Identification of MDM2 as a novel marker gene that modulates radiation-induced osteoblast damage

Identification of MDM2 as a novel marker gene that modulates radiation-induced osteoblast damage | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification of MDM2 as a novel marker gene that modulates radiation-induced osteoblast damage Jiguo Lin, Gang Zhao, Luping Wang, Chang Liu, Jie Feng, Chaonan Sun, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6259924/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Bone injury is a common side effect of radiotherapy in tumors and is a long-term response after damage to osteoblasts, especially a reduction in osteoblast proliferation and differentiation. Currently, there are few studies on radiation-induced bone injury, and the molecules involved in ionizing radiation (IR)-induced osteoblast damage remain to be identified. In this study, the optimal IR damage conditions (8 Gy, 2.22 Gy/min) were first determined by measuring cell proliferation, the cell cycle, cell apoptosis and further cell differentiation and mineralization abilities in a radiation-induced osteoblast injury model. We subsequently screened 26 DEGs after RNA sequencing of the 8 Gy-irradiated MC3T3-E1 cells, which were involved mainly in DNA damage and repair, cell apoptotic progression and cell cycle regulation and involved several main pathways, including the PI3K-AKT signaling pathway, p53 signaling pathway and signaling pathway involved in the cell cycle and cell senescence. We focused on verifying the differentially expressed genes and confirmed that MDM2 was the most significantly upregulated gene after IR treatment, suggesting its key role in the response to IR. In addition, we addressed the functions of MDM2 in osteoblast proliferation, differentiation and DNA damage following MDM2 knockdown and IR treatment. In summary, knockdown of MDM2 alleviates IR-induced damage to MC3T3-E1 cells by promoting cell proliferation, reducing the cell cycle arrest rate and cell apoptosis rate, and reversing osteoblast differentiation, possibly through alleviation of DNA damage. Ionizing radiation MDM2 osteoblast damage DNA damage cell cycle Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Radiotherapy remains one of the main treatments for various tumors, and bone injury is a common side effect of radiotherapy. Radioactive bone injuries present as pathological fractures, deformities, or even osteonecrosis. The probability of pathological fracture increases by 2%~6% after pelvic tissue irradiation (Baxter et al., 2005 ). The main cause of the symptoms of bone damage is osteopenia, which includes decreased bone mineral density and decreased osteocalcin. Clinical data suggest that ionizing radiation (IR) leads to a decrease of 8 ~ 23% in bone tissue (Hopewell, 2003 ). Tumor invasion and pathological fractures caused by radiotherapy seriously affect the quality of life of patients after treatment. IR directly and indirectly causes tissue and organ damage during medical diagnosis and treatment (Soriano et al., 2019 ). In random reactions of biological molecules, including DNA and protein (Shim et al., 2013), in which DNA is the target molecule of IR, the injury-induced DNA damage response (DDR) activates several closely related signal transduction pathways, and these pathways form a tight response mechanism, including cell cycle checkpoints (Santivasi et al., 2014) and cell apoptosis (Lee et al., 2021 ), resulting in a series of biological effects. Data from both in vitro and in vivo studies have suggested that IR can affect bone formation by killing or damaging osteoblasts and reducing bone density, which is thought to be a long-term response after damage to osteoblasts, especially by reducing osteoblast proliferation and differentiation (Zhang et al., 2018 ). Currently, there are few studies on radiation-induced bone injury, and the molecular mechanisms by which ionizing radiation affects the differentiation and function of osteoblast cells remain unknown. Therefore, this study aimed to establish a radiation-induced osteoblast injury model, screen and identify related factors involved in radiation injury to osteoblasts through RNA-seq, and then confirm that key molecules participate in radiation-induced osteoblast damage to provide basic data for the protection against and repair of radiation-induced bone injury. 2. Materials and methods 2.1 Cell culture and induction of osteoblast differentiation The MC3T3-E1 osteoblasts were purchased from Hycyte Biology (China) and were cultured in complete medium containing α-minimum essential medium (α-MEM, Gibco, USA), fetal bovine serum (FBS, Gibco, USA), and 1% penicillin/streptomycin (p/s, Solarbio) at 37°C in a humidified atmosphere of 5% CO 2 . The osteoblast differentiation medium contained 10 mM β-glycerophosphate (Sigma, USA), 50 µg/mL ascorbic acid (Sigma, USA), 10 nmol dexamethasone (Sigma, USA), 10% FBS, and 1% p/s in α-MEM. 2.2 CCK-8 assay A CCK-8 kit (Saintbio, China) was used to detect cell proliferation. MC3T3-E1 cells (5×10 3 cells/well) were seeded in 96‐well plates in quintuplicate with complete medium. A total dose of 0, 2, 4, 6, or 8 Gy (2.22 Gy/min) X-ray radiation was subsequently administered to the cells via a PXI X-RAD (American). Twenty-four, 48, and 72 h after radiation, the cells were incubated with 10 µL of CCK-8 reagent, and cell viability was assessed by measuring the absorbance at a wavelength of 450 nm via a microplate reader (BioTek, USA). 2.3 Clonogenic assay Clonogenic formation assays were performed after X-ray radiation at gradient doses to evaluate the proliferative ability of MC3T3-E1 cells. MC3T3-E1 cells (800 cells/well) in the logarithmic growth phase were cultured in 6-well plates with complete medium for 24 h. After being cultured for another 10 days with X-ray radiation at 0, 2, 4, 6, or 8 Gy, the cells were fixed with crystal violet, and the resulting colonies were counted. 2.4 Cell cycle assay MC3T3-E1 cells (5×10 5 cells/well) were seeded in 6-well plates in quintuplicate with complete medium for 24 h. After being subjected to gradient-dose X-ray radiation, the cells were digested with 0.25% trypsin. Then, anhydrous ethanol was added to the cells, which were fixed for two hours at 4°C, followed by incubation with propidium iodide (PI) in a dark environment at room temperature for 30 min to detect the distribution of the cell cycle distribution via flow cytometry. 2.5 Cell apoptosis assay Cell culture and preliminary treatment methods were performed as described above. After multiple washes and centrifugations, the cells were dissolved in binding buffer. Then, the cells were incubated with propidium iodide (PI) and Annexinv-FITC for 15 min following the manufacturer’s instructions for the Annexin V-FITC/PI Apoptosis Kit in the dark. Finally, these already processed cells were detected by flow cytometry to analyze their degree of apoptosis. 2.6 Alkaline phosphatase (ALP) staining and quantification Alkaline phosphatase (ALP) staining was used to evaluate the mineralization capacity and degree of transformation of MC3T3-E1 cells. MC3T3-E1 cells (5×10 5 cells/well) were cultured in 6-well plates overnight. After X-ray irradiation at 0, 2, 4, 6, and 8 Gy, the cells were cultured with equal volumes of osteoblast differentiation medium for 7 days, and the culture medium was changed every 2 days. Differentiated osteoblasts were fixed with 4% polyoxymethylene for 15 min and then incubated in the dark at room temperature for 3 h with a mixture of 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) and nitro-blue tetrazolium (NBT) reagents (Beyotime, China), and the stained osteoblasts were observed and photographed under a microscope. An ALP activity assay kit (Beyotime, China) and a BCA protein assay kit (Beyotime, China) were used to analyze the activity of ALP quantitatively. Differentiated osteoblasts were lysed, and the ALP activity and protein content were assessed via a microplate reader (BioTek, USA) at wavelengths of 520 and 595 nm, respectively. The relative activity of ALP was adjusted by the protein concentration. Data analysis was conducted with GraphPad Prism 8.0 (San Diego, USA). 2.7 Alizarin red (ARS) staining Alizarin red S (Sigma, USA) was used to determine the extracellular matrix mineralization capacity of MC3T3-E1 cells by detecting mineralized nodes that were chelated with calcium ions. MC3T3-E1 cells (5×10 5 cells/well) were seeded in 6-well plates in quintuplicate with complete medium overnight. Eighty percent confluent cells were administered X-ray radiation at a total dose of 0, 2, 4, 6, or 8 Gy (2.22 Gy/min) and cultured for 21 days in osteoblast differentiation medium. The osteoblasts were fixed with 4% paraformaldehyde for 15 min, followed by staining with 500 µL of 1% ARS (pH 4.2) solution for 30 min. Finally, the stained osteoblasts were observed and photographed via a microscope. After that, the stained calcium nodules of the osteoblasts were incubated with 10% cetylpyridinium chloride (Sigma, USA), and the absorbance at a wavelength of 562 nm was quantified with a microplate reader (BioTek, USA). 2.7 Immunofluorescence (IF) Immunofluorescence of γ-H2AX and 53BP1 was used to detect DNA damage and repair reactions. MC3T3-E1 cells were cultured on Lab-Tek culture slides in 6-well plates in complete medium. Before immunostaining, the cells were administered a total dose of 0, 2, 4, 6, or 8 Gy (2.22 Gy/min) X-ray radiation. Three hours after radiation, the cells were fixed and permeabilized with 4% paraformaldehyde and 0.5% Triton X-100 for 15 min and blocked in 5% BSA for 1 h at 37°C. γ-H2AX was detected with a mouse anti-γH2AX monoclonal antibody (CST, USA), and 53BP1 was detected with a rabbit anti-53BP1 monoclonal antibody (CST, USA) at 4°C overnight. The cells were subsequently incubated with a FITC-conjugated goat anti-mouse secondary antibody (Bioworld, USA) and a rhodamine-conjugated goat anti-rabbit secondary antibody (Bioworld, USA) for 1 h at room temperature in the dark. The cell nuclei were counterstained with DAPI for 20 min. The images were observed under a fluorescence microscope. 2.8 Quantitative real-time PCR analysis (RT‒qPCR) After being subjected to functional-grade radiation, MC3T3-E1 cells were lysed with TRIzol reagent (Invitrogen, USA), and total RNA was extracted with chloroform and isopropanol. After being washed with 75% ethanol, total RNA was dissolved in RNase-free water to 20 µL, and the concentration of RNA was determined with a microplate reader (BioTek, USA) at an absorbance wavelength of 260 nm. The reverse transcription reaction and construction of the real-time PCR system were performed with an Evo M-MLV RT Mix Kit (Takara, Japan) with clean gDNA for RT‒qPCR following the manufacturer’s instructions. The sequences of primers used in this experiment are shown in Table 1 . Table 1 Primers for RT‒qPCR assays for detecting the expression of target genes Primers GenBank accession NO. Sequences(5´→3´) Positions in Gene* Annealing temperature (°C) PCR product (bp) Cyclin B NM_172301.3 F: CTCAGGGTCACTAGGAACACGA 91–112 59 156 R: TTCGCTGACTTTATTACCAATGTC 223–246 BAX NM_001411994 F: ATTGGAGATGAACTGGACAGCA 293–314 59 54 R: CACGTCAGCAATCATCCTCTG 326–346 BCL2 NM_009741 F: CTGTGGATGACTGAGTACCTGAAC 1924–1947 59 134 R: GTCTTCAGAGACAGCCAGGAGA 2036–2057 OPN NM_001204201 F: ACACTTTCACTCCAATCGTCC 541–561 59 240 R: TGCCCTTTCCGTTGTTGTCC 761–780 RUNX2 NM_009820.6 F: GAGGGACTATGGCGTCAAACA 201–221 59 70 R: GGATCCCAAAAGAAGCTTTGC 250–270 ALP NM_001287172 F: TGTGCCAGAGAAAGAGAGAGACC 333–355 59 112 R: GATGACATTCTTGGCTACATTGGT 421–444 CDKN1A NM_001111099.2 F: TGGTGGAGACCTGATGATACC 10–30 59 145 R: ACATCACCAGGATTGGACATG 134–154 GCLC NM_010295.2 F: ATGTCTGAGTTCAACACTGTGGA 615–637 59 143 R: CTGTGTTCTGGCAGTGTGAATC 736–757 MDM2 NM_010786.5 F: CAGCAGCACATTGTGTATTGTTC 437–459 59 134 R: GAGTCTTGCTGACTTACAGCCAC 548–570 NOTCH1 NM_008714.3 F: CCTGCTCACTCTCACAGAGTACA 618–640 59 144 R: CAGCGACAGATGTATGAAGACTC 739–761 CCNG1 NM_009831.3 F: TGTGAATTTACTGGACAGATTCTTGT 442–467 59 163 R: CGTGAACCTATACTGACTTATTCGG 580–604 STAG1 NM_009282.5 F: GAATAGCTTCTCCAGCAATGATTAC 241–265 59 84 R: CAGCATCAGAGTGGGCAGTAGT 303–324 Asic1 NM_009597.2 F: TGATTGTGAAACCCGTTACCT 1464–1484 59 171 R: AGGTTGCAGGGCATCTCAC 1616–1634 β-actin NM_007393.5 F: TTCCAGCCTTCCTTCTTGG 893–911 59 104 R: TTGGCATAGAGGTCTTTACGG 976–996 ༊ The start base was the first base of the sequence of the GenBank accession we referred to. The RT‒qPCR steps included 1 cycle of 95°C for 3 min, 40 cycles of 95°C for 15 sec and 59°C for 10 sec. β-actin was used as an internal control gene, and the relative expression levels of genes of interest were calculated via the 2−ΔΔCT method. 2.9 Western blot analysis All of the irradiated cell samples were extracted via Western and IP cell lysis buffers containing 1% protease inhibitor and phosphatase inhibitor to obtain total protein. To evaluate the levels of differentially expressed proteins, western blotting was used to separate the extracted total proteins by 8% sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒PAGE). After protein gel electrophoresis, the separated proteins were transferred to a PVDF membrane, which was blocked with 10% nonfat milk powder in TBST for 1 h. The membrane was incubated overnight at 4°C with primary antibodies specific for phosphorylated AKT (Proteintech, China), phosphorylated ERK1/2 (Proteintech, China), Cyclin B (HUABIO, China), BAX (HUABIO, China), BCL2 (HUABIO, China), OPN (Wanleibio, China), RUNX2 (Wanleibio, China), Collagen 1 (Proteintech, China), Cdkn1α (Abways, China), MDM2 (Proteintech, China), GCLC (Abways, China), NOTCH1 (Abways, China), STAG1 (UpingBio, China), β-actin (BBI, China) and HRP-conjugated secondary antibodies (BBI, China) for 1 h at room temperature. The protein signals were detected and captured with a Mini Chemiluminescent System (SINSAGE, China) via a high-sensitivity ECL Kit (Beyotime, China). Quantitative analysis of grayscale values was performed via GenoSens Analysis (Clinx Science Instruments, China), and β-actin was used for normalization. 2.10 RNA Sequencing and Bioinformatics analysis The RNA sequencing data were obtained from BGI Tech (China, Shenzhen), and the specific steps were as follows. The 8Gy X-ray radiation group and the control group were set up with three samples in each group. Total RNA was purified via an RNeasy spin column with 500 µL of Buffer PRE three times, and the purified RNA was dissolved in 35 µL of RNase-free water and collected. A small volume of RNA sample was removed, oligo-dT primers were added, and RNA denaturation was performed via an instrument for PCR. SMART amplification was used to synthesize cDNA, and quality control of cDNA enriched via reverse transcription was performed to construct an RNA-Seq library. The cDNA of the PCR products was subsequently denatured into single strands, and single-stranded circular DNA was obtained through a DNA cyclization reaction. Single-stranded circular DNA molecules were replicated to form a DNA nanosphere (DNB) containing multiple copies. The obtained DNBs were added to a DNA microarray chip for sequencing via combinatorial probe-anchor synthesis (cPAS). The raw data obtained from sequencing were removed from low-quality reads via SOAPnuke (v1.5.6), followed by Dr. Tom ( https://biosys.bgi.com ) to perform differential expression gene analysis, pathway and gene functional annotation, and visualization of identified genes through bioinformatics analysis. 2.11 SiRNA transfection All of the RNA oligonucleotides used in this study, including si-MDM2 and the corresponding negative controls (NCs), were obtained from Sangon Biotech Co., Ltd. (Shanghai, China), and the sequences are shown in Table 2 . The oligonucleotides were transfected via LipoPlus™ Reagent (Sage creation, China) according to the manufacturer’s protocol, with at least three replications. Specifically, for the detection of MDM2 expression inhibition by si-MDM2, MC3T3-E1 cells were seeded in a 6 cm cell culture dish, 400 pM siRNAs were then transfected, and the cells were collected for mRNA/protein detection at 24 h after transfection. To test the effects of MDM2 on cell proliferation, the cell cycle and cell apoptosis, as well as the related gene expression, the siRNA-transfected cells were also collected at 24 h after transfection. To assess the effect of MDM2 on osteoblast differentiation, the cells were treated with osteoblast differentiation medium 24 h after transfection with si-MDM2 or si-NC. Table 2 Sequences of the siRNA oligonucleotides Gene Sequences(5' -3') Si-MDM2-1 Sense: CACAUUGUGUAUUGUUCAA Antisense: UUGAACAAUACACAAUGUG Si-MDM2-2 Sense: GGAAGUGUACCUCAUGCAA Antisense: UUGCAUGAGGUACACUUCC Si-MDM2-3 Sense: GACAGAGAAUGAUGCUAAA Antisense: UUUAGCAUCAUUCUCUGUC Si-NC Sense: UUCUCCGAACGUGUCACGUTT Antisense: ACGUGACACGUUCGGAGAATT 2.12 Comet assay To quantify the amount of DNA damage in the different groups, a comet assay was performed via a DNA damage comet assay kit (Beyotime, China) according to the manufacturer’s instructions. Briefly, after 3 h of IR, the cells were harvested and mixed with low-melting agarose gel at 37°C. The gel containing the embedded cells was layered over microscopy slides previously coated with 1% normal-melting point agarose gel. The cells were then lysed by immersion in lysis solution (comprising a 9:1 ratio of lysis buffer to DMSO). For Comet, the slides were immersed in alkaline electrophoresis buffer for 60 min to allow the DNA double strands to unwind before electrophoresis was performed at 25 V for 30 min in 850 mL of alkaline electrophoresis buffer. The slides were neutralized with neutral buffer, and 20 µL of PI solution was used to stain the slides for 30 min in the dark before being analyzed via fluorescence microscopy (Leica, Germany). Comet images were analyzed via OpenComet analysis software. The tail moment length was used as the parameter for estimating DNA damage levels, as it is a combination of the amount of DNA in the tail and the migration distance relative to the nucleus. 2.13 Statistical analysis All the statistical analyses were performed with GraphPad Prism 8.0 software (San Diego, USA), and the data are presented as the means ± standard errors. Differences were compared via unpaired Student’s t tests for two groups or one-way ANOVA for multiple groups. A P value < 0.05 was considered statistically significant. ( ∗P < 0.05; ∗∗P < 0.01). 3. Results 3.1 Effects of radiation on the proliferation of MC3T3-E1 cells We first measured the proliferation ability of MC3T3-E1 cells after gradient-dose irradiation via a CCK-8 assay. The results revealed that the proliferation ability of the cells was markedly inhibited after 6 Gy or 8 Gy ( P < 0.01) irradiation, and the most significant decrease was observed at 72 h (Fig. 1 A). Similarly, the clonogenic formation assay results also revealed that as the radiation dose increased, the proliferation ability of MC3T3-E1 cells gradually decreased (Fig. 1 B). Moreover, available data have shown that the PI3K-AKT and ERK signaling pathways promote the proliferation of osteoblasts (Zhang et al., 2022 ; Wang et al., 2021 ). Western blot analysis revealed that the protein expression levels of phosphorylated AKT and ERK were significantly decreased after 8 Gy irradiation (Fig. 1 C and D). 3.2 Effects of radiation on the cell cycle of MC3T3-E1 cells The majority of experiments have shown that irradiation leads to cell cycle modification, ultimately resulting in a delay in mitotic division in a dose-dependent manner. However, the form of cell cycle arrest varies among cells. Thus, the cell cycle distribution of MC3T3-E1 cells exposed to radiation was examined via flow cytometry. There was a significant increase in the proportion of MC3T3-E1 cells in the G2 phase after 6 Gy or 8 Gy irradiation compared with that in the 0 Gy group ( P < 0.01), whereas the proportion of cells in the G1 and S phases did not change significantly (Fig. 2 A and B). To confirm that G2/M phase arrest had occurred, we further monitored G2/M checkpoint-associated proteins and detected an increase in cyclin B expression at certain doses at both the mRNA ( P < 0.05) (Fig. 2 C) and protein levels compared with those in the 0 Gy group ( P < 0.05) (Fig. 2 D). 3.3 Effects of radiation on the apoptosis of MC3T3-E1 cells Apoptosis is an actively genetically directed programmed cell death process. It is initiated by certain signals that govern the removal of dying or harmful cells, and apoptosis-associated genes are expressed in an orderly manner during this process. In our experiments, we analyzed irradiated MC3T3-E1 cells via flow cytometry to determine the relationship between apoptosis and irradiation dose. As expected, exposure of MC3T3-E1 cells to radiation led to a gradual increase in the ratio of apoptotic cells in a dose-dependent manner (Fig. 3 A and B). This is fundamentally the same apoptotic state as that exhibited by other cells we have previously studied. We also found that ionizing radiation significantly promoted the expression of the intracellular proapoptotic protein Bax ( P < 0.05) (Fig. 3 C and E) and decreased the expression of the apoptosis-inhibiting gene BCL2 ( P < 0.05) (Fig. 3 C and E), as determined by RT‒qPCR and western blot analysis. 3.4 Effects of radiation on the development of MC3T3-E1 cells Osteoblasts are the main functional cells involved in bone formation and are responsible for the synthesis, secretion, and mineralization of the bone matrix. Osteoblasts are rich in ALP, which can reflect the differentiation ability of MC3T3-E1 cells. In irradiated cells, the range of ALP staining clearly decreased in a dose-dependent manner (Fig. 4 A), and the degree of reduction after high-dose radiation was extremely significant ( P < 0.05) (Fig. 4 B). The number of mineralization nodes chelated with calcium ions after ARS staining reflected that the mineralization ability of MC3T3-E1 cells was apparently reduced after gradient-dose irradiation (Fig. 4 A), which was also confirmed by quantitative analysis (Fig. 4 C). To conduct further research on the development of MC3T3-E1 cells after radiation, we detected the mRNA or protein expression levels of 4 common intracellular factors that are thought to be associated with osteoblast differentiation and mineralization. Consistent with the results of ALP staining, the level of intracellular ALP was also reduced at the transcriptional level. In parallel, the genes Runx2, Opn, and Collagen1, which affect the development of MC3T3-E1 cells at both the protein level and the mRNA level, decreased significantly after exposure to ionizing radiation (Fig. 4 D and 4 E) ( P < 0.05). 3.5 Screening and validation of potential molecules involved in radiation-induced osteoblast damage RNA sequencing via high-throughput technology was used to obtain whole mRNA expression information after MC3T3-E1 cells were treated with 8 Gy radiation. According to the sequencing results of BGI·Tech, we identified 26 differentially expressed genes in MC3T3-E1 cells after 8 Gy radiation. Among these genes, 22 genes were upregulated, whereas 4 genes were downregulated (Fig. 5 A). The differentially expressed genes were subjected to GO category analysis of biological progress (BP), which revealed that the differentially expressed genes were involved mainly in DNA damage reactions and repair, apoptotic progress and cell cycle regulation, especially G 2 /M arrest (Fig. 5 C). Moreover, we further used the DEGs to enrich the enriched KEGG pathways. The results of the identified KEGG pathway analysis indicated that these genes participate in several main pathways, including the PI3K-AKT signaling pathway, p53 signaling pathway and signaling pathway involved in the cell cycle and cell senescence (Fig. 5 D). Through KEGG CENT plots, we identified the signaling pathways enriched with several major DEGs. The genes encoding Mdm2 , Notch1 , Cdkn1a , Ccng , and ITGB7 performed most of the biological functions (Fig. 5 B). This annotation provides a reference for understanding the latent molecules and potential signaling pathways involved in osteoblast damage after radiation. Considering the cellular effects of ionizing radiation and the enriched biological functions revealed through RNA-seq, the expression levels of the key molecules Mdm2 , Notch1 , Cdkn1a , Ccng, Gclc , Stag1 and Asic1 were detected via RT‒qPCR and western blotting, and the results revealed that after 8 Gy irradiation, the RNA levels of Mdm2 , Notch1 , Ccng and Gclc were significantly increased ( P < 0.05), whereas those of Stag1 were decreased (Fig. 5 E); moreover, the protein levels of Cdkn1a, Mdm2 , Notch1 and Gclc were increased, and those of Stag1 were decreased (Fig. 5 F). The above results confirmed our sequencing results. 3.6 Confirmation of DNA damage caused by radiation in MC3T3-E1 cells The toxic effects of ionizing radiation can lead to multiple types of DNA damage, including DNA strand breakage and DNA cross-linking, but DNA double-strand breaks (DSBs) are generally considered the most severe. DSB induces the rapid formation of damage lesions, which contain the phosphorylated form of H2AX (γ-H2AX) and recruit many relevant factors, such as 53BP1, for DNA damage repair. Therefore, we used immunofluorescence to detect γ-H2AX-containing damage foci and 53BP1-containing repair foci. Three hours after the irradiation of MC3T3-E1 cells at 8 Gy, we observed extremely significant γ-H2AX damage signals (Fig. 6 A). Perhaps due to physical injury during the treatment process, the unirradiated MC3T3-E1 cells also presented few γ-H2AX signals. Moreover, immunofluorescence staining analysis revealed that, compared with the control cells, the 53BP1-treated cells presented high levels of DNA damage repair foci signals after irradiation (Fig. 6 B). 3.7 Effects of MDM2 on radiation-induced osteoblast growth On the basis of the significantly increased expression of MEM2, we designed a siRNA against MDM2 to examine its effects on cell proliferation, apoptosis and the cell cycle by downregulating MDM2. The results showed that si-MDM2-1 significantly inhibited MDM2 expression (Fig. 7 A) and was used in the following experiments. The cell proliferation rate was sharply increased by MDM2 inhibition under 8-Gy IR (Fig. 7 B and 7 C), the cell arrest rate in G2/M phase was reduced (Fig. 7 D), and the cell apoptosis rate was greater (Fig. 7 E) in the si-NC group than in the si-MDM2 group under 8-Gy IR, as were the corresponding changes in the expression of related genes (Fig. 7 F). 3.8 Effects of MDM2 on radiation-induced osteoblast differentiation Further evaluation of MDM2 in the context of radiation-induced osteoblast differentiation revealed that ALP and ARS staining were both clearly induced in the si-MDM2 group (Fig. 8 A), which was also confirmed by quantitative analysis (Fig. 8 B and 8 C). The expression levels of the genes Runx2, Opn, and Collagen1 increased significantly under the inhibition of MDM2 followed by the IR treatment (Fig. 8 D). 3.9 The inhibition of MDM2 aggravates DNA damage in osteoblasts Moreover, DNA damage and repair capacity were detected, and the results revealed that the inhibition of MDM2 alleviated DNA damage and reduced the repair of DNA repair induced by 8-Gy IR (Fig. 9 ). 4. Discussion Radiotherapy is still one of the major treatments for tumors and is accompanied by adverse late effects, including damage to the bone within the radiation field (Karali et al., 2023 ), which leads to a spectrum of bone changes from mild osteopenia to osteoradionecrosis with an increased risk of fractures, particularly in patients receiving radiotherapy in the pelvic region (Uezono et al., 2013 ; Chan et al., 2016 ). Understanding the mechanisms behind these adverse effects of radiation on bone and identifying effective therapeutic targets for such bone disorders are imperative to improve the quality of life of these patients. Preclinical and cell culture studies indicate that radiation impacts bone formation by decreasing the number of osteoblasts, arresting their cell cycle progression, altering their differentiation ability, and sensitizing them toward apoptotic signals (Dudziak et al., 2000 ; Gal et al., 2000 ; Matsumura et al., 1996 ; Szymczyk et al., 2004 ). Currently, no systematic studies on ionizing radiation-induced osteoblast injury have been reported. Therefore, in this study, the optimal IR damage dose was first determined by establishing a radiation-induced osteoblast injury model to measure cell proliferation, the cell cycle, cell apoptosis and further cell differentiation and mineralization abilities. According to our experimental results, when 4 Gy ionizing radiation was used to damage osteoblasts, cell survival and cell differentiation ability were significantly inhibited, and the apoptosis rate was increased significantly. After the 6 Gy and 8 Gy treatments, the G2 phase of the cell cycle was also significantly affected. Considering the influence on the survival and development ability of osteoblasts, as well as the changes in the expression levels of related genes (p-AKT, p-ERK1/2, cyclin B, BAX, BCL2, ALP, OPN, RUNX2, and Collagen 1), we chose an 8 Gy dose (2.22 Gy/min) as the radiation condition for osteoblast injury. We subsequently screened 26 DEGs after RNA sequencing of 8 Gy-irradiated MC3T3-E1 cells, which are considered key factors involved in radiation damage to osteoblast cells. Furthermore, the differentially expressed genes were subjected to Gene Ontology (GO) category analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment, which suggested that these genes were involved mainly in DNA damage and repair, cell apoptotic progress and cell cycle regulation and participated in several main pathways, including the PI3K-AKT signaling pathway, p53 signaling pathway and signaling pathways involved in the cell cycle and cell senescence. In addition, the genes Mdm2 , Notch1 , Cdkn1a , Ccng , Gclc , Itgb7 , Stag1 and Asic1 perform most of the biological functions. We focused on verifying the differential expression of the upregulated genes MDM2 , NOTCH1 , CDKN1A , CCNG , and GCLC and the downregulated genes STAG1 and ASIC1 according to the NCBI annotation and found that the expression of MDM2, NOTCH1, CDKN1A and GCLC was indeed upregulated after IR treatment, suggesting key roles in the response to IR. Radiation can induce Notch1 activation in breast CSCs (Lagadec et al., 2013 ). A previous study reported changes in Notch signaling following radiation; however, a strong relationship was not detected between the upregulation of Notch1 expression and the suppression of osteoblast differentiation (Yang et al., 2013 ), which may be attributed to the lower radiation dose. CDKN1A, also known as p21, is a critical gene in cell cycle regulation. A previous study confirmed that radiation inhibits cell proliferation through cell cycle arrest by increasing p21 expression (Kim et al., 2004 ), which was consistent with our results. GCLC, an antioxidant enzyme, facilitates radioresistance via the modulation of cellular ROS levels (You et al., 2022 ), which is a common cell response to IR. We verified that the PI3K-AKT signaling pathway was enriched in cell proliferation-related genes. The above validated genes and pathways provide a deep understanding of the latent molecules involved in osteoblast damage after radiation. In the present study, we focused on the most significantly upregulated gene, MDM2. MDM2 is an intracellular molecule with diverse biological functions. It was first described to limit p53-mediated cell cycle arrest and apoptosis, hence generating a rationale for being a potential therapeutic target in cancer therapy (Nayak et al., 2018 ; Bhatia et al., 2023 ; Wang et al., 2024 ). Moreover, MDM2 is also required for organ development and tissue homeostasis (Gannon et al., 2011 ; Molitoris et al., 2009 ; Hagemann et al., 2013 ; Fledderus et al., 2013). However, the role of MDM2 in radiation-induced bone or osteoblast damage has not been fully elucidated. The RNA sequence results revealed its critical function, which needs to be clarified. Therefore, we addressed the functions of MDM2 in osteoblast proliferation, differentiation and DNA damage and its regulatory role in the repair response after DNA damage caused by IR and confirmed that the knockdown of MDM2 alleviates IR-induced damage to MC3T3-E1 cells by promoting cell proliferation, reducing the cell cycle arrest rate and cell apoptosis rate, and reversing osteoblast differentiation. In addition, many studies have indicated that MDM2 is related to the radiation sensitivity of tumor cells and that the expression of MDM2 is induced in response to DNA damage (Alimova et al., 2022 ; Cai et al., 2023 ; Perry, 2004 ). On the basis of these findings, we also confirmed that the DNA protection role of the inhibition of MDM2 via IR reduced DNA damage in osteoblasts, which was coincident with the findings of studies showing that DNA damage mediates apoptosis in glioblastoma multiforme cells (Lou J et al., 2020 ). In conclusion, we demonstrated that IR damaged MC3T3-E1 cells by inhibiting cell proliferation, impacting the cell cycle process, inducing cell apoptosis and affecting osteoblast differentiation, possibly due to DNA damage at the cellular level, and the differential expression of key genes, especially MDM2, may be an intrinsic factor from a molecular perspective. Abbreviations IR Ionizing radiation ROS Reactive oxygen species DDR DNA damage response PI Propidium iodide ALP Alkaline phosphatase ARS Alizarin red staining SDS‒PAGE sodium dodecyl sulfate‒polyacrylamide gel electrophoresis. Declarations Author contributions Jiguo Lin and Gang Zhao conducted all trials and wrote the manuscript; Luping Wang, Chang Liu and Jie Feng completed experiment auxiliary work; Chaonan Sun, Mingyu Wang, Yunpeng Dai and Jialu Zhang completed statistical analysis; Yannan Shen and Yunyun Cheng conducted experiment design and results handing. Conflicts of interest We declare that we have no financial or personal relationships with other people or organizations that can inappropriately influence our work. There is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in the manuscript entitled. Funding This work was supported by the Science and Technology Research and Planning Project of the Education Department of Jilin Province (JJKH20231240KJ), the 8th young science and technology talent lift project of Jilin Province (QT202426), the Bethune Project of Jilin University (2024B39) and the College Students “Innovation and Entrepreneurship Training (Innovation Training)” Program of Jilin University (202310183271, 202310183276). Data availability statement Data are contained within the article. Data, analytic methods, and study materials can be made available to other researchers by requesting their usage for other studies by the corresponding author. References Alimova I, Wang D, Danis E, Pierce A, Donson A, Serkova N, Madhavan K, Lakshmanachetty S, Balakrishnan I, Foreman NK, Mitra S, Venkataraman S, Vibhakar R. Targeting the TP53/MDM2 axis enhances radiation sensitivity in atypical teratoid rhabdoid tumors. Int J Oncol. 2022;60(3):32. Baxter NN, Habermann EB, Tepper JE, et al. Risk of pelvic fractures in older women following pelvic irradiation. JAMA. 2005;294(20):2587–93. Bhatia N, Khator R, Kulkarni S, Singh Y, Kumar P, Thareja S. Recent Advancements in the Discovery of MDM2/MDM2-p53 Interaction Inhibitors for the Treatment of Cancer. Curr Med Chem. 2023;30(32):3668–701. Cai LH, Chen XY, Qian W, Liu CC, Yuan LJ, Zhang L, Nie C, Liu Z, Li Y, Li T, Liu MH. DDB2 and MDM2 genes are promising markers for radiation diagnosis and estimation of radiation dose independent of trauma and burns. Funct Integr Genomics. 2023;23(4):294. Chan S, Rowbottom L, McDonald R, David E, Chung H, Yee A, Turner A, Chow E. Pelvic insufficiency fractures in women following radiation treatment: a case series. Ann Palliat Med. 2016;5(3):233–7. Dudziak ME, Saadeh PB, Mehrara BJ, Steinbrech DS, Greenwald JA, Gittes GK, Longaker MT. The effects of ionizing radiation on osteoblast-like cells in vitro. Plast Reconstr Surg. 2000;106:1049–61. Fledderus JO, Goldschmeding R. Nrf2 implicated as a novel therapeutic target for renal regeneration after acute kidney injury. Nephrol Dial Transpl. 2013;28(8):1969–71. Gal TJ, Munoz-Antonia T, Muro-Cacho CA, Klotch DW. Radiation effects on osteoblasts in vitro: a potential role in osteoradionecrosis. Arch Otolaryngol Head Neck Surg. 2000;126:1124–8. Gannon HS, Donehower LA, Lyle S, Jones SN. Mdm2-p53 signaling regulates epidermal stem cell senescence and premature aging phenotypes in mouse skin. Dev Biol. 2011;353(1):1–9. Hagemann JH, Thomasova D, Mulay SR, Anders HJ. Nrf2 signaling promotes ex vivo tubular epithelial cell survival and regeneration via murine double minute (MDM)-2. Nephrol Dial Transpl. 2013;28(8):2028–37. Hopewell JW. Radiation-therapy effects on bone density. Med Pediatr Oncol. 2003;41(3):208–11. Karali A, Dall'Ara E, Zekonyte J, Kao AP, Blunn G, Tozzi G. Effect of radiation-induced damage of trabecular bone tissue evaluated using indentation and digital volume correlation. J Mech Behav Biomed Mater. 2023;138:105636. Kim HS, Cho HJ, Cho HJ, Park SJ, Park KW, Chae IH, Oh BH, Park YB, Lee MM. The essential role of p21 in radiation-induced cell cycle arrest of vascular smooth muscle cell. J Mol Cell Cardiol. 2004;37(4):871–80. Lagadec C, Vlashi E, Alhiyari Y, Phillips TM, Bochkur Dratver M, Pajonk F. Radiation-induced notch signaling in breast cancer stem cells. Int J Radiat Oncol Biol Phys. 2013;87:609–18. Lee SH, Cho WJ, Najy AJ, Saliganan AD, Pham T, Rakowski J, Loughery B, Ji CH, Sakr W, Kim S, Kato I, Chung WK, Kim HE, Kwon YT, Kim HC. p62/SQSTM1-induced caspase-8 aggresomes are essential for ionizing radiation-mediated apoptosis. Cell Death Dis. 2021;12(11):997. Matsumura S, Jikko A, Hiranuma H, Deguchi A, Fuchihata H. Effect of X-ray irradiation on proliferation and differentiation of osteoblast. Calcif Tissue Int. 1996;59:307–8. Molitoris BA, Dagher PC, Sandoval RM, Campos SB, Ashush H, Fridman E, Brafman A, Faerman A, Atkinson SJ, Thompson JD, Kalinski H, Skaliter R, Erlich S, Feinstein E. siRNA targeted to p53 attenuates ischemic and cisplatin-induced acute kidney injury. J Am Soc Nephrol. 2009;20(8):1754–64. Nayak SK, Khatik GL, Narang R, Monga V, Chopra HK. p53-Mdm2 Interaction Inhibitors as Novel Nongenotoxic Anticancer Agents. Curr Cancer Drug Targets. 2018;18(8):749–72. Perry ME. Mdm2 in the response to radiation. Mol Cancer Res. 2004;2(1):9–19. Santivasi WL, Xia F. Ionizing radiation-induced DNA damage, response, and repair. Antioxid Redox Signal. 2014;21(2):251–9. Soriano JL, Calpena AC, Souto EB, et al. Therapy for prevention and treatment of skin ionizing radiation damage: a review. Int J Radiat Biol. 2019;95(5):537–53. Shim MS, Xia Y. A reactive oxygen species (ROS)-responsive polymer for safe, efficient, and targeted gene delivery in cancer cells. Angew Chem Int Ed Eng. 2013;52(27):6926–9. Szymczyk KH, Shapiro IM, Adams C. Ionizing radiation sensitizes bone cells to apoptosis. Bone. 2004;34:148–56. Uezono H, Tsujino K, Moriki K, Nagano F, Ota Y, Sasaki R, Soejima T. Pelvic insufficiency fracture after definitive radiotherapy for uterine cervical cancer: retrospective analysis of risk factors. J Radiat Res. 2013;54:1102–9. Wang C, Liu S, Li J, Cheng Y, Wang Z, Feng T, Lu G, Wang S, Song J, Xia P, Hao L. Biological Functions of Let-7e-5p in Promoting the Differentiation of MC3T3-E1 Cells. Front Cell Dev Biol. 2021;9:671170. Wang W, Albadari N, Du Y, Fowler JF, Sang HT, Xian W, McKeon F, Li W, Zhou J, Zhang R. MDM2 Inhibitors for Cancer Therapy: The Past, Present, and Future. Pharmacol Rev. 2024;76(3):414–53. Yang B, Tang Q, Post J, Zhou H, Huang XB, Zhang XD, Wang Q, Sun YM, Fan FY. Effect of radiation on the Notch signaling pathway in osteoblasts. Int J Mol Med. 2013;31(3):698–706. You GR, Chang JT, Li YL, Huang CW, Tsai YL, Fan KH, Kang CJ, Huang SF, Chang PH, Cheng AJ. MYH9 Facilitates Cell Invasion and Radioresistance in Head and Neck Cancer via Modulation of Cellular ROS Levels by Activating the MAPK-Nrf2-GCLC Pathway. Cells. 2022;11(18):2855. Zhang J, Qiu X, Xi K, et al. Therapeutic ionizing radiation induced bone loss: a review of in vivo and in vitro findings. Connect Tissue Res. 2018;59(6):509–22. Zhang Y, Jiang T, Ni S, Liu W, Luo P, Hao S, Wang P, Guo L. Effects of Estrogen on Proliferation and Apoptosis of Osteoblasts through Regulating GPER/AKT Pathway. Cell Mol Biol (Noisy-le-grand). 2022; 68(6): 124–9. Lou J, Hao Y, Lin K, Lyu Y, Chen M, Wang H, Zou D, Jiang X, Wang R, Jin D, Lam EW, Shao S, Liu Q, Yan J, Wang X, Chen P, Zhang B, Jin B. Circular RNA CDR1as disrupts the p53/MDM2 complex to inhibit Gliomagenesis. Mol Cancer. 2020;19(1):138. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6259924","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":432480239,"identity":"0fe1d0fb-501f-45fb-a191-73a5f513e797","order_by":0,"name":"Jiguo Lin","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Jiguo","middleName":"","lastName":"Lin","suffix":""},{"id":432480241,"identity":"62ee2844-1b39-4d63-abd4-3ef207d6f98b","order_by":1,"name":"Gang Zhao","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Gang","middleName":"","lastName":"Zhao","suffix":""},{"id":432480244,"identity":"bba06aba-dca2-4af8-ba48-051ad1b1abbb","order_by":2,"name":"Luping Wang","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Luping","middleName":"","lastName":"Wang","suffix":""},{"id":432480245,"identity":"b46cde7a-d99a-4bcb-b72f-818412ced04a","order_by":3,"name":"Chang Liu","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Chang","middleName":"","lastName":"Liu","suffix":""},{"id":432480246,"identity":"45ed80a9-025f-4d45-b3f6-c7f75e7c98f1","order_by":4,"name":"Jie Feng","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Feng","suffix":""},{"id":432480247,"identity":"6907b236-62ce-414d-9d75-0066b1767c8d","order_by":5,"name":"Chaonan Sun","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Chaonan","middleName":"","lastName":"Sun","suffix":""},{"id":432480254,"identity":"4a31c731-df86-4909-ba30-bbdcdb6ab4b3","order_by":6,"name":"Mingyu Wang","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Mingyu","middleName":"","lastName":"Wang","suffix":""},{"id":432480258,"identity":"96b2281b-7cee-4510-8839-b880c7691ea7","order_by":7,"name":"Yunpeng Dai","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Yunpeng","middleName":"","lastName":"Dai","suffix":""},{"id":432480261,"identity":"fc5fb2a5-0649-40bb-8c2d-6be0a160bc9a","order_by":8,"name":"Jialu Zhang","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Jialu","middleName":"","lastName":"Zhang","suffix":""},{"id":432480262,"identity":"7137e17e-7e24-4e2e-9c0e-511a68e4e79c","order_by":9,"name":"Yannan Shen","email":"","orcid":"","institution":"Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Yannan","middleName":"","lastName":"Shen","suffix":""},{"id":432480263,"identity":"c8023d5c-93c1-401f-bc1d-95756b44087b","order_by":10,"name":"Yunyun Cheng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYDACCQglx9gOothI0GLM2EyqlsQGZmK18M9uPvbwa9vh9OZmHgOGD2WHgSINBCy5cyzdWLbtcG4jUAvjjHOHgSIH8GsxkMgxk5aEamHmbTsMFEkgpCX/G0hLOiNIy1/itOSwSX5sO5wA1sJIjBaJG2lm0gzn0g0bm9kKDvacS+eRuEFAC/+M5GeSP8qs5Q3bmzc+ADLk+GcQ0AICzLxszQyGDQwMB4AcHsLqgYDxx586BnmilI6CUTAKRsGIBAC4Aj/gz6L6tQAAAABJRU5ErkJggg==","orcid":"","institution":"Jilin University","correspondingAuthor":true,"prefix":"","firstName":"Yunyun","middleName":"","lastName":"Cheng","suffix":""}],"badges":[],"createdAt":"2025-03-19 09:23:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6259924/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6259924/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":79080310,"identity":"e110349a-fbdf-4313-9805-3204130c84a7","added_by":"auto","created_at":"2025-03-24 08:12:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":122499,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of different doses of ionizing radiation on the survival of MC3T3-E1 cells. \u003c/strong\u003eA. The viability of MC3T3-E1 cells 24, 48 and 72 h after 0, 2, 4, 6, and 8 Gy IR treatment was detected via a CCK8 assay. B. Clonogenic ability of MC3T3-E1 cells after 0, 2, 4, 6, and 8 Gy IR treatment, as detected by crystal violet staining. C. Changes in the expression of thecell proliferation-related genes p-AKT and p-ERK1/2 weredetected viawestern blot. D. Quantificationof the western blot bands in C.\u003c/p\u003e","description":"","filename":"Onlinefloatimage16.png","url":"https://assets-eu.researchsquare.com/files/rs-6259924/v1/26909b7a45fdb41dc9da5249.png"},{"id":79080312,"identity":"48c7946c-201a-4e0c-bc50-60335364c9b9","added_by":"auto","created_at":"2025-03-24 08:12:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":64005,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of different doses of ionizing radiation on the cell cycle distribution of MC3T3-E1 cells. \u003c/strong\u003eA. Cell cycle detection of MC3T3-E1 cells 24 h after 0, 2, 4, 6, or 8 Gy IR treatment by flow cytometry. B. Cell cycle distribution analysis after 0, 2, 4, 6, and 8 Gy IR treatment. C. Changes in thecyclin B gene mRNA level after 0, 2, 4, 6, and 8 Gy IR treatment were detected via RT‒qPCR. D. Changes in the cyclin Bprotein level after 0, 2, 4, 6, and 8 Gy IR treatment were detected via western blot.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6259924/v1/4017166de046ed926a61b79b.png"},{"id":79080540,"identity":"d8e010c0-6026-49ac-8d29-af3e946a9d1b","added_by":"auto","created_at":"2025-03-24 08:20:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":90478,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of different doses of ionizing radiation on the apoptosis of MC3T3-E1 cells. \u003c/strong\u003eA. Cell apoptosis of MC3T3-E1 cells 24 h after 0, 2, 4, 6, or 8 Gy IR treatment, as determined by flow cytometry. B. The cell apoptosis rate after 0, 2, 4, 6, and 8 Gy IR treatment. C. Changes in the BAX gene mRNA level after 0, 2, 4, 6, and 8 Gy IR treatment were detected via RT‒qPCR. D. Changes in the BCL2 gene mRNA level after 0, 2, 4, 6, and 8 Gy IR treatment were detected via RT‒qPCR. E. Changes in the protein levels of BAX and BCL2after 0, 2, 4, 6, and 8 Gy IR treatment were detected via western blot.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6259924/v1/ab7614d6fb63916c27b555ad.png"},{"id":79080314,"identity":"23fe9d71-adf8-4572-b63c-c2a5e49d4d38","added_by":"auto","created_at":"2025-03-24 08:12:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":183501,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of different doses of ionizing radiation on the cell differentiation and mineralization abilities of MC3T3-E1 cells. \u003c/strong\u003eA. Representative images of MC3T3-E1 cell differentiation detected by ALP staining (40×) and mineralization detected by ARS staining (100×) after 0, 2, 4, 6, and 8 Gy IR treatment. B. Quantitative analysis of ALP activity. C. Quantitative analysis of the ARS activity using 10% cetylpyridinium chloride. D. \u003cem\u003eALP\u003c/em\u003e, \u003cem\u003eOPN\u003c/em\u003e, \u003cem\u003eRUNX2\u003c/em\u003e and \u003cem\u003eCollagen 1\u003c/em\u003e mRNA levels changed after 0, 2, 4, 6, and 8 Gy IR, as determined by RT‒qPCR. E. Changes in the protein levels of OPN, RUNX2, and Collagnen1 after 0, 2, 4, 6, and8 Gy IR treatment.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6259924/v1/3ac1b0d10ddd6e5e888b0faf.png"},{"id":79080539,"identity":"dce3875f-ef57-4def-9fff-dbcedd3581cf","added_by":"auto","created_at":"2025-03-24 08:20:22","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":112535,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis and validation of potentialmolecules after 8 Gy ionizing radiation. \u003c/strong\u003eA. Heatmap of the DEGsin MC3T3-E1 cells after 8 Gy radiation. B. PPI network of differentially expressed genes. C. Pathway analysis of DEGs arranged into functional groups by GO enrichment. D. Genes that were differentially expressed were selected for gene ontology analysis. E. Validation of differentially expressed genes (\u003cem\u003eCDKN1A\u003c/em\u003e, \u003cem\u003eMDM2\u003c/em\u003e, \u003cem\u003eCCNG, GCLC\u003c/em\u003e, \u003cem\u003eNOTCH1\u003c/em\u003e, \u003cem\u003eSTAG1 \u003c/em\u003eand\u003cem\u003e ASIC1\u003c/em\u003e) via RT‒qPCR. F. The differentially expressed genes were further validated by western blot analysis.\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6259924/v1/208d3fdadbd49ca665a94663.png"},{"id":79080321,"identity":"2dae704f-7ff2-4307-b037-b67fbb4f6773","added_by":"auto","created_at":"2025-03-24 08:12:22","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":444378,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetection of DNA damage and repair in MC3T3-E1 cells via immunofluorescence after 8 Gy ionizing radiation. \u003c/strong\u003eA. DNA damage foci detected by the immunofluorescence of γ-H2AX. B. DNA damage repair detected by the immunofluorescence of 53BP1.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6259924/v1/3fc1428f384ea860d5c3cbba.jpeg"},{"id":79080317,"identity":"fa15020c-8d9e-4bc7-ab2e-7c7cd028f0c9","added_by":"auto","created_at":"2025-03-24 08:12:22","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":253794,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMC3T3-E1 cell growth is affected by the inhibition of MDM2 following IR treatment. \u003c/strong\u003eA. MDM2 expression detection under si-MDM2 transfection. B. Cell proliferation affected by si-MDM2, as determined through a CCK8 assay. C. Crystal violet staining revealed that the clonogenic ability was affected by si-MDM2. D. Cellcycle distribution detection of si-MDM2 in MC3T3-E1 cells. E. Cell apoptosis detection of MC3T3-E1 cells transfected with si-MDM2. F. Changes in the expression of cell growth-related genes were detected via western blot.\u003c/p\u003e","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6259924/v1/fc4271f5a96643691375bd32.png"},{"id":79080323,"identity":"8bc19f5d-68c1-4f8c-9ebf-0428daa87877","added_by":"auto","created_at":"2025-03-24 08:12:22","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":279535,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMC3T3-E1 cell development is affected by the inhibition of MDM2 following IR treatment. \u003c/strong\u003eA. Representative images of MC3T3-E1 cell differentiation detected by ALP staining and mineralization detected by ARS staining after the inhibition of MDM2 followed by IR treatment. B. Quantitative analysis of ALP activity. C. Quantitative analysis of the ARS activity using 10% cetylpyridinium chloride. D. The OPN, RUNX2 and Collagen 1 protein levels changed after the inhibition of MDM2 following IR treatment.\u003c/p\u003e","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-6259924/v1/2a1e5c5c1adf548e6cafdc1a.png"},{"id":79080316,"identity":"c1bb90b8-1f96-4fed-b512-4c8208fc8fd2","added_by":"auto","created_at":"2025-03-24 08:12:22","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":63477,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDNA damage and repair inMC3T3-E1 cells are affected by the inhibition of MDM2 following IR treatment. \u003c/strong\u003eA. DNA damage foci detected by the immunofluorescence of γ-H2AX. B. DNA damage repair detected by the immunofluorescence of 53BP1. C. The degree of DNA damage caused by si-MDM2 following IR treatment.\u003c/p\u003e","description":"","filename":"Onlinefloatimage91.png","url":"https://assets-eu.researchsquare.com/files/rs-6259924/v1/6887c3f4dcf402835ee18320.png"},{"id":79799025,"identity":"72e9cc14-dd93-47ff-925f-55c57cd6871d","added_by":"auto","created_at":"2025-04-03 02:31:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2980246,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6259924/v1/a8cf5372-b8e8-46c4-b9d5-e53601a7ecc5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification of MDM2 as a novel marker gene that modulates radiation-induced osteoblast damage","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eRadiotherapy remains one of the main treatments for various tumors, and bone injury is a common side effect of radiotherapy. Radioactive bone injuries present as pathological fractures, deformities, or even osteonecrosis. The probability of pathological fracture increases by 2%~6% after pelvic tissue irradiation (Baxter et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). The main cause of the symptoms of bone damage is osteopenia, which includes decreased bone mineral density and decreased osteocalcin. Clinical data suggest that ionizing radiation (IR) leads to a decrease of 8\u0026thinsp;~\u0026thinsp;23% in bone tissue (Hopewell, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Tumor invasion and pathological fractures caused by radiotherapy seriously affect the quality of life of patients after treatment.\u003c/p\u003e \u003cp\u003eIR directly and indirectly causes tissue and organ damage during medical diagnosis and treatment (Soriano et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In random reactions of biological molecules, including DNA and protein (Shim et al., 2013), in which DNA is the target molecule of IR, the injury-induced DNA damage response (DDR) activates several closely related signal transduction pathways, and these pathways form a tight response mechanism, including cell cycle checkpoints (Santivasi et al., 2014) and cell apoptosis (Lee et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), resulting in a series of biological effects. Data from both in vitro and in vivo studies have suggested that IR can affect bone formation by killing or damaging osteoblasts and reducing bone density, which is thought to be a long-term response after damage to osteoblasts, especially by reducing osteoblast proliferation and differentiation (Zhang et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCurrently, there are few studies on radiation-induced bone injury, and the molecular mechanisms by which ionizing radiation affects the differentiation and function of osteoblast cells remain unknown. Therefore, this study aimed to establish a radiation-induced osteoblast injury model, screen and identify related factors involved in radiation injury to osteoblasts through RNA-seq, and then confirm that key molecules participate in radiation-induced osteoblast damage to provide basic data for the protection against and repair of radiation-induced bone injury.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Cell culture and induction of osteoblast differentiation\u003c/h2\u003e \u003cp\u003eThe MC3T3-E1 osteoblasts were purchased from Hycyte Biology (China) and were cultured in complete medium containing α-minimum essential medium (α-MEM, Gibco, USA), fetal bovine serum (FBS, Gibco, USA), and 1% penicillin/streptomycin (p/s, Solarbio) at 37\u0026deg;C in a humidified atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e. The osteoblast differentiation medium contained 10 mM β-glycerophosphate (Sigma, USA), 50 \u0026micro;g/mL ascorbic acid (Sigma, USA), 10 nmol dexamethasone (Sigma, USA), 10% FBS, and 1% p/s in α-MEM.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 CCK-8 assay\u003c/h2\u003e \u003cp\u003e \u003cb\u003eA\u003c/b\u003e CCK-8 kit (Saintbio, China) was used to detect cell proliferation. MC3T3-E1 cells (5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells/well) were seeded in 96‐well plates in quintuplicate with complete medium. A total dose of 0, 2, 4, 6, or 8 Gy (2.22 Gy/min) X-ray radiation was subsequently administered to the cells via a PXI X-RAD (American). Twenty-four, 48, and 72 h after radiation, the cells were incubated with 10 \u0026micro;L of CCK-8 reagent, and cell viability was assessed by measuring the absorbance at a wavelength of 450 nm via a microplate reader (BioTek, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Clonogenic assay\u003c/h2\u003e \u003cp\u003eClonogenic formation assays were performed after X-ray radiation at gradient doses to evaluate the proliferative ability of MC3T3-E1 cells. MC3T3-E1 cells (800 cells/well) in the logarithmic growth phase were cultured in 6-well plates with complete medium for 24 h. After being cultured for another 10 days with X-ray radiation at 0, 2, 4, 6, or 8 Gy, the cells were fixed with crystal violet, and the resulting colonies were counted.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Cell cycle assay\u003c/h2\u003e \u003cp\u003eMC3T3-E1 cells (5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well) were seeded in 6-well plates in quintuplicate with complete medium for 24 h. After being subjected to gradient-dose X-ray radiation, the cells were digested with 0.25% trypsin. Then, anhydrous ethanol was added to the cells, which were fixed for two hours at 4\u0026deg;C, followed by incubation with propidium iodide (PI) in a dark environment at room temperature for 30 min to detect the distribution of the cell cycle distribution via flow cytometry.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Cell apoptosis assay\u003c/h2\u003e \u003cp\u003eCell culture and preliminary treatment methods were performed as described above. After multiple washes and centrifugations, the cells were dissolved in binding buffer. Then, the cells were incubated with propidium iodide (PI) and Annexinv-FITC for 15 min following the manufacturer\u0026rsquo;s instructions for the Annexin V-FITC/PI Apoptosis Kit in the dark. Finally, these already processed cells were detected by flow cytometry to analyze their degree of apoptosis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Alkaline phosphatase (ALP) staining and quantification\u003c/h2\u003e \u003cp\u003eAlkaline phosphatase (ALP) staining was used to evaluate the mineralization capacity and degree of transformation of MC3T3-E1 cells. MC3T3-E1 cells (5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well) were cultured in 6-well plates overnight. After X-ray irradiation at 0, 2, 4, 6, and 8 Gy, the cells were cultured with equal volumes of osteoblast differentiation medium for 7 days, and the culture medium was changed every 2 days. Differentiated osteoblasts were fixed with 4% polyoxymethylene for 15 min and then incubated in the dark at room temperature for 3 h with a mixture of 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) and nitro-blue tetrazolium (NBT) reagents (Beyotime, China), and the stained osteoblasts were observed and photographed under a microscope.\u003c/p\u003e \u003cp\u003eAn ALP activity assay kit (Beyotime, China) and a BCA protein assay kit (Beyotime, China) were used to analyze the activity of ALP quantitatively. Differentiated osteoblasts were lysed, and the ALP activity and protein content were assessed via a microplate reader (BioTek, USA) at wavelengths of 520 and 595 nm, respectively. The relative activity of ALP was adjusted by the protein concentration. Data analysis was conducted with GraphPad Prism 8.0 (San Diego, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Alizarin red (ARS) staining\u003c/h2\u003e \u003cp\u003eAlizarin red S (Sigma, USA) was used to determine the extracellular matrix mineralization capacity of MC3T3-E1 cells by detecting mineralized nodes that were chelated with calcium ions. MC3T3-E1 cells (5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well) were seeded in 6-well plates in quintuplicate with complete medium overnight. Eighty percent confluent cells were administered X-ray radiation at a total dose of 0, 2, 4, 6, or 8 Gy (2.22 Gy/min) and cultured for 21 days in osteoblast differentiation medium. The osteoblasts were fixed with 4% paraformaldehyde for 15 min, followed by staining with 500 \u0026micro;L of 1% ARS (pH 4.2) solution for 30 min. Finally, the stained osteoblasts were observed and photographed via a microscope. After that, the stained calcium nodules of the osteoblasts were incubated with 10% cetylpyridinium chloride (Sigma, USA), and the absorbance at a wavelength of 562 nm was quantified with a microplate reader (BioTek, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Immunofluorescence (IF)\u003c/h2\u003e \u003cp\u003eImmunofluorescence of γ-H2AX and 53BP1 was used to detect DNA damage and repair reactions. MC3T3-E1 cells were cultured on Lab-Tek culture slides in 6-well plates in complete medium. Before immunostaining, the cells were administered a total dose of 0, 2, 4, 6, or 8 Gy (2.22 Gy/min) X-ray radiation. Three hours after radiation, the cells were fixed and permeabilized with 4% paraformaldehyde and 0.5% Triton X-100 for 15 min and blocked in 5% BSA for 1 h at 37\u0026deg;C. γ-H2AX was detected with a mouse anti-γH2AX monoclonal antibody (CST, USA), and 53BP1 was detected with a rabbit anti-53BP1 monoclonal antibody (CST, USA) at 4\u0026deg;C overnight. The cells were subsequently incubated with a FITC-conjugated goat anti-mouse secondary antibody (Bioworld, USA) and a rhodamine-conjugated goat anti-rabbit secondary antibody (Bioworld, USA) for 1 h at room temperature in the dark. The cell nuclei were counterstained with DAPI for 20 min. The images were observed under a fluorescence microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Quantitative real-time PCR analysis (RT‒qPCR)\u003c/h2\u003e \u003cp\u003eAfter being subjected to functional-grade radiation, MC3T3-E1 cells were lysed with TRIzol reagent (Invitrogen, USA), and total RNA was extracted with chloroform and isopropanol. After being washed with 75% ethanol, total RNA was dissolved in RNase-free water to 20 \u0026micro;L, and the concentration of RNA was determined with a microplate reader (BioTek, USA) at an absorbance wavelength of 260 nm. The reverse transcription reaction and construction of the real-time PCR system were performed with an Evo M-MLV RT Mix Kit (Takara, Japan) with clean gDNA for RT‒qPCR following the manufacturer\u0026rsquo;s instructions. The sequences of primers used in this experiment are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for RT‒qPCR assays for detecting the expression of target genes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGenBank accession NO.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequences(5\u0026acute;\u0026rarr;3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePositions in\u003c/p\u003e \u003cp\u003eGene*\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAnnealing temperature (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR product (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCyclin B\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_172301.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CTCAGGGTCACTAGGAACACGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e91\u0026ndash;112\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e156\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TTCGCTGACTTTATTACCAATGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e223\u0026ndash;246\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eBAX\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001411994\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: ATTGGAGATGAACTGGACAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e293\u0026ndash;314\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CACGTCAGCAATCATCCTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e326\u0026ndash;346\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eBCL2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_009741\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CTGTGGATGACTGAGTACCTGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1924\u0026ndash;1947\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e134\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GTCTTCAGAGACAGCCAGGAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2036\u0026ndash;2057\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eOPN\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001204201\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: ACACTTTCACTCCAATCGTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e541\u0026ndash;561\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e240\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TGCCCTTTCCGTTGTTGTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e761\u0026ndash;780\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eRUNX2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_009820.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GAGGGACTATGGCGTCAAACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e201\u0026ndash;221\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GGATCCCAAAAGAAGCTTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e250\u0026ndash;270\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eALP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001287172\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TGTGCCAGAGAAAGAGAGAGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e333\u0026ndash;355\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e112\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GATGACATTCTTGGCTACATTGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e421\u0026ndash;444\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCDKN1A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001111099.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TGGTGGAGACCTGATGATACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u0026ndash;30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e145\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: ACATCACCAGGATTGGACATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e134\u0026ndash;154\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eGCLC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_010295.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: ATGTCTGAGTTCAACACTGTGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e615\u0026ndash;637\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e143\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CTGTGTTCTGGCAGTGTGAATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e736\u0026ndash;757\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eMDM2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_010786.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CAGCAGCACATTGTGTATTGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e437\u0026ndash;459\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e134\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GAGTCTTGCTGACTTACAGCCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e548\u0026ndash;570\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eNOTCH1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_008714.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CCTGCTCACTCTCACAGAGTACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e618\u0026ndash;640\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e144\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CAGCGACAGATGTATGAAGACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e739\u0026ndash;761\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCCNG1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_009831.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TGTGAATTTACTGGACAGATTCTTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e442\u0026ndash;467\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e163\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CGTGAACCTATACTGACTTATTCGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e580\u0026ndash;604\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSTAG1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_009282.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GAATAGCTTCTCCAGCAATGATTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e241\u0026ndash;265\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e84\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CAGCATCAGAGTGGGCAGTAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e303\u0026ndash;324\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eAsic1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_009597.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TGATTGTGAAACCCGTTACCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1464\u0026ndash;1484\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e171\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: AGGTTGCAGGGCATCTCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1616\u0026ndash;1634\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_007393.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TTCCAGCCTTCCTTCTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e893\u0026ndash;911\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e104\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TTGGCATAGAGGTCTTTACGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e976\u0026ndash;996\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003csup\u003e༊\u003c/sup\u003eThe start base was the first base of the sequence of the GenBank accession we referred to.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe RT‒qPCR steps included 1 cycle of 95\u0026deg;C for 3 min, 40 cycles of 95\u0026deg;C for 15 sec and 59\u0026deg;C for 10 sec. β-actin was used as an internal control gene, and the relative expression levels of genes of interest were calculated via the \u003csup\u003e2\u0026minus;ΔΔCT\u003c/sup\u003e method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Western blot analysis\u003c/h2\u003e \u003cp\u003eAll of the irradiated cell samples were extracted via Western and IP cell lysis buffers containing 1% protease inhibitor and phosphatase inhibitor to obtain total protein. To evaluate the levels of differentially expressed proteins, western blotting was used to separate the extracted total proteins by 8% sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒PAGE). After protein gel electrophoresis, the separated proteins were transferred to a PVDF membrane, which was blocked with 10% nonfat milk powder in TBST for 1 h. The membrane was incubated overnight at 4\u0026deg;C with primary antibodies specific for phosphorylated AKT (Proteintech, China), phosphorylated ERK1/2 (Proteintech, China), Cyclin B (HUABIO, China), BAX (HUABIO, China), BCL2 (HUABIO, China), OPN (Wanleibio, China), RUNX2 (Wanleibio, China), Collagen 1 (Proteintech, China), Cdkn1α (Abways, China), MDM2 (Proteintech, China), GCLC (Abways, China), NOTCH1 (Abways, China), STAG1 (UpingBio, China), β-actin (BBI, China) and HRP-conjugated secondary antibodies (BBI, China) for 1 h at room temperature. The protein signals were detected and captured with a Mini Chemiluminescent System (SINSAGE, China) via a high-sensitivity ECL Kit (Beyotime, China). Quantitative analysis of grayscale values was performed via GenoSens Analysis (Clinx Science Instruments, China), and β-actin was used for normalization.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.10 RNA Sequencing and Bioinformatics analysis\u003c/h2\u003e \u003cp\u003eThe RNA sequencing data were obtained from BGI Tech (China, Shenzhen), and the specific steps were as follows. The 8Gy X-ray radiation group and the control group were set up with three samples in each group. Total RNA was purified via an RNeasy spin column with 500 \u0026micro;L of Buffer PRE three times, and the purified RNA was dissolved in 35 \u0026micro;L of RNase-free water and collected. A small volume of RNA sample was removed, oligo-dT primers were added, and RNA denaturation was performed via an instrument for PCR. SMART amplification was used to synthesize cDNA, and quality control of cDNA enriched via reverse transcription was performed to construct an RNA-Seq library. The cDNA of the PCR products was subsequently denatured into single strands, and single-stranded circular DNA was obtained through a DNA cyclization reaction. Single-stranded circular DNA molecules were replicated to form a DNA nanosphere (DNB) containing multiple copies. The obtained DNBs were added to a DNA microarray chip for sequencing via combinatorial probe-anchor synthesis (cPAS). The raw data obtained from sequencing were removed from low-quality reads via SOAPnuke (v1.5.6), followed by Dr. Tom (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://biosys.bgi.com\u003c/span\u003e\u003cspan address=\"https://biosys.bgi.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to perform differential expression gene analysis, pathway and gene functional annotation, and visualization of identified genes through bioinformatics analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.11 SiRNA transfection\u003c/h2\u003e \u003cp\u003eAll of the RNA oligonucleotides used in this study, including si-MDM2 and the corresponding negative controls (NCs), were obtained from Sangon Biotech Co., Ltd. (Shanghai, China), and the sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The oligonucleotides were transfected via LipoPlus\u0026trade; Reagent (Sage creation, China) according to the manufacturer\u0026rsquo;s protocol, with at least three replications. Specifically, for the detection of MDM2 expression inhibition by si-MDM2, MC3T3-E1 cells were seeded in a 6 cm cell culture dish, 400 pM siRNAs were then transfected, and the cells were collected for mRNA/protein detection at 24 h after transfection. To test the effects of MDM2 on cell proliferation, the cell cycle and cell apoptosis, as well as the related gene expression, the siRNA-transfected cells were also collected at 24 h after transfection. To assess the effect of MDM2 on osteoblast differentiation, the cells were treated with osteoblast differentiation medium 24 h after transfection with si-MDM2 or si-NC.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of the siRNA oligonucleotides\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequences(5' -3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSi-MDM2-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense: CACAUUGUGUAUUGUUCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAntisense: UUGAACAAUACACAAUGUG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSi-MDM2-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense: GGAAGUGUACCUCAUGCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAntisense: UUGCAUGAGGUACACUUCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSi-MDM2-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense: GACAGAGAAUGAUGCUAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAntisense: UUUAGCAUCAUUCUCUGUC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSi-NC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense: UUCUCCGAACGUGUCACGUTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAntisense: ACGUGACACGUUCGGAGAATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Comet assay\u003c/h2\u003e \u003cp\u003eTo quantify the amount of DNA damage in the different groups, a comet assay was performed via a DNA damage comet assay kit (Beyotime, China) according to the manufacturer\u0026rsquo;s instructions. Briefly, after 3 h of IR, the cells were harvested and mixed with low-melting agarose gel at 37\u0026deg;C. The gel containing the embedded cells was layered over microscopy slides previously coated with 1% normal-melting point agarose gel. The cells were then lysed by immersion in lysis solution (comprising a 9:1 ratio of lysis buffer to DMSO). For Comet, the slides were immersed in alkaline electrophoresis buffer for 60 min to allow the DNA double strands to unwind before electrophoresis was performed at 25 V for 30 min in 850 mL of alkaline electrophoresis buffer. The slides were neutralized with neutral buffer, and 20 \u0026micro;L of PI solution was used to stain the slides for 30 min in the dark before being analyzed via fluorescence microscopy (Leica, Germany). Comet images were analyzed via OpenComet analysis software. The tail moment length was used as the parameter for estimating DNA damage levels, as it is a combination of the amount of DNA in the tail and the migration distance relative to the nucleus.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Statistical analysis\u003c/h2\u003e \u003cp\u003eAll the statistical analyses were performed with GraphPad Prism 8.0 software (San Diego, USA), and the data are presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard errors. Differences were compared via unpaired Student\u0026rsquo;s t tests for two groups or one-way ANOVA for multiple groups. A P value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. (\u003cem\u003e\u0026lowast;P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; \u003cem\u003e\u0026lowast;\u0026lowast;P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Effects of radiation on the proliferation of MC3T3-E1 cells\u003c/h2\u003e \u003cp\u003eWe first measured the proliferation ability of MC3T3-E1 cells after gradient-dose irradiation via a CCK-8 assay. The results revealed that the proliferation ability of the cells was markedly inhibited after 6 Gy or 8 Gy (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) irradiation, and the most significant decrease was observed at 72 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Similarly, the clonogenic formation assay results also revealed that as the radiation dose increased, the proliferation ability of MC3T3-E1 cells gradually decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Moreover, available data have shown that the PI3K-AKT and ERK signaling pathways promote the proliferation of osteoblasts (Zhang et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Western blot analysis revealed that the protein expression levels of phosphorylated AKT and ERK were significantly decreased after 8 Gy irradiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and D).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Effects of radiation on the cell cycle of MC3T3-E1 cells\u003c/h2\u003e \u003cp\u003eThe majority of experiments have shown that irradiation leads to cell cycle modification, ultimately resulting in a delay in mitotic division in a dose-dependent manner. However, the form of cell cycle arrest varies among cells. Thus, the cell cycle distribution of MC3T3-E1 cells exposed to radiation was examined via flow cytometry. There was a significant increase in the proportion of MC3T3-E1 cells in the G2 phase after 6 Gy or 8 Gy irradiation compared with that in the 0 Gy group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), whereas the proportion of cells in the G1 and S phases did not change significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and B). To confirm that G2/M phase arrest had occurred, we further monitored G2/M checkpoint-associated proteins and detected an increase in cyclin B expression at certain doses at both the mRNA (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) and protein levels compared with those in the 0 Gy group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Effects of radiation on the apoptosis of MC3T3-E1 cells\u003c/h2\u003e \u003cp\u003eApoptosis is an actively genetically directed programmed cell death process. It is initiated by certain signals that govern the removal of dying or harmful cells, and apoptosis-associated genes are expressed in an orderly manner during this process. In our experiments, we analyzed irradiated MC3T3-E1 cells via flow cytometry to determine the relationship between apoptosis and irradiation dose. As expected, exposure of MC3T3-E1 cells to radiation led to a gradual increase in the ratio of apoptotic cells in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B). This is fundamentally the same apoptotic state as that exhibited by other cells we have previously studied. We also found that ionizing radiation significantly promoted the expression of the intracellular proapoptotic protein Bax (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and E) and decreased the expression of the apoptosis-inhibiting gene BCL2 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and E), as determined by RT‒qPCR and western blot analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Effects of radiation on the development of MC3T3-E1 cells\u003c/h2\u003e \u003cp\u003eOsteoblasts are the main functional cells involved in bone formation and are responsible for the synthesis, secretion, and mineralization of the bone matrix. Osteoblasts are rich in ALP, which can reflect the differentiation ability of MC3T3-E1 cells. In irradiated cells, the range of ALP staining clearly decreased in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), and the degree of reduction after high-dose radiation was extremely significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The number of mineralization nodes chelated with calcium ions after ARS staining reflected that the mineralization ability of MC3T3-E1 cells was apparently reduced after gradient-dose irradiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), which was also confirmed by quantitative analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eTo conduct further research on the development of MC3T3-E1 cells after radiation, we detected the mRNA or protein expression levels of 4 common intracellular factors that are thought to be associated with osteoblast differentiation and mineralization. Consistent with the results of ALP staining, the level of intracellular ALP was also reduced at the transcriptional level. In parallel, the genes Runx2, Opn, and Collagen1, which affect the development of MC3T3-E1 cells at both the protein level and the mRNA level, decreased significantly after exposure to ionizing radiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Screening and validation of potential molecules involved in radiation-induced osteoblast damage\u003c/h2\u003e \u003cp\u003eRNA sequencing via high-throughput technology was used to obtain whole mRNA expression information after MC3T3-E1 cells were treated with 8 Gy radiation. According to the sequencing results of BGI\u0026middot;Tech, we identified 26 differentially expressed genes in MC3T3-E1 cells after 8 Gy radiation. Among these genes, 22 genes were upregulated, whereas 4 genes were downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The differentially expressed genes were subjected to GO category analysis of biological progress (BP), which revealed that the differentially expressed genes were involved mainly in DNA damage reactions and repair, apoptotic progress and cell cycle regulation, especially G\u003csub\u003e2\u003c/sub\u003e/M arrest (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Moreover, we further used the DEGs to enrich the enriched KEGG pathways. The results of the identified KEGG pathway analysis indicated that these genes participate in several main pathways, including the PI3K-AKT signaling pathway, p53 signaling pathway and signaling pathway involved in the cell cycle and cell senescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Through KEGG CENT plots, we identified the signaling pathways enriched with several major DEGs. The genes encoding \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eMdm2\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eNotch1\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eCdkn1a\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eCcng\u003c/span\u003e, and \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eITGB7\u003c/span\u003e performed most of the biological functions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). This annotation provides a reference for understanding the latent molecules and potential signaling pathways involved in osteoblast damage after radiation.\u003c/p\u003e \u003cp\u003eConsidering the cellular effects of ionizing radiation and the enriched biological functions revealed through RNA-seq, the expression levels of the key molecules \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eMdm2\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eNotch1\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eCdkn1a\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eCcng, Gclc\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eStag1\u003c/span\u003e \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eand\u003c/span\u003e \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eAsic1\u003c/span\u003e were detected via RT‒qPCR and western blotting, and the results revealed that after 8 Gy irradiation, the RNA levels of \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eMdm2\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eNotch1\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eCcng\u003c/span\u003e \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eand\u003c/span\u003e \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eGclc\u003c/span\u003e were significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas those of Stag1 were decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE); moreover, the protein levels of \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eCdkn1a, Mdm2\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eNotch1\u003c/span\u003e \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eand\u003c/span\u003e \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eGclc\u003c/span\u003e were increased, and those of Stag1 were decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). The above results confirmed our sequencing results.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Confirmation of DNA damage caused by radiation in MC3T3-E1 cells\u003c/h2\u003e \u003cp\u003eThe toxic effects of ionizing radiation can lead to multiple types of DNA damage, including DNA strand breakage and DNA cross-linking, but DNA double-strand breaks (DSBs) are generally considered the most severe. DSB induces the rapid formation of damage lesions, which contain the phosphorylated form of H2AX (γ-H2AX) and recruit many relevant factors, such as 53BP1, for DNA damage repair. Therefore, we used immunofluorescence to detect γ-H2AX-containing damage foci and 53BP1-containing repair foci. Three hours after the irradiation of MC3T3-E1 cells at 8 Gy, we observed extremely significant γ-H2AX damage signals (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Perhaps due to physical injury during the treatment process, the unirradiated MC3T3-E1 cells also presented few γ-H2AX signals. Moreover, immunofluorescence staining analysis revealed that, compared with the control cells, the 53BP1-treated cells presented high levels of DNA damage repair foci signals after irradiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.7 Effects of MDM2 on radiation-induced osteoblast growth\u003c/h2\u003e \u003cp\u003eOn the basis of the significantly increased expression of MEM2, we designed a siRNA against MDM2 to examine its effects on cell proliferation, apoptosis and the cell cycle by downregulating MDM2. The results showed that si-MDM2-1 significantly inhibited MDM2 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA) and was used in the following experiments. The cell proliferation rate was sharply increased by MDM2 inhibition under 8-Gy IR (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC), the cell arrest rate in G2/M phase was reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD), and the cell apoptosis rate was greater (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE) in the si-NC group than in the si-MDM2 group under 8-Gy IR, as were the corresponding changes in the expression of related genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.8 Effects of MDM2 on radiation-induced osteoblast differentiation\u003c/h2\u003e \u003cp\u003eFurther evaluation of MDM2 in the context of radiation-induced osteoblast differentiation revealed that ALP and ARS staining were both clearly induced in the si-MDM2 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), which was also confirmed by quantitative analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB and \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). The expression levels of the genes Runx2, Opn, and Collagen1 increased significantly under the inhibition of MDM2 followed by the IR treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e3.9 The inhibition of MDM2 aggravates DNA damage in osteoblasts\u003c/h2\u003e \u003cp\u003eMoreover, DNA damage and repair capacity were detected, and the results revealed that the inhibition of MDM2 alleviated DNA damage and reduced the repair of DNA repair induced by 8-Gy IR (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eRadiotherapy is still one of the major treatments for tumors and is accompanied by adverse late effects, including damage to the bone within the radiation field (Karali et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), which leads to a spectrum of bone changes from mild osteopenia to osteoradionecrosis with an increased risk of fractures, particularly in patients receiving radiotherapy in the pelvic region (Uezono et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Chan et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Understanding the mechanisms behind these adverse effects of radiation on bone and identifying effective therapeutic targets for such bone disorders are imperative to improve the quality of life of these patients.\u003c/p\u003e \u003cp\u003ePreclinical and cell culture studies indicate that radiation impacts bone formation by decreasing the number of osteoblasts, arresting their cell cycle progression, altering their differentiation ability, and sensitizing them toward apoptotic signals (Dudziak et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Gal et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Matsumura et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Szymczyk et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Currently, no systematic studies on ionizing radiation-induced osteoblast injury have been reported. Therefore, in this study, the optimal IR damage dose was first determined by establishing a radiation-induced osteoblast injury model to measure cell proliferation, the cell cycle, cell apoptosis and further cell differentiation and mineralization abilities. According to our experimental results, when 4 Gy ionizing radiation was used to damage osteoblasts, cell survival and cell differentiation ability were significantly inhibited, and the apoptosis rate was increased significantly. After the 6 Gy and 8 Gy treatments, the G2 phase of the cell cycle was also significantly affected. Considering the influence on the survival and development ability of osteoblasts, as well as the changes in the expression levels of related genes (p-AKT, p-ERK1/2, cyclin B, BAX, BCL2, ALP, OPN, RUNX2, and Collagen 1), we chose an 8 Gy dose (2.22 Gy/min) as the radiation condition for osteoblast injury.\u003c/p\u003e \u003cp\u003eWe subsequently screened 26 DEGs after RNA sequencing of 8 Gy-irradiated MC3T3-E1 cells, which are considered key factors involved in radiation damage to osteoblast cells. Furthermore, the differentially expressed genes were subjected to Gene Ontology (GO) category analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment, which suggested that these genes were involved mainly in DNA damage and repair, cell apoptotic progress and cell cycle regulation and participated in several main pathways, including the PI3K-AKT signaling pathway, p53 signaling pathway and signaling pathways involved in the cell cycle and cell senescence. In addition, the genes \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eMdm2\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eNotch1\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eCdkn1a\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eCcng\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eGclc\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eItgb7\u003c/span\u003e, \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eStag1\u003c/span\u003e \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eand\u003c/span\u003e \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003eAsic1\u003c/span\u003e perform most of the biological functions. We focused on verifying the differential expression of the upregulated genes \u003cem\u003eMDM2\u003c/em\u003e, \u003cem\u003eNOTCH1\u003c/em\u003e, \u003cem\u003eCDKN1A\u003c/em\u003e, \u003cem\u003eCCNG\u003c/em\u003e, and \u003cem\u003eGCLC\u003c/em\u003e and the downregulated genes \u003cem\u003eSTAG1\u003c/em\u003e and \u003cem\u003eASIC1\u003c/em\u003e according to the NCBI annotation and found that the expression of MDM2, NOTCH1, CDKN1A and GCLC was indeed upregulated after IR treatment, suggesting key roles in the response to IR. Radiation can induce Notch1 activation in breast CSCs (Lagadec et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). A previous study reported changes in Notch signaling following radiation; however, a strong relationship was not detected between the upregulation of Notch1 expression and the suppression of osteoblast differentiation (Yang et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), which may be attributed to the lower radiation dose. CDKN1A, also known as p21, is a critical gene in cell cycle regulation. A previous study confirmed that radiation inhibits cell proliferation through cell cycle arrest by increasing p21 expression (Kim et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), which was consistent with our results. GCLC, an antioxidant enzyme, facilitates radioresistance via the modulation of cellular ROS levels (You et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), which is a common cell response to IR. We verified that the PI3K-AKT signaling pathway was enriched in cell proliferation-related genes. The above validated genes and pathways provide a deep understanding of the latent molecules involved in osteoblast damage after radiation.\u003c/p\u003e \u003cp\u003eIn the present study, we focused on the most significantly upregulated gene, MDM2. MDM2 is an intracellular molecule with diverse biological functions. It was first described to limit p53-mediated cell cycle arrest and apoptosis, hence generating a rationale for being a potential therapeutic target in cancer therapy (Nayak et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Bhatia et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Moreover, MDM2 is also required for organ development and tissue homeostasis (Gannon et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Molitoris et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Hagemann et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Fledderus et al., 2013). However, the role of MDM2 in radiation-induced bone or osteoblast damage has not been fully elucidated. The RNA sequence results revealed its critical function, which needs to be clarified. Therefore, we addressed the functions of MDM2 in osteoblast proliferation, differentiation and DNA damage and its regulatory role in the repair response after DNA damage caused by IR and confirmed that the knockdown of MDM2 alleviates IR-induced damage to MC3T3-E1 cells by promoting cell proliferation, reducing the cell cycle arrest rate and cell apoptosis rate, and reversing osteoblast differentiation. In addition, many studies have indicated that MDM2 is related to the radiation sensitivity of tumor cells and that the expression of MDM2 is induced in response to DNA damage (Alimova et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Cai et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Perry, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). On the basis of these findings, we also confirmed that the DNA protection role of the inhibition of MDM2 via IR reduced DNA damage in osteoblasts, which was coincident with the findings of studies showing that DNA damage mediates apoptosis in glioblastoma multiforme cells (Lou J et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn conclusion, we demonstrated that IR damaged MC3T3-E1 cells by inhibiting cell proliferation, impacting the cell cycle process, inducing cell apoptosis and affecting osteoblast differentiation, possibly due to DNA damage at the cellular level, and the differential expression of key genes, especially MDM2, may be an intrinsic factor from a molecular perspective.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eIonizing radiation\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eROS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eReactive oxygen species\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDDR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDNA damage response\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePropidium iodide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eALP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAlkaline phosphatase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eARS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAlizarin red staining\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSDS‒PAGE\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003esodium dodecyl sulfate‒polyacrylamide gel electrophoresis.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJiguo Lin and Gang Zhao conducted all trials and wrote the manuscript; Luping Wang, Chang Liu and Jie Feng completed experiment auxiliary work; Chaonan Sun, Mingyu Wang, Yunpeng Dai and Jialu Zhang completed statistical analysis; Yannan Shen and Yunyun Cheng conducted experiment design and results handing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe declare that we have no financial or personal relationships with other people or organizations that can inappropriately influence our work. There is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in the manuscript entitled.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Science and Technology Research and Planning Project of the Education Department of Jilin Province (JJKH20231240KJ), the 8th young science and technology talent lift project of Jilin Province (QT202426), the Bethune Project of Jilin University (2024B39) and the College Students \u0026ldquo;Innovation and Entrepreneurship Training (Innovation Training)\u0026rdquo; Program of Jilin University (202310183271,\u0026nbsp;202310183276).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are contained within the article. Data, analytic methods, and study materials can be made available to other researchers by requesting their usage for other studies by the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlimova I, Wang D, Danis E, Pierce A, Donson A, Serkova N, Madhavan K, Lakshmanachetty S, Balakrishnan I, Foreman NK, Mitra S, Venkataraman S, Vibhakar R. Targeting the TP53/MDM2 axis enhances radiation sensitivity in atypical teratoid rhabdoid tumors. Int J Oncol. 2022;60(3):32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaxter NN, Habermann EB, Tepper JE, et al. Risk of pelvic fractures in older women following pelvic irradiation. JAMA. 2005;294(20):2587\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhatia N, Khator R, Kulkarni S, Singh Y, Kumar P, Thareja S. Recent Advancements in the Discovery of MDM2/MDM2-p53 Interaction Inhibitors for the Treatment of Cancer. Curr Med Chem. 2023;30(32):3668\u0026ndash;701.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai LH, Chen XY, Qian W, Liu CC, Yuan LJ, Zhang L, Nie C, Liu Z, Li Y, Li T, Liu MH. DDB2 and MDM2 genes are promising markers for radiation diagnosis and estimation of radiation dose independent of trauma and burns. Funct Integr Genomics. 2023;23(4):294.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChan S, Rowbottom L, McDonald R, David E, Chung H, Yee A, Turner A, Chow E. Pelvic insufficiency fractures in women following radiation treatment: a case series. Ann Palliat Med. 2016;5(3):233\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDudziak ME, Saadeh PB, Mehrara BJ, Steinbrech DS, Greenwald JA, Gittes GK, Longaker MT. The effects of ionizing radiation on osteoblast-like cells in vitro. Plast Reconstr Surg. 2000;106:1049\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFledderus JO, Goldschmeding R. Nrf2 implicated as a novel therapeutic target for renal regeneration after acute kidney injury. Nephrol Dial Transpl. 2013;28(8):1969\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGal TJ, Munoz-Antonia T, Muro-Cacho CA, Klotch DW. Radiation effects on osteoblasts in vitro: a potential role in osteoradionecrosis. Arch Otolaryngol Head Neck Surg. 2000;126:1124\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGannon HS, Donehower LA, Lyle S, Jones SN. Mdm2-p53 signaling regulates epidermal stem cell senescence and premature aging phenotypes in mouse skin. Dev Biol. 2011;353(1):1\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHagemann JH, Thomasova D, Mulay SR, Anders HJ. Nrf2 signaling promotes ex vivo tubular epithelial cell survival and regeneration via murine double minute (MDM)-2. Nephrol Dial Transpl. 2013;28(8):2028\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHopewell JW. Radiation-therapy effects on bone density. Med Pediatr Oncol. 2003;41(3):208\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarali A, Dall'Ara E, Zekonyte J, Kao AP, Blunn G, Tozzi G. Effect of radiation-induced damage of trabecular bone tissue evaluated using indentation and digital volume correlation. J Mech Behav Biomed Mater. 2023;138:105636.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim HS, Cho HJ, Cho HJ, Park SJ, Park KW, Chae IH, Oh BH, Park YB, Lee MM. The essential role of p21 in radiation-induced cell cycle arrest of vascular smooth muscle cell. J Mol Cell Cardiol. 2004;37(4):871\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLagadec C, Vlashi E, Alhiyari Y, Phillips TM, Bochkur Dratver M, Pajonk F. Radiation-induced notch signaling in breast cancer stem cells. Int J Radiat Oncol Biol Phys. 2013;87:609\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee SH, Cho WJ, Najy AJ, Saliganan AD, Pham T, Rakowski J, Loughery B, Ji CH, Sakr W, Kim S, Kato I, Chung WK, Kim HE, Kwon YT, Kim HC. p62/SQSTM1-induced caspase-8 aggresomes are essential for ionizing radiation-mediated apoptosis. Cell Death Dis. 2021;12(11):997.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsumura S, Jikko A, Hiranuma H, Deguchi A, Fuchihata H. Effect of X-ray irradiation on proliferation and differentiation of osteoblast. Calcif Tissue Int. 1996;59:307\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolitoris BA, Dagher PC, Sandoval RM, Campos SB, Ashush H, Fridman E, Brafman A, Faerman A, Atkinson SJ, Thompson JD, Kalinski H, Skaliter R, Erlich S, Feinstein E. siRNA targeted to p53 attenuates ischemic and cisplatin-induced acute kidney injury. J Am Soc Nephrol. 2009;20(8):1754\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNayak SK, Khatik GL, Narang R, Monga V, Chopra HK. p53-Mdm2 Interaction Inhibitors as Novel Nongenotoxic Anticancer Agents. Curr Cancer Drug Targets. 2018;18(8):749\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerry ME. Mdm2 in the response to radiation. Mol Cancer Res. 2004;2(1):9\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantivasi WL, Xia F. Ionizing radiation-induced DNA damage, response, and repair. Antioxid Redox Signal. 2014;21(2):251\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoriano JL, Calpena AC, Souto EB, et al. Therapy for prevention and treatment of skin ionizing radiation damage: a review. Int J Radiat Biol. 2019;95(5):537\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShim MS, Xia Y. A reactive oxygen species (ROS)-responsive polymer for safe, efficient, and targeted gene delivery in cancer cells. Angew Chem Int Ed Eng. 2013;52(27):6926\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzymczyk KH, Shapiro IM, Adams C. Ionizing radiation sensitizes bone cells to apoptosis. Bone. 2004;34:148\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUezono H, Tsujino K, Moriki K, Nagano F, Ota Y, Sasaki R, Soejima T. Pelvic insufficiency fracture after definitive radiotherapy for uterine cervical cancer: retrospective analysis of risk factors. J Radiat Res. 2013;54:1102\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Liu S, Li J, Cheng Y, Wang Z, Feng T, Lu G, Wang S, Song J, Xia P, Hao L. Biological Functions of Let-7e-5p in Promoting the Differentiation of MC3T3-E1 Cells. Front Cell Dev Biol. 2021;9:671170.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W, Albadari N, Du Y, Fowler JF, Sang HT, Xian W, McKeon F, Li W, Zhou J, Zhang R. MDM2 Inhibitors for Cancer Therapy: The Past, Present, and Future. Pharmacol Rev. 2024;76(3):414\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang B, Tang Q, Post J, Zhou H, Huang XB, Zhang XD, Wang Q, Sun YM, Fan FY. Effect of radiation on the Notch signaling pathway in osteoblasts. Int J Mol Med. 2013;31(3):698\u0026ndash;706.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYou GR, Chang JT, Li YL, Huang CW, Tsai YL, Fan KH, Kang CJ, Huang SF, Chang PH, Cheng AJ. MYH9 Facilitates Cell Invasion and Radioresistance in Head and Neck Cancer via Modulation of Cellular ROS Levels by Activating the MAPK-Nrf2-GCLC Pathway. Cells. 2022;11(18):2855.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Qiu X, Xi K, et al. Therapeutic ionizing radiation induced bone loss: a review of in vivo and in vitro findings. Connect Tissue Res. 2018;59(6):509\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Jiang T, Ni S, Liu W, Luo P, Hao S, Wang P, Guo L. Effects of Estrogen on Proliferation and Apoptosis of Osteoblasts through Regulating GPER/AKT Pathway. Cell Mol Biol (Noisy-le-grand). 2022; 68(6): 124\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLou J, Hao Y, Lin K, Lyu Y, Chen M, Wang H, Zou D, Jiang X, Wang R, Jin D, Lam EW, Shao S, Liu Q, Yan J, Wang X, Chen P, Zhang B, Jin B. Circular RNA CDR1as disrupts the p53/MDM2 complex to inhibit Gliomagenesis. Mol Cancer. 2020;19(1):138.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Ionizing radiation, MDM2, osteoblast damage, DNA damage, cell cycle","lastPublishedDoi":"10.21203/rs.3.rs-6259924/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6259924/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBone injury is a common side effect of radiotherapy in tumors and is a long-term response after damage to osteoblasts, especially a reduction in osteoblast proliferation and differentiation. Currently, there are few studies on radiation-induced bone injury, and the molecules involved in ionizing radiation (IR)-induced osteoblast damage remain to be identified. In this study, the optimal IR damage conditions (8 Gy, 2.22 Gy/min) were first determined by measuring cell proliferation, the cell cycle, cell apoptosis and further cell differentiation and mineralization abilities in a radiation-induced osteoblast injury model. We subsequently screened 26 DEGs after RNA sequencing of the 8 Gy-irradiated MC3T3-E1 cells, which were involved mainly in DNA damage and repair, cell apoptotic progression and cell cycle regulation and involved several main pathways, including the PI3K-AKT signaling pathway, p53 signaling pathway and signaling pathway involved in the cell cycle and cell senescence. We focused on verifying the differentially expressed genes and confirmed that MDM2 was the most significantly upregulated gene after IR treatment, suggesting its key role in the response to IR. In addition, we addressed the functions of MDM2 in osteoblast proliferation, differentiation and DNA damage following MDM2 knockdown and IR treatment. In summary, knockdown of MDM2 alleviates IR-induced damage to MC3T3-E1 cells by promoting cell proliferation, reducing the cell cycle arrest rate and cell apoptosis rate, and reversing osteoblast differentiation, possibly through alleviation of DNA damage.\u003c/p\u003e","manuscriptTitle":"Identification of MDM2 as a novel marker gene that modulates radiation-induced osteoblast damage","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-03-24 08:12:17","doi":"10.21203/rs.3.rs-6259924/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"03ccc884-fb56-4b1b-a053-4977be5b518e","owner":[],"postedDate":"March 24th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-04-03T02:23:11+00:00","versionOfRecord":[],"versionCreatedAt":"2025-03-24 08:12:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6259924","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6259924","identity":"rs-6259924","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}