Anti‑Helicobacter pylori activity of Lactobacillus plantarum LZU-J-Q21, LZU-J-Q25 and LZU-J-QA85 in vitro evaluation

Anti‑Helicobacter pylori activity of Lactobacillus plantarum LZU-J-Q21, LZU-J-Q25 and LZU-J-QA85 in vitro evaluation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Anti‑Helicobacter pylori activity of Lactobacillus plantarum LZU-J-Q21, LZU-J-Q25 and LZU-J-QA85 in vitro evaluation Hui Yang, Yang Lin, Yuchan Ma, Jiaru Li, Junxiang Li, Zeqi Huo, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3905585/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose The aim was to investigate the inhibitory potential of probiotics sourced from Northwest China Plateau Region against Helicobacter pylori (H. pylori), targeting the reduction of H. pylori colonization and associated inflammation. Methods Phenotypic assays including aggregation, cell adhesion, and hydrophobic activity were performed to characterize strains. Anti- H. pylori activity of lactobacillus was determined by the Oxford Cup diffusion method, urease assay and co-culture assay. To test immune modulation activity of lactobacillus, and TNF-α, IL-6, IL-8 expression in AGS was determined by RT-qPCR. Results Here, we screened three well-characterized probiotic strains, Lactobacillus plantarum LZU-J-Q21 (Q21), LZU-J-Q25 (Q25) and LZU-J-QA85 (QA85). All three lactobacillus strains were tolerant to the simulated gastrointestinal conditions. Mixture of three lactobacillus strains showed the highest adhesion ability to AGS cells. All tested strains exhibited an inhibitory effect against H. pylori. The suspension and cell-free supernatant of three strains showed abilities to inhibit H. pylori urease activity. All the treatment of AGS cells with Q21, Q25, QA85, and mixture significantly decreased the TNF-α, IL-6, IL-8 expression induced by H. pylori infection. Conclusions Q21, Q25, QA85, and their mixture possesses potent inhibitory activity against H. pylori infection, growth, and H. pylori-induced inflammation. These results suggest that lactobacillus and its derivatives have the potential as complementary agents against H. pylori infection and alleviate inflammatory response. Probiotics Adhesion Helicobacter pylori Urease Inflammatory Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Helicobacter pylori (H. pylori) is a gram-negative microaerobic bacterium that establishes colonization within the gastric mucosa, potentially resulting in various gastric ailments including gastritis, gastric ulcers, and even gastric cancer [ 1 ]. Despite the widespread prevalence of H. pylori infection can lead to stomach diseases, but only a small proportion of infected patients will develop clinical symptoms, and most of the patients with no alarming symptoms will be neglected. After the successful treatment of H. pylori infection, it has been observed that the recurrence rate remains high. Consequently, enhancing the eradication rate and reducing the recurrence rate are urgently needed measures [ 2 ]. The current first-line treatment for H. pylori infection is mainly quadruple therapy, which combines a proton pump inhibitor with two antibiotics and bismuth. While this method exhibits high efficacy, good compliance, and overall safety, it is not without drawbacks, including potential side effects and a notable recurrence rate post-cure [ 3 ]. Therefore, there is an urgent need to explore novel modalities that either exhibit fewer side effects or can enhance the overall cure rate. Probiotics are living microorganisms that can play a beneficial role in the host's health by ingesting a certain amount [ 4 ], primarily including lactobacilli, bifidobacteria, certain streptococci and yeasts [ 5 ]. Probiotics have the ability to inhibit the growth of pathogenic bacteria, regulate the microecological balance within the body, and treat diseases caused by pathogenic bacteria, such as acute diarrhea infections and colitis [ 6 ]. Additionally, probiotics contribute to enhanced digestion and absorption, as well as the regulation of the immune system, all without adverse effects [ 7 ]. Currently, a variety of probiotic preparations have been clinically applied in the treatment of diseases caused by gastrointestinal pathogenic bacterial infections [ 8 , 9 ]. Several studies have demonstrated the effectiveness of various probiotics in the treatment of diseases resulting from H. pylori infections, such as L. acidophilus [ 10 , 11 ], L. rhamnosus GG [ 12 , 13 ], L. casei [ 14 – 16 ], L. gasseri OLL2716 [ 17 ], L. reuteri [ 18 – 20 ], L. salivarius [ 21 ], L. plantarum [ 22 , 23 ], E. faecium [ 24 , 25 ], Bacillus subtilis [ 26 , 27 ], Bifidobacterium [ 28 , 29 ], and others. Certain lactobacillus can tolerate the low pH of the stomach, enabling them to adhere and transiently colonize the human stomach. Therefore, based on both in vitro and animal studies, it has been hypothesized that probiotics may be able to compete with H. pylori for adhesion and reduce H. pylori infection in humans [ 30 ]. Numerous subsequent studies have shown that probiotics do have a role in reducing H. pylori infections within the human body, and they can assist in the treatment of illnesses caused by H. pylori infections, playing a crucial role in significantly reducing associated adverse reactions. JiangShui is a Chinese specialty from Northwest China, which is made by adding fresh plant stems, roots, and leaves, such as celery, white radish, and lotus leaf, to a boiled base liquid and placing it at a suitable temperature for fermentation. The fermented slurry can be consumed directly or used to make other delicacies. We screened probiotics from the JiangShui that originate in highland areas such as Qinghai for research purposes. In order to verify whether these characteristic strains have inhibitory effects on H. pylori, whether they are expected to be potential strains against H. pylori. In this study, our aim was to investigate the inhibitory potential of probiotics sourced from Northwest China Plateau Region against H. pylori, targeting the reduction of H. pylori colonization and associated inflammation. We screened probiotics with antagonistic effects on H. pylori and tried to elucidate the mechanisms by which these probiotics exert their effects on H. pylori. It is then hoped that our research on the screened probiotics will lay the groundwork for future applications in products. 2. Materials and methods 2.1 Bacterial strains and culture conditions Lactobacillus plantarum LZU-J-Q21 (Q21), LZU-J-Q25 (Q25), LZU-J-QA85 (QA85), and Lactobacillus rhamnosus GG (LGG) were stored at − 80°C in Lanzhou University, China and Sharpe (MRS) broth containing 20% glycerol (v/v) until tested. LGG is widely used probiotic strain and is thus used as control strain in this study. LGG was stored in lab at Lanzhou University (China). Q21, Q25, and QA85 were the laboratory stock strains isolated from JiangShui in Qinghai, China. Q21, Q25, and QA85 are stored in the Guangdong Microbial Culture Collection Center (GDMCC), with storage numbers are GDMCC NO: 63277, GDMCC NO: 63278, GDMCC NO: 61192, respectively. The bacteria were cultured in MRS broth at 37°C for 24 h to activate lactobacillus, repeated twice and then subjected to each experimental study. H. pylori J99 was stored in the Lanzhou University Microbiological Culture Collection and stored at − 80°C in H. Pylori Medium (fluids) containing 20% glycerol (v/v) until tested. H. pylori was grown on Columbia blood agar plates containing 5% (v/v) off fiber sheep blood (Qingdao Hope Bio-Technology Co., Ltd.) at 37°C in microaerophilic conditions (5% O 2 , 10% CO 2 , and 85% N 2 ). 2.2 Cell culture AGS cells (human gastric adenocarcinoma epithelial cells, ATCC CRL 1739) were purchases from Procell Life Science&Technology Co., Ltd. (China). AGS cells were maintained in RPMI 1640 medium supplemented with 15% fetal bovine serum (FBS) (Gemini Fetal Bovine Serum, Gemini Biotechnology company, California), penicillin (100 IU/mL), and streptomycin (100 µm/mL) at 37°C with 5% CO 2 . 2.3 Acid tolerance of lactobacillus After activation of lactobacillus, the supernatant was discarded by centrifugation. The bacterial precipitate was washed three times with phosphate-buffered saline (PBS) and resuspended to a viable bacterial count of 10 8 CFU/mL. Lactobacillus suspension with a viable count of 10 8 CFU/mL was inoculated into simulated gastric fluid (filtered through a 0.22 µm membrane) at pH 3.0, and sampled at 0 and 3 h of the test, respectively. Counts of viable bacteria were performed using the MRS agar plates method and the survival rate of several lactobacillus strains in simulated gastric fluid after 3 h was calculated separately [ 31 ]. 2.4 Hydrophobic properties of lactobacillus The hydrophobicity of the bacterial surface was determined according to the method of Kos et al [ 32 ]. After activated lactobacillus, the bacteria were washed and resuspended with PBS to give a viable bacterial count of 10 8 CFU/mL. 3 mL of lactobacillus suspension and 1 mL of xylene were thoroughly mixed, shaken thoroughly for 5 min, allowed to stand at room temperature, and the absorbance values of the aqueous phase were measured after 0 h and 1 h to calculate the hydrophobicity of lactobacillus. 2.5 Autoaggregation properties of lactobacillus After activation, the lactobacillus was washed with PBS and resuspended so that the number of viable bacteria was 10 8 CFU/mL. The mixture was incubated at 37 ℃, and the absorbance value at 600 nm of the upper layer of the liquid was measured within 24 h to calculate the autoaggregation rate of lactobacillus [ 32 , 33 ]. 2.6 Coaggregation properties of lactobacillus with H. pylori After the activation of lactobacillus, washed with PBS and resuspend, so that the number of viable bacterial was 10 8 CFU/mL, added an equal volume of H. pylori suspension, mix uniformly, then set the mixture at 37 ℃ for static incubation. Test the absorbance value at 600 nm in the upper layer of the liquid within 24 h. Calculate the coaggregation rate of the interaction between the lactobacillus and H. pylori [ 32 , 33 ]. 2.7 Anti‑H. pylori activity of lactobacillus Anti-H. pylori activity of lactobacillus was determined by the Oxford cup diffusion method. 200 µL of H. pylori suspension was evenly spread on Columbia blood agar plates without antibiotics. After spreading, 4 sterilized Oxford cups were placed on the plates, and add 200 µL of lactobacillus suspension, lactobacillus supernatant, amoxicillin solution at a concentration of 0.06 µg/mL (MIC), and a blank MRS broth to Oxford cups, respectively. The plates were incubated at 37 ℃ under microaerobic environment for 72 h. At the end of incubation, the diameter of the inhibition circle was measured by vernier caliper [ 14 , 34 ]. 2.8 Urease activity assay To analyze the inhibitory effects of lactobacillus against H. pylori urease, 40 µL of H. pylori suspension was mixed with 10 µL of lactobacillus supernatant, and 10 µL of sterile H. pylori liquid medium was used as control. The mixture was added into a clean and sterile 96-well plate and incubated at 37 ℃ in a microaerobic environment for 48 h. The incubated mixture was taken out, and 150 µL of urease reagent (20% urea, 0.012% phenol red, dissolved in PBS and adjusted to pH 6.5 with HCl) was added into each well, the color change was observed and the OD550nm value was measured [ 14 ]. 2.9 Co-culture of lactobacillus with H. pylori Activated H. pylori were resuspended in fresh H. pylori liquid medium, added 10% lactobacillus suspension (10 8 CFU/mL) or supernatant. Co-culture for a certain period of time and H. pylori viable cells were counted using their selective medium. At the same time, urease activity was measured. 2.10 Antibiotic susceptibility assay The susceptibility of lactobacillus to antibiotics was determined by the disc diffusion method [ 35 ]. The concentration of lactobacillus was adjusted to 10 8 CFU/ml, and the bacterial suspension was evenly spread on MRS agar plates, and left to dry for 5 minutes. Use tweezers to stick the antibiotic discs (Microbial Reagent Co., Ltd., Hangzhou, China) onto the surface of the inoculated plates, and incubate in an inverted at 37 ℃ for 24 h, with the quality control bacteria as a control. The diameter of the inhibition circle was measured and recorded by vernier caliper. Three replicates were set up for each antibiotic and the results were averaged. The standard strains of Staphylococcus aureus ATCC 25923 (S. aureus) and Escherichia coli ATCC 25922 (E. coli) were used as the control bacteria, operation as above. The inhibition zone after incubation was measured and interpreted as susceptible, intermediate, or resistant according to the instructions for the antibiotic discs (Microbial Reagent Co., Ltd., Hangzhou, China). 2.11 Cytotoxicity assay on AGS cells The cytotoxicity effect of lactobacillus on AGS cells was determined by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. First, cells (10 4 ) were grown and allowed to adhere to a 96-well plate at 37°C for 12–24 h to approximately 80% confluence and then cells were treated at 37°C in a 5% CO 2 atmosphere with lactobacillus (MOI = 100) for 6 h. Then 20 µL of MTT solution (5 mg/mL) was added to each well, and the cells were incubated for 4 h at 37°C. Finally, 150 µL of DMSO was added to each well and allow the color to develop. The OD was measured at 490 nm. Cell viability (%) = (Asample/Acontrol) × 100, where Asample is the absorbance of the cells that were incubated with the medium containing lactobacillus, and Acontrol is the absorbance of the cells alone. 2.12 Adhesion assay of lactobacillus to AGS cells AGS cells (10 6 cells) were inoculated into 6-well plates in RPMI-1640 media, with 15% FBS and 1% penicillin-streptomycin, and grown to a monolayer at 37°C for 12–24 h. Fresh culture medium without antibiotics was used instead before infection. To determine the adhesion capacity of lactobacillus, lactobacillus was washed three times with PBS before infection, and resuspended in antibiotic-free RPMI-1640 culture medium. The concentration of lactobacillus was adjusted to 10 6 , 10 7 , 10 8 , 10 9 , and 10 10 CFU/mL to de-infect the cells, respectively, and incubated for a total of 4 h at 37°C. At the end of the incubation, the 6-well plate was washed with PBS to wash away unadhered bacteria. Trypsin digestion was added and the mixture was collected in a centrifuge tube, diluted stepwise and spread on MRS agar plates. The number of colonies was counted to determine the number of adherent bacteria. The percentage of bacterial adherence to cells was calculated by the following formula: adherence capacity (%) = (adherent bacteria) / (total bacteria) × 100. Cell adhesion assay was conducted in biological triplicate to ensure reproducibility. In order to determine the effect of co-culture duration on adhesion, lactobacillus was adjusted to 10 8 CFU/mL, and co-cultured with AGS cells for 1, 2, 4, and 6 h, respectively. Other operations were the same as above. 2.13 Inhibition of H. pylori adhesion to AGS cells by lactobacillus AGS cells (10 6 cells) were inoculated into 6-well plates in RPMI-1640 media, with 15% FBS and 1% penicillin-streptomycin, and grown to a monolayer at 37°C for 12–24 h. Fresh culture medium without antibiotics was used instead before infection. In order to determine the inhibitory effect of lactobacillus on the adhesion of H. pylori to AGS cells, it was validated in four sets of experiments. Cells were infected with H. pylori (MOI = 100) and incubated at 37°C for 4 h, as an infected control. After co-culturing the cells with H. pylori (MOI = 100) for 2 h, the unadhered bacteria were washed away with PBS, and then lactobacillus (MOI = 100) was added and co-cultured with the cells for 2 h as the displacement experimental group. The cells were co-cultured with lactobacillus (MOI = 100) for 2 h, then washed with PBS to remove unadhered bacteria, and then H. pylori (MOI = 100) was added to co-cultivate with the cells for 2 h as the exclusion experimental group. The cells were co-cultured with lactobacillus (MOI = 100), and H. pylori (MOI = 100) for 4 h as the competition experimental group. At the end of the incubation, 6-well plates were washed with PBS. Trypsin digestion was added and terminated with antibiotic-free medium, then the mixture was collected for gradual dilution and coated with pylorus-selective medium for counting. The relative percentage of H. pylori adhesion to cells was calculated according to the following formula: relative adhesion (%) = (number of adherent bacteria in the experimental group) / (number of adherent bacteria in the control group) × 100. The cell adhesion assay was performed using the biological triplex method to ensure reproducibility. 2.14 Total RNA extraction and reverse‑transcription quantitative PCR (RT‑qPCR) To study the anti-inflammatory effect of lactobacillus, it was verified in four groups of experiments. AGS cells were cultured normally for 4 h as blank control group. AGS cells were treated with H. pylori (MOI = 100) for 4 h as H. pylori-infected group. After co-culturing the cells with lactobacillus (MOI = 100) for 2 h, the unadhered bacteria were washed away with PBS, and then H. pylori (MOI = 100) was added and co-cultured with the cells for 2 h. This was used as the exclusion experimental group. The cells were co-cultured with lactobacillus (MOI = 100) and H. pylori (MOI = 100) for 4h as the competition experimental group. Total mRNA was extracted with SevenFast® Total RNA Extraction Kit for Cells (Seven Innovation (Beijing) Biotech Co., China). cDNA synthesis was performed with SevenClever ™ First Strand cDNA Synthesis Kit (with dsDNase) (Seven Innovation (Beijing) Biotech Co., China). RT-qPCR was performed in qPCR 96-well plates on an Mx3000/Mx3005P system (Agilent, USA) and 2× SYBR Green qPCR MasterMix II (Universal) (Seven Innovation (Beijing) Biotech Co., China) to de-analyze the TNF-α, IL-6, IL-8 and IL-10 mRNA. The oligonudleotide sequence of primers used for RT-qPCR [ 36 – 38 ] are listed in Table 1 . Table 1 Specific primers used for RT-qPCR Target gene Primer sequence (5′ to 3′) Tm Size of amplicon (bp) TNF-α F:TTTGATCCCTGACATCTGGA 55.83 112 R:GGCCTAAGGTCCACTTGTGT 59.60 IL-6 F:GACAGCCACTCACCTCTTCA 59.32 457 R:CGCAGAATGAGATGAGTTGT 55.87 IL-8 F:ACTGAGAGTGATTGAGAGTGGAC 59.49 112 R:AACCCTCTGCACCCAGTTTTC 60.75 IL-10 F:AGGGAGGATGAGTGATTTGC 57.27 783 R:AACTGGGAGGAACACTGACC 59.23 β-actin F:GACCTCTATGCCAACACAGT 57.23 139 R:AGTACTTGCGCTCAGGAGGA 60.61 RT-qPCR: quantitative real-time PCR; IL: interleukin; F: forward; R: reverse. 2.15 Statistical analysis The data were expressed as a mean of three replicates ± SD. ANOVA one-way test was used to calculate the statistical significance of the experimental results between two groups. In the aggregation assay, urease activity assay and anti-H. pylori activity of lactobacillus assay, ANOVA two-way test was used to assess multiple comparisons in those groups. A p-value less than 0.05 was considered as a significant difference. GraphPad Prism version 9 software and Origin 2023 software were used for the analyses. 3. Results 3.1 Properties assay of lactobacillus The pH range of the human stomach is between 1–4, so screening for lactobacillus with the ability to inhibit the growth of H. pylori should have the ability to tolerate artificial gastric juice. In this experiment, seven strains of lactobacillus with good probiotic properties were used to study, and LGG was selected as control bacteria. The results showed that eight strains could survive for 3 h under artificial gastric juice at pH 3.0, with four strains surviving more than 20%, and ZCJ showed the strongest acid tolerance (Fig. 1 A). The greater hydrophobic force of the strain indicates that its cell surface is more hydrophobic. The hydrophobicity of these eight strains of lactobacillus with acid resistance was analyzed (Fig. 1 B). The results showed that the hydrophobicity of the lactobacillus ranged from 12–31%, among which QA85, QX(A)-4, TSL-6, and Q21 were more hydrophobic, and QA85 was the most hydrophobic. The aggregation of bacterial strains is divided into two forms: autoaggregation and coaggregation. Autoaggregation is the phenomenon of aggregation between the same bacteria, and coaggregation is the phenomenon of aggregation between different bacteria. In this study, we determined the autoaggregation ability of lactobacillus at 37°C for up to 24h. From the results, most of the lactobacillus showed strong autoaggregation ability, and the autoaggregation increased with the increase of incubation time. The incubation time of 24 h, Q25 showed the strongest autoaggregation at 69%, while autoaggregation rates of QA85, Q21, and LGG were also high (above 60%) (Fig. 1 C). It has been shown that there is a positive correlation between the autoaggregation ability of a strain and its adhesion in the gut, and that strains with higher autoaggregation ability also have high adhesion. Coaggregation results showed that lactobacillus and H. pylori coaggregation also increased with time. The maximum rate of coaggregation of QA85 was 60% at an incubation time of 24 h (Fig. 1 D). The aggregation of pathogenic bacteria by lactobacillus can make it easier for pathogenic bacteria to be eliminated from the intestine. 3.2 Screening of lactobacillus with inhibitory effect on H. pylori Screening of lactobacillus with anti-H. pylori effect by Oxford cup assay. It can be seen that the amoxicillin positive control inhibited the growth of H. pylori and the circle of inhibition was around 10–12 mm (Fig. 2 A). The size of the circle of inhibition of the eight strains of lactobacillus suspensions was in the range of 12–16 mm, and that of the lactobacillus supernatants was in the range of 12–15 mm. The suspensions and supernatants of the same strain had comparable inhibitory abilities, with the suspensions being superior, and the strongest ability to inhibit H. pylori was Q25. The expression level and activity of urease are critical for the survival of H. pylori in an acidic environment. It was demonstrated that the supernatants of all eight lactobacillus significantly inhibited the urease activity of H. pylori, with Q25 having the strongest inhibitory ability (Fig. 2 B). In this experiment, principal component analysis (PCA) was used to evaluate the correlation between the nature of lactobacillus and the inhibition of the growth of H. pylori and to analyze the probiotics that antagonized H. pylori. It was found through factor scoring plot (Fig. 2 C) that the first component accounted for 39.7% and the second component accounted for 32.2%, with the bacteriostatic ability playing a major contributing role. By correlation analysis (Fig. 2 D), it was found that there was a close association between the nature of lactobacillus and its inhibition of H. pylori growth. Therefore, based on the PCA analysis and the properties of H. pylori growth inhibition, Q21, Q25, and QA85 were comprehensively screened as potential antagonists of H. pylori infection and were used as the strains for the subsequent studies. The three strains were compounded to verify the antibacterial effect of the mixture, and it was found that the mixture also possessed better antibacterial ability (Fig. 2 E). 3.3 Co-culture validation experiments of lactobacillus and H. pylori Q21, Q25, and QA85 were screened as potential antagonists of H. pylori infection. To further confirm the ability of lactobacillus to antagonize H. pylori, LGG was used as a control to analyze the effect of viable lactobacillus and fermentation supernatant on the growth of H. pylori under co-culture conditions with H. pylori. From the effect of lactobacillus vivax on the growth and urease activity of H. pylori (Fig. 3 A & 3 C), it can be seen that the number of viable bacteria of H. pylori decreased with the extension of time. At 24 h, all three strains and mixtures inhibited H. pylori growth and urease activity; with QA85 being the most potent in inhibiting H. pylori growth and urease activity. At 48 h and 72 h, the strains also all inhibited H. pylori growth and urease activity, with the trend leveling off compared to 24 h. From the effect of fermentation supernatant of lactobacillus on the growth and urease activity of H. pylori (Fig. 3 B & 3 D), it was observed that the viable count of H. pylori under co-culture conditions decreased with increasing time. At 24 h, the supernatants of all three strains and mixtures inhibited H. pylori growth and urease activity; Q25 and QA85 were the most potent in inhibiting H. pylori growth and urease activity. The supernatant of the strain also strongly inhibited H. pylori growth and urease activity at both 48 h and 72 h. Live bacteria and fermentation supernatant of lactobacillus inhibited the growth and urease activity of H. pylori when co-cultured with H. pylori, a result that further suggests that live bacteria also play an important role in the antimicrobial action and that the metabolites of the live bacteria can be bacteriostatic, and that their strong inhibitory effect was demonstrated in the case of contact with the pathogenic bacterium H. pylori. 3.4 Adhesion of lactobacillus to AGS cells and inhibition of H. pylori adhesion To confirm the ability of several strains to adhere to gastric epithelial cells, their adhesion rates to AGS cells were explored. First, the adhesion rate of lactobacillus on AGS cells at different concentrations was explored (Fig. 4 A), and it was found that the adhesion rate of lactobacillus at a concentration of 10 8 CFU/mL was significantly different compared with that at a concentration of 10 6 CFU/mL. Secondly, the adhesion rate of lactobacillus on AGS cells was explored at different time durations of incubation (Fig. 4 B), and it was found that there was a significant difference in the adhesion rate at 4 h or 6 h of incubation compared to that at 1 h of incubation. As the screened strains exhibited a strong capacity to adhere to AGS cells, a cell model was established to delve deeper into their potential to impede the subsequent colonization of H. pylori. This involved investigating their ability to compete with H. pylori for adhesion through three distinct models: displacement, exclusion, and competition treatment. The results show that all three strains of bacterial fluids and their mixture inhibited H. pylori adhesion to AGS cells (Fig. 4 C). Specifically, the relative adhesion rates of Q21, Q25, QA85, and their mixture were 55.04%, 50.39%, 54.26%, and 59.69%, respectively, compared with H. pylori adhesion to AGS cells alone during displacement adhesion (P < 0.0001 and P < 0.001); their relative adhesion rates were 38.76%, 31.16%, 32.79%, and 30.85%, respectively, during exclusion adhesion (P < 0.0001), and the mixture inhibited adhesion at the highest rate; their relative adhesion rates were 45.12%, 42.56%, 43.49%, and 40.85% (P < 0.0001), respectively, during the competition adhesion process, and the mixture still had the highest inhibition of adhesion. Taken together, the relative adhesion rate of H. pylori in the exclusion group was lower than that of the other two modes in all three modes, indicating that the bacterial fluids had a higher ability to inhibit the adhesion of H. pylori under the exclusion conditions, and the highest inhibition rate was found in the mixture of three strains. Therefore, the results here are also in line with the previous experimental results that the mixture had a stronger adhesion ability to AGS cells at 4 h of incubation. In the competition mode, the individual bacterial fluids also showed excellent inhibition of adhesion to H. pylori (all above 54%), which is important for hindering the subsequent colonization of H. pylori. 3.5 Effect of lactobacillus on H. pylori-induced inflammatory factors in AGS cells H. pylori infection induces the production of inflammatory factors and contributes to inflammation in gastric epithelial cells. Therefore, we investigated whether lactobacillus could inhibit the expression of H. pylori-induced inflammatory genes. The relative expression levels of relevant cytokines, including pro-inflammatory factors TNF-α, IL-6, IL-8, and anti-inflammatory factor IL-10, in H. pylori-treated AGS cells under different conditions were examined by RT-qPCR. It was found that the relative expression levels of TNF-α, IL-6, and IL-8 were significantly increased in H. pylori-treated AGS cells compared to the control group, and after treatment with Q21, Q25, QA85, and mixture, their relative expression levels were significantly decreased compared to the H. pylori-treated group (P < 0.0001) (Fig. 5 A & 5 B & 5 C). Compared with the control group, the relative expression level of IL-10 in AGS cells stimulated by H. pylori was significantly increased (Fig. 5 D); compared with the H. pylori-treated group, after treatment with lactobacillus, there was a significant change in the relative expression level of IL-10 in the exclusion group, and none of the relative expression levels of IL-10 in the competition group were significantly changed (P > 0.05). 3.6 Antibiotic susceptibility and cellular cytotoxicity assay of lactobacillus Antibiotic susceptibility was an important index for the safety of lactobacillus before application. Therefore, we tested the susceptibility of these lactobacillus to 22 antibiotics (Fig. 6 A). As shown in Table 2 , Q21, Q25, QA85, and LGG showed varying degrees of drug sensitivity to 22 antibiotics, with sensitivity to penicillins (e.g., ampicillin), tetracyclines (e.g., doxycycline), cephalosporins (e.g., imipenem), and chloramphenicol; and showed intermediate sensitivity to aminoglycosides and macrolides (e.g., gentamicin and erythromycin). In contrast, these strains were resistant to quinolones (e.g., ciprofloxacin and levofloxacin). To test the safety of lactobacillus in future applications, we performed the cell viability assay to determine the cytotoxicity of three lactobacillus strains and their mixture to AGS cells (Fig. 6 B). The results showed that the co-culture of Q21, Q25, QA85, and their mixture with cells for 6 h had no significant cytotoxic effects on cells. Table 2 Results of the sensitivity of lactobacillus to 22 antibiotics Class Antibiotic Content Sensitivity LGG Q21 Q25 QA85 Penicillins Penicillin 10 U R R R S Oxacillin 1 µg R R R S Ampicillin 10 µg S S S S Aminoglycoside Gentamicin 10 µg I R R R Streptomycin 10 µg R R R R Kanamycin 30 µg R R R R Tetracyclines Tetracycline 30 µg S I S I Doxycycline 30 µg S S S S Cephalosporins Imipenem 10 µg S S S S Ceftazidime 30 µg S R R R Cefotaxime 30 µg I R R R Cefuroxime 30 µg S S I S Macrolide Erythromycin 15 µg I I I I Quinolones Ciprofloxacin 5 µg R R R R Norfloxacin 10 µg R R R R Levofloxacin 5 µg R R R R Folate metabolism pathway inhibitors Sulfafurazole 300 µg R R R R Trimethoprim-sulfamethoxazole 23.75/1.25 µg S S S S Glycopeptide Vancomycin 30 µg R R R R Chloramphenicol Chloramphenicol 30 µg S S S S Rifamycins Rifampicin 5 µg S R I I R: resistant; I: intermediate; S: susceptible. 4. Discussion The inhibitory effect of probiotics on H. pylori renders it promising as a potentially safe approach to fight H. pylori and reduce adverse effects. In this study, three strains of lactobacillus plantarum, Q21, Q25, and QA85, were screened by utilizing the probiotic properties of lactobacillus as well as the inhibitory properties of H. pylori growth. They both thrive in low-acid conditions (pH 3.0), resembling the acidic environment of gastric juices, and demonstrate notable hydrophobicity, as well as tendencies for autoaggregation and coaggregation. Additionally, these strains showcase a robust capability to inhibit the growth of H. pylori and diminish urease activity. Strains that are highly hydrophobic may have protein-like substances on their cell surfaces, which may have a better self-protective effect on the cells, while hydrophilic strains may have polysaccharides on their cell surfaces [ 39 ]. Hydrophobicity role of cells is a non-specific interaction of bacteria with gastric epithelial cells, and bacterial cells with strong hydrophobicity usually form a strong interaction with gastric epithelial cells [ 40 ]. Strains can also exert their probiotic efficacy by aggregating to a certain amount such as forming biofilms through autoaggregation and allowing for stronger adhesion of the strains in the gut [ 33 ]. Autoaggregation of probiotic strains may be one of the mechanisms to maintain the viability of the strains and increase the resistance of the human upper gastrointestinal tract to pathogenic bacteria. Autoaggregation allows probiotics to form spatial site barriers to impede the colonization of the gastrointestinal tract by pathogenic bacteria such as H. pylori [ 41 ]. Certainly, the aggregation of pathogenic bacteria by lactobacillus can make it easier to expel pathogenic bacteria from the intestine [ 42 ]. The ability of lactobacillus to inhibit the growth of H. pylori may be mainly due to the role of substances such as organic acids, bacteriocins and protein-like substances produced by lactobacillus. For example, lactic acid, which is the main metabolite of lactobacillus, causes a decrease in the pH of the fermentation broth, which can significantly inhibit the activity of the enzyme auxin urease [ 43 ], thus achieving the inhibition of H. pylori. By studying the probiotic properties of lactobacillus, it was found that lactobacillus may hinder the colonization of H. pylori through bacteriostatic effects and autoaggregation or coaggregation, thus preventing H. pylori infection and further deterioration of H. pylori. Previous studies have found that decreased mucin secretion is commonly observed in H. pylori-induced diseases, resulting in disruption of the mucosal barrier, and that probiotics can repair the mucosal permeability of the gastric mucosa, form a mucosal barrier, and inhibit the adhesion of pathogenic bacteria such as H. pylori [ 44 ]. Therefore, the adhesion of screened lactobacillus with AGS cells and the inhibition of H. pylori adhesion to AGS cells by lactobacillus were examined, which further validated that lactobacillus could impede H. pylori colonization adhesion to the gastric mucosa. The manifestation of H. pylori-induced gastritis has been associated with the release of a wide variety of inflammatory mediators, such as chemokines and cytokines.IL-8 was the first of these cytokines to be found that associated with H. pylori-induced gastritis, and it is capable of leading to the migration of neutrophilic leukocytes and monocytes from the mucosa [ 45 ]. It also stimulates the production of TNF-α and IL-6 by monocytes and dendritic cells in the mucosal layer [ 46 ]. These responses do not clear the infection and can lead to persistent inflammation. Studies have also demonstrated that probiotics inhibit the production of pro-inflammatory factors, such as IL-8, leading to a reduction in neutrophil infiltration in the gastric mucosa. Moreover, they promote the generation of anti-inflammatory factors like IL-10, eliciting an immune response in Th2 cells [ 47 ]. Therefore, probiotics can modulate the immune response of the host by adhering to epithelial cells, and in particular, they can reduce the inflammatory response of the stomach by modulating the balance of inflammatory factors [ 48 ]. By RT-qPCR experiments, it was found that Q21, Q25, QA85, and their mixture all inhibited the relative expression of the pro-inflammatory factors IL-8, IL-6, and TNF-α, whereas the expression of the inflammation-suppressing factor IL-10 was not particularly significantly elevated in comparison with the infected group, and our findings are in general agreement with those of previous studies. Probiotics are capable of generating a wide variety of immune responses due to strain specificity, and the immune status of the host affects the immune response [ 49 ], so the immunomodulatory effects of probiotics are difficult to generalize. We just studied the immunomodulatory effects of three strains of lactobacillus plantarum isolated from JiangShui with typical regional characteristics. Probiotics limit H. pylori colonization and inhibit its growth and minimize treatment-related adverse effects such as antibiotic-associated diarrhea [ 50 ]. The utilization of probiotic preparations as adjuvant therapy against H. pylori holds positive implications for both controlling the resistance rate and enhancing the eradication rate of H. pylori. Probiotics are becoming more and more widely used, and their safety deserves more attention. For this reason, we verified the antibiotic susceptibility of the three strains of bacteria, and found the strains to have some antibiotic susceptibility, with a considerable degree of safety, providing a guarantee for the subsequent study. In this study, the overall effect of lactobacillus plantarum has been studied, without exploring which or which components work or the synergistic effect of the components, which can be further studied in the future. In the future, corresponding in vivo experiments can also be carried out to verify the specific effects of lactobacillus plantarum. In order to lay the foundation for the subsequent application alone or in combination with drugs to have a better healing effect on the human body. 5. Conclusions Our results showed that lactobacillus plantarum Q21, Q25, and QA85 possessed excellent probiotic properties as well as antagonistic effects against H. pylori, and anti-inflammatory effects on AGS cells were verified at the mRNA level. Lactobacillus plantarum Q21, Q25, and QA85 could survive in simulated gastric juice, were acid tolerant and had strong cell adhesion. These lactobacillus plantarum can inhibit H. pylori infection and growth by decreasing urease activity, hindering H. pylori colonization and anti-inflammatory properties. Thus, lactobacillus plantarum may be a suitable candidate probiotic for promoting host health, and lactobacillus plantarum Q21, Q25, and QA85 and their derivatives have the potential to be used as prophylactic or adjunctive therapeutic agents for H. pylori infection. Declarations Author contribution All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Hui Yang and Yang Lin. The first draft of the manuscript was written by Hui Yang and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Data availability The authors confirm that the data supporting the findings of this study are available within the article. Ethical approval Not applicable. Consent to participate Not applicable. Consent to publication Not applicable. Conflict of interest The authors declare no competing interests. Acknowledgements We also would like to express our gratitude to the Core Facility of the School of Life Sciences, Lanzhou University for their support. Funding This work was supported by the Science and Technology Major Project of Gansu Province (Grant no. 22ZD1FA001), the Science and Technology Major Project of Gansu Province-Enterprise Innovation Consortium Project (Grant no. 23ZDFA013-3), the Guangzhou Science and Technology Planning Project (Grant no. 202206010165), and the Key Talent Project of Gansu Province (Grant no. 2022RCXM027). References FitzGerald R, Smith SM (2021) An Overview of Helicobacter pylori Infection. Methods in molecular biology . (Clifton N J) 2283:1–14. https://doi.org/10.1007/978-1-0716-1302-3_1 Sun Y, Zhang J (2019) Helicobacter pylori recrudescence and its influencing factors. J Cell Mol Med 23(12):7919–7925. https://doi.org/10.1111/jcmm.14682 Xie Y, Hu Y, Zhu Y, Wang H, Wang QZ, Li YQ, Wang JB, Zhang ZY, Zhang DK, Liu XW, Lu NH (2023) Colloidal bismuth pectin-containing quadruple therapy as the first-line treatment of Helicobacter pylori infection: A multicenter, randomized, double-blind, non-inferiority clinical trial. Helicobacter 28(3):e12978. https://doi.org/10.1111/hel.12978 Phumkhachorn P, Rattanachaikunsopon P (2023) Probiotics: Sources, Selection and Health Benefits. Res J Biotechnol 18(5):102–113 Wilkins T, Sequoia J (2017) Probiotics for Gastrointestinal Conditions: A Summary of the Evidence. Am Family Phys 96(3):170–178 Sang LX, Chang B, Zhang WL, Wu XM, Li XH, Jiang M (2010) Remission induction and maintenance effect of probiotics on ulcerative colitis: a meta-analysis. World J Gastroenterol 16(15):1908–1915. https://doi.org/10.3748/wjg.v16.i15.1908 Wang X, Zhang P, Zhang X (2021) Probiotics Regulate Gut Microbiota: An Effective Method to Improve Immunity. Molecules 26(19):6076. https://doi.org/10.3390/molecules26196076 He C, Xie Y, Zhu Y, Zhuang K, Huo L, Yu Y, Guo Q, Shu X, Xiong Z, Zhang Z, Lyu B, Lu N (2022) Probiotics modulate gastrointestinal microbiota after Helicobacter pylori eradication: A multicenter randomized double-blind placebo-controlled trial. Front Immunol 13:1033063. https://doi.org/10.3389/fimmu.2022.1033063 Pernica JM, Steenhoff AP, Mokomane M, Moorad B, Lechiile K, Smieja M, Mazhani L, Cheng J, Kelly MS, Loeb M, Stordal K, Goldfarb DM (2017) Rapid enteric testing to permit targeted antimicrobial therapy, with and without Lactobacillus reuteri probiotics, for paediatric acute diarrhoeal disease in Botswana: A pilot, randomized, factorial, controlled trial. PLoS ONE 12(10):e0185177. https://doi.org/10.1371/journal.pone.0185177 Lee CY, Shih HC, Yu MC, Lee MY, Chang YL, Lai YY, Lee YC, Kuan YH, Lin CC (2017) Evaluation of the potential inhibitory activity of a combination of L. acidophilus, L. rhamnosus and L. sporogenes on Helicobacter pylori: A randomized double-blind placebo-controlled clinical trial. Chin J Integr Med 23(3):176–182. https://doi.org/10.1007/s11655-016-2531-0 Wang YH, Huang Y (2014) Effect of Lactobacillus acidophilus and Bifidobacterium bifidum supplementation to standard triple therapy on Helicobacter pylori eradication and dynamic changes in intestinal flora. World J Microbiol Biotechnol 30(3):847–853. https://doi.org/10.1007/s11274-013-1490-2 Myllyluoma E, Ahlroos T, Veijola L, Rautelin H, Tynkkynen S, Korpela R (2007) Effects of anti-Helicobacter pylori treatment and probiotic supplementation on intestinal microbiota. Int J Antimicrob Agents 29(1):66–72. https://doi.org/10.1016/j.ijantimicag.2006.08.034 Myllyluoma E, Veijola L, Ahlroos T, Tynkkynen S, Kankuri E, Vapaatalo H, Rautelin H, Korpela R (2005) Probiotic supplementation improves tolerance to Helicobacter pylori eradication therapy–a placebo-controlled, double-blind randomized pilot study. Aliment Pharmacol Ther 21(10):1263–1272. https://doi.org/10.1111/j.1365-2036.2005.02448.x Sgouras D, Maragkoudakis P, Petraki K, Martinez-Gonzalez B, Eriotou E, Michopoulos S, Kalantzopoulos G, Tsakalidou E, Mentis A (2004) In vitro and in vivo inhibition of Helicobacter pylori by Lactobacillus casei strain Shirota. Appl Environ Microbiol 70(1):518–526. https://doi.org/10.1128/AEM.70.1.518-526.2004 Sahagún-Flores JE, López-Peña LS, de la Cruz-Ramírez Jaimes J, García-Bravo MS, Peregrina-Gómez R, de Alba-García JE (2007) Erradicación de helicobácter pylori: esquema triple tradicional versus mismo esquema más probiótico [Eradication of Helicobacter pylori: triple treatment scheme plus Lactobacillus vs. triple treatment alone]. Cir Cir 75(5):333–336 Sýkora J, Valecková K, Amlerová J, Siala K, Dedek P, Watkins S, Varvarovská J, Stozický F, Pazdiora P, Schwarz J (2005) Effects of a specially designed fermented milk product containing probiotic Lactobacillus casei DN-114 001 and the eradication of H. pylori in children: a prospective randomized double-blind study. J Clin Gastroenterol 39(8):692–698. https://doi.org/10.1097/01.mcg.0000173855.77191.44 Deguchi R, Nakaminami H, Rimbara E, Noguchi N, Sasatsu M, Suzuki T, Matsushima M, Koike J, Igarashi M, Ozawa H, Fukuda R, Takagi A (2012) Effect of pretreatment with Lactobacillus gasseri OLL2716 on first-line Helicobacter pylori eradication therapy. J Gastroenterol Hepatol 27(5):888–892. https://doi.org/10.1111/j.1440-1746.2011.06985.x Holz C, Busjahn A, Mehling H, Arya S, Boettner M, Habibi H, Lang C (2015) Significant Reduction in Helicobacter pylori Load in Humans with Non-viable Lactobacillus reuteri DSM17648: A Pilot Study. Probiotics and antimicrobial proteins 7(2):91–100. https://doi.org/10.1007/s12602-014-9181-3 Dore MP, Cuccu M, Pes GM, Manca A, Graham DY (2014) Lactobacillus reuteri in the treatment of Helicobacter pylori infection. Intern Emerg Med 9(6):649–654. https://doi.org/10.1007/s11739-013-1013-z Ismail NI, Nawawi KNM, Hsin DCC, Hao KW, Mahmood NRKN, Chearn GLC, Wong Z, Tamil AM, Joseph H, Raja Ali RA (2023) Probiotic containing Lactobacillus reuteri DSM 17648 as an adjunct treatment for Helicobacter pylori infection: A randomized, double-blind, placebo-controlled trial. Helicobacter 28(6):e13017. https://doi.org/10.1111/hel.13017 Jin F, Yang H (2022) Transcriptome Analysis of the Response of Mature Helicobacter pylori Biofilm to Different Doses of Lactobacillus salivarius LN12 with Amoxicillin and Clarithromycin. Antibiot (Basel Switzerland) 11(2):262. https://doi.org/10.3390/antibiotics11020262 Del Piano M, Pagliarulo M, Tari R, Carmagnola S, Balzarini M, Lorenzini P, Pane M (2014) Correlation between chronic treatment with proton pump inhibitors and bacterial overgrowth in the stomach: any possible beneficial role for selected lactobacilli? J Clin Gastroenterol 48(Suppl 1):S40–S46. https://doi.org/10.1097/MCG.0000000000000256 Wu S, Xu Y, Chen Z, Chen Y, Wei F, Xia C, Zhou Q, Li P, Gu Q (2023) Lactiplantibacillus plantarum ZJ316 Reduces Helicobacter pylori Adhesion and Inflammation by Inhibiting the Expression of Adhesin and Urease Genes. Mol Nutr Food Res 67(18):e2300241. https://doi.org/10.1002/mnfr.202300241 Ermolenko EI, Molostova AS, Baryshnikova NV, Svarval AV, Gladyshev NS, Kashchenko VA, Suvorov AN (2022) The Clinical Effectiveness of Probiotics and Autoprobiotics in Treatment of Helicobacter Pylori -Associated Dyspepsia. Russian J Infect Immun 12(4):726–734 Olekhnovich, E. I., Manolov, A. I., Samoilov, A. E., Prianichnikov, N. A., Malakhova,M. V., Tyakht, A. V., Pavlenko, A. V., Babenko, V. V., Larin, A. K., Kovarsky, B.A., Starikova, E. V., Glushchenko, O. E., Safina, D. D., Markelova, M. I., Boulygina,E. A., Khusnutdinova, D. R., Malanin, S. Y., Abdulkhakov, S. R., Abdulkhakov, R. A.,Grigoryeva, T. V., … Ilina, E. N. (2019). Shifts in the Human Gut Microbiota Structure Caused by Quadruple Helicobacter pylori Eradication Therapy. Frontiers in microbiology , 10 , 1902. https://doi.org/10.3389/fmicb.2019.01902 Katsande PM, Nguyen VD, Nguyen TLP, Nguyen TKC, Mills G, Bailey DMD, Christie G, Hong HA, Cutting SM (2023) Prophylactic immunization to Helicobacter pylori infection using spore vectored vaccines. Helicobacter 28(4):e12997. https://doi.org/10.1111/hel.12997 Wu L, Wang Z, Sun G, Peng L, Lu Z, Yan B, Huang K, Yang Y (2019) Effects of anti-H. pylori triple therapy and a probiotic complex on intestinal microbiota in duodenal ulcer. Sci Rep 9(1):12874. https://doi.org/10.1038/s41598-019-49415-3 Yuan Z, Xiao S, Li S, Suo B, Wang Y, Meng L, Liu Z, Yin Z, Xue Y, Zhou L (2021) The impact of Helicobacter pylori infection, eradication therapy, and probiotics intervention on gastric microbiota in young adults. Helicobacter 26(6):e12848. https://doi.org/10.1111/hel.12848 Yakovenko EP, Strokova TV, Iakovenko AV, Ivanov AN, Soluyanova IP, Vasilyev NN (2021) A Prospective Randomized Comparative Study of the Efficacy and Safety of a Two-Week Bismuth-Based Quadrotherapy of Helicobacter Pylori Infection with the Inclusion of the Probiotic Containing Bifidobacterium Longum BB-46 and Enterococcus Faecium ENCfa-68 . Ter Arkh 93(8):916–922. https://doi.org/10.26442/00403660.2021.08.200996 Si XB, Lan Y, Qiao L (2017) [A meta-analysis of randomized controlled trials of bismuth-containing quadruple therapy combined with probiotic supplement for eradication of Helicobacter pylori]. Zhonghua nei ke za zhi 56(10):752–759. https://doi.org/10.3760/cma.j.issn.0578-1426.2017.10.009 Zhou XX, Pan YJ, Wang YB, Li WF (2007) In vitro assessment of gastrointestinal viability of two photosynthetic bacteria, Rhodopseudomonas palustris and Rhodobacter sphaeroides. J Zhejiang Univ Sci B 8(9):686–692. https://doi.org/10.1631/jzus.2007.B0686 Kos B, Susković J, Vuković S, Simpraga M, Frece J, Matosić S (2003) Adhesion and aggregation ability of probiotic strain Lactobacillus acidophilus M92. J Appl Microbiol 94(6):981–987. https://doi.org/10.1046/j.1365-2672.2003.01915.x Collado MC, Meriluoto J, Salminen S (2008) Adhesion and Aggregation Properties of Probiotic and Pathogen Strains. Eur Food Res Technol 226(5):1065–1073 Ryan KA, Daly P, Li Y, Hooton C, O'Toole PW (2008) Strain-specific inhibition of Helicobacter pylori by Lactobacillus salivarius and other lactobacilli. J Antimicrob Chemother 61(4):831–834. https://doi.org/10.1093/jac/dkn040 Tan Q, Xu H, Aguilar ZP, Peng S, Dong S, Wang B, Li P, Chen T, Xu F, Wei H (2013) Safety assessment and probiotic evaluation of Enterococcus faecium YF5 isolated from sourdough. J Food Sci 78(4):M587–M593. https://doi.org/10.1111/1750-3841.12079 Thuy TTD, Kuo PY, Lin SM, Kao CY (2022) Anti-Helicobacter pylori activity of potential probiotic Lactiplantibacillus pentosus SLC13. BMC Microbiol 22(1):277. https://doi.org/10.1186/s12866-022-02701-z Jing D, Jin J, Mei Z, Zhu Q, Lu Y, Wang X (2020) Effects of Helicobacter pylori infection and interleukin 6 on the expression of ITIH4 in human gastric cancer cells. Translational cancer research 9(8):4656–4665. https://doi.org/10.21037/tcr-20-1766 Jiang M, Zhang F, Wan C, Xiong Y, Shah NP, Wei H, Tao X (2016) Evaluation of probiotic properties of Lactobacillus plantarum WLPL04 isolated from human breast milk. J Dairy Sci 99(3):1736–1746. https://doi.org/10.3168/jds.2015-10434 Sophatha B, Teanpaisan R (2021) Factors Relating to Adhesion and Aggregation of Lactobacillus Paracasei and Lactobacillus Rhamnosus Strains. Microbiology 90(6):793–800 Van den Abbeele P, Roos S, Eeckhaut V, MacKenzie DA, Derde M, Verstraete W, Marzorati M, Possemiers S, Vanhoecke B, Van Immerseel F, Van de Wiele T (2012) Incorporating a mucosal environment in a dynamic gut model results in a more representative colonization by lactobacilli. Microb Biotechnol 5(1):106–115. https://doi.org/10.1111/j.1751-7915.2011.00308.x Zuo F, Appaswamy A, Gebremariam HG, Jonsson AB (2019) Role of Sortase A in Lactobacillus gasseri Kx110A1 Adhesion to Gastric Epithelial Cells and Competitive Exclusion of Helicobacter pylori . Front Microbiol 10:2770. https://doi.org/10.3389/fmicb.2019.02770 Ekmekci H, Aslim B, Ozturk S (2009) Characterization of vaginal lactobacilli coaggregation ability with Escherichia coli. Microbiol Immunol 53(2):59–65. https://doi.org/10.1111/j.1348-0421.2009.00115.x Zhao K, Xie Q, Xu D, Guo Y, Tao X, Wei H, Wan C (2018) Antagonistics of Lactobacillus plantarum ZDY2013 against Helicobacter pylori SS1 and its infection in vitro in human gastric epithelial AGS cells. J Biosci Bioeng 126(4):458–463. https://doi.org/10.1016/j.jbiosc.2018.04.003 Gotteland M, Cruchet S, Verbeke S (2001) Effect of Lactobacillus ingestion on the gastrointestinal mucosal barrier alterations induced by indometacin in humans. Aliment Pharmacol Ther 15(1):11–17. https://doi.org/10.1046/j.1365-2036.2001.00898.x Imanishi J, Kita M, Yamaoka Y, Sawai N, Tanahashi T, Kodama T (1998) Le rôle des cytokines dans la pathogénèse des maladies gastro-intestinales associées à l'infection par Helicobacter pylori [Role of cytokines in the pathogenesis of gastrointestinal diseases associated with Helicobacter pylori infection]. C R Seances Soc Biol Fil 192(5):991–996 Noach LA, Bosma NB, Jansen J, Hoek FJ, van Deventer SJ, Tytgat GN (1994) Mucosal tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-8 production in patients with Helicobacter pylori infection. Scand J Gastroenterol 29(5):425–429. https://doi.org/10.3109/00365529409096833 Garcia-Castillo V, Marcial G, Albarracín L, Tomokiyo M, Clua P, Takahashi H, Kitazawa H, Garcia-Cancino A, Villena J (2020) The Exopolysaccharide of Lactobacillus fermentum UCO-979C Is Partially Involved in Its Immunomodulatory Effect and Its Ability to Improve the Resistance against Helicobacter pylori Infection. Microorganisms 8(4):479. https://doi.org/10.3390/microorganisms8040479 Gill HS (2003) Probiotics to enhance anti-infective defences in the gastrointestinal tract. Best Pract Res Clin Gastroenterol 17(5):755–773. https://doi.org/10.1016/s1521-6918(03)00074-x Haller D, Bode C, Hammes WP, Pfeifer AM, Schiffrin EJ, Blum S (2000) Non-pathogenic bacteria elicit a differential cytokine response by intestinal epithelial cell/leucocyte co-cultures. Gut 47(1):79–87. https://doi.org/10.1136/gut.47.1.79 Yang C, Liang L, Lv P, Liu L, Wang S, Wang Z, Chen Y (2021) Effects of non-viable Lactobacillus reuteri combining with 14-day standard triple therapy on Helicobacter pylori eradication: A randomized double-blind placebo-controlled trial. Helicobacter 26(6):e12856. https://doi.org/10.1111/hel.12856 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3905585","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":269981360,"identity":"69c87c9a-43a3-46fe-a477-4925fed4d222","order_by":0,"name":"Hui Yang","email":"","orcid":"","institution":"Lanzhou University School of pharmacy","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Yang","suffix":""},{"id":269981361,"identity":"48e7dcb3-a6ca-4738-ae5b-23444d549f17","order_by":1,"name":"Yang Lin","email":"","orcid":"","institution":"Lanzhou University School of Life Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Lin","suffix":""},{"id":269981362,"identity":"75714270-9950-4982-b8a0-6e34f7c5490c","order_by":2,"name":"Yuchan Ma","email":"","orcid":"","institution":"Lanzhou University School of pharmacy","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuchan","middleName":"","lastName":"Ma","suffix":""},{"id":269981363,"identity":"3768d2fb-f26a-4a41-9e66-e11c019481fc","order_by":3,"name":"Jiaru Li","email":"","orcid":"","institution":"Lanzhou University School of pharmacy","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiaru","middleName":"","lastName":"Li","suffix":""},{"id":269981364,"identity":"31d0da2f-cd75-4311-93e5-b8d784c0d9d8","order_by":4,"name":"Junxiang Li","email":"","orcid":"","institution":"Lanzhou University School of Life Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Junxiang","middleName":"","lastName":"Li","suffix":""},{"id":269981365,"identity":"a542a3a8-befe-48ea-96d4-9d288a6c051b","order_by":5,"name":"Zeqi Huo","email":"","orcid":"","institution":"Lanzhou University School of Life Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zeqi","middleName":"","lastName":"Huo","suffix":""},{"id":269981366,"identity":"25cf4c30-c00f-41ce-8ec0-39a284a1efa4","order_by":6,"name":"Pingrong Yang","email":"","orcid":"","institution":"Gansu Medical Products Administration","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Pingrong","middleName":"","lastName":"Yang","suffix":""},{"id":269981367,"identity":"8dd69822-c83c-4ae4-b8d6-491a552dd8ef","order_by":7,"name":"Chunjiang Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvUlEQVRIiWNgGAWjYDACCYYEZoYKCyibeC1nJEjTwsDM2EaKFv7ZDY8/F86TsDc4wHzwNg+DXR5hS+4cSDCeuU2C2eAAW7I1D0NyMUEtBhIJCcm82yTYDA7wmEnzMBxIbCBGy2HeORI8Bgf4vxGtJbGZt0FCAmgLG3FaJG4kJDPzHJMwkDzMZmw5xyCZsBb+GTnJn3lqbOz5jjc/vPGmwo6wFgYGngQIzQx2J2H1QMB+gChlo2AUjIJRMIIBAE/zMqM/8TQ4AAAAAElFTkSuQmCC","orcid":"","institution":"Lanzhou University School of Life Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Chunjiang","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-01-28 11:29:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3905585/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3905585/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50481598,"identity":"7f4d12b5-6e1a-40e0-9919-54ea53f667d0","added_by":"auto","created_at":"2024-02-01 08:10:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":101569,"visible":true,"origin":"","legend":"\u003cp\u003eStudies on the properties of lactobacillus. \u003cstrong\u003eA\u003c/strong\u003e Survival rate of lactobacillus in simulated gastric juice at pH 3.0. \u003cstrong\u003eB\u003c/strong\u003e Hydrophobic properties of lactobacillus. \u003cstrong\u003eC\u003c/strong\u003e Lactobacillus autoaggregation properties. \u003cstrong\u003eD\u003c/strong\u003eCoaggregation properties of lactobacillus with H. pylori. Error bars represent the standard deviation of biological triplicates. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ****, p \u0026lt; 0.0001; ns, no significant difference\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3905585/v1/56b26d87ef2115a4634a756a.png"},{"id":50481593,"identity":"bfc789fa-f9f9-4044-9d86-e65bbeea1d4b","added_by":"auto","created_at":"2024-02-01 08:10:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":121492,"visible":true,"origin":"","legend":"\u003cp\u003eScreening lactobacillus and testing the effect of the complex. \u003cstrong\u003eA\u003c/strong\u003eDetermination of the inhibitory ability of lactobacillus against H. pylori. \u003cstrong\u003eB\u003c/strong\u003eDetermination of urease activity (OD550nm). \u003cstrong\u003eC\u003c/strong\u003e Factor score plots of influencing factors. \u003cstrong\u003eD\u003c/strong\u003e Correlation analysis of influencing factors. \u003cstrong\u003eE\u003c/strong\u003eDetermination of the inhibitory capacity of mixture of Q21, Q25, and QA85 against H. pylori. Error bars represent the standard deviation of biological triplicates. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ****, p \u0026lt; 0.0001; ns, no significant difference\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3905585/v1/d388cb3031811044337fec1f.png"},{"id":50481594,"identity":"49f3b502-6ecb-46ea-ad98-eb5a78af7e4a","added_by":"auto","created_at":"2024-02-01 08:10:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":142567,"visible":true,"origin":"","legend":"\u003cp\u003eCo-culture validation experiments of lactobacillus and H. pylori. \u003cstrong\u003eA\u003c/strong\u003e Counting of live H. pylori in co-culture of lactobacillus suspension with H. pylori. \u003cstrong\u003eB\u003c/strong\u003e Counting of live H. pylori in co-culture of lactobacillus supernatant with H. pylori. \u003cstrong\u003eC\u003c/strong\u003e Measurement of urease activity in co-culture of lactobacillus suspension with H. pylori. \u003cstrong\u003eD\u003c/strong\u003eMeasurement of urease activity in co-culture of lactobacillus supernatant with H. pylori. Error bars represent the standard deviation of biological triplicates. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ****, p \u0026lt; 0.0001; ns, no significant difference\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3905585/v1/a0e003b64d4414e62ea44dbf.png"},{"id":50482041,"identity":"4c33dd6d-586e-4056-a0a4-8b921387db7c","added_by":"auto","created_at":"2024-02-01 08:18:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":90264,"visible":true,"origin":"","legend":"\u003cp\u003eAdhesion of lactobacillus to AGS cells (10\u003csup\u003e6\u003c/sup\u003e cells) and inhibition of H. pylori adhesion. \u003cstrong\u003eA\u003c/strong\u003e Adhesion of different concentrations of lactobacillus with AGS cells. \u003cstrong\u003eB\u003c/strong\u003e Adhesion of lactobacillus (10\u003csup\u003e8\u003c/sup\u003e CFU/ml) to AGS cells at different time durations. \u003cstrong\u003eC\u003c/strong\u003e Inhibition of H. pylori adhesion to AGS cells by lactobacillus. Error bars represent the standard deviation of biological triplicates. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ****, p \u0026lt; 0.0001; ns, no significant difference.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3905585/v1/721ee198005591fddac03b56.png"},{"id":50482040,"identity":"29dd5166-7c23-474b-bcbf-186d11c3bc2e","added_by":"auto","created_at":"2024-02-01 08:18:00","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":94459,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression level of TNF-α, IL-6, IL-8, and IL-10 in AGS cells. \u003cstrong\u003eA\u003c/strong\u003eTNF-α, \u003cstrong\u003eB\u003c/strong\u003e IL-6, \u003cstrong\u003eC\u003c/strong\u003e IL-8 and \u003cstrong\u003eD\u003c/strong\u003e IL-10 expression level in AGS cells treated with H. pylori and different lactobacillus. Error bars represent the standard deviation of biological triplicates. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ****, p \u0026lt; 0.0001; ns, no significant difference\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3905585/v1/f2bc9c087786ba56922b06df.png"},{"id":50481596,"identity":"5face5fa-6ca7-41ae-8e4a-ec55960f0cb2","added_by":"auto","created_at":"2024-02-01 08:10:00","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":757598,"visible":true,"origin":"","legend":"\u003cp\u003eLactobacillus antibiotic susceptibility and cytotoxicity of lactobacillus to AGS cells (10\u003csup\u003e4\u003c/sup\u003e cells). \u003cstrong\u003eA\u003c/strong\u003e Typical diagram of lactobacillus antibiotic susceptibility. E. coli and S. aureus were used as the control bacteria. \u003cstrong\u003eB\u003c/strong\u003e Cell viability was determined by MTT assay after 6 h of co-culture (MOI = 100). Error bars represent the standard deviation of biological triplicates. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ****, p \u0026lt; 0.0001; ns, no significant difference\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3905585/v1/9274df7faa76288c9d6cab90.png"},{"id":50584121,"identity":"266823cf-ea70-4ad2-a064-b90d828bf7d1","added_by":"auto","created_at":"2024-02-02 20:52:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1901660,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3905585/v1/502627a1-db6f-4a46-a525-502173a52f41.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Anti‑Helicobacter pylori activity of Lactobacillus plantarum LZU-J-Q21, LZU-J-Q25 and LZU-J-QA85 in vitro evaluation","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eHelicobacter pylori (H. pylori) is a gram-negative microaerobic bacterium that establishes colonization within the gastric mucosa, potentially resulting in various gastric ailments including gastritis, gastric ulcers, and even gastric cancer [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Despite the widespread prevalence of H. pylori infection can lead to stomach diseases, but only a small proportion of infected patients will develop clinical symptoms, and most of the patients with no alarming symptoms will be neglected. After the successful treatment of H. pylori infection, it has been observed that the recurrence rate remains high. Consequently, enhancing the eradication rate and reducing the recurrence rate are urgently needed measures [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The current first-line treatment for H. pylori infection is mainly quadruple therapy, which combines a proton pump inhibitor with two antibiotics and bismuth. While this method exhibits high efficacy, good compliance, and overall safety, it is not without drawbacks, including potential side effects and a notable recurrence rate post-cure [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, there is an urgent need to explore novel modalities that either exhibit fewer side effects or can enhance the overall cure rate.\u003c/p\u003e \u003cp\u003eProbiotics are living microorganisms that can play a beneficial role in the host's health by ingesting a certain amount [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], primarily including lactobacilli, bifidobacteria, certain streptococci and yeasts [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Probiotics have the ability to inhibit the growth of pathogenic bacteria, regulate the microecological balance within the body, and treat diseases caused by pathogenic bacteria, such as acute diarrhea infections and colitis [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Additionally, probiotics contribute to enhanced digestion and absorption, as well as the regulation of the immune system, all without adverse effects [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCurrently, a variety of probiotic preparations have been clinically applied in the treatment of diseases caused by gastrointestinal pathogenic bacterial infections [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Several studies have demonstrated the effectiveness of various probiotics in the treatment of diseases resulting from H. pylori infections, such as L. acidophilus [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], L. rhamnosus GG [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], L. casei [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], L. gasseri OLL2716 [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], L. reuteri [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], L. salivarius [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], L. plantarum [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], E. faecium [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], Bacillus subtilis [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], Bifidobacterium [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], and others.\u003c/p\u003e \u003cp\u003eCertain lactobacillus can tolerate the low pH of the stomach, enabling them to adhere and transiently colonize the human stomach. Therefore, based on both in vitro and animal studies, it has been hypothesized that probiotics may be able to compete with H. pylori for adhesion and reduce H. pylori infection in humans [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Numerous subsequent studies have shown that probiotics do have a role in reducing H. pylori infections within the human body, and they can assist in the treatment of illnesses caused by H. pylori infections, playing a crucial role in significantly reducing associated adverse reactions.\u003c/p\u003e \u003cp\u003eJiangShui is a Chinese specialty from Northwest China, which is made by adding fresh plant stems, roots, and leaves, such as celery, white radish, and lotus leaf, to a boiled base liquid and placing it at a suitable temperature for fermentation. The fermented slurry can be consumed directly or used to make other delicacies. We screened probiotics from the JiangShui that originate in highland areas such as Qinghai for research purposes. In order to verify whether these characteristic strains have inhibitory effects on H. pylori, whether they are expected to be potential strains against H. pylori. In this study, our aim was to investigate the inhibitory potential of probiotics sourced from Northwest China Plateau Region against H. pylori, targeting the reduction of H. pylori colonization and associated inflammation. We screened probiotics with antagonistic effects on H. pylori and tried to elucidate the mechanisms by which these probiotics exert their effects on H. pylori. It is then hoped that our research on the screened probiotics will lay the groundwork for future applications in products.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Bacterial strains and culture conditions\u003c/h2\u003e \u003cp\u003eLactobacillus plantarum LZU-J-Q21 (Q21), LZU-J-Q25 (Q25), LZU-J-QA85 (QA85), and Lactobacillus rhamnosus GG (LGG) were stored at \u0026minus;\u0026thinsp;80\u0026deg;C in Lanzhou University, China and Sharpe (MRS) broth containing 20% glycerol (v/v) until tested. LGG is widely used probiotic strain and is thus used as control strain in this study. LGG was stored in lab at Lanzhou University (China). Q21, Q25, and QA85 were the laboratory stock strains isolated from JiangShui in Qinghai, China. Q21, Q25, and QA85 are stored in the Guangdong Microbial Culture Collection Center (GDMCC), with storage numbers are GDMCC NO: 63277, GDMCC NO: 63278, GDMCC NO: 61192, respectively. The bacteria were cultured in MRS broth at 37\u0026deg;C for 24 h to activate lactobacillus, repeated twice and then subjected to each experimental study. H. pylori J99 was stored in the Lanzhou University Microbiological Culture Collection and stored at \u0026minus;\u0026thinsp;80\u0026deg;C in H. Pylori Medium (fluids) containing 20% glycerol (v/v) until tested. H. pylori was grown on Columbia blood agar plates containing 5% (v/v) off fiber sheep blood (Qingdao Hope Bio-Technology Co., Ltd.) at 37\u0026deg;C in microaerophilic conditions (5% O\u003csub\u003e2\u003c/sub\u003e, 10% CO\u003csub\u003e2\u003c/sub\u003e, and 85% N\u003csub\u003e2\u003c/sub\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Cell culture\u003c/h2\u003e \u003cp\u003eAGS cells (human gastric adenocarcinoma epithelial cells, ATCC CRL 1739) were purchases from Procell Life Science\u0026amp;Technology Co., Ltd. (China). AGS cells were maintained in RPMI 1640 medium supplemented with 15% fetal bovine serum (FBS) (Gemini Fetal Bovine Serum, Gemini Biotechnology company, California), penicillin (100 IU/mL), and streptomycin (100 \u0026micro;m/mL) at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Acid tolerance of lactobacillus\u003c/h2\u003e \u003cp\u003eAfter activation of lactobacillus, the supernatant was discarded by centrifugation. The bacterial precipitate was washed three times with phosphate-buffered saline (PBS) and resuspended to a viable bacterial count of 10\u003csup\u003e8\u003c/sup\u003e CFU/mL. Lactobacillus suspension with a viable count of 10\u003csup\u003e8\u003c/sup\u003e CFU/mL was inoculated into simulated gastric fluid (filtered through a 0.22 \u0026micro;m membrane) at pH 3.0, and sampled at 0 and 3 h of the test, respectively. Counts of viable bacteria were performed using the MRS agar plates method and the survival rate of several lactobacillus strains in simulated gastric fluid after 3 h was calculated separately [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Hydrophobic properties of lactobacillus\u003c/h2\u003e \u003cp\u003eThe hydrophobicity of the bacterial surface was determined according to the method of Kos et al [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. After activated lactobacillus, the bacteria were washed and resuspended with PBS to give a viable bacterial count of 10\u003csup\u003e8\u003c/sup\u003e CFU/mL. 3 mL of lactobacillus suspension and 1 mL of xylene were thoroughly mixed, shaken thoroughly for 5 min, allowed to stand at room temperature, and the absorbance values of the aqueous phase were measured after 0 h and 1 h to calculate the hydrophobicity of lactobacillus.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Autoaggregation properties of lactobacillus\u003c/h2\u003e \u003cp\u003eAfter activation, the lactobacillus was washed with PBS and resuspended so that the number of viable bacteria was 10\u003csup\u003e8\u003c/sup\u003e CFU/mL. The mixture was incubated at 37 ℃, and the absorbance value at 600 nm of the upper layer of the liquid was measured within 24 h to calculate the autoaggregation rate of lactobacillus [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Coaggregation properties of lactobacillus with H. pylori\u003c/h2\u003e \u003cp\u003eAfter the activation of lactobacillus, washed with PBS and resuspend, so that the number of viable bacterial was 10\u003csup\u003e8\u003c/sup\u003e CFU/mL, added an equal volume of H. pylori suspension, mix uniformly, then set the mixture at 37 ℃ for static incubation. Test the absorbance value at 600 nm in the upper layer of the liquid within 24 h. Calculate the coaggregation rate of the interaction between the lactobacillus and H. pylori [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Anti‑H. pylori activity of lactobacillus\u003c/h2\u003e \u003cp\u003eAnti-H. pylori activity of lactobacillus was determined by the Oxford cup diffusion method. 200 \u0026micro;L of H. pylori suspension was evenly spread on Columbia blood agar plates without antibiotics. After spreading, 4 sterilized Oxford cups were placed on the plates, and add 200 \u0026micro;L of lactobacillus suspension, lactobacillus supernatant, amoxicillin solution at a concentration of 0.06 \u0026micro;g/mL (MIC), and a blank MRS broth to Oxford cups, respectively. The plates were incubated at 37 ℃ under microaerobic environment for 72 h. At the end of incubation, the diameter of the inhibition circle was measured by vernier caliper [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Urease activity assay\u003c/h2\u003e \u003cp\u003eTo analyze the inhibitory effects of lactobacillus against H. pylori urease, 40 \u0026micro;L of H. pylori suspension was mixed with 10 \u0026micro;L of lactobacillus supernatant, and 10 \u0026micro;L of sterile H. pylori liquid medium was used as control. The mixture was added into a clean and sterile 96-well plate and incubated at 37 ℃ in a microaerobic environment for 48 h. The incubated mixture was taken out, and 150 \u0026micro;L of urease reagent (20% urea, 0.012% phenol red, dissolved in PBS and adjusted to pH 6.5 with HCl) was added into each well, the color change was observed and the OD550nm value was measured [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Co-culture of lactobacillus with H. pylori\u003c/h2\u003e \u003cp\u003eActivated H. pylori were resuspended in fresh H. pylori liquid medium, added 10% lactobacillus suspension (10\u003csup\u003e8\u003c/sup\u003e CFU/mL) or supernatant. Co-culture for a certain period of time and H. pylori viable cells were counted using their selective medium. At the same time, urease activity was measured.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Antibiotic susceptibility assay\u003c/h2\u003e \u003cp\u003eThe susceptibility of lactobacillus to antibiotics was determined by the disc diffusion method [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. The concentration of lactobacillus was adjusted to 10\u003csup\u003e8\u003c/sup\u003e CFU/ml, and the bacterial suspension was evenly spread on MRS agar plates, and left to dry for 5 minutes. Use tweezers to stick the antibiotic discs (Microbial Reagent Co., Ltd., Hangzhou, China) onto the surface of the inoculated plates, and incubate in an inverted at 37 ℃ for 24 h, with the quality control bacteria as a control. The diameter of the inhibition circle was measured and recorded by vernier caliper. Three replicates were set up for each antibiotic and the results were averaged. The standard strains of Staphylococcus aureus ATCC 25923 (S. aureus) and Escherichia coli ATCC 25922 (E. coli) were used as the control bacteria, operation as above. The inhibition zone after incubation was measured and interpreted as susceptible, intermediate, or resistant according to the instructions for the antibiotic discs (Microbial Reagent Co., Ltd., Hangzhou, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Cytotoxicity assay on AGS cells\u003c/h2\u003e \u003cp\u003eThe cytotoxicity effect of lactobacillus on AGS cells was determined by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. First, cells (10\u003csup\u003e4\u003c/sup\u003e) were grown and allowed to adhere to a 96-well plate at 37\u0026deg;C for 12\u0026ndash;24 h to approximately 80% confluence and then cells were treated at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere with lactobacillus (MOI\u0026thinsp;=\u0026thinsp;100) for 6 h. Then 20 \u0026micro;L of MTT solution (5 mg/mL) was added to each well, and the cells were incubated for 4 h at 37\u0026deg;C. Finally, 150 \u0026micro;L of DMSO was added to each well and allow the color to develop. The OD was measured at 490 nm. Cell viability (%) = (Asample/Acontrol) \u0026times; 100, where Asample is the absorbance of the cells that were incubated with the medium containing lactobacillus, and Acontrol is the absorbance of the cells alone.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Adhesion assay of lactobacillus to AGS cells\u003c/h2\u003e \u003cp\u003eAGS cells (10\u003csup\u003e6\u003c/sup\u003e cells) were inoculated into 6-well plates in RPMI-1640 media, with 15% FBS and 1% penicillin-streptomycin, and grown to a monolayer at 37\u0026deg;C for 12\u0026ndash;24 h. Fresh culture medium without antibiotics was used instead before infection. To determine the adhesion capacity of lactobacillus, lactobacillus was washed three times with PBS before infection, and resuspended in antibiotic-free RPMI-1640 culture medium. The concentration of lactobacillus was adjusted to 10\u003csup\u003e6\u003c/sup\u003e, 10\u003csup\u003e7\u003c/sup\u003e, 10\u003csup\u003e8\u003c/sup\u003e, 10\u003csup\u003e9\u003c/sup\u003e, and 10\u003csup\u003e10\u003c/sup\u003e CFU/mL to de-infect the cells, respectively, and incubated for a total of 4 h at 37\u0026deg;C. At the end of the incubation, the 6-well plate was washed with PBS to wash away unadhered bacteria. Trypsin digestion was added and the mixture was collected in a centrifuge tube, diluted stepwise and spread on MRS agar plates. The number of colonies was counted to determine the number of adherent bacteria. The percentage of bacterial adherence to cells was calculated by the following formula: adherence capacity (%) = (adherent bacteria) / (total bacteria) \u0026times; 100. Cell adhesion assay was conducted in biological triplicate to ensure reproducibility.\u003c/p\u003e \u003cp\u003eIn order to determine the effect of co-culture duration on adhesion, lactobacillus was adjusted to 10\u003csup\u003e8\u003c/sup\u003e CFU/mL, and co-cultured with AGS cells for 1, 2, 4, and 6 h, respectively. Other operations were the same as above.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Inhibition of H. pylori adhesion to AGS cells by lactobacillus\u003c/h2\u003e \u003cp\u003eAGS cells (10\u003csup\u003e6\u003c/sup\u003e cells) were inoculated into 6-well plates in RPMI-1640 media, with 15% FBS and 1% penicillin-streptomycin, and grown to a monolayer at 37\u0026deg;C for 12\u0026ndash;24 h. Fresh culture medium without antibiotics was used instead before infection. In order to determine the inhibitory effect of lactobacillus on the adhesion of H. pylori to AGS cells, it was validated in four sets of experiments. Cells were infected with H. pylori (MOI\u0026thinsp;=\u0026thinsp;100) and incubated at 37\u0026deg;C for 4 h, as an infected control. After co-culturing the cells with H. pylori (MOI\u0026thinsp;=\u0026thinsp;100) for 2 h, the unadhered bacteria were washed away with PBS, and then lactobacillus (MOI\u0026thinsp;=\u0026thinsp;100) was added and co-cultured with the cells for 2 h as the displacement experimental group. The cells were co-cultured with lactobacillus (MOI\u0026thinsp;=\u0026thinsp;100) for 2 h, then washed with PBS to remove unadhered bacteria, and then H. pylori (MOI\u0026thinsp;=\u0026thinsp;100) was added to co-cultivate with the cells for 2 h as the exclusion experimental group. The cells were co-cultured with lactobacillus (MOI\u0026thinsp;=\u0026thinsp;100), and H. pylori (MOI\u0026thinsp;=\u0026thinsp;100) for 4 h as the competition experimental group. At the end of the incubation, 6-well plates were washed with PBS. Trypsin digestion was added and terminated with antibiotic-free medium, then the mixture was collected for gradual dilution and coated with pylorus-selective medium for counting. The relative percentage of H. pylori adhesion to cells was calculated according to the following formula: relative adhesion (%) = (number of adherent bacteria in the experimental group) / (number of adherent bacteria in the control group) \u0026times; 100. The cell adhesion assay was performed using the biological triplex method to ensure reproducibility.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14 Total RNA extraction and reverse‑transcription quantitative PCR (RT‑qPCR)\u003c/h2\u003e \u003cp\u003eTo study the anti-inflammatory effect of lactobacillus, it was verified in four groups of experiments. AGS cells were cultured normally for 4 h as blank control group. AGS cells were treated with H. pylori (MOI\u0026thinsp;=\u0026thinsp;100) for 4 h as H. pylori-infected group. After co-culturing the cells with lactobacillus (MOI\u0026thinsp;=\u0026thinsp;100) for 2 h, the unadhered bacteria were washed away with PBS, and then H. pylori (MOI\u0026thinsp;=\u0026thinsp;100) was added and co-cultured with the cells for 2 h. This was used as the exclusion experimental group. The cells were co-cultured with lactobacillus (MOI\u0026thinsp;=\u0026thinsp;100) and H. pylori (MOI\u0026thinsp;=\u0026thinsp;100) for 4h as the competition experimental group.\u003c/p\u003e \u003cp\u003eTotal mRNA was extracted with SevenFast\u0026reg; Total RNA Extraction Kit for Cells (Seven Innovation (Beijing) Biotech Co., China). cDNA synthesis was performed with SevenClever \u0026trade; First Strand cDNA Synthesis Kit (with dsDNase) (Seven Innovation (Beijing) Biotech Co., China). RT-qPCR was performed in qPCR 96-well plates on an Mx3000/Mx3005P system (Agilent, USA) and 2\u0026times; SYBR Green qPCR MasterMix II (Universal) (Seven Innovation (Beijing) Biotech Co., China) to de-analyze the TNF-α, IL-6, IL-8 and IL-10 mRNA. The oligonudleotide sequence of primers used for RT-qPCR [\u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSpecific primers used for RT-qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime; to 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSize of amplicon (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:TTTGATCCCTGACATCTGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e55.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e112\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:GGCCTAAGGTCCACTTGTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e59.60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GACAGCCACTCACCTCTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e59.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e457\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:CGCAGAATGAGATGAGTTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e55.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:ACTGAGAGTGATTGAGAGTGGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e59.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e112\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:AACCCTCTGCACCCAGTTTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60.75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:AGGGAGGATGAGTGATTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e783\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:AACTGGGAGGAACACTGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e59.23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GACCTCTATGCCAACACAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e57.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e139\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR:AGTACTTGCGCTCAGGAGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e60.61\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eRT-qPCR: quantitative real-time PCR; IL: interleukin; F: forward; R: reverse.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.15 Statistical analysis\u003c/h2\u003e \u003cp\u003eThe data were expressed as a mean of three replicates\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. ANOVA one-way test was used to calculate the statistical significance of the experimental results between two groups. In the aggregation assay, urease activity assay and anti-H. pylori activity of lactobacillus assay, ANOVA two-way test was used to assess multiple comparisons in those groups. A p-value less than 0.05 was considered as a significant difference. GraphPad Prism version 9 software and Origin 2023 software were used for the analyses.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Properties assay of lactobacillus\u003c/h2\u003e \u003cp\u003eThe pH range of the human stomach is between 1\u0026ndash;4, so screening for lactobacillus with the ability to inhibit the growth of H. pylori should have the ability to tolerate artificial gastric juice. In this experiment, seven strains of lactobacillus with good probiotic properties were used to study, and LGG was selected as control bacteria. The results showed that eight strains could survive for 3 h under artificial gastric juice at pH 3.0, with four strains surviving more than 20%, and ZCJ showed the strongest acid tolerance (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eThe greater hydrophobic force of the strain indicates that its cell surface is more hydrophobic. The hydrophobicity of these eight strains of lactobacillus with acid resistance was analyzed (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). The results showed that the hydrophobicity of the lactobacillus ranged from 12\u0026ndash;31%, among which QA85, QX(A)-4, TSL-6, and Q21 were more hydrophobic, and QA85 was the most hydrophobic.\u003c/p\u003e \u003cp\u003eThe aggregation of bacterial strains is divided into two forms: autoaggregation and coaggregation. Autoaggregation is the phenomenon of aggregation between the same bacteria, and coaggregation is the phenomenon of aggregation between different bacteria. In this study, we determined the autoaggregation ability of lactobacillus at 37\u0026deg;C for up to 24h. From the results, most of the lactobacillus showed strong autoaggregation ability, and the autoaggregation increased with the increase of incubation time. The incubation time of 24 h, Q25 showed the strongest autoaggregation at 69%, while autoaggregation rates of QA85, Q21, and LGG were also high (above 60%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). It has been shown that there is a positive correlation between the autoaggregation ability of a strain and its adhesion in the gut, and that strains with higher autoaggregation ability also have high adhesion. Coaggregation results showed that lactobacillus and H. pylori coaggregation also increased with time. The maximum rate of coaggregation of QA85 was 60% at an incubation time of 24 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). The aggregation of pathogenic bacteria by lactobacillus can make it easier for pathogenic bacteria to be eliminated from the intestine.\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Screening of lactobacillus with inhibitory effect on H. pylori\u003c/h2\u003e \u003cp\u003eScreening of lactobacillus with anti-H. pylori effect by Oxford cup assay. It can be seen that the amoxicillin positive control inhibited the growth of H. pylori and the circle of inhibition was around 10\u0026ndash;12 mm (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The size of the circle of inhibition of the eight strains of lactobacillus suspensions was in the range of 12\u0026ndash;16 mm, and that of the lactobacillus supernatants was in the range of 12\u0026ndash;15 mm. The suspensions and supernatants of the same strain had comparable inhibitory abilities, with the suspensions being superior, and the strongest ability to inhibit H. pylori was Q25.\u003c/p\u003e \u003cp\u003eThe expression level and activity of urease are critical for the survival of H. pylori in an acidic environment. It was demonstrated that the supernatants of all eight lactobacillus significantly inhibited the urease activity of H. pylori, with Q25 having the strongest inhibitory ability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eIn this experiment, principal component analysis (PCA) was used to evaluate the correlation between the nature of lactobacillus and the inhibition of the growth of H. pylori and to analyze the probiotics that antagonized H. pylori. It was found through factor scoring plot (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) that the first component accounted for 39.7% and the second component accounted for 32.2%, with the bacteriostatic ability playing a major contributing role. By correlation analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), it was found that there was a close association between the nature of lactobacillus and its inhibition of H. pylori growth. Therefore, based on the PCA analysis and the properties of H. pylori growth inhibition, Q21, Q25, and QA85 were comprehensively screened as potential antagonists of H. pylori infection and were used as the strains for the subsequent studies. The three strains were compounded to verify the antibacterial effect of the mixture, and it was found that the mixture also possessed better antibacterial ability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE).\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Co-culture validation experiments of lactobacillus and H. pylori\u003c/h2\u003e \u003cp\u003eQ21, Q25, and QA85 were screened as potential antagonists of H. pylori infection. To further confirm the ability of lactobacillus to antagonize H. pylori, LGG was used as a control to analyze the effect of viable lactobacillus and fermentation supernatant on the growth of H. pylori under co-culture conditions with H. pylori. From the effect of lactobacillus vivax on the growth and urease activity of H. pylori (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA \u0026amp; \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), it can be seen that the number of viable bacteria of H. pylori decreased with the extension of time. At 24 h, all three strains and mixtures inhibited H. pylori growth and urease activity; with QA85 being the most potent in inhibiting H. pylori growth and urease activity. At 48 h and 72 h, the strains also all inhibited H. pylori growth and urease activity, with the trend leveling off compared to 24 h.\u003c/p\u003e \u003cp\u003eFrom the effect of fermentation supernatant of lactobacillus on the growth and urease activity of H. pylori (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB \u0026amp; \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), it was observed that the viable count of H. pylori under co-culture conditions decreased with increasing time. At 24 h, the supernatants of all three strains and mixtures inhibited H. pylori growth and urease activity; Q25 and QA85 were the most potent in inhibiting H. pylori growth and urease activity. The supernatant of the strain also strongly inhibited H. pylori growth and urease activity at both 48 h and 72 h. Live bacteria and fermentation supernatant of lactobacillus inhibited the growth and urease activity of H. pylori when co-cultured with H. pylori, a result that further suggests that live bacteria also play an important role in the antimicrobial action and that the metabolites of the live bacteria can be bacteriostatic, and that their strong inhibitory effect was demonstrated in the case of contact with the pathogenic bacterium H. pylori.\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Adhesion of lactobacillus to AGS cells and inhibition of H. pylori adhesion\u003c/h2\u003e \u003cp\u003eTo confirm the ability of several strains to adhere to gastric epithelial cells, their adhesion rates to AGS cells were explored. First, the adhesion rate of lactobacillus on AGS cells at different concentrations was explored (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), and it was found that the adhesion rate of lactobacillus at a concentration of 10\u003csup\u003e8\u003c/sup\u003e CFU/mL was significantly different compared with that at a concentration of 10\u003csup\u003e6\u003c/sup\u003e CFU/mL. Secondly, the adhesion rate of lactobacillus on AGS cells was explored at different time durations of incubation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), and it was found that there was a significant difference in the adhesion rate at 4 h or 6 h of incubation compared to that at 1 h of incubation.\u003c/p\u003e \u003cp\u003eAs the screened strains exhibited a strong capacity to adhere to AGS cells, a cell model was established to delve deeper into their potential to impede the subsequent colonization of H. pylori. This involved investigating their ability to compete with H. pylori for adhesion through three distinct models: displacement, exclusion, and competition treatment. The results show that all three strains of bacterial fluids and their mixture inhibited H. pylori adhesion to AGS cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Specifically, the relative adhesion rates of Q21, Q25, QA85, and their mixture were 55.04%, 50.39%, 54.26%, and 59.69%, respectively, compared with H. pylori adhesion to AGS cells alone during displacement adhesion (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.001); their relative adhesion rates were 38.76%, 31.16%, 32.79%, and 30.85%, respectively, during exclusion adhesion (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and the mixture inhibited adhesion at the highest rate; their relative adhesion rates were 45.12%, 42.56%, 43.49%, and 40.85% (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), respectively, during the competition adhesion process, and the mixture still had the highest inhibition of adhesion. Taken together, the relative adhesion rate of H. pylori in the exclusion group was lower than that of the other two modes in all three modes, indicating that the bacterial fluids had a higher ability to inhibit the adhesion of H. pylori under the exclusion conditions, and the highest inhibition rate was found in the mixture of three strains. Therefore, the results here are also in line with the previous experimental results that the mixture had a stronger adhesion ability to AGS cells at 4 h of incubation. In the competition mode, the individual bacterial fluids also showed excellent inhibition of adhesion to H. pylori (all above 54%), which is important for hindering the subsequent colonization of H. pylori.\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Effect of lactobacillus on H. pylori-induced inflammatory factors in AGS cells\u003c/h2\u003e \u003cp\u003eH. pylori infection induces the production of inflammatory factors and contributes to inflammation in gastric epithelial cells. Therefore, we investigated whether lactobacillus could inhibit the expression of H. pylori-induced inflammatory genes. The relative expression levels of relevant cytokines, including pro-inflammatory factors TNF-α, IL-6, IL-8, and anti-inflammatory factor IL-10, in H. pylori-treated AGS cells under different conditions were examined by RT-qPCR. It was found that the relative expression levels of TNF-α, IL-6, and IL-8 were significantly increased in H. pylori-treated AGS cells compared to the control group, and after treatment with Q21, Q25, QA85, and mixture, their relative expression levels were significantly decreased compared to the H. pylori-treated group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA \u0026amp; \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB \u0026amp; \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Compared with the control group, the relative expression level of IL-10 in AGS cells stimulated by H. pylori was significantly increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD); compared with the H. pylori-treated group, after treatment with lactobacillus, there was a significant change in the relative expression level of IL-10 in the exclusion group, and none of the relative expression levels of IL-10 in the competition group were significantly changed (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Antibiotic susceptibility and cellular cytotoxicity assay of lactobacillus\u003c/h2\u003e \u003cp\u003eAntibiotic susceptibility was an important index for the safety of lactobacillus before application. Therefore, we tested the susceptibility of these lactobacillus to 22 antibiotics (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). As shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Q21, Q25, QA85, and LGG showed varying degrees of drug sensitivity to 22 antibiotics, with sensitivity to penicillins (e.g., ampicillin), tetracyclines (e.g., doxycycline), cephalosporins (e.g., imipenem), and chloramphenicol; and showed intermediate sensitivity to aminoglycosides and macrolides (e.g., gentamicin and erythromycin). In contrast, these strains were resistant to quinolones (e.g., ciprofloxacin and levofloxacin).\u003c/p\u003e \u003cp\u003eTo test the safety of lactobacillus in future applications, we performed the cell viability assay to determine the cytotoxicity of three lactobacillus strains and their mixture to AGS cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). The results showed that the co-culture of Q21, Q25, QA85, and their mixture with cells for 6 h had no significant cytotoxic effects on cells.\u003c/p\u003e\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eResults of the sensitivity of lactobacillus to 22 antibiotics\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eClass\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAntibiotic\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eContent\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c7\" namest=\"c4\"\u003e \u003cp\u003eSensitivity\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLGG\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eQ21\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eQ25\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eQA85\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003ePenicillins\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePenicillin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10 U\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOxacillin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmpicillin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eAminoglycoside\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGentamicin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStreptomycin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKanamycin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTetracyclines\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTetracycline\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDoxycycline\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003eCephalosporins\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eImipenem\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCeftazidime\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCefotaxime\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCefuroxime\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMacrolide\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eErythromycin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eQuinolones\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCiprofloxacin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNorfloxacin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLevofloxacin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFolate metabolism pathway inhibitors\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSulfafurazole\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e300 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTrimethoprim-sulfamethoxazole\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23.75/1.25 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGlycopeptide\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVancomycin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eChloramphenicol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eChloramphenicol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRifamycins\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRifampicin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 \u0026micro;g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eR: resistant; I: intermediate; S: susceptible.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe inhibitory effect of probiotics on H. pylori renders it promising as a potentially safe approach to fight H. pylori and reduce adverse effects. In this study, three strains of lactobacillus plantarum, Q21, Q25, and QA85, were screened by utilizing the probiotic properties of lactobacillus as well as the inhibitory properties of H. pylori growth. They both thrive in low-acid conditions (pH 3.0), resembling the acidic environment of gastric juices, and demonstrate notable hydrophobicity, as well as tendencies for autoaggregation and coaggregation. Additionally, these strains showcase a robust capability to inhibit the growth of H. pylori and diminish urease activity. Strains that are highly hydrophobic may have protein-like substances on their cell surfaces, which may have a better self-protective effect on the cells, while hydrophilic strains may have polysaccharides on their cell surfaces [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Hydrophobicity role of cells is a non-specific interaction of bacteria with gastric epithelial cells, and bacterial cells with strong hydrophobicity usually form a strong interaction with gastric epithelial cells [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Strains can also exert their probiotic efficacy by aggregating to a certain amount such as forming biofilms through autoaggregation and allowing for stronger adhesion of the strains in the gut [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Autoaggregation of probiotic strains may be one of the mechanisms to maintain the viability of the strains and increase the resistance of the human upper gastrointestinal tract to pathogenic bacteria. Autoaggregation allows probiotics to form spatial site barriers to impede the colonization of the gastrointestinal tract by pathogenic bacteria such as H. pylori [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Certainly, the aggregation of pathogenic bacteria by lactobacillus can make it easier to expel pathogenic bacteria from the intestine [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The ability of lactobacillus to inhibit the growth of H. pylori may be mainly due to the role of substances such as organic acids, bacteriocins and protein-like substances produced by lactobacillus. For example, lactic acid, which is the main metabolite of lactobacillus, causes a decrease in the pH of the fermentation broth, which can significantly inhibit the activity of the enzyme auxin urease [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], thus achieving the inhibition of H. pylori.\u003c/p\u003e \u003cp\u003eBy studying the probiotic properties of lactobacillus, it was found that lactobacillus may hinder the colonization of H. pylori through bacteriostatic effects and autoaggregation or coaggregation, thus preventing H. pylori infection and further deterioration of H. pylori. Previous studies have found that decreased mucin secretion is commonly observed in H. pylori-induced diseases, resulting in disruption of the mucosal barrier, and that probiotics can repair the mucosal permeability of the gastric mucosa, form a mucosal barrier, and inhibit the adhesion of pathogenic bacteria such as H. pylori [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Therefore, the adhesion of screened lactobacillus with AGS cells and the inhibition of H. pylori adhesion to AGS cells by lactobacillus were examined, which further validated that lactobacillus could impede H. pylori colonization adhesion to the gastric mucosa.\u003c/p\u003e \u003cp\u003eThe manifestation of H. pylori-induced gastritis has been associated with the release of a wide variety of inflammatory mediators, such as chemokines and cytokines.IL-8 was the first of these cytokines to be found that associated with H. pylori-induced gastritis, and it is capable of leading to the migration of neutrophilic leukocytes and monocytes from the mucosa [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. It also stimulates the production of TNF-α and IL-6 by monocytes and dendritic cells in the mucosal layer [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. These responses do not clear the infection and can lead to persistent inflammation. Studies have also demonstrated that probiotics inhibit the production of pro-inflammatory factors, such as IL-8, leading to a reduction in neutrophil infiltration in the gastric mucosa. Moreover, they promote the generation of anti-inflammatory factors like IL-10, eliciting an immune response in Th2 cells [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Therefore, probiotics can modulate the immune response of the host by adhering to epithelial cells, and in particular, they can reduce the inflammatory response of the stomach by modulating the balance of inflammatory factors [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. By RT-qPCR experiments, it was found that Q21, Q25, QA85, and their mixture all inhibited the relative expression of the pro-inflammatory factors IL-8, IL-6, and TNF-α, whereas the expression of the inflammation-suppressing factor IL-10 was not particularly significantly elevated in comparison with the infected group, and our findings are in general agreement with those of previous studies. Probiotics are capable of generating a wide variety of immune responses due to strain specificity, and the immune status of the host affects the immune response [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], so the immunomodulatory effects of probiotics are difficult to generalize. We just studied the immunomodulatory effects of three strains of lactobacillus plantarum isolated from JiangShui with typical regional characteristics.\u003c/p\u003e \u003cp\u003eProbiotics limit H. pylori colonization and inhibit its growth and minimize treatment-related adverse effects such as antibiotic-associated diarrhea [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. The utilization of probiotic preparations as adjuvant therapy against H. pylori holds positive implications for both controlling the resistance rate and enhancing the eradication rate of H. pylori. Probiotics are becoming more and more widely used, and their safety deserves more attention. For this reason, we verified the antibiotic susceptibility of the three strains of bacteria, and found the strains to have some antibiotic susceptibility, with a considerable degree of safety, providing a guarantee for the subsequent study.\u003c/p\u003e \u003cp\u003eIn this study, the overall effect of lactobacillus plantarum has been studied, without exploring which or which components work or the synergistic effect of the components, which can be further studied in the future. In the future, corresponding in vivo experiments can also be carried out to verify the specific effects of lactobacillus plantarum. In order to lay the foundation for the subsequent application alone or in combination with drugs to have a better healing effect on the human body.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eOur results showed that lactobacillus plantarum Q21, Q25, and QA85 possessed excellent probiotic properties as well as antagonistic effects against H. pylori, and anti-inflammatory effects on AGS cells were verified at the mRNA level. Lactobacillus plantarum Q21, Q25, and QA85 could survive in simulated gastric juice, were acid tolerant and had strong cell adhesion. These lactobacillus plantarum can inhibit H. pylori infection and growth by decreasing urease activity, hindering H. pylori colonization and anti-inflammatory properties. Thus, lactobacillus plantarum may be a suitable candidate probiotic for promoting host health, and lactobacillus plantarum Q21, Q25, and QA85 and their derivatives have the potential to be used as prophylactic or adjunctive therapeutic agents for H. pylori infection.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Hui Yang and Yang Lin. The first draft of the manuscript was written by Hui Yang and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003eThe authors confirm that the data supporting the findings of this study are available within the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publication\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003eWe also would like to express our gratitude to the Core Facility of the School of Life Sciences, Lanzhou University for their support.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e This work was supported by the Science and Technology Major Project of Gansu Province (Grant no. 22ZD1FA001), the Science and Technology Major Project of Gansu Province-Enterprise Innovation Consortium Project (Grant no. 23ZDFA013-3), the Guangzhou Science and Technology Planning Project (Grant no. 202206010165), and the Key Talent Project of Gansu Province (Grant no. 2022RCXM027).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFitzGerald R, Smith SM (2021) An Overview of Helicobacter pylori Infection. \u003cem\u003eMethods in molecular biology\u003c/em\u003e. (Clifton N J) 2283:1\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-1-0716-1302-3_1\u003c/span\u003e\u003cspan address=\"10.1007/978-1-0716-1302-3_1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun Y, Zhang J (2019) Helicobacter pylori recrudescence and its influencing factors. J Cell Mol Med 23(12):7919\u0026ndash;7925. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jcmm.14682\u003c/span\u003e\u003cspan address=\"10.1111/jcmm.14682\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie Y, Hu Y, Zhu Y, Wang H, Wang QZ, Li YQ, Wang JB, Zhang ZY, Zhang DK, Liu XW, Lu NH (2023) Colloidal bismuth pectin-containing quadruple therapy as the first-line treatment of Helicobacter pylori infection: A multicenter, randomized, double-blind, non-inferiority clinical trial. Helicobacter 28(3):e12978. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/hel.12978\u003c/span\u003e\u003cspan address=\"10.1111/hel.12978\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhumkhachorn P, Rattanachaikunsopon P (2023) Probiotics: Sources, Selection and Health Benefits. Res J Biotechnol 18(5):102\u0026ndash;113\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilkins T, Sequoia J (2017) Probiotics for Gastrointestinal Conditions: A Summary of the Evidence. Am Family Phys 96(3):170\u0026ndash;178\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSang LX, Chang B, Zhang WL, Wu XM, Li XH, Jiang M (2010) Remission induction and maintenance effect of probiotics on ulcerative colitis: a meta-analysis. World J Gastroenterol 16(15):1908\u0026ndash;1915. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3748/wjg.v16.i15.1908\u003c/span\u003e\u003cspan address=\"10.3748/wjg.v16.i15.1908\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Zhang P, Zhang X (2021) Probiotics Regulate Gut Microbiota: An Effective Method to Improve Immunity. Molecules 26(19):6076. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules26196076\u003c/span\u003e\u003cspan address=\"10.3390/molecules26196076\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe C, Xie Y, Zhu Y, Zhuang K, Huo L, Yu Y, Guo Q, Shu X, Xiong Z, Zhang Z, Lyu B, Lu N (2022) Probiotics modulate gastrointestinal microbiota after \u003cem\u003eHelicobacter pylori\u003c/em\u003e eradication: A multicenter randomized double-blind placebo-controlled trial. Front Immunol 13:1033063. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2022.1033063\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.1033063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePernica JM, Steenhoff AP, Mokomane M, Moorad B, Lechiile K, Smieja M, Mazhani L, Cheng J, Kelly MS, Loeb M, Stordal K, Goldfarb DM (2017) Rapid enteric testing to permit targeted antimicrobial therapy, with and without Lactobacillus reuteri probiotics, for paediatric acute diarrhoeal disease in Botswana: A pilot, randomized, factorial, controlled trial. PLoS ONE 12(10):e0185177. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0185177\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0185177\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee CY, Shih HC, Yu MC, Lee MY, Chang YL, Lai YY, Lee YC, Kuan YH, Lin CC (2017) Evaluation of the potential inhibitory activity of a combination of L. acidophilus, L. rhamnosus and L. sporogenes on Helicobacter pylori: A randomized double-blind placebo-controlled clinical trial. Chin J Integr Med 23(3):176\u0026ndash;182. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11655-016-2531-0\u003c/span\u003e\u003cspan address=\"10.1007/s11655-016-2531-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang YH, Huang Y (2014) Effect of Lactobacillus acidophilus and Bifidobacterium bifidum supplementation to standard triple therapy on Helicobacter pylori eradication and dynamic changes in intestinal flora. World J Microbiol Biotechnol 30(3):847\u0026ndash;853. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11274-013-1490-2\u003c/span\u003e\u003cspan address=\"10.1007/s11274-013-1490-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMyllyluoma E, Ahlroos T, Veijola L, Rautelin H, Tynkkynen S, Korpela R (2007) Effects of anti-Helicobacter pylori treatment and probiotic supplementation on intestinal microbiota. Int J Antimicrob Agents 29(1):66\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijantimicag.2006.08.034\u003c/span\u003e\u003cspan address=\"10.1016/j.ijantimicag.2006.08.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMyllyluoma E, Veijola L, Ahlroos T, Tynkkynen S, Kankuri E, Vapaatalo H, Rautelin H, Korpela R (2005) Probiotic supplementation improves tolerance to Helicobacter pylori eradication therapy\u0026ndash;a placebo-controlled, double-blind randomized pilot study. Aliment Pharmacol Ther 21(10):1263\u0026ndash;1272. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1365-2036.2005.02448.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2036.2005.02448.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSgouras D, Maragkoudakis P, Petraki K, Martinez-Gonzalez B, Eriotou E, Michopoulos S, Kalantzopoulos G, Tsakalidou E, Mentis A (2004) In vitro and in vivo inhibition of Helicobacter pylori by Lactobacillus casei strain Shirota. Appl Environ Microbiol 70(1):518\u0026ndash;526. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/AEM.70.1.518-526.2004\u003c/span\u003e\u003cspan address=\"10.1128/AEM.70.1.518-526.2004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSahag\u0026uacute;n-Flores JE, L\u0026oacute;pez-Pe\u0026ntilde;a LS, de la Cruz-Ram\u0026iacute;rez Jaimes J, Garc\u0026iacute;a-Bravo MS, Peregrina-G\u0026oacute;mez R, de Alba-Garc\u0026iacute;a JE (2007) Erradicaci\u0026oacute;n de helicob\u0026aacute;cter pylori: esquema triple tradicional versus mismo esquema m\u0026aacute;s probi\u0026oacute;tico [Eradication of Helicobacter pylori: triple treatment scheme plus Lactobacillus vs. triple treatment alone]. Cir Cir 75(5):333\u0026ndash;336\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS\u0026yacute;kora J, Valeckov\u0026aacute; K, Amlerov\u0026aacute; J, Siala K, Dedek P, Watkins S, Varvarovsk\u0026aacute; J, Stozick\u0026yacute; F, Pazdiora P, Schwarz J (2005) Effects of a specially designed fermented milk product containing probiotic Lactobacillus casei DN-114 001 and the eradication of H. pylori in children: a prospective randomized double-blind study. J Clin Gastroenterol 39(8):692\u0026ndash;698. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/01.mcg.0000173855.77191.44\u003c/span\u003e\u003cspan address=\"10.1097/01.mcg.0000173855.77191.44\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeguchi R, Nakaminami H, Rimbara E, Noguchi N, Sasatsu M, Suzuki T, Matsushima M, Koike J, Igarashi M, Ozawa H, Fukuda R, Takagi A (2012) Effect of pretreatment with Lactobacillus gasseri OLL2716 on first-line Helicobacter pylori eradication therapy. J Gastroenterol Hepatol 27(5):888\u0026ndash;892. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1440-1746.2011.06985.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1440-1746.2011.06985.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolz C, Busjahn A, Mehling H, Arya S, Boettner M, Habibi H, Lang C (2015) Significant Reduction in Helicobacter pylori Load in Humans with Non-viable Lactobacillus reuteri DSM17648: A Pilot Study. Probiotics and antimicrobial proteins 7(2):91\u0026ndash;100. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12602-014-9181-3\u003c/span\u003e\u003cspan address=\"10.1007/s12602-014-9181-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDore MP, Cuccu M, Pes GM, Manca A, Graham DY (2014) Lactobacillus reuteri in the treatment of Helicobacter pylori infection. Intern Emerg Med 9(6):649\u0026ndash;654. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11739-013-1013-z\u003c/span\u003e\u003cspan address=\"10.1007/s11739-013-1013-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsmail NI, Nawawi KNM, Hsin DCC, Hao KW, Mahmood NRKN, Chearn GLC, Wong Z, Tamil AM, Joseph H, Raja Ali RA (2023) Probiotic containing Lactobacillus reuteri DSM 17648 as an adjunct treatment for Helicobacter pylori infection: A randomized, double-blind, placebo-controlled trial. Helicobacter 28(6):e13017. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/hel.13017\u003c/span\u003e\u003cspan address=\"10.1111/hel.13017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin F, Yang H (2022) Transcriptome Analysis of the Response of Mature \u003cem\u003eHelicobacter pylori\u003c/em\u003e Biofilm to Different Doses of \u003cem\u003eLactobacillus salivarius\u003c/em\u003e LN12 with Amoxicillin and Clarithromycin. Antibiot (Basel Switzerland) 11(2):262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antibiotics11020262\u003c/span\u003e\u003cspan address=\"10.3390/antibiotics11020262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDel Piano M, Pagliarulo M, Tari R, Carmagnola S, Balzarini M, Lorenzini P, Pane M (2014) Correlation between chronic treatment with proton pump inhibitors and bacterial overgrowth in the stomach: any possible beneficial role for selected lactobacilli? J Clin Gastroenterol 48(Suppl 1):S40\u0026ndash;S46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/MCG.0000000000000256\u003c/span\u003e\u003cspan address=\"10.1097/MCG.0000000000000256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu S, Xu Y, Chen Z, Chen Y, Wei F, Xia C, Zhou Q, Li P, Gu Q (2023) Lactiplantibacillus plantarum ZJ316 Reduces Helicobacter pylori Adhesion and Inflammation by Inhibiting the Expression of Adhesin and Urease Genes. Mol Nutr Food Res 67(18):e2300241. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/mnfr.202300241\u003c/span\u003e\u003cspan address=\"10.1002/mnfr.202300241\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErmolenko EI, Molostova AS, Baryshnikova NV, Svarval AV, Gladyshev NS, Kashchenko VA, Suvorov AN (2022) The Clinical Effectiveness of Probiotics and Autoprobiotics in Treatment of \u003cem\u003eHelicobacter Pylori\u003c/em\u003e-Associated Dyspepsia. Russian J Infect Immun 12(4):726\u0026ndash;734\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlekhnovich, E. I., Manolov, A. I., Samoilov, A. E., Prianichnikov, N. A., Malakhova,M. V., Tyakht, A. V., Pavlenko, A. V., Babenko, V. V., Larin, A. K., Kovarsky, B.A., Starikova, E. V., Glushchenko, O. E., Safina, D. D., Markelova, M. I., Boulygina,E. A., Khusnutdinova, D. R., Malanin, S. Y., Abdulkhakov, S. R., Abdulkhakov, R. A.,Grigoryeva, T. V., \u0026hellip; Ilina, E. N. (2019). Shifts in the Human Gut Microbiota Structure Caused by Quadruple \u003cem\u003eHelicobacter pylori\u003c/em\u003e Eradication Therapy. \u003cem\u003eFrontiers in microbiology\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 1902. https://doi.org/10.3389/fmicb.2019.01902\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatsande PM, Nguyen VD, Nguyen TLP, Nguyen TKC, Mills G, Bailey DMD, Christie G, Hong HA, Cutting SM (2023) Prophylactic immunization to Helicobacter pylori infection using spore vectored vaccines. Helicobacter 28(4):e12997. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/hel.12997\u003c/span\u003e\u003cspan address=\"10.1111/hel.12997\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu L, Wang Z, Sun G, Peng L, Lu Z, Yan B, Huang K, Yang Y (2019) Effects of anti-H. pylori triple therapy and a probiotic complex on intestinal microbiota in duodenal ulcer. Sci Rep 9(1):12874. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-019-49415-3\u003c/span\u003e\u003cspan address=\"10.1038/s41598-019-49415-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan Z, Xiao S, Li S, Suo B, Wang Y, Meng L, Liu Z, Yin Z, Xue Y, Zhou L (2021) The impact of Helicobacter pylori infection, eradication therapy, and probiotics intervention on gastric microbiota in young adults. Helicobacter 26(6):e12848. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/hel.12848\u003c/span\u003e\u003cspan address=\"10.1111/hel.12848\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYakovenko EP, Strokova TV, Iakovenko AV, Ivanov AN, Soluyanova IP, Vasilyev NN (2021) A Prospective Randomized Comparative Study of the Efficacy and Safety of a Two-Week Bismuth-Based Quadrotherapy of \u003cem\u003eHelicobacter Pylori\u003c/em\u003e Infection with the Inclusion of the Probiotic Containing Bifidobacterium Longum BB-46 and \u003cem\u003eEnterococcus Faecium ENCfa-68\u003c/em\u003e. Ter Arkh 93(8):916\u0026ndash;922. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.26442/00403660.2021.08.200996\u003c/span\u003e\u003cspan address=\"10.26442/00403660.2021.08.200996\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSi XB, Lan Y, Qiao L (2017) [A meta-analysis of randomized controlled trials of bismuth-containing quadruple therapy combined with probiotic supplement for eradication of Helicobacter pylori]. Zhonghua nei ke za zhi 56(10):752\u0026ndash;759. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3760/cma.j.issn.0578-1426.2017.10.009\u003c/span\u003e\u003cspan address=\"10.3760/cma.j.issn.0578-1426.2017.10.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou XX, Pan YJ, Wang YB, Li WF (2007) In vitro assessment of gastrointestinal viability of two photosynthetic bacteria, Rhodopseudomonas palustris and Rhodobacter sphaeroides. J Zhejiang Univ Sci B 8(9):686\u0026ndash;692. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1631/jzus.2007.B0686\u003c/span\u003e\u003cspan address=\"10.1631/jzus.2007.B0686\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKos B, Susković J, Vuković S, Simpraga M, Frece J, Matosić S (2003) Adhesion and aggregation ability of probiotic strain Lactobacillus acidophilus M92. J Appl Microbiol 94(6):981\u0026ndash;987. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-2672.2003.01915.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-2672.2003.01915.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollado MC, Meriluoto J, Salminen S (2008) Adhesion and Aggregation Properties of Probiotic and Pathogen Strains. Eur Food Res Technol 226(5):1065\u0026ndash;1073\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRyan KA, Daly P, Li Y, Hooton C, O'Toole PW (2008) Strain-specific inhibition of Helicobacter pylori by Lactobacillus salivarius and other lactobacilli. J Antimicrob Chemother 61(4):831\u0026ndash;834. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jac/dkn040\u003c/span\u003e\u003cspan address=\"10.1093/jac/dkn040\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan Q, Xu H, Aguilar ZP, Peng S, Dong S, Wang B, Li P, Chen T, Xu F, Wei H (2013) Safety assessment and probiotic evaluation of Enterococcus faecium YF5 isolated from sourdough. J Food Sci 78(4):M587\u0026ndash;M593. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1750-3841.12079\u003c/span\u003e\u003cspan address=\"10.1111/1750-3841.12079\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThuy TTD, Kuo PY, Lin SM, Kao CY (2022) Anti-Helicobacter pylori activity of potential probiotic Lactiplantibacillus pentosus SLC13. BMC Microbiol 22(1):277. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12866-022-02701-z\u003c/span\u003e\u003cspan address=\"10.1186/s12866-022-02701-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJing D, Jin J, Mei Z, Zhu Q, Lu Y, Wang X (2020) Effects of \u003cem\u003eHelicobacter pylori\u003c/em\u003e infection and interleukin 6 on the expression of ITIH4 in human gastric cancer cells. Translational cancer research 9(8):4656\u0026ndash;4665. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.21037/tcr-20-1766\u003c/span\u003e\u003cspan address=\"10.21037/tcr-20-1766\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang M, Zhang F, Wan C, Xiong Y, Shah NP, Wei H, Tao X (2016) Evaluation of probiotic properties of Lactobacillus plantarum WLPL04 isolated from human breast milk. J Dairy Sci 99(3):1736\u0026ndash;1746. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3168/jds.2015-10434\u003c/span\u003e\u003cspan address=\"10.3168/jds.2015-10434\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSophatha B, Teanpaisan R (2021) Factors Relating to Adhesion and Aggregation of Lactobacillus Paracasei and Lactobacillus Rhamnosus Strains. Microbiology 90(6):793\u0026ndash;800\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan den Abbeele P, Roos S, Eeckhaut V, MacKenzie DA, Derde M, Verstraete W, Marzorati M, Possemiers S, Vanhoecke B, Van Immerseel F, Van de Wiele T (2012) Incorporating a mucosal environment in a dynamic gut model results in a more representative colonization by lactobacilli. Microb Biotechnol 5(1):106\u0026ndash;115. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1751-7915.2011.00308.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1751-7915.2011.00308.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZuo F, Appaswamy A, Gebremariam HG, Jonsson AB (2019) Role of Sortase A in \u003cem\u003eLactobacillus gasseri\u003c/em\u003e Kx110A1 Adhesion to Gastric Epithelial Cells and Competitive Exclusion of \u003cem\u003eHelicobacter pylori\u003c/em\u003e. Front Microbiol 10:2770. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2019.02770\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2019.02770\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEkmekci H, Aslim B, Ozturk S (2009) Characterization of vaginal lactobacilli coaggregation ability with Escherichia coli. Microbiol Immunol 53(2):59\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1348-0421.2009.00115.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1348-0421.2009.00115.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao K, Xie Q, Xu D, Guo Y, Tao X, Wei H, Wan C (2018) Antagonistics of Lactobacillus plantarum ZDY2013 against Helicobacter pylori SS1 and its infection in vitro in human gastric epithelial AGS cells. J Biosci Bioeng 126(4):458\u0026ndash;463. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jbiosc.2018.04.003\u003c/span\u003e\u003cspan address=\"10.1016/j.jbiosc.2018.04.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGotteland M, Cruchet S, Verbeke S (2001) Effect of Lactobacillus ingestion on the gastrointestinal mucosal barrier alterations induced by indometacin in humans. Aliment Pharmacol Ther 15(1):11\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-2036.2001.00898.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-2036.2001.00898.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImanishi J, Kita M, Yamaoka Y, Sawai N, Tanahashi T, Kodama T (1998) Le r\u0026ocirc;le des cytokines dans la pathog\u0026eacute;n\u0026egrave;se des maladies gastro-intestinales associ\u0026eacute;es \u0026agrave; l'infection par Helicobacter pylori [Role of cytokines in the pathogenesis of gastrointestinal diseases associated with Helicobacter pylori infection]. C R Seances Soc Biol Fil 192(5):991\u0026ndash;996\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoach LA, Bosma NB, Jansen J, Hoek FJ, van Deventer SJ, Tytgat GN (1994) Mucosal tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-8 production in patients with Helicobacter pylori infection. Scand J Gastroenterol 29(5):425\u0026ndash;429. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3109/00365529409096833\u003c/span\u003e\u003cspan address=\"10.3109/00365529409096833\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarcia-Castillo V, Marcial G, Albarrac\u0026iacute;n L, Tomokiyo M, Clua P, Takahashi H, Kitazawa H, Garcia-Cancino A, Villena J (2020) The Exopolysaccharide of \u003cem\u003eLactobacillus fermentum\u003c/em\u003e UCO-979C Is Partially Involved in Its Immunomodulatory Effect and Its Ability to Improve the Resistance against \u003cem\u003eHelicobacter pylori\u003c/em\u003e Infection. Microorganisms 8(4):479. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms8040479\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms8040479\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGill HS (2003) Probiotics to enhance anti-infective defences in the gastrointestinal tract. Best Pract Res Clin Gastroenterol 17(5):755\u0026ndash;773. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s1521-6918(03)00074-x\u003c/span\u003e\u003cspan address=\"10.1016/s1521-6918(03)00074-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaller D, Bode C, Hammes WP, Pfeifer AM, Schiffrin EJ, Blum S (2000) Non-pathogenic bacteria elicit a differential cytokine response by intestinal epithelial cell/leucocyte co-cultures. Gut 47(1):79\u0026ndash;87. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1136/gut.47.1.79\u003c/span\u003e\u003cspan address=\"10.1136/gut.47.1.79\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang C, Liang L, Lv P, Liu L, Wang S, Wang Z, Chen Y (2021) Effects of non-viable Lactobacillus reuteri combining with 14-day standard triple therapy on Helicobacter pylori eradication: A randomized double-blind placebo-controlled trial. Helicobacter 26(6):e12856. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/hel.12856\u003c/span\u003e\u003cspan address=\"10.1111/hel.12856\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Probiotics, Adhesion, Helicobacter pylori, Urease, Inflammatory","lastPublishedDoi":"10.21203/rs.3.rs-3905585/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3905585/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003ePurpose\u003c/h2\u003e \u003cp\u003eThe aim was to investigate the inhibitory potential of probiotics sourced from Northwest China Plateau Region against Helicobacter pylori (H. pylori), targeting the reduction of H. pylori colonization and associated inflammation.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003ePhenotypic assays including aggregation, cell adhesion, and hydrophobic activity were performed to characterize strains. Anti- H. pylori activity of lactobacillus was determined by the Oxford Cup diffusion method, urease assay and co-culture assay. To test immune modulation activity of lactobacillus, and TNF-α, IL-6, IL-8 expression in AGS was determined by RT-qPCR.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eHere, we screened three well-characterized probiotic strains, Lactobacillus plantarum LZU-J-Q21 (Q21), LZU-J-Q25 (Q25) and LZU-J-QA85 (QA85). All three lactobacillus strains were tolerant to the simulated gastrointestinal conditions. Mixture of three lactobacillus strains showed the highest adhesion ability to AGS cells. All tested strains exhibited an inhibitory effect against H. pylori. The suspension and cell-free supernatant of three strains showed abilities to inhibit H. pylori urease activity. All the treatment of AGS cells with Q21, Q25, QA85, and mixture significantly decreased the TNF-α, IL-6, IL-8 expression induced by H. pylori infection.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eQ21, Q25, QA85, and their mixture possesses potent inhibitory activity against H. pylori infection, growth, and H. pylori-induced inflammation. These results suggest that lactobacillus and its derivatives have the potential as complementary agents against H. pylori infection and alleviate inflammatory response.\u003c/p\u003e","manuscriptTitle":"Anti‑Helicobacter pylori activity of Lactobacillus plantarum LZU-J-Q21, LZU-J-Q25 and LZU-J-QA85 in vitro evaluation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-01 08:09:55","doi":"10.21203/rs.3.rs-3905585/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8bcd5571-21bf-4095-8848-4424976391a1","owner":[],"postedDate":"February 1st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-02-02T20:44:09+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-01 08:09:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3905585","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3905585","identity":"rs-3905585","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}