Oxalate induces phosphatidylserine externalization, apoptosis, and crystal-cell adhesion in renal tubular epithelial cells through the ROS-ADAM17-Notch1 axis

preprint OA: closed
Full text JSON View at publisher
Full text 93,289 characters · extracted from preprint-html · click to expand
Oxalate induces phosphatidylserine externalization, apoptosis, and crystal-cell adhesion in renal tubular epithelial cells through the ROS-ADAM17-Notch1 axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Oxalate induces phosphatidylserine externalization, apoptosis, and crystal-cell adhesion in renal tubular epithelial cells through the ROS-ADAM17-Notch1 axis Yan Ma, Zhenyu Bi, Feihong Yang, Xiuguo Gan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9282701/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background Oxalate salts induce reactive oxygen species (ROS) generation, leading to phosphatidylserine (PS) externalization from renal tubule epithelial cells and the development of kidney stone. This research investigated the roles of ADAM17 (A Disintegrin and Metalloproteinase 17) and the Notch1 signaling pathway in oxalate-induced cell crystal adhesion through ROS-mediated mechanisms. Methods We treated HK-2 with sodium oxalate to establish a model of damage. ROS were measured using DCFH-DA fluorescence, and apoptosis and PS externalization were measured using flow cytometry. QPCR was applied to evaluate the mRNA of ADAM17 and Notch1, while western blot analysis was employed to assess their corresponding protein levels. Crystal adhesion assays were used to assess cell adherence to calcium oxalate crystals. The function of ADAM17 in oxalate-induced injury was examined by siRNA-mediated knockdown. Results Exposure to oxalate significantly elevated ROS generation, apoptotic incidence, PS externalization, and crystal adhesion in HK-2 cells. Moreover, oxalate exposure upregulated ADAM17 expression and activated the Notch1 signaling pathway. Antioxidant treatment reduces ADAM17 expression and inhibits Notch1 pathway activation. ADAM17 knockdown partially rescued ROS-induced apoptosis and PS externalization, reduced crystal adhesion, and suppressed Notch1 signaling. Conclusion Oxalate triggers apoptosis, PS externalization, and crystal cell adhesion in renal tubular epithelial cells through the ROS-ADAM17-Notch1 axis. Biological sciences/Cell biology Health sciences/Diseases Biological sciences/Molecular biology Health sciences/Nephrology ROS calcium oxalate kidney stones ADAM17 Notch1 signaling pathway crystal-cell adhesion Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Kidney stones, a widespread and highly prevalent urinary system disease, have a global incidence ranging from 1% to 15% [ 1 ] . The high incidence and recurrence of this disease pose major health and economic risks. The vast majority of kidney stones are calcium oxalate stones [ 2 ] , yet their pathogenesis remains unclear. Therefore, in order to prevent kidney stones, investigating the pathological mechanisms behind the development of calcium oxalate renal stones holds significant importance.. A crucial element in the formation of calcium oxalate kidney stones involves the attachment of these crystals to renal tubular epithelial cell surfaces [ 3 ] . Oxalate exposure compromises renal tubule cells, impairing structure and activity, and fostering crystal accumulation [ 4 – 6 ] . When renal tubule cells are exposed to oxalate, oxidative stress is triggered, which is marked by the overproduction of ROS. This surge causes cellular damage, functional impairment, and apoptosis [ 7 ] . During apoptosis, PS redistributes to the outer membrane leaflet from its physiological inner localization, thereby exposing the negatively charged regions. Early studies indicated oxalate exposure triggers the generation of ROS, leading to the outward translocation of phosphatidylserine in renal tubular epithelial cells. The exposure of phosphatidylserine on the cell surface facilitates crystal adhesion, which in turn accelerates the progression of kidney stone formation [ 8 ] . However, the intrinsic mechanism of action is fuzzy. Numerous previous researches have indicated that ROS promotes the expression and activation of a disintegrin and metalloproteinase 17(ADAM17) in cell models of various diseases [ 9 – 11 ] . ADAM17 is a protein pivotal in the development and release of various receptors [ 12 ] . It can activate TNF-α(Tumor Necrosis Factor-α) and EGFR(Epidermal growth factor receptor) ligands, promoting renal inflammation and fibrosis. Renal fibrosis leads to acute and chronic kidney injury [ 13 – 15 ] , which is the pathologic basis of kidney stone [ 17 ] . Additionally, in a diabetic nephropathy cell injury model, Zhong et al. found that the promotion of ADAM17 transcription leads to unusual activation of the Notch1 signaling pathway [ 16 ] . This signaling pathway, being a crucial means of intercellular communication, is pivotal in the processes of cell growth and programmed cell death. It's especially key in sustaining the regular operation of renal tubular epithelial cells. In adult kidney tissues, the Notch pathway is expressed at low levels, however, it becomes activated in a variety of kidney diseases [ 18 – 20 ] . Upon activation, Notch1 binds to its ligand and is cleaved by ADAM17 [ 21 ] . Subsequently, at the S3 site, the intracellular domain of Notch1 (NICD) is released into the nucleus, leading to the transcription of target genes involved in biological processes such as apoptosis [ 22 ] . One study reported that inhibiting the activation of Notch1 signaling through γ-secretase can reduce cell apoptosis by lowering the protein Bax and increasing Bcl-2, thereby offering protective effects against kidney injury [ 23 ] . Notch also regulates membrane phospholipid asymmetry through Atp8a2, which modulates the flipping of PS onto the cell membrane [ 24 ] . Therefore, we proposed that Notch1 pathway activation contributes to oxalate-induced apoptosis and phosphatidylserine externalization in HK-2 cells. PS flipping on the cell membrane and apoptosis are important pathological processes in oxalate-induced renal tubule epithelial cell stone formation [ 25 , 26 ] . In the scope of this investigation, building upon our past work, we aimed to determine if high oxalate concentrations cause renal tubular epithelial cells to produce ROS. They then kick off the ADAM17-Notch1 signaling cascade, facilitating cell apoptosis, PS externalization, and crystal-cell adhesion. Our study aimed to investigate the cause of ROS-triggered PS externalization in HK2 cells and shed light on the mechanism that drives the development of calcium oxalate renal stones. 2. Materials and methods 2.1. Cell culture HK-2 cells were from Cellverse (Shanghai, China). Cells were cultured in DMEM/F12 medium (Seven, China) supplemented with 1% penicillin-streptomycin (Beyotime, China) and 10% fetal bovine serum (BI, Israel), and incubated at 37℃ in an atmosphere containing 5% CO₂. After the cells had been passaged 3 times, we performed cell processing. 2.2. Cell grouping and treatment 2.2.1. Three groups were established: control, OX, and PBN + OX. We treated the control group with complete culture medium. We treated the OX group with 1 mM sodium oxalate (Yuanye Bio, Shanghai, China) for 24 h. Lastly, cells in the PBN + OX group were pretreated with 4 mM PBN (N-tert-Butyl-α-phenylnitrone, MCE, USA) for 2 h, followed by 1 mM sodium oxalate treatment for 24 h. 2.2.2. Three groups were established: si-NC, si-NC + OX, si-ADAM17, and si-ADAM17 + OX. We treated the si-NC and si-ADAM17 with complete culture medium. We treated si-NC + OX and si-ADAM17 + OX groups with 1 mM sodium oxalate for 24 h. 2.3. Cell transfection SiRNAs suppress ADAM17 expression. SevenBio helped us design siRNA targeting ADAM17 (si-ADAM17#1 and si-ADAM17#2) and negative control (si-NC). At approximately 80% confluence of cells within 6-well plates, siRNA transfection was carried out using Lipofectamine3000 (Invitrogen) in accordance with the supplier's instructions. 2.4. Detection of intracellular ROS After each group of cells has been processed, discard the spent medium in the six-well plates. After washing with phosphate buffered saline (PBS), serum-free medium containing DCFH-DA solution (10 µM, HY-D0940, MCE, USA) was added. Then, thorough mixing, the plates were placed in the incubator at 37°C for 30 min, followed by three washes with medium to wash out residual DCFH-DA. Cells were visualized and imaged using a fluorescence microscope (Zeiss, Germany), and the mean fluorescence intensity was assessed with ImageJ software to gauge the ROS concentrations. 2.5. qRT-PCR We used a cDNA synthesis kit (SM134, SevenBio, China) to reverse transcribe total RNA extracted from HK-2 cells into cDNA. Real-time quantitative PCR was performed using 2× SYBR Green qPCR Master Mix II (SM143, SevenBio, China) on a real-time fluorescence quantitative PCR analyzer (FQD-96C, Bioer Technology, China), strictly following manufacturer protocols. The results were normalized using β-actin mRNA as the internal reference for qRT-PCR. The ΔCt value was calculated as ΔCt = Ct (target gene) - Ct (β-actin). A higher ΔCt value indicates a lower expression level of the target gene. The relative expression levels of the genes were represented in the form of 2 −ΔΔCt . The following primers (Table 1 ) were used. Table 1 primers. Notch1-F GGTGAACTGCTCTGAGGAGATC Notch1-R GGATTGCAGTCGTCCACGTTGA NICD-F GCAGTTGT-GCTCCTGAAGAA NICD-R CGGGCG-GCCAGAAAC Hes1-F GGAAATGACAGTGAAGCACCTCC Hes1-R GAAGCGGGTCACCTCGTTCATG ADAM17-F AACAGCGACTGCACGTTGAAGG ADAM17-R CTGTGCAGTAGGACACGCCTTT β- actin-F CTC-CATCCTGGCCTCGCTGT β- actin-R GCT-GTCACCTTCACCGTTCC 2.6. Western blot After treatment, the cells in each well of the six-well plate were ruptured using RIPA lysis buffer for protein extraction. Following SDS-PAGE separation, protein samples were electroblotted onto PVDF membranes (Merck, Germany). Following 2-hour blocking in 5% non-fat dry milk at RT (20–25°C), membranes were incubated with primary antibodies diluted in TBST.: ADAM17 (1:500, WL04487, WanleiBio, China), Notch1 (1:1,000, CY5244, Abways, China), NICD (1:1,000, YP-Ab-12892, UpingBio, China), Hes1 (1:500, YP-Ab-07080, UpingBio, China), Bcl2 (1:500, WL01556, WanleiBio, China), Bax (1:2000, 50599-2-Ig, Proteintech, China), CD44 (Leukocyte differentiation antigen 44,1:2000, PTM-6106, PTM Bio, China), OPN (Osteopontin, 1:1000, WL00691, WanleiBio, China). The membranes were exposed to primary antibodies at 4°C for 16–18 hours, followed by triple TBST washes (10 min/wash). They were then exposed to a secondary antibody (1:10,000, SA00001-2/SA00001-1, Proteintech, China) at 25°C for 2 h. Proteins were detected using an ECL Chemiluminescent Substrate Kit (34580, Thermo Scientific, USA) and exposed to X-ray film. Finally, protein band quantification was performed using ImageJ, with relative expression levels normalized to β-actin loading controls. 2.7. Flow cytometry detection of cell apoptosis and PS externalization rate Annexin V-FITC can bind to phosphatidylserine (PS), which is externalized during apoptosis, whereas propidium iodide (PI) can permeate the membranes of late apoptotic and necrotic cells. Therefore, Annexin V-FITC/PI double staining (SC123, SevenBio, China) was used to detect PS externalization and differentiate between apoptosis and necrosis. In accordance with the manufacturer’s instructions, the cells were rinsed twice using PBS and then digested with trypsin (SevenBio, China) that contained no EDTA. Following centrifugation, cells were resuspended in kit-supplied buffer, followed by addition of 5 µl Annexin V-FITC and 5 µl propidium iodide (PI) per tube with subsequent gentle mixing. Following 10-min incubation at 20–25°C, stained cells were analyzed on a BD FACScan flow cytometer. The results were analyzed using FlowJo_v10.8.1 software. 2.8. Cell crystal adhesion assay After treatment, cells from each group were collected and seeded into 6-well plates at a density of 1×10⁶ cells per well in serum-free medium. After 3–4 h incubation for complete adhesion, the medium was replaced with serum-free medium containing COM powder (100 µg/mL; HY-Y0262D, MCE, USA). Cells were exposed to COM powder at 37℃ for 30 min. Post-incubation, they were rinsed three times with Hank's balanced salt solution (5 min/wash) to eliminate calcium oxalate crystals that had not adhered. Crystal-cell adhesion was documented via phase-contrast microscopy. Subsequently, bound crystals were dissolved with 10% HCl (2 mL/well), and lysate Ca²⁺ concentrations were quantified using a calcium assay kit (Beyotime, China) per manufacturer's protocol. The level of crystal cell adhesion was calculated as follows: Crystal cell adhesion ability = Calcium ion concentration in the treatment group - Calcium ion concentration in the corresponding treatment group without COM crystal powder. 3. Statistical analysis Each experiment was conducted three times, and the resulting data were processed using GraphPad Prism 10.1.2 software. Outcomes are expressed as the mean±standard error of the mean (SEM). For comparisons between two separate groups, Student’s t-tests were applied, while a one-way analysis of variance (ANOVA) was utilized to analyze differences across multiple groups.Statistical significance was set at p < 0.05. 4. Results 4.1. PBN pretreatment alleviated oxalate-induced ROS generation PBN (N-tert-Butyl-α-phenylnitrone) was employed to assess ROS involvement in oxalate-triggered PS externalization, crystal adhesion and apoptosis. Relative to controls, OX group exhibited markedly elevated ROS levels. PBN pretreatment substantially attenuated oxalate-induced oxidative stress (Fig. 1 ). 4.2. Inhibition of ROS production alleviated oxalate-induced cell apoptosis and PS externalization We assessed the pro-apoptotic effects of oxalate on HK-2 cells. Flow cytometric analysis demonstrated significantly elevated apoptotic rates and phosphatidylserine exposure in oxalate-exposed HK-2 cells (OX group) (Fig. 2 B). Bcl-2 and Bax, which are key apoptotic proteins, showed significant changes (Fig. 2 A). However, PBN pretreatment significantly reduced the oxalate-induced apoptosis and PS externalization. 4.3. Inhibition of ROS production reduces oxalate-induced crystal-cell adhesion and related adhesion molecule expression The ability of cells to adhere to crystals was assessed using a crystal-cell adhesion assay and the expression of OPN and CD44 (Fig. 3 B). HK-2 cells treated with high oxalate concentrations exhibited an increased expression of adhesion molecules, and COM crystals adhered more to the cell surface. However, PBN pretreatment markedly attenuated HK-2 cell adhesion capacity to COM crystals. (Fig. 3 A). 4.4. Oxalate increases ADAM17 expression through ROS-mediated activation of the Notch1 signaling pathway Studies have shown that oxidative stress promotes ADAM expression of ADAM17. Consequently, we supposed that high-concentration oxalate treatment of HK-2 would increase ADAM17 expression mediated by oxidative stress. As shown in Fig. 4 , western blot and qPCR demonstrated that oxalate treatment significantly elevated the levels of ADAM17, Notch1, NICD, and Hes1 in HK-2 cells. Moreover, ROS partially suppressed ADAM17 expression and Notch1 pathway activation. 4.5. ADAM17 knockdown alleviates oxalate-induced cell apoptosis, PS externalization, and crystal-cell adhesion Next, we investigated whether silencing ADAM17 could improve oxalate-induced crystal cell adhesion and cell apoptosis using siRNA to knockdown ADAM17 expression. Then we confirmed the knockdown efficiency by western blot (Fig. 5 A). In the crystal cell adhesion experiment, the adhesion of COM crystals to the surface of HK-2 cells was significantly diminished following the silencing of ADAM17 (Fig. 7 A). Flow cytometry analysis revealed that the knockdown of ADAM17 reversed oxalate-induced apoptosis (Fig. 6 A). At the protein level, the si-ADAM17 + OX group exhibited a significant reduction in the pro-apoptotic protein Bax compared with the si-nc + OX group. Contrarily, the level of Bcl-2, an anti-apoptotic protein, was notably increased (Fig. 6 B). Knockdown of ADAM17 also inhibited oxalate-induced elevation of OPN and CD44 (Fig. 7 B). These results suggest that ADAM17 knockdown not only inhibits oxalate-induced crystal cell adhesion but also attenuates cell damage by modulating apoptosis-related proteins. 4.6. ADAM17 knockdown partially inhibits the activation of the Notch1 pathway induced by oxalate To clarify the role of ADAM17 knockdown on the regulation of Notch1 signaling pathway activity under oxalic acid stress, our research further measured the expression changes of the key signaling molecule NICD and its downstream target gene Hes1. HK-2 cells that had been transfected with si-NC or si-ADAM17 were subjected to treatment with 1 mM sodium oxalate, and western blot was utilized to analyze the protein expression levels of NICD and Hes1. As shown in the results (Fig. 8 A), when compared with the si-nc + OX group, the expression levels of both NICD and Hes1 in the si-ADAM17 + OX group were importantly decreased (*p < 0.05), suggesting that ADAM17 knockdown effectively inhibited the activation of Notch1 signaling pathway triggered by oxalate stimulation. 5. Discussion Crystal-cell adhesion plays a critical role in kidney stone formation. Although the mechanisms underlying crystal cell adhesion remain unclear, growing evidence suggests that high concentrations of oxalate induce oxidative stress in renal tubular epithelial cells, generating amounts of ROS, damaging epithelial cells, and subsequently promoting stone formation [ 27 – 29 ] .Antioxidants are capable of reducing harm to renal tubular epithelial cells, and they can also decrease the adhesion and accumulation of these crystals [ 6 , 7 , 30 ] . Furthermore, our prior study confirmed that oxalate-induced ROS generation leads to PS externalization from renal tubular epithelial cell membranes. The negatively charged phosphatidylserine present on the cell surface functions as an anionic molecule, playing a mediating role in the adhesion of calcium oxalate monohydrate crystals [ 8 ] . We confirmed that the oxalate treatment of HK-2 significantly increased ROS production, promoted apoptosis and PS externalization, and enhanced the adhesion of crystals. Emerging evidence highlights that ADAM17 mediates the proteolytic shedding of extracellular domains from diverse cytokines, cell adhesion molecules, receptors, ligands, and enzymes. [ 31 – 34 ] . In the kidney, ADAM17 is significantly elevated in the kidney during acute and chronic kidney injury [ 35 ] . However, no studies have explored the direct relationship between ADAM17 and oxalate-induced damage to renal tubular epithelial cells. In HK-2 cells exposed to oxalate, the ADAM17 expression showed a marked increase, with this rise being associated with higher ROS concentrations. The level of ADAM17 was markedly reduced using PBN to inhibit ROS production. Additionally, siRNA-mediated ADAM17 knockdown significantly decreased oxalate-induced apoptosis and PS externalization, further reducing calcium oxalate crystal adhesion. These findings suggest that the ROS-mediated upregulation of ADAM17 contributes to oxalate-induced renal tubular epithelial cell damage and COM crystal adhesion. Studies have demonstrated that inhibiting Notch1 signaling can reduce apoptosis by regulating Bax and Bcl2, thereby exerting protective effects following kidney injury [ 23 ] . In the present study, an investigation was conducted into the impacts of oxalate on the Notch1 signaling pathway within HK-2 cells. Our results showed that oxalate treatment at high concentrations significantly increased the expression of Notch1, elevated NICD production, and upregulated the mRNA and protein levels of downstream genes such as Hes1. These results indicate that the ROS-driven increase in ADAM17 expression plays a role in renal tubular epithelial cell injury and COM crystal attachment caused by oxalate. Notch1 activation requires cleavage of the S2 site by ADAM17. ADAM17 knockdown inhibited oxalate-induced activation of the Notch1 pathway, thereby reducing phosphatidylserine externalization. Additionally, regulation of Bax and Bcl2 expression suppressed oxalate-induced apoptosis, thereby decreasing the adhesion of COM crystals. Prior researches have suggested that stimulation with oxalate or COM crystals increases the expression of CD44 and OPN in renal tubular epithelial cells, thereby promoting crystal adhesion and retention [ 36 – 38 ] . Similarly, our experiments demonstrated that CD44 and OPN expression increased in HK-2 cells treated with high oxalate concentrations. The antioxidant PBN inhibited oxalate-induced upregulation of CD44 and OPN. Additionally, ADAM17 knockdown significantly reduced oxalate-induced CD44 and OPN expression. This suggests that ADAM17 knockdown partially reduces calcium oxalate crystal adhesion by suppressing CD44 and OPN expression. Although this study reveals the role of ADAM17 in oxalate-induced cellular damage, it has several limitations. First, although the HK-2 cell model provides valuable experimental data, it does not fully replicate the complex pathological conditions involved in kidney stone formation in humans. Second, the concentration and duration of the oxalate treatment used in this study may not have accurately reflected the physiological environment of patients with kidney stones. Future studies should optimize the experimental designs to explore more clinically relevant treatment protocols. 6. Conclusion Our results suggested that oxalate induces renal tubular epithelial cell damage by generating ROS, leading to apoptosis and phosphatidylserine externalization. Oxalate activates the Notch1 signaling pathway, promoting apoptosis and PS externalization, which are mediated by the cleavage of ADAM17. Notably, oxalate-induced cell injury increases the expression of adhesion molecules, such as CD44 and OPN, which further facilitates the attachment of calcium oxalate crystals to the renal epithelium. In contrast, inhibiting ROS production or silencing ADAM17 effectively reduces the expression of these adhesion molecules, suggesting a potential therapeutic approach to mitigate kidney stone formation. In summary, our research explored the damaging effects of high concentrations of oxalate on renal tubular epithelial cells and revealed potential mechanisms involving ROS, ADAM17, and the Notch1 signaling pathway in calcium oxalate stone formation. Our findings provide new theoretical insights into the role of oxalate in kidney stone formation and suggest potential therapeutic strategies to mitigate this process. Declarations Author contributions Ma, Yan:Validation,Investigation,Data Analysis,Writing,Original Draft ; Bi,Zhengyu:Combined Pictures; Yang,Feihong:Investigation; Gan, Xiuguo:Conceptualization,Methodology,Resources,Writing,Review & Editing; Com p eting interests The authors declare that there are no financial or non-financial conflicts of interest that could influence the interpretation or presentation of the results in this study. Data Availability Statement The data supporting the findings of this study are available within the paper and its Supplementary Information files. Funding This study was supported by the Natural Science Foundation of Heilongjiang Province(Grant no.LH2022H036). References Wang, Z., Zhang, Y., Zhang, J., Deng, Q. & Liang, H. Recent advances on the mechanisms of kidney stone formation (Review). Int. J. Mol. Med. 48 , 149 (2021). Ming, S. et al. Oxalate-induced apoptosis through ERS-ROS-NF-κB signalling pathway in renal tubular epithelial cell. Mol. Med. 28 , 88 (2022). Ye, Q. L. et al. Sirt1 inhibits kidney stones formation by attenuating calcium oxalate-induced cell injury. Chem. Biol. Interact. 347 , 109605 (2021). Qin, B. et al. Losartan Ameliorates calcium oxalate-induced elevation of stone-related proteins in renal tubular cells by inhibiting NADPH oxidase and oxidative stress. Oxid Med Cell Longev. 2018:1271864. (2018). Deng, J. W. et al. Mechanism of porphyra yezoensis polysaccharides in inhibiting hyperoxalate-induced renal injury and crystal deposition. J. Agric. Food Chem. 72 (12), 6372–6388 (2024). Heng, B. L., Wu, F. Y., Tong, X. Y., Zou, G. J. & Ouyang, J. M. Corn silk polysaccharide reduces the risk of kidney stone formation by reducing oxidative stress and inhibiting COM crystal adhesion and aggregation. ACS Omega . 9 , 19236–19249 (2024). Lu, H. et al. Rosiglitazone suppresses renal crystal deposition by ameliorating tubular injury resulted from oxidative stress and inflammatory response via promoting the Nrf2/HO-1 pathway and shifting macrophage polarization. Oxid Med Cell Longev. 2021:5527137. (2021). Yu, S. L. et al. Oxalate impairs aminophospholipid translocase activity in renal epithelial cells via oxidative stress: implications for calcium oxalate urolithiasis. J. Urol. 186 , 1114–1120 (2011). Moreno-Càceres, J. et al. Caveolin-1-dependent activation of the metalloprotease TACE/ADAM17 by TGF-β in hepatocytes requires activation of Src and the NADPH oxidase NOX1. FEBS J. 283 , 1300–1310 (2016). Zeng, S. Y. et al. Upregulation of Nox4 promotes angiotensin II-induced epidermal growth factor receptor activation and subsequent cardiac hypertrophy by increasing ADAM17 expression. Can. J. Cardiol. 29 , 1310–1319 (2013). Li, T. M. et al. The interferon-rich skin environment regulates Langerhans cell ADAM17 to promote photosensitivity in lupus. Elife 13 , e85914 (2024). Jiang, N. et al. Inhibition of ADAM17 attenuates high glucose-induced angiogenesis and inflammation in endothelial cells partly through down-regulation of GRO-α/CXCR2 expression: implications in peritoneal dialysis. Clin. Exp. Nephrol. 28 , 1232–1240 (2024). Kefaloyianni, E. et al. ADAM17 substrate release in proximal tubule drives kidney fibrosis. JCI Insight . 1 , e87023 (2016). Perna, A. F. et al. ADAM17, a new player in the pathogenesis of chronic kidney disease-mineral and bone disorder. J. Ren. Nutr. 27 , 453–457 (2017). Tang, J. et al. Neutrophil and macrophage cell surface colony-stimulating factor 1 shed by ADAM17 drives mouse macrophage proliferation in acute and chronic inflammation. Mol. Cell. Biol. 38 , e00103–e00118 (2018). Zhong, W. et al. ASH2L-mediated H3K4me3 drives diabetic nephropathy through HIPK2 and Notch1 pathway. Transl Res. 264 , 85–96 (2024). Liu, Y. et al. Telmisartan inhibits oxalate and calcium oxalate crystal-induced epithelial-mesenchymal transformation via PPAR-γ-AKT/STAT3/p38 MAPK-Snail pathway. Life Sci. 241 , 117108 (2020). Zhu, Q. Q. et al. EGCG targeting Notch to attenuate renal fibrosis via inhibition of TGFβ/Smad3 signaling pathway activation in streptozotocin-induced diabetic mice. Food Funct. 11 , 9686–9695 (2020). Marquez-Exposito, L. et al. Deletion of delta-like 1 homologue accelerates renal inflammation by modulating the Th17 immune response. FASEB J. 35 , e21213 (2021). Song, B. F. et al. Overexpression of sirtuin 1 attenuates calcium oxalate-induced kidney injury by promoting macrophage polarization. Int. Immunopharmacol. 121 , 110398 (2023). Alabi, R. O., Lora, J., Celen, A. B., Maretzky, T. & Blobel, C. P. Analysis of the conditions that affect the selective processing of endogenous notch1 by ADAM10 and ADAM17. Int. J. Mol. Sci. 22 , 1846 (2021). Li, D., Xu, D., Zhang, Y., Chen, P. & Xie, J. Effect of Notch1 signaling on cellular proliferation and apoptosis in human laryngeal carcinoma. World J. Surg. Oncol. 20 , 262 (2022). Soni, H., Matthews, A. T., Pallikkuth, S., Gangaraju, R. & Adebiyi, A. γ-secretase inhibitor DAPT mitigates cisplatin-induced acute kidney injury by suppressing Notch1 signaling. J. Cell. Mol. Med. 23 (1), 260–270 (2019). Ishifune, C. et al. Regulation of membrane phospholipid asymmetry by Notch-mediated flippase expression controls the number of intraepithelial TCRαβ + CD8αα + T cells. PLoS Biol. 17 , e3000262 (2019). Liang, H. et al. Based on network pharmacology, the mechanism of Dioscin in alleviating renal tubular epithelial cell injury induced by calcium oxalate crystals was explored. Urolithiasis 53 , 3 (2024). Gan, X. G., Xu, H. T. & Wang, Z. H. Phosphatidylserine eversion regulated by phospholipid scramblase activated by TGF-β1/Smad signaling in the early stage of kidney stone formation. Urolithiasis 50 , 11–20 (2022). Albert, A., Paul, E., Rajakumar, S. & Saso, L. Oxidative stress and endoplasmic stress in calcium oxalate stone disease: the chicken or the egg. Free Radic Res. 54 , 244–253 (2020). Chaiyarit, S. & Thongboonkerd, V. Mitochondrial dysfunction and kidney stone disease. Front. Physiol. 11 , 566506 (2020). Cao, W., Zhang, J., Yu, S., Gan, X. & An, R. N-acetylcysteine regulates oxalate induced injury of renal tubular epithelial cells through CDKN2B/TGF-β/SMAD axis. Urolithiasis 52 , 46 (2024). Gao, M. et al. Inhibitory effect of Incarvillea diffusa Royle extract in the formation of calcium oxalate nephrolithiasis by regulating ROS-induced Nrf2/HO-1 pathway in rats. J. Ethnopharmacol. 325 , 117619 (2024). Kaneko, T. et al. Regulation of osteoarthritis development by ADAM17/Tace in articular cartilage. J. Bone Min. Metab. 40 , 196–207 (2022). Saad, M. I. et al. Blockade of the protease ADAM17 ameliorates experimental pancreatitis. Proc. Natl. Acad. Sci. U S A . 119 , e2213744119 (2022). Sisto, M. & Lisi, S. Updates on inflammatory molecular pathways mediated by ADAM17 in autoimmunity. Cells 13 , 2092 (2024). Düsterhöft, S., Lokau, J. & Garbers, C. The metalloprotease ADAM17 in inflammation and cancer. Pathol. Res. Pract. 215 , 152410 (2019). Meyer-Schwesinger, C., Seipold, L. & Saftig, P. Ectodomain shedding by ADAM proteases as a central regulator in kidney physiology and disease. Biochim. Biophys. Acta Mol. Cell. Res. 1869 , 119165 (2022). Wang, B., He, G., Xu, G., Wen, J. & Yu, X. miRNA-34a inhibits cell adhesion by targeting CD44 in human renal epithelial cells: implications for renal stone disease. Urolithiasis 48 , 109–116 (2020). Yang, X. et al. Metformin prevents nephrolithiasis formation by inhibiting the expression of OPN and MCP-1 in vitro and in vivo. Int. J. Mol. Med. 43 , 1611–1622 (2019). Gan, Q. Z., Sun, X. Y. & Ouyang, J. M. Adhesion and internalization differences of COM nanocrystals on Vero cells before and after cell damage. Mater. Sci. Eng. C Mater. Biol. Appl. 59 , 286–295 (2016). Additional Declarations No competing interests reported. Supplementary Files wbrawfigure.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 14 May, 2026 Reviewers agreed at journal 25 Apr, 2026 Reviewers invited by journal 23 Apr, 2026 Editor assigned by journal 16 Apr, 2026 Editor invited by journal 14 Apr, 2026 Submission checks completed at journal 10 Apr, 2026 First submitted to journal 10 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9282701","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":633598298,"identity":"0d7cd4d0-4090-47e3-9549-104f089b894c","order_by":0,"name":"Yan Ma","email":"","orcid":"","institution":"The First Affiliated Hospital of Harbin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Ma","suffix":""},{"id":633598299,"identity":"a4a71aeb-254c-4ade-8a4e-3ca68f2e9699","order_by":1,"name":"Zhenyu Bi","email":"","orcid":"","institution":"The First Affiliated Hospital of Harbin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhenyu","middleName":"","lastName":"Bi","suffix":""},{"id":633598300,"identity":"48e629c9-9bc4-477d-b6b4-da7a7c948add","order_by":2,"name":"Feihong Yang","email":"","orcid":"","institution":"The First Affiliated Hospital of Harbin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Feihong","middleName":"","lastName":"Yang","suffix":""},{"id":633598301,"identity":"26a39d98-4c09-4be5-8714-156418ba1738","order_by":3,"name":"Xiuguo Gan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtUlEQVRIiWNgGAWjYLCCBBDB3kCyFp4DJFslkUCkQnn3s8ckHrbVJvZLPt54g6HGJpqgFsMzeckGiW3HE2fOTiu2YDiWlttAUEtDjuGDxLZjiRtu55hJMDYcJkJL/xuDA2AtN88QqUVeAmxLTeKGGzxEajGQeGNskHDugPHMHqBfEojxi3x/jpnkj7I62X72wxtvfKixIcKWA2DqMMTGBELKwbZADK2DaCFGxygYBaNgFIw8AAC9cUI/4qjP8QAAAABJRU5ErkJggg==","orcid":"","institution":"The First Affiliated Hospital of Harbin Medical University","correspondingAuthor":true,"prefix":"","firstName":"Xiuguo","middleName":"","lastName":"Gan","suffix":""}],"badges":[],"createdAt":"2026-03-31 16:39:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9282701/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9282701/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":108401869,"identity":"fc673bb9-eecd-4069-9037-4557d5fd8e34","added_by":"auto","created_at":"2026-05-04 09:07:27","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":107245,"visible":true,"origin":"","legend":"\u003cp\u003ePBN pretreatment alleviated oxalate-induced ROS production. After treatment of HK-2 cells according to the respective groups, cells were collected for subsequent experiments. (A) DCFH-DA (10 μM) staining of HK-2 cells enabled quantification of cellular ROS levels via mean fluorescence intensity. Magnification: 100×. The fluorescence intensity was used to indirectly reflect the cellular ROS levels. *P\u0026lt;0.05, **P\u0026lt;0.01\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-9282701/v1/aaef91a487376eb36316b038.png"},{"id":109067644,"identity":"1126b16e-b046-400f-b9ee-039f7c958324","added_by":"auto","created_at":"2026-05-12 09:58:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":182645,"visible":true,"origin":"","legend":"\u003cp\u003eInhibition of ROS production alleviates oxalate-induced cell apoptosis and PS externalization. After treating HK-2 cells according to the respective groups, the cells were collected for subsequent experiments. (A) The expression of Bax and Bcl-2 were measured by Western blot. (B) Annexin V-PI double staining experiment and flow cytometry were utilized to evaluate cellular apoptosis and phosphatidylserine externalization metrics. *P\u0026lt;0.05, **P\u0026lt;0.01, ****P\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-9282701/v1/3e2562ff77d539d68ee6e1ec.png"},{"id":108401872,"identity":"1199fcf9-c542-4890-b92e-6c21d9b5f335","added_by":"auto","created_at":"2026-05-04 09:07:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":8096546,"visible":true,"origin":"","legend":"\u003cp\u003eInhibition of ROS generation reduces oxalate-induced crystal-cell adhesion and the expression level of adhesion molecules. According to the groupings, cells were collected for subsequent experiments.(A) Crystal-cell adhesion was observed under a light microscope to evaluate COM adhesion. The crystal-cell adhesion ability was quantified by measuring the concentration of Ca²⁺ in the supernatant using a calcium ion detection kit. (B) Western blot analysis was conducted to determine the expression levels of CD44 and OPN, which are proteins associated with cell adhesion. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-9282701/v1/d5e28f7d3c501ec8e8be1d9e.png"},{"id":108492837,"identity":"6b1dd5ff-333b-4aed-9380-f1c419beff91","added_by":"auto","created_at":"2026-05-05 09:58:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":168349,"visible":true,"origin":"","legend":"\u003cp\u003eOxalate increases ADAM17 expression and activates the Notch1 signaling pathway through ROS mediation. After treating HK-2 cells according to the experimental groups, cells were collected for subsequent experiments. \u003cstrong\u003e(A)\u003c/strong\u003e Western blot was employed to examine ADAM17 as well as the Notch1 signaling pathway. \u003cstrong\u003e(B)\u003c/strong\u003e We employed qPCR to determine the mRNA expression levels of ADAM17 and other genes associated with the Notch1 pathway. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9282701/v1/e32320ecee0103cac7844dc2.png"},{"id":108492507,"identity":"69d35239-f8f8-4d9a-ae0d-2c724d334822","added_by":"auto","created_at":"2026-05-05 09:57:57","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":138658,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSuccessful knockdown of ADAM17 in HK-2. F\u003c/strong\u003eor the purpose of knocking down ADAM17 expression, we transfected si-ADAM17 in HK-2. The transfection efficiency was validated 72 h post-transfection. (A) We used western blot to assess the efficiency of knockdown. The loading control was β-actin. ***P\u0026lt;0.001\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-9282701/v1/cd6f30539af663b3cd49e656.png"},{"id":108401874,"identity":"643877d8-f5f5-40d5-866e-7945f6925b42","added_by":"auto","created_at":"2026-05-04 09:07:27","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":239215,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eADAM17 knockdown mitigates oxalate-induced cell apoptosis and PS externalization.\u003c/strong\u003e After transfection, the cells were grouped and processed for subsequent experiments. (A) Annexin V-PI double staining combined with flow cytometry was employed to examine cell apoptosis and the levels of PS externalization. (B) Levels of BAX and Bcl2 proteins, which are related to cell apoptosis, were measured using Western blot assays to determine their expression. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-9282701/v1/60aa29eddf80ec12a0952093.png"},{"id":108493445,"identity":"74309c79-48ea-4dcf-928d-2c193c5049c4","added_by":"auto","created_at":"2026-05-05 10:00:24","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":462166,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eADAM17 knockdown alleviates oxalate-induced crystal-cell adhesion and expression of adhesion-related proteins. \u003c/strong\u003e(A) Crystal-cell adhesion was observed under a light microscope, and the level of crystal-cell adhesion was quantified by measuring the Ca²⁺ concentration in the supernatant using a calcium ion detection kit. (B) The expression levels of CD44 and OPN proteins, which take part in cell adhesion processes, were investigated via Western blot analysis. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-9282701/v1/9ca97407c77ee921adb79579.png"},{"id":108401876,"identity":"6f9b516a-382c-43ad-9948-9bc0214aed2b","added_by":"auto","created_at":"2026-05-04 09:07:28","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":152754,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of ADAM17 inhibited oxalic acid-induced activation of the Notch1 signaling pathway. Si-nc and si-ADAM17 were respectively transfected in HK-2 cells, Then the cells were treated with oxalic acid for a 24-hour period. Subsequently, western blot analysis was employed to determine the expression levels of ADAM17, NICD, and Hes1 in the cells individually. \u0026nbsp;\u003c/strong\u003e**P\u0026lt;0.01, ***P\u0026lt;0.001\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-9282701/v1/b1186d260f978b43bacd40c3.png"},{"id":109069241,"identity":"7bf681a6-c593-4c4d-9d7c-8a4b48a7c6de","added_by":"auto","created_at":"2026-05-12 10:21:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":12421200,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9282701/v1/c68f0084-0666-4ff4-9a7e-7ee869a444c7.pdf"},{"id":108493134,"identity":"9a5e0e01-a57b-4a1b-bbdb-d1e9820c7976","added_by":"auto","created_at":"2026-05-05 09:59:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":3166122,"visible":true,"origin":"","legend":"","description":"","filename":"wbrawfigure.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9282701/v1/59e74f23294705359706ca9e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Oxalate induces phosphatidylserine externalization, apoptosis, and crystal-cell adhesion in renal tubular epithelial cells through the ROS-ADAM17-Notch1 axis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eKidney stones, a widespread and highly prevalent urinary system disease, have a global incidence ranging from 1% to 15%\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. The high incidence and recurrence of this disease pose major health and economic risks. The vast majority of kidney stones are calcium oxalate stones\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e, yet their pathogenesis remains unclear. Therefore, in order to prevent kidney stones, investigating the pathological mechanisms behind the development of calcium oxalate renal stones holds significant importance..\u003c/p\u003e \u003cp\u003eA crucial element in the formation of calcium oxalate kidney stones involves the attachment of these crystals to renal tubular epithelial cell surfaces\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. Oxalate exposure compromises renal tubule cells, impairing structure and activity, and fostering crystal accumulation\u003csup\u003e[\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. When renal tubule cells are exposed to oxalate, oxidative stress is triggered, which is marked by the overproduction of ROS. This surge causes cellular damage, functional impairment, and apoptosis\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. During apoptosis, PS redistributes to the outer membrane leaflet from its physiological inner localization, thereby exposing the negatively charged regions. Early studies indicated oxalate exposure triggers the generation of ROS, leading to the outward translocation of phosphatidylserine in renal tubular epithelial cells. The exposure of phosphatidylserine on the cell surface facilitates crystal adhesion, which in turn accelerates the progression of kidney stone formation\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. However, the intrinsic mechanism of action is fuzzy.\u003c/p\u003e \u003cp\u003eNumerous previous researches have indicated that ROS promotes the expression and activation of a disintegrin and metalloproteinase 17(ADAM17) in cell models of various diseases\u003csup\u003e[\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. ADAM17 is a protein pivotal in the development and release of various receptors\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. It can activate TNF-α(Tumor Necrosis Factor-α) and EGFR(Epidermal growth factor receptor) ligands, promoting renal inflammation and fibrosis. Renal fibrosis leads to acute and chronic kidney injury\u003csup\u003e[\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e, which is the pathologic basis of kidney stone\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAdditionally, in a diabetic nephropathy cell injury model, Zhong et al. found that the promotion of ADAM17 transcription leads to unusual activation of the Notch1 signaling pathway\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. This signaling pathway, being a crucial means of intercellular communication, is pivotal in the processes of cell growth and programmed cell death. It's especially key in sustaining the regular operation of renal tubular epithelial cells. In adult kidney tissues, the Notch pathway is expressed at low levels, however, it becomes activated in a variety of kidney diseases\u003csup\u003e[\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Upon activation, Notch1 binds to its ligand and is cleaved by ADAM17\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Subsequently, at the S3 site, the intracellular domain of Notch1 (NICD) is released into the nucleus, leading to the transcription of target genes involved in biological processes such as apoptosis\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. One study reported that inhibiting the activation of Notch1 signaling through γ-secretase can reduce cell apoptosis by lowering the protein Bax and increasing Bcl-2, thereby offering protective effects against kidney injury\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Notch also regulates membrane phospholipid asymmetry through Atp8a2, which modulates the flipping of PS onto the cell membrane\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Therefore, we proposed that Notch1 pathway activation contributes to oxalate-induced apoptosis and phosphatidylserine externalization in HK-2 cells. PS flipping on the cell membrane and apoptosis are important pathological processes in oxalate-induced renal tubule epithelial cell stone formation\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn the scope of this investigation, building upon our past work, we aimed to determine if high oxalate concentrations cause renal tubular epithelial cells to produce ROS. They then kick off the ADAM17-Notch1 signaling cascade, facilitating cell apoptosis, PS externalization, and crystal-cell adhesion. Our study aimed to investigate the cause of ROS-triggered PS externalization in HK2 cells and shed light on the mechanism that drives the development of calcium oxalate renal stones.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Cell culture\u003c/h2\u003e \u003cp\u003eHK-2 cells were from Cellverse (Shanghai, China). Cells were cultured in DMEM/F12 medium (Seven, China) supplemented with 1% penicillin-streptomycin (Beyotime, China) and 10% fetal bovine serum (BI, Israel), and incubated at 37℃ in an atmosphere containing 5% CO₂. After the cells had been passaged 3 times, we performed cell processing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Cell grouping and treatment\u003c/h2\u003e \u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e2.2.1. Three groups were established: control, OX, and PBN\u0026thinsp;+\u0026thinsp;OX. We treated the control group with complete culture medium. We treated the OX group with 1 mM sodium oxalate (Yuanye Bio, Shanghai, China) for 24 h. Lastly, cells in the PBN\u0026thinsp;+\u0026thinsp;OX group were pretreated with 4 mM PBN (N-tert-Butyl-α-phenylnitrone, MCE, USA) for 2 h, followed by 1 mM sodium oxalate treatment for 24 h.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e2.2.2. Three groups were established: si-NC, si-NC\u0026thinsp;+\u0026thinsp;OX, si-ADAM17, and si-ADAM17\u0026thinsp;+\u0026thinsp;OX. We treated the si-NC and si-ADAM17 with complete culture medium. We treated si-NC\u0026thinsp;+\u0026thinsp;OX and si-ADAM17\u0026thinsp;+\u0026thinsp;OX groups with 1 mM sodium oxalate for 24 h.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Cell transfection\u003c/h2\u003e \u003cp\u003eSiRNAs suppress ADAM17 expression. SevenBio helped us design siRNA targeting ADAM17 (si-ADAM17#1 and si-ADAM17#2) and negative control (si-NC). At approximately 80% confluence of cells within 6-well plates, siRNA transfection was carried out using Lipofectamine3000 (Invitrogen) in accordance with the supplier's instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Detection of intracellular ROS\u003c/h2\u003e \u003cp\u003eAfter each group of cells has been processed, discard the spent medium in the six-well plates. After washing with phosphate buffered saline (PBS), serum-free medium containing DCFH-DA solution (10 \u0026micro;M, HY-D0940, MCE, USA) was added. Then, thorough mixing, the plates were placed in the incubator at 37\u0026deg;C for 30 min, followed by three washes with medium to wash out residual DCFH-DA. Cells were visualized and imaged using a fluorescence microscope (Zeiss, Germany), and the mean fluorescence intensity was assessed with ImageJ software to gauge the ROS concentrations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. qRT-PCR\u003c/h2\u003e \u003cp\u003eWe used a cDNA synthesis kit (SM134, SevenBio, China) to reverse transcribe total RNA extracted from HK-2 cells into cDNA. Real-time quantitative PCR was performed using 2\u0026times; SYBR Green qPCR Master Mix II (SM143, SevenBio, China) on a real-time fluorescence quantitative PCR analyzer (FQD-96C, Bioer Technology, China), strictly following manufacturer protocols. The results were normalized using β-actin mRNA as the internal reference for qRT-PCR. The ΔCt value was calculated as ΔCt\u0026thinsp;=\u0026thinsp;Ct (target gene) - Ct (β-actin). A higher ΔCt value indicates a lower expression level of the target gene. The relative expression levels of the genes were represented in the form of 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e. The following primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were used.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eprimers.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNotch1-F\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTGAACTGCTCTGAGGAGATC\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNotch1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGATTGCAGTCGTCCACGTTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNICD-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAGTTGT-GCTCCTGAAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNICD-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGGCG-GCCAGAAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHes1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAAATGACAGTGAAGCACCTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHes1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAAGCGGGTCACCTCGTTCATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADAM17-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACAGCGACTGCACGTTGAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADAM17-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTGCAGTAGGACACGCCTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ- actin-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTC-CATCCTGGCCTCGCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ- actin-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCT-GTCACCTTCACCGTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Western blot\u003c/h2\u003e \u003cp\u003eAfter treatment, the cells in each well of the six-well plate were ruptured using RIPA lysis buffer for protein extraction. Following SDS-PAGE separation, protein samples were electroblotted onto PVDF membranes (Merck, Germany). Following 2-hour blocking in 5% non-fat dry milk at RT (20\u0026ndash;25\u0026deg;C), membranes were incubated with primary antibodies diluted in TBST.:\u003c/p\u003e \u003cp\u003eADAM17 (1:500, WL04487, WanleiBio, China), Notch1 (1:1,000, CY5244, Abways, China), NICD (1:1,000, YP-Ab-12892, UpingBio, China), Hes1 (1:500, YP-Ab-07080, UpingBio, China), Bcl2 (1:500, WL01556, WanleiBio, China), Bax (1:2000, 50599-2-Ig, Proteintech, China), CD44 (Leukocyte differentiation antigen 44,1:2000, PTM-6106, PTM Bio, China), OPN (Osteopontin, 1:1000, WL00691, WanleiBio, China). The membranes were exposed to primary antibodies at 4\u0026deg;C for 16\u0026ndash;18 hours, followed by triple TBST washes (10 min/wash). They were then exposed to a secondary antibody (1:10,000, SA00001-2/SA00001-1, Proteintech, China) at 25\u0026deg;C for 2 h. Proteins were detected using an ECL Chemiluminescent Substrate Kit (34580, Thermo Scientific, USA) and exposed to X-ray film. Finally, protein band quantification was performed using ImageJ, with relative expression levels normalized to β-actin loading controls.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Flow cytometry detection of cell apoptosis and PS externalization rate\u003c/h2\u003e \u003cp\u003eAnnexin V-FITC can bind to phosphatidylserine (PS), which is externalized during apoptosis, whereas propidium iodide (PI) can permeate the membranes of late apoptotic and necrotic cells. Therefore, Annexin V-FITC/PI double staining (SC123, SevenBio, China) was used to detect PS externalization and differentiate between apoptosis and necrosis. In accordance with the manufacturer\u0026rsquo;s instructions, the cells were rinsed twice using PBS and then digested with trypsin (SevenBio, China) that contained no EDTA. Following centrifugation, cells were resuspended in kit-supplied buffer, followed by addition of 5 \u0026micro;l Annexin V-FITC and 5 \u0026micro;l propidium iodide (PI) per tube with subsequent gentle mixing. Following 10-min incubation at 20\u0026ndash;25\u0026deg;C, stained cells were analyzed on a BD FACScan flow cytometer. The results were analyzed using FlowJo_v10.8.1 software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Cell crystal adhesion assay\u003c/h2\u003e \u003cp\u003eAfter treatment, cells from each group were collected and seeded into 6-well plates at a density of 1\u0026times;10⁶ cells per well in serum-free medium. After 3\u0026ndash;4 h incubation for complete adhesion, the medium was replaced with serum-free medium containing COM powder (100 \u0026micro;g/mL; HY-Y0262D, MCE, USA). Cells were exposed to COM powder at 37℃ for 30 min. Post-incubation, they were rinsed three times with Hank's balanced salt solution (5 min/wash) to eliminate calcium oxalate crystals that had not adhered. Crystal-cell adhesion was documented via phase-contrast microscopy. Subsequently, bound crystals were dissolved with 10% HCl (2 mL/well), and lysate Ca\u0026sup2;⁺ concentrations were quantified using a calcium assay kit (Beyotime, China) per manufacturer's protocol. The level of crystal cell adhesion was calculated as follows:\u003c/p\u003e \u003cp\u003eCrystal cell adhesion ability\u0026thinsp;=\u0026thinsp;Calcium ion concentration in the treatment group - Calcium ion concentration in the corresponding treatment group without COM crystal powder.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Statistical analysis","content":"\u003cp\u003eEach experiment was conducted three times, and the resulting data were processed using GraphPad Prism 10.1.2 software. Outcomes are expressed as the mean\u0026plusmn;standard error of the mean (SEM). For comparisons between two separate groups, Student\u0026rsquo;s t-tests were applied, while a one-way analysis of variance (ANOVA) was utilized to analyze differences across multiple groups.Statistical significance was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e"},{"header":"4. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e4.1. PBN pretreatment alleviated oxalate-induced ROS generation\u003c/h2\u003e \u003cp\u003ePBN (N-tert-Butyl-α-phenylnitrone) was employed to assess ROS involvement in oxalate-triggered PS externalization, crystal adhesion and apoptosis. Relative to controls, OX group exhibited markedly elevated ROS levels. PBN pretreatment substantially attenuated oxalate-induced oxidative stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e4.2. Inhibition of ROS production alleviated oxalate-induced cell apoptosis and PS externalization\u003c/h2\u003e \u003cp\u003eWe assessed the pro-apoptotic effects of oxalate on HK-2 cells. Flow cytometric analysis demonstrated significantly elevated apoptotic rates and phosphatidylserine exposure in oxalate-exposed HK-2 cells (OX group) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Bcl-2 and Bax, which are key apoptotic proteins, showed significant changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). However, PBN pretreatment significantly reduced the oxalate-induced apoptosis and PS externalization.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e4.3. Inhibition of ROS production reduces oxalate-induced crystal-cell adhesion and related adhesion molecule expression\u003c/h2\u003e \u003cp\u003eThe ability of cells to adhere to crystals was assessed using a crystal-cell adhesion assay and the expression of OPN and CD44 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). HK-2 cells treated with high oxalate concentrations exhibited an increased expression of adhesion molecules, and COM crystals adhered more to the cell surface. However, PBN pretreatment markedly attenuated HK-2 cell adhesion capacity to COM crystals. (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e4.4. Oxalate increases ADAM17 expression through ROS-mediated activation of the Notch1 signaling pathway\u003c/h2\u003e \u003cp\u003eStudies have shown that oxidative stress promotes ADAM expression of ADAM17. Consequently, we supposed that high-concentration oxalate treatment of HK-2 would increase ADAM17 expression mediated by oxidative stress. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, western blot and qPCR demonstrated that oxalate treatment significantly elevated the levels of ADAM17, Notch1, NICD, and Hes1 in HK-2 cells. Moreover, ROS partially suppressed ADAM17 expression and Notch1 pathway activation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e4.5. ADAM17 knockdown alleviates oxalate-induced cell apoptosis, PS externalization, and crystal-cell adhesion\u003c/h2\u003e \u003cp\u003eNext, we investigated whether silencing ADAM17 could improve oxalate-induced crystal cell adhesion and cell apoptosis using siRNA to knockdown ADAM17 expression. Then we confirmed the knockdown efficiency by western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In the crystal cell adhesion experiment, the adhesion of COM crystals to the surface of HK-2 cells was significantly diminished following the silencing of ADAM17 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). Flow cytometry analysis revealed that the knockdown of ADAM17 reversed oxalate-induced apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). At the protein level, the si-ADAM17\u0026thinsp;+\u0026thinsp;OX group exhibited a significant reduction in the pro-apoptotic protein Bax compared with the si-nc\u0026thinsp;+\u0026thinsp;OX group. Contrarily, the level of Bcl-2, an anti-apoptotic protein, was notably increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Knockdown of ADAM17 also inhibited oxalate-induced elevation of OPN and CD44 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). These results suggest that ADAM17 knockdown not only inhibits oxalate-induced crystal cell adhesion but also attenuates cell damage by modulating apoptosis-related proteins.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e4.6. ADAM17 knockdown partially inhibits the activation of the Notch1 pathway induced by oxalate\u003c/h2\u003e \u003cp\u003eTo clarify the role of ADAM17 knockdown on the regulation of Notch1 signaling pathway activity under oxalic acid stress, our research further measured the expression changes of the key signaling molecule NICD and its downstream target gene Hes1. HK-2 cells that had been transfected with si-NC or si-ADAM17 were subjected to treatment with 1 mM sodium oxalate, and western blot was utilized to analyze the protein expression levels of NICD and Hes1. As shown in the results (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), when compared with the si-nc\u0026thinsp;+\u0026thinsp;OX group, the expression levels of both NICD and Hes1 in the si-ADAM17\u0026thinsp;+\u0026thinsp;OX group were importantly decreased (*p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), suggesting that ADAM17 knockdown effectively inhibited the activation of Notch1 signaling pathway triggered by oxalate stimulation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"5. Discussion","content":"\u003cp\u003eCrystal-cell adhesion plays a critical role in kidney stone formation. Although the mechanisms underlying crystal cell adhesion remain unclear, growing evidence suggests that high concentrations of oxalate induce oxidative stress in renal tubular epithelial cells, generating amounts of ROS, damaging epithelial cells, and subsequently promoting stone formation\u003csup\u003e[\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e.Antioxidants are capable of reducing harm to renal tubular epithelial cells, and they can also decrease the adhesion and accumulation of these crystals\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. Furthermore, our prior study confirmed that oxalate-induced ROS generation leads to PS externalization from renal tubular epithelial cell membranes. The negatively charged phosphatidylserine present on the cell surface functions as an anionic molecule, playing a mediating role in the adhesion of calcium oxalate monohydrate crystals\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. We confirmed that the oxalate treatment of HK-2 significantly increased ROS production, promoted apoptosis and PS externalization, and enhanced the adhesion of crystals.\u003c/p\u003e \u003cp\u003eEmerging evidence highlights that ADAM17 mediates the proteolytic shedding of extracellular domains from diverse cytokines, cell adhesion molecules, receptors, ligands, and enzymes.\u003csup\u003e[\u003cspan additionalcitationids=\"CR32 CR33\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. In the kidney, ADAM17 is significantly elevated in the kidney during acute and chronic kidney injury\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. However, no studies have explored the direct relationship between ADAM17 and oxalate-induced damage to renal tubular epithelial cells. In HK-2 cells exposed to oxalate, the ADAM17 expression showed a marked increase, with this rise being associated with higher ROS concentrations. The level of ADAM17 was markedly reduced using PBN to inhibit ROS production. Additionally, siRNA-mediated ADAM17 knockdown significantly decreased oxalate-induced apoptosis and PS externalization, further reducing calcium oxalate crystal adhesion. These findings suggest that the ROS-mediated upregulation of ADAM17 contributes to oxalate-induced renal tubular epithelial cell damage and COM crystal adhesion.\u003c/p\u003e \u003cp\u003eStudies have demonstrated that inhibiting Notch1 signaling can reduce apoptosis by regulating Bax and Bcl2, thereby exerting protective effects following kidney injury\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. In the present study, an investigation was conducted into the impacts of oxalate on the Notch1 signaling pathway within HK-2 cells. Our results showed that oxalate treatment at high concentrations significantly increased the expression of Notch1, elevated NICD production, and upregulated the mRNA and protein levels of downstream genes such as Hes1. These results indicate that the ROS-driven increase in ADAM17 expression plays a role in renal tubular epithelial cell injury and COM crystal attachment caused by oxalate. Notch1 activation requires cleavage of the S2 site by ADAM17. ADAM17 knockdown inhibited oxalate-induced activation of the Notch1 pathway, thereby reducing phosphatidylserine externalization. Additionally, regulation of Bax and Bcl2 expression suppressed oxalate-induced apoptosis, thereby decreasing the adhesion of COM crystals.\u003c/p\u003e \u003cp\u003ePrior researches have suggested that stimulation with oxalate or COM crystals increases the expression of CD44 and OPN in renal tubular epithelial cells, thereby promoting crystal adhesion and retention\u003csup\u003e[\u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. Similarly, our experiments demonstrated that CD44 and OPN expression increased in HK-2 cells treated with high oxalate concentrations. The antioxidant PBN inhibited oxalate-induced upregulation of CD44 and OPN. Additionally, ADAM17 knockdown significantly reduced oxalate-induced CD44 and OPN expression. This suggests that ADAM17 knockdown partially reduces calcium oxalate crystal adhesion by suppressing CD44 and OPN expression.\u003c/p\u003e \u003cp\u003eAlthough this study reveals the role of ADAM17 in oxalate-induced cellular damage, it has several limitations. First, although the HK-2 cell model provides valuable experimental data, it does not fully replicate the complex pathological conditions involved in kidney stone formation in humans. Second, the concentration and duration of the oxalate treatment used in this study may not have accurately reflected the physiological environment of patients with kidney stones. Future studies should optimize the experimental designs to explore more clinically relevant treatment protocols.\u003c/p\u003e"},{"header":"6. Conclusion","content":"\u003cp\u003eOur results suggested that oxalate induces renal tubular epithelial cell damage by generating ROS, leading to apoptosis and phosphatidylserine externalization. Oxalate activates the Notch1 signaling pathway, promoting apoptosis and PS externalization, which are mediated by the cleavage of ADAM17. Notably, oxalate-induced cell injury increases the expression of adhesion molecules, such as CD44 and OPN, which further facilitates the attachment of calcium oxalate crystals to the renal epithelium. In contrast, inhibiting ROS production or silencing ADAM17 effectively reduces the expression of these adhesion molecules, suggesting a potential therapeutic approach to mitigate kidney stone formation.\u003c/p\u003e \u003cp\u003eIn summary, our research explored the damaging effects of high concentrations of oxalate on renal tubular epithelial cells and revealed potential mechanisms involving ROS, ADAM17, and the Notch1 signaling pathway in calcium oxalate stone formation. Our findings provide new theoretical insights into the role of oxalate in kidney stone formation and suggest potential therapeutic strategies to mitigate this process.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMa, Yan:Validation,Investigation,Data Analysis,Writing,Original Draft\u003c/strong\u003e\u003cstrong\u003e;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBi,Zhengyu:Combined Pictures;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eYang,Feihong:Investigation;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGan, Xiuguo:Conceptualization,Methodology,Resources,Writing,Review \u0026amp; Editing;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCom\u003c/strong\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003cstrong\u003eeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there are no financial or non-financial conflicts of interest that could influence the interpretation or presentation of the results in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data supporting the findings of this study are available within the paper and its Supplementary Information files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Natural Science Foundation of Heilongjiang Province(Grant no.LH2022H036).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWang, Z., Zhang, Y., Zhang, J., Deng, Q. \u0026amp; Liang, H. Recent advances on the mechanisms of kidney stone formation (Review). \u003cem\u003eInt. J. Mol. Med.\u003c/em\u003e \u003cb\u003e48\u003c/b\u003e, 149 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMing, S. et al. Oxalate-induced apoptosis through ERS-ROS-NF-κB signalling pathway in renal tubular epithelial cell. \u003cem\u003eMol. Med.\u003c/em\u003e \u003cb\u003e28\u003c/b\u003e, 88 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe, Q. L. et al. Sirt1 inhibits kidney stones formation by attenuating calcium oxalate-induced cell injury. \u003cem\u003eChem. Biol. Interact.\u003c/em\u003e \u003cb\u003e347\u003c/b\u003e, 109605 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin, B. et al. Losartan Ameliorates calcium oxalate-induced elevation of stone-related proteins in renal tubular cells by inhibiting NADPH oxidase and oxidative stress. Oxid Med Cell Longev. 2018:1271864. (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng, J. W. et al. Mechanism of porphyra yezoensis polysaccharides in inhibiting hyperoxalate-induced renal injury and crystal deposition. \u003cem\u003eJ. Agric. Food Chem.\u003c/em\u003e \u003cb\u003e72\u003c/b\u003e (12), 6372\u0026ndash;6388 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeng, B. L., Wu, F. Y., Tong, X. Y., Zou, G. J. \u0026amp; Ouyang, J. M. Corn silk polysaccharide reduces the risk of kidney stone formation by reducing oxidative stress and inhibiting COM crystal adhesion and aggregation. \u003cem\u003eACS Omega\u003c/em\u003e. \u003cb\u003e9\u003c/b\u003e, 19236\u0026ndash;19249 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu, H. et al. Rosiglitazone suppresses renal crystal deposition by ameliorating tubular injury resulted from oxidative stress and inflammatory response via promoting the Nrf2/HO-1 pathway and shifting macrophage polarization. Oxid Med Cell Longev. 2021:5527137. (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu, S. L. et al. Oxalate impairs aminophospholipid translocase activity in renal epithelial cells via oxidative stress: implications for calcium oxalate urolithiasis. \u003cem\u003eJ. Urol.\u003c/em\u003e \u003cb\u003e186\u003c/b\u003e, 1114\u0026ndash;1120 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoreno-C\u0026agrave;ceres, J. et al. Caveolin-1-dependent activation of the metalloprotease TACE/ADAM17 by TGF-β in hepatocytes requires activation of Src and the NADPH oxidase NOX1. \u003cem\u003eFEBS J.\u003c/em\u003e \u003cb\u003e283\u003c/b\u003e, 1300\u0026ndash;1310 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng, S. Y. et al. Upregulation of Nox4 promotes angiotensin II-induced epidermal growth factor receptor activation and subsequent cardiac hypertrophy by increasing ADAM17 expression. \u003cem\u003eCan. J. Cardiol.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 1310\u0026ndash;1319 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, T. M. et al. The interferon-rich skin environment regulates Langerhans cell ADAM17 to promote photosensitivity in lupus. \u003cem\u003eElife\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, e85914 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang, N. et al. Inhibition of ADAM17 attenuates high glucose-induced angiogenesis and inflammation in endothelial cells partly through down-regulation of GRO-α/CXCR2 expression: implications in peritoneal dialysis. \u003cem\u003eClin. Exp. Nephrol.\u003c/em\u003e \u003cb\u003e28\u003c/b\u003e, 1232\u0026ndash;1240 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKefaloyianni, E. et al. ADAM17 substrate release in proximal tubule drives kidney fibrosis. \u003cem\u003eJCI Insight\u003c/em\u003e. \u003cb\u003e1\u003c/b\u003e, e87023 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerna, A. F. et al. ADAM17, a new player in the pathogenesis of chronic kidney disease-mineral and bone disorder. \u003cem\u003eJ. Ren. Nutr.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e, 453\u0026ndash;457 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang, J. et al. Neutrophil and macrophage cell surface colony-stimulating factor 1 shed by ADAM17 drives mouse macrophage proliferation in acute and chronic inflammation. \u003cem\u003eMol. Cell. Biol.\u003c/em\u003e \u003cb\u003e38\u003c/b\u003e, e00103\u0026ndash;e00118 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhong, W. et al. ASH2L-mediated H3K4me3 drives diabetic nephropathy through HIPK2 and Notch1 pathway. \u003cem\u003eTransl Res.\u003c/em\u003e \u003cb\u003e264\u003c/b\u003e, 85\u0026ndash;96 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, Y. et al. Telmisartan inhibits oxalate and calcium oxalate crystal-induced epithelial-mesenchymal transformation via PPAR-γ-AKT/STAT3/p38 MAPK-Snail pathway. \u003cem\u003eLife Sci.\u003c/em\u003e \u003cb\u003e241\u003c/b\u003e, 117108 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu, Q. Q. et al. EGCG targeting Notch to attenuate renal fibrosis via inhibition of TGFβ/Smad3 signaling pathway activation in streptozotocin-induced diabetic mice. \u003cem\u003eFood Funct.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 9686\u0026ndash;9695 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarquez-Exposito, L. et al. Deletion of delta-like 1 homologue accelerates renal inflammation by modulating the Th17 immune response. \u003cem\u003eFASEB J.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e, e21213 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong, B. F. et al. Overexpression of sirtuin 1 attenuates calcium oxalate-induced kidney injury by promoting macrophage polarization. \u003cem\u003eInt. Immunopharmacol.\u003c/em\u003e \u003cb\u003e121\u003c/b\u003e, 110398 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlabi, R. O., Lora, J., Celen, A. B., Maretzky, T. \u0026amp; Blobel, C. P. Analysis of the conditions that affect the selective processing of endogenous notch1 by ADAM10 and ADAM17. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e, 1846 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, D., Xu, D., Zhang, Y., Chen, P. \u0026amp; Xie, J. Effect of Notch1 signaling on cellular proliferation and apoptosis in human laryngeal carcinoma. \u003cem\u003eWorld J. Surg. Oncol.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e, 262 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoni, H., Matthews, A. T., Pallikkuth, S., Gangaraju, R. \u0026amp; Adebiyi, A. γ-secretase inhibitor DAPT mitigates cisplatin-induced acute kidney injury by suppressing Notch1 signaling. \u003cem\u003eJ. Cell. Mol. Med.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e (1), 260\u0026ndash;270 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshifune, C. et al. Regulation of membrane phospholipid asymmetry by Notch-mediated flippase expression controls the number of intraepithelial TCRαβ\u0026thinsp;+\u0026thinsp;CD8αα\u0026thinsp;+\u0026thinsp;T cells. \u003cem\u003ePLoS Biol.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, e3000262 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang, H. et al. Based on network pharmacology, the mechanism of Dioscin in alleviating renal tubular epithelial cell injury induced by calcium oxalate crystals was explored. \u003cem\u003eUrolithiasis\u003c/em\u003e \u003cb\u003e53\u003c/b\u003e, 3 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGan, X. G., Xu, H. T. \u0026amp; Wang, Z. H. Phosphatidylserine eversion regulated by phospholipid scramblase activated by TGF-β1/Smad signaling in the early stage of kidney stone formation. \u003cem\u003eUrolithiasis\u003c/em\u003e \u003cb\u003e50\u003c/b\u003e, 11\u0026ndash;20 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlbert, A., Paul, E., Rajakumar, S. \u0026amp; Saso, L. Oxidative stress and endoplasmic stress in calcium oxalate stone disease: the chicken or the egg. \u003cem\u003eFree Radic Res.\u003c/em\u003e \u003cb\u003e54\u003c/b\u003e, 244\u0026ndash;253 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaiyarit, S. \u0026amp; Thongboonkerd, V. Mitochondrial dysfunction and kidney stone disease. \u003cem\u003eFront. Physiol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 566506 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao, W., Zhang, J., Yu, S., Gan, X. \u0026amp; An, R. N-acetylcysteine regulates oxalate induced injury of renal tubular epithelial cells through CDKN2B/TGF-β/SMAD axis. \u003cem\u003eUrolithiasis\u003c/em\u003e \u003cb\u003e52\u003c/b\u003e, 46 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao, M. et al. Inhibitory effect of Incarvillea diffusa Royle extract in the formation of calcium oxalate nephrolithiasis by regulating ROS-induced Nrf2/HO-1 pathway in rats. \u003cem\u003eJ. Ethnopharmacol.\u003c/em\u003e \u003cb\u003e325\u003c/b\u003e, 117619 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaneko, T. et al. Regulation of osteoarthritis development by ADAM17/Tace in articular cartilage. \u003cem\u003eJ. Bone Min. Metab.\u003c/em\u003e \u003cb\u003e40\u003c/b\u003e, 196\u0026ndash;207 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaad, M. I. et al. Blockade of the protease ADAM17 ameliorates experimental pancreatitis. \u003cem\u003eProc. Natl. Acad. Sci. U S A\u003c/em\u003e. \u003cb\u003e119\u003c/b\u003e, e2213744119 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSisto, M. \u0026amp; Lisi, S. Updates on inflammatory molecular pathways mediated by ADAM17 in autoimmunity. \u003cem\u003eCells\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 2092 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026uuml;sterh\u0026ouml;ft, S., Lokau, J. \u0026amp; Garbers, C. The metalloprotease ADAM17 in inflammation and cancer. \u003cem\u003ePathol. Res. Pract.\u003c/em\u003e \u003cb\u003e215\u003c/b\u003e, 152410 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeyer-Schwesinger, C., Seipold, L. \u0026amp; Saftig, P. Ectodomain shedding by ADAM proteases as a central regulator in kidney physiology and disease. \u003cem\u003eBiochim. Biophys. Acta Mol. Cell. Res.\u003c/em\u003e \u003cb\u003e1869\u003c/b\u003e, 119165 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, B., He, G., Xu, G., Wen, J. \u0026amp; Yu, X. miRNA-34a inhibits cell adhesion by targeting CD44 in human renal epithelial cells: implications for renal stone disease. \u003cem\u003eUrolithiasis\u003c/em\u003e \u003cb\u003e48\u003c/b\u003e, 109\u0026ndash;116 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, X. et al. Metformin prevents nephrolithiasis formation by inhibiting the expression of OPN and MCP-1 in vitro and in vivo. \u003cem\u003eInt. J. Mol. Med.\u003c/em\u003e \u003cb\u003e43\u003c/b\u003e, 1611\u0026ndash;1622 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGan, Q. Z., Sun, X. Y. \u0026amp; Ouyang, J. M. Adhesion and internalization differences of COM nanocrystals on Vero cells before and after cell damage. \u003cem\u003eMater. Sci. Eng. C Mater. Biol. Appl.\u003c/em\u003e \u003cb\u003e59\u003c/b\u003e, 286\u0026ndash;295 (2016).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"ROS, calcium oxalate, kidney stones, ADAM17, Notch1 signaling pathway, crystal-cell adhesion","lastPublishedDoi":"10.21203/rs.3.rs-9282701/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9282701/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eOxalate salts induce reactive oxygen species (ROS) generation, leading to phosphatidylserine (PS) externalization from renal tubule epithelial cells and the development of kidney stone. This research investigated the roles of ADAM17 (A Disintegrin and Metalloproteinase 17) and the Notch1 signaling pathway in oxalate-induced cell crystal adhesion through ROS-mediated mechanisms.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eWe treated HK-2 with sodium oxalate to establish a model of damage. ROS were measured using DCFH-DA fluorescence, and apoptosis and PS externalization were measured using flow cytometry. QPCR was applied to evaluate the mRNA of ADAM17 and Notch1, while western blot analysis was employed to assess their corresponding protein levels. Crystal adhesion assays were used to assess cell adherence to calcium oxalate crystals. The function of ADAM17 in oxalate-induced injury was examined by siRNA-mediated knockdown.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eExposure to oxalate significantly elevated ROS generation, apoptotic incidence, PS externalization, and crystal adhesion in HK-2 cells. Moreover, oxalate exposure upregulated ADAM17 expression and activated the Notch1 signaling pathway. Antioxidant treatment reduces ADAM17 expression and inhibits Notch1 pathway activation. ADAM17 knockdown partially rescued ROS-induced apoptosis and PS externalization, reduced crystal adhesion, and suppressed Notch1 signaling.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOxalate triggers apoptosis, PS externalization, and crystal cell adhesion in renal tubular epithelial cells through the ROS-ADAM17-Notch1 axis.\u003c/p\u003e","manuscriptTitle":"Oxalate induces phosphatidylserine externalization, apoptosis, and crystal-cell adhesion in renal tubular epithelial cells through the ROS-ADAM17-Notch1 axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-04 09:07:23","doi":"10.21203/rs.3.rs-9282701/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"155439734074986750376970687718703370190","date":"2026-05-14T18:00:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"224018090184295341650548356208995673123","date":"2026-04-25T23:42:34+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-23T11:28:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-16T18:08:33+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-04-14T11:02:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-10T18:31:41+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2026-04-10T16:47:26+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"774542d0-ccbb-477d-bce9-76b4367fb656","owner":[],"postedDate":"May 4th, 2026","published":true,"recentEditorialEvents":[{"type":"reviewerAgreed","content":"155439734074986750376970687718703370190","date":"2026-05-14T18:00:00+00:00","index":142,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":67435926,"name":"Biological sciences/Cell biology"},{"id":67435927,"name":"Health sciences/Diseases"},{"id":67435928,"name":"Biological sciences/Molecular biology"},{"id":67435929,"name":"Health sciences/Nephrology"}],"tags":[],"updatedAt":"2026-05-04T09:07:23+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-04 09:07:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9282701","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9282701","identity":"rs-9282701","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00