days after surgery.\u003c/p\u003e\n\u003cp\u003eThe researchers underwent professional training before participating in the study, and the patients were evaluated by medical personnel who were proficient in the Confusion Assessment Method for the Intensive Care Unit (CAM-ICU). Two assessments were conducted twice (8:00–10:00 am and 18:00–20:00 pm) for 3 days post-surgery. The CAM-ICU [14] criteria comprise four aspects: acute changes or repeated fluctuations in consciousness status, attention deficit, thinking disorder, and changes in consciousness clarity. A positive delirium diagnosis was determined by the presence of the first two features, combined with either the third or fourth feature.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSecondary endpoints\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEnzyme-linked immunosorbent assay\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBefore intervention (T0) and at 1–3 days post-surgery (T1–T3), peripheral venous blood samples were collected from the patients and centrifuged at 3000 × g for 15 min to separate the serum. The serum was stored at -80°C until analysis. The concentration of IL-1 β was determined using an enzyme-linked immunosorbent assay kit (Thermo Fisher, USA), in accordance with the manufacturer’s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 3 ml of venous blood was collected from patients at T0–T3 into EDTA anticoagulant tubes. Human peripheral blood was mixed with lymphocyte separation solution (Sigma, USA) at a 1:1 ratio and centrifuged (LB-5000 medical centrifuge; Shanghai Zhaodi Biotechnology Co., Ltd.) at 3000 g/m for 10 min to separate peripheral blood mononuclear cells (Figure 1). TRIzol reagent (Invitrogen) was added to lyse the cells and total RNA was extracted. RNasin was added to samples with OD260/280 values between 1.6 and 2.0, and the samples were stored in a -80°C freezer until analysis. Next, 1 μg RNA was used as a template for cDNA synthesis. The reaction mixture volume was 20 μl. The reaction conditions were as follows: 37°C for 60 min and 95°C for 5 min. The obtained cDNA was stored at -20°C. The experiment was performed according to the instructions of a reverse transcription kit (Shanghai Sangong Biotechnology Co., LTD). The primers were designed and synthesized by Shanghai Sangong Biotechnology Co., LTD. The primer sequences are shown in Table I. Real-time PCR was performed using a PCR kit (Shanghai Sangong Biotechnology Co., LTD) with a reaction system of volume 20 μl containing 10 μl of 2x real-time PCR buffer, 0.4 μl of upstream and downstream primers, 2 μl of cDNA template, and 20 μl of water treated with diethylpyrocarbonate. The reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 93°C for 20 sec, annealing at 56°C for 20 sec, and extension at 75°C for 30 sec (40 cycles). Two replicates were performed for each sample, with GAPDH as the internal reference gene. The results were analyzed using the CFX Manager Dx Software version 3.0. The expression of the target gene was reflected by the integrated optical density value, and the fold of expression change was calculated using 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△△\u003c/sup\u003e\u003csup\u003eCt\u003c/sup\u003e (△△Ct=average\u0026nbsp;△\u0026nbsp;Ct of Group I - average\u0026nbsp;△Ct of Group C). The 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△△\u003c/sup\u003e\u003csup\u003eCt\u0026nbsp;\u003c/sup\u003emethod was used to determine the expression level of the target gene relative to that of the reference gene\u0026nbsp;[15]. The primer sequences used for gene amplification are listed in Table I.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdverse reactions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA continuous blood glucose monitoring system (Changsha Sinocare Biosensing Co., Ltd., China) was used to dynamically monitor blood glucose levels during the study period. Based on the American Diabetes Association dynamic blood glucose standard, a blood glucose level below 3.9 mmol/l was defined as hypoglycemia [16]. The blood glucose meter was used to record the time of hypoglycemia and the average blood glucose level.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt our hospital, over the past 3 years, the incidence of POD among older patients undergoing radical resection for esophageal cancer has reached 48%. In the pre-experiment, the incidence of POD was 10% after intranasal administration of 40 U of long-acting insulin. A significance level of α=0.05 (two-tailed) and a power of 1-β=0.9 were used to calculate the required sample. Power Analysis and Sample Size (PASS) software, version 11.0 (NCSS Statistical Software, Kaysville, UT, USA) was used, yielding a sample size of 50. To account for an anticipated 20% loss to follow-up, the sample size was adjusted to 60 patients.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eData analysis was performed using IBM SPSS Statistics version 26.0 (IBM Corp., Armonk, NY, USA). Analyses were based on the intent-to-treat outcomes. For quantitative data, the Shapiro–Wilk test and Levene's test were used to examine the normal distribution and homogeneity of variance. Quantitative data that conform to normal distribution are expressed as mean±standard deviation and were analyzed using an independent sample t-test. Quantitative data that do not follow a normal distribution are presented as median (interquartile range) and were analyzed using the Mann–Whitney U test. Count data are presented as frequency and percentage and were analyzed using the χ2 test or Fisher's exact test. Repeated measures analysis of variance was used to determine the significance of differences in the average NLRP3 mRNA and caspase-1 mRNA expression and IL-1β concentration over time among the groups. Comparisons between the groups were performed using Dunnett's \u003cem\u003et\u003c/em\u003e-test. For all tests, results with \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 were considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec2\" class=\"Section2\"\u003e \u003ch2\u003eParticipants\u0026rsquo; characteristics\u003c/h2\u003e \u003cp\u003eA total of 67 patients were screened for eligibility. Of these, seven declined to participate and were subsequently excluded. The remaining 60 eligible patients were randomly assigned to the control group (Group C, n\u0026thinsp;=\u0026thinsp;30) or the insulin group (Group I, n\u0026thinsp;=\u0026thinsp;30). Three patients were excluded from the per-protocol analysis: two in Group C who received insulin through alternative routes and one in Group I who underwent surgery with a duration of over 6 hours. However, all 60 randomized patients were included in the intention-to-treat analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Baseline demographic and clinical characteristics were comparable between groups, confirming successful randomization (Table II).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePrevalence of POD\u003c/h2\u003e \u003cp\u003ePatients who received preoperative intranasal insulin exhibited a lower incidence of POD across multiple time points compared with those in the control group. On postoperative day 1, the incidence of POD was significantly reduced in Group I at both morning and evening assessments (16.7% vs. 46.7%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.012; and 16.7% vs. 43.3%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.024, respectively). This protective effect persisted on day 2, with Group I again showing fewer cases in both time periods (13.3% vs. 36.7%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.037; and 6.7% vs. 26.7%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.038). Although differences on day 3 were not statistically significant, the cumulative incidence of POD over the first three postoperative days remained significantly lower in the insulin group (16.7% vs. 46.7%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.012) (Table III). These results suggest that intranasal insulin pretreatment may offer short-term neuroprotective benefits in preventing POD among elderly patients.\u003c/p\u003e \u003cp\u003e \u003cb\u003eComparison of NLRP3 mRNA and caspase-1 mRNA expression levels and IL-1β concentration between the groups at different time points\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCompared with Group C, the expression of NLRP3 mRNA and caspase-1 mRNA and the concentration of IL-1β were significantly downregulated in Group I at T1, T2, and T3 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Compared to T0, the expression of NLRP3 mRNA and caspase-1 mRNA and the concentration of IL-1β were upregulated in both patient groups at T1, T2, and T3, with significant differences observed (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Table IV). These findings imply that intranasal insulin may suppress peripheral inflammatory responses, possibly through inhibition of the NLRP3/caspase-1/IL-1β signaling pathway, which has been implicated in the pathogenesis of neuroinflammation and POD.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAdverse events\u003c/h3\u003e\n\u003cp\u003eNo episodes of hypoglycemia were reported in either group throughout the study period. Mean blood glucose levels remained stable and comparable between the two groups before the first intervention and during the entire observation period (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Table V). These data confirm that intranasal delivery of rapid-acting insulin is safe and well tolerated in elderly surgical patients, without exerting significant effects on systemic glucose homeostasis.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePOD involves impaired consciousness resulting from both surgical and individual factors. It is a common postoperative complication in older individuals, usually occurring within 1\u0026ndash;3 days postoperatively [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. POD is characterized by impaired orientation, decreased attention, and changes in cognitive function [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. POD increases the risk of further complications, prolongs hospitalization, and increases healthcare costs [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. At present, esophageal cancer is the eighth most common malignant tumor globally and the sixth most common cause of cancer-related deaths [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Multidisciplinary comprehensive treatment based on radical resection of esophageal cancer has become an important approach for managing POD [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Central nervous system complications in older patients after radical surgery for esophageal cancer remain a common concern [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In this study, 14 patients (46.7%) developed POD within 3 days of surgery, which is consistent with previous findings [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is important to emphasize that the present study represents a methodological and mechanistic extension, rather than a repetition, of our previous work. Earlier trials established the feasibility and optimal 30 U intranasal insulin dose for POD prevention using a multiple-dose regimen of rapid-acting insulin (twice daily for 2 days preoperatively) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In contrast, the current study employed a single preoperative dose of long-acting insulin detemir (30 U), which not only simplifies the clinical workflow and improves patient compliance but may also provide more sustained central nervous system exposure. The current study, conducted in a newly enrolled and independent patient cohort in 2022, confirmed the protective trend of this simplified long-acting insulin regimen and, importantly, demonstrated for the first time that NLRP3 and caspase-1 mRNA expression in PBMCs decreased significantly following single-dose long-acting insulin pretreatment, consistent with the reduction in serum IL-1β. These findings suggest that this optimized single-dose long-acting insulin regimen may attenuate perioperative neuroinflammation by suppressing NLRP3/caspase-1 inflammasome activation, thus providing a mechanistic link between systemic inflammation and neurocognitive protection. Compared with our earlier research, which focused mainly on serum cytokines or neurodegenerative markers (Tau/Aβ) using multiple rapid-acting insulin doses, the present study offers cellular-level and pathway-specific evidence, clarifying the causal chain from single-dose long-acting insulin pretreatment to inflammasome inhibition and reduced POD incidence.\u003c/p\u003e \u003cp\u003eIt is particularly noteworthy that although recent research indicates long-term use of regular insulin provides superior cognitive improvement compared to insulin detemir[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], the single-dose regimen of long-acting insulin detemir employed in this study also demonstrated significant efficacy in preventing POD. When compared to the effectiveness rates reported in our team's previous studies utilizing a multiple-dose rapid-acting insulin regimen, the single-dose approach in the current study demonstrates a comparable protective trend. This finding provides new support for the practicality and clinical value of long-acting insulin formulations in perioperative applications, while suggesting that the selection of different insulin preparations requires comprehensive consideration based on specific clinical scenarios and treatment objectives.\u003c/p\u003e \u003cp\u003eInsulin pretreatment was initiated as a single dose on the day preceding surgery, a decision based on clinical feasibility and the pharmacokinetic profile of long-acting insulin detemir. This approach aligns with standard practice, as patients are typically admitted 1\u0026ndash;2 days before surgery in most clinical settings, making this timeframe both practical and representative of real-world clinical workflows. The single-dose regimen with long-acting insulin represents a significant simplification compared to the multiple-dose rapid-acting insulin schedules used in previous studies, potentially enhancing clinical adoption. Moreover, the approach aligns with the principles of Enhanced Recovery After Surgery, which emphasize timely, targeted, and efficient preoperative interventions [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The single-dose long-acting insulin regimen used in this study particularly exemplifies these principles by minimizing preoperative interventions while maintaining efficacy. While a longer duration of pretreatment might further enhance the therapeutic effects, our regimen balances biological plausibility with clinical practicality. Notably, there is currently no universally accepted gold standard for the assessment of POD. The CAM-ICU remains one of the most widely used tools in clinical research [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In our study, all evaluators underwent standardized training to ensure consistency and reliability in their assessments. Given that POD most commonly occurs within the first 1\u0026ndash;3 days postoperatively, and considering the constraints of routine clinical care, we conducted assessments twice daily during this critical postoperative period. Although this frequency of assessments may have missed some transient or fluctuating symptoms, a meaningful reduction in POD incidence was observed in the insulin-treated group. Future studies may benefit from incorporating more frequent or even continuous patient monitoring, potentially through interdisciplinary collaboration, to better characterize the temporal relationship between single-dose long-acting insulin pretreatment and the onset or progression of POD and its ongoing impact on neurocognitive function.Currently, various pathophysiological mechanisms underlying the occurrence of POD have been proposed, with the inflammatory response increasingly recognized as a key contributor [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The innate immunity of the central nervous system is primarily mediated by microglia, which is essential in immune surveillance and communication between the immune system and brain. After being stimulated by ischemia or infection, microglia secrete pro-inflammatory cytokines such as IL-1β and TNF-α [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. These pro-inflammatory cytokines interact with astrocytes, neurons, and oligodendrocytes to regulate neuroinflammation. While transient activation of microglia is beneficial in responding to peripheral infection, aging can impair the function of microglia, increase their sensitivity to pro-inflammatory activation, and subsequently trigger an inflammatory cascade reaction, leading to disruption of the central nervous system microenvironment and ultimately affecting cognitive function [11.29]. In summary, a moderate increase in central nervous system inflammation and changes in microglial cell function during aging can affect behavior and cognition, leading to a higher risk of POD in older patients [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe NLRP3 inflammasome is an intracellular multiprotein complex composed of the nucleotide-binding oligomerization domain-like receptor protein, pro-caspase-1, and apoptosis-associated spike-like protein containing a caspase recruitment domain, with a molecular weight of approximately 700 kDa [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. It is an important component of the innate immune response. NLRP3 can regulate the activation of caspase-1 and promote the cleavage, maturation, and secretion of cytokine precursors\u0026mdash;pro-IL-1β and pro-IL-18\u0026mdash;during natural immune defense [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. A recent study [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] revealed that the NLRP3 inflammasome plays a critical role in the inflammatory pathway, leading to cognitive impairment. Wang et al. [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]exposed healthy male C57BL/6 mice aged 6\u0026ndash;8 months and 14 months to 1.5% isoflurane for 2 h. Some mice underwent intraperitoneal injection with the caspase-1 specific inhibitor Ac-Tyr-Val-Ala-Asp-chloromethylketone (8 mg/kg) 30 min before isoflurane exposure. Brain tissue was collected 24 hours later for western blotting to determine the expression of NLRP3, IL-1β, and IL-18 in the hippocampus. One week later, the mice were subjected to the Morris water maze test. The results indicated that NLRP3 activation in the brains of older mice may be associated with isoflurane-induced hippocampal inflammation and cognitive impairment. Shao et al. [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] also evaluated the neuroprotective activity of chitohexaose (ChIV) on sevoflurane-induced cognitive impairment in older rats and found that ChIV can exert neuroprotective effects by blocking the NLRP3/caspase-1 pathway. In summary, the NLRP3 inflammasome plays an important role in the inflammatory response associated with POD. In this study, both groups of patients experienced POD. The expression of NLRP3 mRNA and caspase-1 mRNA in monocytes was upregulated, and the concentration of IL-1β in peripheral blood increased, indicating that the NLRP3/caspase-1 pathway is involved in the occurrence of POD.\u003c/p\u003e \u003cp\u003eIn the present study, POD was observed in both groups of patients. We detected a significant upregulation of NLRP3 and caspase-1 mRNA expression in peripheral blood mononuclear cells (PBMCs), accompanied by elevated levels of IL-1β in the peripheral circulation. These findings suggest that activation of the NLRP3/caspase-1 signaling pathway may be involved in the pathogenesis of POD. Although our study primarily focused on peripheral immune activation and did not directly assess neuroinflammation, growing evidence indicates that the peripheral immune system and the CNS are closely interconnected through multiple bidirectional mechanisms [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Under physiological conditions, the BBB serves as a selective barrier that effectively limits the entry of large molecules and immune cells into the brain. However, under pathological states such as stress, systemic inflammation, surgical trauma, or aging, the permeability of the BBB can be compromised [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. This disruption allows proinflammatory mediators, including IL-1β, IL-6, and TNF-α, to gain access to the CNS, where they activate glial cells and initiate neuroinflammatory cascades [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In addition to humoral transmission, peripheral immune signals can influence the CNS via neural routes\u0026mdash;such as the vagus nerve\u0026mdash;or through secondary messengers released by cerebrovascular endothelial cells [\u003cspan additionalcitationids=\"CR37 CR38\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Importantly, peripheral inflammation is frequently associated with CNS dysfunction [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Postoperative increases in circulating cytokines correlate with cognitive decline and the upregulation of neuroinflammatory markers [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Conversely, CNS inflammation can result in the release of cytokines into the peripheral bloodstream, establishing a bidirectional inflammatory feedback loop between the brain and the periphery [\u003cspan additionalcitationids=\"CR44\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Within this context, PBMCs function as crucial immune sensors and effectors. The expression of inflammasome components (e.g., NLRP3, caspase-1) and proinflammatory cytokines such as IL-1β by PBMCs reflects the systemic immune status and may also serve as an indirect indicator of CNS inflammation [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Therefore, PBMC-derived molecular markers may represent accessible and informative peripheral biomarkers for investigating postoperative neuroinflammation and its related complications, including POD, with potential value in both clinical monitoring and mechanistic research.\u003c/p\u003e\n\u003ch3\u003eStudy limitations\u003c/h3\u003e\n\u003cp\u003eThis study has several limitations. First, it focused solely on the expression of NLRP3/caspase-1/IL-1β pathway-related markers in PBMCs, without directly assessing inflammatory responses within the central nervous system or evaluating NLRP3 and caspase-1 expression at the protein level. Given the complex interplay between peripheral and central immune responses, and the importance of confirming transcriptional findings at the translational level, future studies should include simultaneous assessment of inflammatory markers in both compartments and at both mRNA and protein levels to better elucidate the mechanisms of inflammasome activation. Secondly, this is a single-center study with a small cohort size. It is necessary to further verify the universality of the research results through multi-center, large-sample clinical trials.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003ePreoperative single-dose intranasal insulin administration reduces the incidence of POD and inflammatory response in older patients undergoing radical esophagectomy for esophageal cancer. This effect may be associated with the downregulation of the NLRP3/caspase-1 signaling pathway.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ebispectral index (BIS)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ebody mass index (BMI)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003echitohexaose (ChIV)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eComprehensive Standards for Trial Reporting (CONSORT)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eConfusion Assessment Method for the Intensive Care Unit (CAM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eICU)\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eesophageal cancer (EC)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003einterleukin (IL)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMini\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMental State Examination (MMSE)\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003enucleoside\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ebinding oligomerization domain-like receptor protein 3 (NLRP3)\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003epostoperative delirium (POD)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePower Analysis and Sample Size (PASS)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003equantitative reverse transcription\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epolymerase chain reaction (qRT-PCR)\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eEnhanced Recovery After Surgery (ERAS)\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Editage (www.Editage.com) for English language editing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Hospital Management Project of the General Hospital of the Western Theater Command (grant number 2024-YGLC-B12), the Neurosurgery Anesthesia Specialist Center and the Key disciplines of joint logistics support .\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data of this study have been uploaded to www.medresman.org.cn. They are also available from the corresponding author on reasonable request. The data have not been previously presented orally or by poster at scientific meetings\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: YZ, QQH, ZLZ, WW, GG\u003c/p\u003e\n\u003cp\u003eSupervision: DL: \u0026nbsp;YHL,ZLZ\u003c/p\u003e\n\u003cp\u003eFormal analysis: WW, ZLZ, YHL,\u003c/p\u003e\n\u003cp\u003eWriting – original draft: YZ, QQH, ZLZ, YHL, LL, WW, GG\u003c/p\u003e\n\u003cp\u003eWriting – review \u0026amp; editing: GG, QQH\u003c/p\u003e\n\u003cp\u003eAll authors have contributed significantly to this work, reviewed and approved the final manuscript for publication, agreed on the journal to which the manuscript has been submitted, and accept responsibility for all aspects of the research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study adhered to the tenets of the Declaration of Helsinki, followed the Comprehensive Standards for Trial Reporting (CONSORT) guidelines, and was approved by the Ethics Committee of the General Hospital of Western Theater (Ethics Approval No. 2019ky64). The study was registered at the Chinese Clinical Trials Registry (http://www.trialregister.nl, date: 22/02/2022; Number: ChiCTR2200056906). All participants provided written informed consent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data for this study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSatapathy P, Gaidhane AM, Vadia N, et al. Prevalence of recurrent nerve injury among esophageal cancer patients undergoing esophagectomy: A systematic review and meta-analysis. Surg Open Sci. 2025;27:68\u0026ndash;80. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.sopen.2025.05.009\u003c/span\u003e\u003cspan address=\"10.1016/j.sopen.2025.05.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaranov NS, Slootmans C, van Workum F, Klarenbeek BR, Schoon Y, Rosman C. Outcomes of curative esophageal cancer surgery in elderly: A meta-analysis. World J Gastrointest Oncol. 2021;13(2):131\u0026ndash;146. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4251/wjgo.v13.i2.131\u003c/span\u003e\u003cspan address=\"10.4251/wjgo.v13.i2.131\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFoley KA, Djaiani G. Update of the European Society of Anaesthesiology and Intensive Care Medicine evidence-based and consensus-based guideline on postoperative delirium in adult patients. Eur J Anaesthesiol. 2025;42(1):86\u0026ndash;87. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/EJA.0000000000002043\u003c/span\u003e\u003cspan address=\"10.1097/EJA.0000000000002043\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFenaroli F, Valerio A, Ingrassia R. Ischemic Neuroprotection by Insulin with Down-Regulation of Divalent Metal Transporter 1 (DMT1) Expression and Ferrous Iron-Dependent Cell Death. Biomolecules. 2024;14(7):856. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/biom14070856\u003c/span\u003e\u003cspan address=\"10.3390/biom14070856\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArda DB, Tun\u0026ccedil; KC, Bozkurt MF, Bora ES, \u0026Ccedil;iğel A, Erbaş O. Intranasal Insulin Eases Autism in Rats via GDF-15 and Anti-Inflammatory Pathways. Curr Issues Mol Biol. 2024;46(9):10530\u0026ndash;10544. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cimb46090624\u003c/span\u003e\u003cspan address=\"10.3390/cimb46090624\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShpakov AO, Zorina II, Derkach KV. Hot Spots for the Use of Intranasal Insulin: Cerebral Ischemia, Brain Injury, Diabetes Mellitus, Endocrine Disorders and Postoperative Delirium. Int J Mol Sci. 2023;24(4):3278. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms24043278\u003c/span\u003e\u003cspan address=\"10.3390/ijms24043278\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBadenes R, Qeva E, Giordano G, Romero-Garc\u0026iacute;a N, Bilotta F. Intranasal Insulin Administration to Prevent Delayed Neurocognitive Recovery and Postoperative Neurocognitive Disorder: A Narrative Review. Int J Environ Res Public Health. 2021;18(5):2681. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijerph18052681\u003c/span\u003e\u003cspan address=\"10.3390/ijerph18052681\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Q, Shi Q, Yi X, Eet al. Effect of Repeated Intranasal Administration of Different Doses of Insulin on Postoperative Delirium, Serum τ and Aβ Protein in Elderly Patients Undergoing Radical Esophageal Cancer Surgery. Neuropsychiatr Dis Treat. 2023;19:1017\u0026ndash;1026. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/NDT.S405426\u003c/span\u003e\u003cspan address=\"10.2147/NDT.S405426\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang Q, Li Q, Qin F, et al. Repeated Preoperative Intranasal Administration of Insulin Decreases the Incidence of Postoperative Delirium in Elderly Patients Undergoing Laparoscopic Radical Gastrointestinal Surgery: A Randomized, Placebo-Controlled, Double-Blinded Clinical Study. Am J Geriatr Psychiatry. 2021;29(12):1202\u0026ndash;1211.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Li L, He J, Xu J, Bao F. The NLRP3 inflammasome is a potential mechanism and therapeutic target for perioperative neurocognitive disorders. Front Aging Neurosci. 2023;14:1072003. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fnagi.2022.1072003\u003c/span\u003e\u003cspan address=\"10.3389/fnagi.2022.1072003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Meng S, Cao L, Chen Y, Zuo Z, Peng S. Critical role of NLRP3-caspase-1 pathway in age-dependent isoflurane-induced microglial inflammatory response and cognitive impairment. J Neuroinflammation. 2018;15(1):109. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12974-018-1137-1\u003c/span\u003e\u003cspan address=\"10.1186/s12974-018-1137-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao S, Chen F, Wang D, Han W, Zhang Y, Yin Q. NLRP3 inflammasomes are involved in the progression of postoperative cognitive dysfunction: from mechanism to treatment. Neurosurg Rev. 2021;44(4):1815\u0026ndash;1831. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10143-020-01387-z\u003c/span\u003e\u003cspan address=\"10.1007/s10143-020-01387-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020 Sep 12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClaxton A, Baker LD, Hanson A, et al. Long-acting intranasal insulin detemir improves cognition for adults with mild cognitive impairment or early-stage Alzheimer's disease dementia. J Alzheimers Dis. 2015;44(3):897\u0026ndash;906. doi: 10.3233/JAD-141791. Erratum in: J Alzheimers Dis. 2015;45(4):1269-70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRieck KM, Pagali S, Miller DM. Delirium in hospitalized older adults. Hosp Pract (1995). 2020;48(sup1):3\u0026ndash;16. doi: 10.1080/21548331.2019.1709359. Epub 2020 Jan 18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402\u0026ndash;8. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/meth.2001.1262\u003c/span\u003e\u003cspan address=\"10.1006/meth.2001.1262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrias JP, Deenadayalan S, Erichsen L, et al. Efficacy and safety of co-administered once-weekly cagrilintide 2\u0026middot;4 mg with once-weekly semaglutide 2\u0026middot;4 mg in type 2 diabetes: a multicentre, randomised, double-blind, active-controlled, Phase 2 trial. Lancet. 2023;402(10403):720\u0026ndash;730. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0140-6736(23)01163-7\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(23)01163-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2023 Jun 23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao MZ, Liu CX, Zhou LG, Yang Y, Wang Y. Postoperative delirium, neuroinflammation, and influencing factors of postoperative delirium: A review. Medicine (Baltimore). 2023;102(8):e32991. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/MD.0000000000032991\u003c/span\u003e\u003cspan address=\"10.1097/MD.0000000000032991\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQureshi O, Arthur ME. Recent advances in predicting, preventing, and managing postoperative delirium. Fac Rev. 2023;12:19. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.12703/r/12-19\u003c/span\u003e\u003cspan address=\"10.12703/r/12-19\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Han H, Dong L, Wang Z, Qin Y. Function of p21 and its therapeutic effects in esophageal cancer. Oncol Lett. 2021;21(2):136. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ol.2020.12397\u003c/span\u003e\u003cspan address=\"10.3892/ol.2020.12397\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020 Dec 20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang AJ, Choi SH, Byun HK, et al. Management of Clinical T1N0M0 Esophageal Cancer. Gut Liver. 2019;13(3):315\u0026ndash;324. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5009/gnl18254\u003c/span\u003e\u003cspan address=\"10.5009/gnl18254\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSato H, Miyawaki Y, Lee S. [ESSENSE Concept and Perioperative Management in Esophageal Cancer Treatment]. Kyobu Geka. 2023;76(10):904\u0026ndash;907.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCraft S, Claxton A, Baker LD, et al. Effects of Regular and Long-Acting Insulin on Cognition and Alzheimer's Disease Biomarkers: A Pilot Clinical Trial. J Alzheimers Dis. 2017;57(4):1325\u0026ndash;1334. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3233/JAD-161256\u003c/span\u003e\u003cspan address=\"10.3233/JAD-161256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. doi: 10.3233/JAD-161256.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePowers BK, Ponder HL, Findley R, Wolfe R, Patel GP, Parrish RH 2nd; Enhanced Recovery Comparative Pharmacotherapy Collaborative. Enhanced recovery after surgery (ERAS\u0026reg;) Society abdominal and thoracic surgery recommendations: A systematic review and comparison of guidelines for perioperative and pharmacotherapy core items. World J Surg. 2024;48(3):509\u0026ndash;523. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/wjs.12101\u003c/span\u003e\u003cspan address=\"10.1002/wjs.12101\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2024 Feb 13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen TJ, Chung YW, Chang HR, et al. Diagnostic accuracy of the CAM-ICU and ICDSC in detecting intensive care unit delirium: A bivariate meta-analysis. Int J Nurs Stud. 2021;113:103782. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ijnurstu.2020.103782\u003c/span\u003e\u003cspan address=\"10.1016/j.ijnurstu.2020.103782\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020 Oct 3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang Y, Le W. Differential Roles of M1 and M2 Microglia in Neurodegenerative Diseases. Mol Neurobiol. 2016;53(2):1181\u0026ndash;1194. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12035-014-9070-5\u003c/span\u003e\u003cspan address=\"10.1007/s12035-014-9070-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2015 Jan 20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThedim M and Vacas S: Anesthetic sensitivity and resilience in the aging brain: Implications for perioperative neurocognitive disorders. Anesthesiol Perioper Sci 3: 11, 2025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNorden DM, Godbout JP. Review: microglia of the aged brain: primed to be activated and resistant to regulation. Neuropathol Appl Neurobiol. 2013;39(1):19\u0026ndash;34. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1365-2990.2012.01306.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2990.2012.01306.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFranceschi C, Campisi J. Chronic inflammation (inflammaging) and its potential contribution to age-associated diseases. J Gerontol A Biol Sci Med Sci. 2014;69 Suppl 1:S4-9. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/gerona/glu057\u003c/span\u003e\u003cspan address=\"10.1093/gerona/glu057\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan den Boogaard M, Slooter AJ, Br\u0026uuml;ggemann RJ,et al. Prevention of ICU delirium and delirium-related outcome with haloperidol: a study protocol for a multicenter randomized controlled trial. Trials. 2013;14:400. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1745-6215-14-400\u003c/span\u003e\u003cspan address=\"10.1186/1745-6215-14-400\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalker KA, Basisty N, Wilson DM 3rd, Ferrucci L. Connecting aging biology and inflammation in the omics era. J Clin Invest. 2022;132(14):e158448. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/JCI158448\u003c/span\u003e\u003cspan address=\"10.1172/JCI158448\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao A, Fei J, Feng S, Weng J. Chikusetsu saponin IVa alleviated sevoflurane-induced neuroinflammation and cognitive impairment by blocking NLRP3/caspase-1 pathway. Pharmacol Rep. 2020;72(4):833\u0026ndash;845. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s43440-020-00078-2\u003c/span\u003e\u003cspan address=\"10.1007/s43440-020-00078-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2020 Mar 2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCho I, Koo BN, Kim SY, et al. Neuroprotective Effect of Dexmedetomidine against Postoperative Cognitive Decline via NLRP3 Inflammasome Signaling Pathway. Int J Mol Sci. 2022;23(15):8806. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms23158806\u003c/span\u003e\u003cspan address=\"10.3390/ijms23158806\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider E, Spetter MS, Martin E, et al, Thomas JM, Lee M, Hallschmid M, Rotshtein P, Dourish CT, Higgs S. The effect of intranasal insulin on appetite and mood in women with and without obesity: an experimental medicine study. Int J Obes (Lond). 2022;46(7):1319\u0026ndash;1327. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41366-022-01115-1\u003c/span\u003e\u003cspan address=\"10.1038/s41366-022-01115-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Wang D, Yin K, et al. Lycopene attenuates oxidative stress, inflammation, and apoptosis by modulating Nrf2/NF-κB balance in sulfamethoxazole-induced neurotoxicity in grass carp (Ctenopharyngodon Idella). Fish Shellfish Immunol. 2022;121:322\u0026ndash;331. doi: 10.1016/j.fsi.2022.01.012. Epub 2022 Jan 13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlam A, Hana Z, Jin Z, Suen KC, Ma D. Surgery, neuroinflammation and cognitive impairment. EBioMedicine. 2018;37:547\u0026ndash;556. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ebiom.2018.10.021\u003c/span\u003e\u003cspan address=\"10.1016/j.ebiom.2018.10.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLerman I, Davis B, Huang M, et al. Noninvasive vagus nerve stimulation alters neural response and physiological autonomic tone to noxious thermal challenge. PLoS One. 2019;14(2):e0201212. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0201212\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0201212\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYagi M, Morishita K, Ueno A, et al. Electrical stimulation of the vagus nerve improves intestinal blood flow after trauma and hemorrhagic shock. Surgery. 2020;167(3):638\u0026ndash;645. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.surg.2019.09.024\u003c/span\u003e\u003cspan address=\"10.1016/j.surg.2019.09.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2019 Nov 21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChao CC, Yang WK, Yeh TY, et al. Transthyretin variants impact blood-nerve barrier and neuroinflammation in amyloidotic neuropathy. Brain. 2025;148(7):2537\u0026ndash;2550. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/brain/awaf028\u003c/span\u003e\u003cspan address=\"10.1093/brain/awaf028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eF\u0026ouml;rstermann U, Sessa WC. Nitric oxide synthases: regulation and function. Eur Heart J. 2012;33(7):829\u0026thinsp;\u0026ndash;\u0026thinsp;37, 837a-837d. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/eurheartj/ehr304\u003c/span\u003e\u003cspan address=\"10.1093/eurheartj/ehr304\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2011 Sep 1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD'Mello C, Swain MG. Immune-to-Brain Communication Pathways in Inflammation-Associated Sickness and Depression. Curr Top Behav Neurosci. 2017;31:73\u0026ndash;94. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/7854_2016_37\u003c/span\u003e\u003cspan address=\"10.1007/7854_2016_37\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng W, Lu W, Jiang X, et al. Current Progress on Neuroinflammation-mediated Postoperative Cognitive Dysfunction: An Update. Curr Mol Med. 2023;23(10):1077\u0026ndash;1086. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2174/1566524023666221118140523\u003c/span\u003e\u003cspan address=\"10.2174/1566524023666221118140523\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang XD, Wang LK, Wu HY, Jiao L. Effects of prebiotic galacto-oligosaccharide on postoperative cognitive dysfunction and neuroinflammation through targeting of the gut-brain axis. BMC Anesthesiol. 2018;18(1):177. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12871-018-0642-1\u003c/span\u003e\u003cspan address=\"10.1186/s12871-018-0642-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDahm T, Rudolph H, Schwerk C, Schroten H, Tenenbaum T. Neuroinvasion and Inflammation in Viral Central Nervous System Infections. Mediators Inflamm. 2016;2016:8562805. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2016/8562805\u003c/span\u003e\u003cspan address=\"10.1155/2016/8562805\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2016 May 25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoffmann O, Zipp F, Weber JR. Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) in central nervous system inflammation. J Mol Med (Berl). 2009;87(8):753\u0026ndash;63. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00109-009-0484-x\u003c/span\u003e\u003cspan address=\"10.1007/s00109-009-0484-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2009 May 17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodriguez-Smith J, Lin YC, Tsai WL, et al. Cerebrospinal Fluid Cytokines Correlate With Aseptic Meningitis and Blood-Brain Barrier Function in Neonatal-Onset Multisystem Inflammatory Disease: Central Nervous System Biomarkers in Neonatal-Onset Multisystem Inflammatory Disease Correlate With Central Nervous System Inflammation. Arthritis Rheumatol. 2017;69(6):1325\u0026ndash;1336. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/art.40055\u003c/span\u003e\u003cspan address=\"10.1002/art.40055\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2017 May 10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan Z, Pan YT, Zhang ZY, et al. Systemic activation of NLRP3 inflammasome and plasma α-synuclein levels are correlated with motor severity and progression in Parkinson's disease. J Neuroinflammation. 2020;17(1):11. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12974-019-1670-6\u003c/span\u003e\u003cspan address=\"10.1186/s12974-019-1670-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzabo A, O'Connell KS, Akkouh IA, et al. Elevated levels of peripheral and central nervous system immune markers reflect innate immune dysregulation in autism spectrum disorder. Psychiatry Res. 2024;342:116245. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.psychres.2024.116245\u003c/span\u003e\u003cspan address=\"10.1016/j.psychres.2024.116245\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2024 Oct 30.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Unsectioned Tables","content":"\u003cp\u003eTable I. Sequence of primers used for gene amplification\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 263px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 290px;\"\u003e\n \u003cp\u003ePrimer sequence (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 263px;\"\u003e\n \u003cp\u003e\u003cem\u003eNLRP3\u0026nbsp;\u003c/em\u003e(NCBI: MK697677.1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 290px;\"\u003e\n \u003cp\u003eF: CTCTGCTCAGCACCACGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 290px;\"\u003e\n \u003cp\u003eR: CTCCACATGCCGAGGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 263px;\"\u003e\n \u003cp\u003e\u003cem\u003eCaspase-1\u003c/em\u003e (NCBI: NM033294.3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 290px;\"\u003e\n \u003cp\u003eF: CCTGCCGTGGTGATAATGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 290px;\"\u003e\n \u003cp\u003eR: TCCACATCACAGGAACAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 263px;\"\u003e\n \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e (NCBI: NM_002046.7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 290px;\"\u003e\n \u003cp\u003eF: GGAGCGAGATCCCTCCAAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 290px;\"\u003e\n \u003cp\u003eR: GGCTGTTGTCATACTTCTCATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNote: All primers were designed based on published sequences and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable II. Patient demographics and clinical data\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"630\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eCharacteristic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003eGroup C (n=30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003eGroup I (n=30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e67 (6)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e68.5 (7)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.306\u003csup\u003e$\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eSex (male)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e27 (90%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e25 (83.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.706\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eBody mass index (kg/m\u0026sup2;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e21.90\u0026plusmn;2.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e23.06\u0026plusmn;2.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.105\u003csup\u003e\u0026amp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Education level\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.485\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eIlliterate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e25 (83.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e26 (86.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003ePrimary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e2 (6.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e3 (10%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eSecondary\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e3 (10%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e1 (3.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eMMSE score\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e21.00 (3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e21.00 (2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.706\u003csup\u003e$\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eASA classification\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.605\u003csup\u003e＃\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eII\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e17 (56.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e15 (50%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eIII\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e13 (43.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e15 (50%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eOperation time (min)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e265.93\u0026plusmn;54.35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e265.83\u0026plusmn;37.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.993\u003csup\u003e\u0026amp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003ePreoperative hemoglobin concentration (g/l)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e124.90\u0026plusmn;11.75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e129.00\u0026plusmn;11.71\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.181\u003csup\u003e\u0026amp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eTotal intraoperative infusion (ml)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e2600 (600)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e2300 (925)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.733\u003csup\u003e$\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eIntraoperative blood loss (ml)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e200 (200)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e200 (100)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.318\u003csup\u003e$\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eUrine output\u0026nbsp;(ml)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e200 (113)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e200 (200)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.400\u003csup\u003e$\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eNRS score\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e2.50 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e3.00 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.447\u003csup\u003e$\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eT2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e1.50 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e2.00 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.650\u003csup\u003e$\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 237px;\"\u003e\n \u003cp\u003eT3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 122px;\"\u003e\n \u003cp\u003e1.00 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e1.00 (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e0.861\u003csup\u003e$\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eNotes:\u003c/strong\u003e Data are presented as mean \u0026plusmn; SD, median (interquartile range), or percentage (proportion). \u003csup\u003e$\u003c/sup\u003eMann\u0026ndash;Whitney U test; *Fisher\u0026rsquo;s exact test; \u003csup\u003e\u0026amp;\u003c/sup\u003eIndependent \u003cem\u003et\u003c/em\u003e-test;\u0026nbsp;\u003csup\u003e＃\u003c/sup\u003ePearson \u0026chi;\u003csup\u003e2\u003c/sup\u003e test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviations:\u003c/strong\u003e T1: postoperative day 1; T2: postoperative day 2; T3: postoperative day 3.\u003c/p\u003e\n\u003cp\u003eMMSE: Mini-Mental State Examination; ASA: American Society of Anesthesiologists; NRS: numerical rating scale\u003c/p\u003e\n\u003cp\u003eTable III. Incidence of POD during the first three postoperative days\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"574\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003ePostoperative day\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 127px;\"\u003e\n \u003cp\u003eGroup C (n=30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eGroup I (n=30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003ecOR (95% CI)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 86px;\"\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003e1 AM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 127px;\"\u003e\n \u003cp\u003e14 (46.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e5 (16.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e4.38 (1.32\u0026ndash;14.50)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 86px;\"\u003e\n \u003cp\u003e0.012\u003csup\u003ea\u003c/sup\u003e\u003csup\u003e＃\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003e1 PM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 127px;\"\u003e\n \u003cp\u003e13 (43.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e5 (16.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e3.82\u003c/p\u003e\n \u003cp\u003e(1.15\u0026ndash;12.71)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 86px;\"\u003e\n \u003cp\u003e0.024\u003csup\u003ea\u003c/sup\u003e\u003csup\u003e＃\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003e2 AM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 127px;\"\u003e\n \u003cp\u003e11 (36.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e4 (13.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e3.76\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;(1.04\u0026ndash;13.65)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 86px;\"\u003e\n \u003cp\u003e0.037\u003csup\u003ea\u003c/sup\u003e\u003csup\u003e＃\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003e2 PM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 127px;\"\u003e\n \u003cp\u003e8 (26.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e2 (6.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e5.09\u003c/p\u003e\n \u003cp\u003e(0.98\u0026ndash;26.43)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 86px;\"\u003e\n \u003cp\u003e0.038\u003csup\u003ea\u003c/sup\u003e\u003csup\u003e＃\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003e3 AM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 127px;\"\u003e\n \u003cp\u003e4 (13.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e1 (3.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e4.46\u003c/p\u003e\n \u003cp\u003e(0.47\u0026ndash;42.51)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 86px;\"\u003e\n \u003cp\u003e0.351＊\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003e3 PM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 127px;\"\u003e\n \u003cp\u003e2 (6.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e1 (3.3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e2.07\u003c/p\u003e\n \u003cp\u003e(0.18\u0026ndash;24.15)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 86px;\"\u003e\n \u003cp\u003e1.00＊\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 131px;\"\u003e\n \u003cp\u003eWithin 3 days of surgery\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 127px;\"\u003e\n \u003cp\u003e14 (46.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e5 (16.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 110px;\"\u003e\n \u003cp\u003e4.38 (1.32\u0026ndash;14.50)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 86px;\"\u003e\n \u003cp\u003e0.012\u003csup\u003ea\u003c/sup\u003e\u003csup\u003e＃\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eNotes:\u003c/strong\u003e Data are presented as percentage (proportion). \u003csup\u003ea\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 for comparison between two groups.\u0026nbsp;\u003csup\u003e＃\u003c/sup\u003ePearson \u0026chi;\u003csup\u003e2\u0026nbsp;\u003c/sup\u003etest; *Fisher\u0026rsquo;s exact test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviations:\u003c/strong\u003e POD: postoperative delirium\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable IV. Expression levels of key molecules in the NLRP3/caspase-1/IL-1 \u0026beta; pathway\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"682\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003eGroup C\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;(n=30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 114px;\"\u003e\n \u003cp\u003eGroup I\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;(n=30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u0026nbsp;\u003c/em\u003e(Group)/\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u0026nbsp;\u003c/em\u003e(Time)\u003cem\u003e/\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP-\u003c/em\u003evalue\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u0026nbsp;\u003c/em\u003e(Group\u0026times;Time)\u003cem\u003e/\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP-\u003c/em\u003evalue\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"4\" valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eNLRP3 mRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e25.40\u0026plusmn;1.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e26.02\u0026plusmn;2.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e=29.76\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e=231.91\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 141px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e=29.27\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e35.66\u0026plusmn;2.02\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e30.88\u0026plusmn;1.44\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e31.41\u0026plusmn;1.46\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e28.80\u0026plusmn;3.18\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e28.04\u0026plusmn;2.88\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e27.61\u0026plusmn;2.90\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"4\" valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eCaspase-1 mRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e23.98\u0026plusmn;3.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e23.10\u0026plusmn;3.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e=10.31\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP=\u003c/em\u003e0.004\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e=107.50\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 141px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e=4.09\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP=\u003c/em\u003e0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e31.05\u0026plusmn;2.09\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e28.70\u0026plusmn;1.80\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e28.09\u0026plusmn;4.49\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e25.67\u0026plusmn;4.11\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e25.12\u0026plusmn;1.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e24.84\u0026plusmn;1.92\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"4\" valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eIL-1\u0026beta;\u003c/p\u003e\n \u003cp\u003e(pg/ml)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e31.01\u0026plusmn;1.91\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e31.21\u0026plusmn;2.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e=105.17\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e=338.75\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" style=\"width: 141px;\"\u003e\n \u003cp\u003e\u003cem\u003eF\u003c/em\u003e=30.46\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e51.39\u0026plusmn;3.82\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e43.15\u0026plusmn;3.66\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e45.32\u0026plusmn;3.70\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e37.73\u0026plusmn;2.68\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eT3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003e34.80\u0026plusmn;4.12\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 114px;\"\u003e\n \u003cp\u003e34.05\u0026plusmn;3.66\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eNotes:\u003c/strong\u003e Data are expressed as mean \u0026plusmn; SD. Comparisons between the groups were performed using the Dunnett\u003cem\u003e-t\u003c/em\u003e test. Repeated measurements were compared using repeated measure ANOVA. \u003csup\u003ea\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt;0.05 vs. T0; \u003csup\u003eb\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt;0.05 vs. Group C; * multiplication symbol.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviations:\u003c/strong\u003e T0: before the first intervention; T1: postoperative day 1; T2: postoperative day 2; T3: postoperative day 3.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable V. Average blood glucose values at different time points (mmol/l)\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"386\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 116px;\"\u003e\n \u003cp\u003eTime point\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 103px;\"\u003e\n \u003cp\u003eGroup C\u003c/p\u003e\n \u003cp\u003e(n=30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003eGroup I\u003c/p\u003e\n \u003cp\u003e(n=30)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 78px;\"\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 116px;\"\u003e\n \u003cp\u003eT0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 103px;\"\u003e\n \u003cp\u003e5.41+0.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e5.35+0.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e0.406\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 116px;\"\u003e\n \u003cp\u003eT4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 103px;\"\u003e\n \u003cp\u003e5.70+0.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 89px;\"\u003e\n \u003cp\u003e5.82+0.44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 78px;\"\u003e\n \u003cp\u003e0.286\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eNotes:\u003c/strong\u003e Data are expressed as mean \u0026plusmn; SD. Comparisons between the groups were performed using the independent \u003cem\u003et\u003c/em\u003e-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviations:\u003c/strong\u003e T0: before the first intervention; T4: the period from the first intervention to the last intervention.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"inflammation-and-regeneration","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ireg","sideBox":"Learn more about [Inflammation and Regeneration](http://inflammregen.biomedcentral.com/)","snPcode":"41232","submissionUrl":"https://www.editorialmanager.com/ireg/default2.aspx","title":"Inflammation and Regeneration","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Intranasal administration, Long-acting insulin, Postoperative delirium, NLRP3 inflammasome, Elderly patients, Esophageal cancer","lastPublishedDoi":"10.21203/rs.3.rs-8658457/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8658457/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eInsulin exhibits neuroprotective and anti-inflammatory properties. Preoperative intranasal insulin preconditioning is a potential strategy to prevent postoperative delirium (POD), but prior studies mainly used rapid-acting formulations. This investigation focused on intranasal long-acting insulin, which ensures sustained central nervous system exposure, in elderly patients undergoing radical esophagectomy. We assessed its impact on POD incidence and the NLRP3/caspase-1/IL-1β pathway.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eSixty older patients scheduled for elective radical esophagectomy were randomized into two groups. The intervention group (n\u0026thinsp;=\u0026thinsp;30) received a single intranasal dose of long-acting insulin (30U) one day preoperatively, while the control group (n\u0026thinsp;=\u0026thinsp;30) received an equivalent volume of physiological saline. POD was evaluated using the Confusion Assessment Method for the ICU on postoperative days 1, 2, and 3. Peripheral blood samples were collected before surgery and postoperatively to measure IL-1β concentrations and NLRP3/caspase-1 mRNA expression in mononuclear cells.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eCompared to controls, long-acting insulin pretreatment significantly reduced POD incidence (16.7% vs. 46.7%, P\u0026thinsp;=\u0026thinsp;0.012) and suppressed the postoperative rise in peripheral IL-1β levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Additionally, NLRP3 and caspase-1 mRNA expression were notably lower in the insulin group during the postoperative period (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003ePreoperative intranasal long-acting insulin effectively decreases POD incidence in the first 3 days after radical esophagectomy in older patients. This protective effect is likely mediated through sustained downregulation of the NLRP3/caspase-1 signaling pathway, emphasizing the advantage of long-acting formulations for continuous neuroprotection during the critical postoperative phase.\u003c/p\u003e","manuscriptTitle":"Effects of intranasal long-acting insulin pretreatment on postoperative delirium and the NLRP3/caspase-1/IL-1β pathway in older patients with esophageal cancer Running title: intranasal long-acting insulin and postoperative delirium","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-09 12:41:40","doi":"10.21203/rs.3.rs-8658457/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-09T05:11:11+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-09T02:57:37+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-12T12:21:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"93499525874596468023442272609047883596","date":"2026-02-10T06:22:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"298883090663970004730659299579232438242","date":"2026-02-05T12:16:44+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-02-05T05:31:11+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-29T12:06:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-28T22:51:55+00:00","index":"","fulltext":""},{"type":"submitted","content":"Inflammation and Regeneration","date":"2026-01-21T09:54:23+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"inflammation-and-regeneration","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ireg","sideBox":"Learn more about [Inflammation and Regeneration](http://inflammregen.biomedcentral.com/)","snPcode":"41232","submissionUrl":"https://www.editorialmanager.com/ireg/default2.aspx","title":"Inflammation and Regeneration","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b8dc8e48-63a0-4b8e-8470-5f95720cde0f","owner":[],"postedDate":"February 9th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-04-20T16:05:02+00:00","versionOfRecord":{"articleIdentity":"rs-8658457","link":"https://doi.org/10.1186/s41232-026-00418-4","journal":{"identity":"inflammation-and-regeneration","isVorOnly":false,"title":"Inflammation and Regeneration"},"publishedOn":"2026-04-18 15:59:12","publishedOnDateReadable":"April 18th, 2026"},"versionCreatedAt":"2026-02-09 12:41:40","video":"","vorDoi":"10.1186/s41232-026-00418-4","vorDoiUrl":"https://doi.org/10.1186/s41232-026-00418-4","workflowStages":[]},"version":"v1","identity":"rs-8658457","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8658457","identity":"rs-8658457","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}