Identification of keystone taxa shaping biocrust formation and biodeterioration of limestone monuments in the Xiaoling Tomb of the Ming Dynasty

preprint OA: closed
Full text JSON View at publisher
Full text 118,656 characters · extracted from preprint-html · click to expand
Identification of keystone taxa shaping biocrust formation and biodeterioration of limestone monuments in the Xiaoling Tomb of the Ming Dynasty | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification of keystone taxa shaping biocrust formation and biodeterioration of limestone monuments in the Xiaoling Tomb of the Ming Dynasty Weijia Wang, Xiaofang Huang, Fasi Wu, Xiaobo Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8923180/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract The limestone monuments of the Rectangular Tower in the Xiaoling Tomb of the Ming Dynasty, created in the mid-14th century, are biodeteriorating due to environmental exposure, leading to the formation of black biocrusts. However, the microbiomes shaping biocrust formation and the biodeterioration involved remain unclear, which largely challenges the conservation of stone monuments at this archaeological site. Here, we systematically investigated the physicochemical properties and microbial communities of biocrusts to identify keystone taxa that shape their formation and biodeterioration. Physicochemical analysis showed that biological crusts contribute to substantial calcium loss of the limestone monuments. Microscopy and spectroscopy indicated that microbial interactions with limestone promote the formation of biological crusts. High-throughput sequencing revealed that two photosynthetic bacterial phyla, Cyanobacteria and Chloroflexi, predominated in the biocrusts, suggesting that photosynthesis might be a crucial process involved in biocrust formation. Moreover, fungal communities in the biological crusts mainly consisted of Ascomycota, Basidiomycota, and Chytridiomycota, with archaeal communities purely dominated by Crenarchaeota. Microbial co-occurrence network and correlation analyses identified 12 keystone taxa across 11 genera that shape biocrust formation. Importantly, Scytonema could provide organic carbon and nitrogen fixation for Spirosomaceae , and Cyanobacteriia , Setophaeosphaeria , Agaricomycetes , and Plectosphaerella are likely the keystone taxa responsible for both biocrust formation and the associated biodeterioration. Additionally, two predominant ammonia-oxidizing archaea, Nitrososphaeraceae and Candidatus_ Nitrocosmicus, could support chemolithoautotrophic growth in the microbiome by oxidizing ammonia and fixing carbon dioxide. Together, these findings underscore the need for targeted conservation strategies to mitigate microbial biodeterioration of stone monuments during biocrust formation. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Stone monuments serve as crucial carriers of human civilization and are widely distributed worldwide. They not only embody the outstanding achievements of ancient art and craftsmanship but also stand as tangible witnesses to historical transformations. However, during long-term open-air preservation, these heritage sites are generally subjected to dual damage from biotic and abiotic processes, leading to various forms of deterioration, including cracks, exfoliation, salt crystallization, and microbial colonization. Among these, biodeterioration caused by microbial colonization, growth, and metabolism has become a severe challenge threatening the long-term conservation of stone monuments [ 1 , 2 ]. Constructed in the mid-14th century, the Imperial Xiaoling Mausoleum is a representative example of imperial tombs of the Ming and Qing dynasties and was inscribed on the UNESCO World Heritage List in 2003. As part of the Imperial Xiaoling Mausoleum, the Rectangular Tower has long been exposed to a warm, humid subtropical climate. Its surfaces have developed prominent biological erosion characterized by the formation of black biocrusts [ 3 ]. Such biocrusts not only extensively cover the walls, significantly impairing the heritage's aesthetic appearance, but may also accelerate the dissolution of minerals and structural deterioration, posing a potential threat to the long-term preservation of the site. Biocrusts typically consist of a complex microecosystem formed by various microorganisms—including bacteria, fungi, algae, and archaea—along with mineral particles and extracellular polymeric substances [ 4 , 5 ]. Photoautotrophic organisms, such as algae and cyanobacteria, are key contributors to biocrust formation [ 6 ]. They can colonize outdoor stone monuments with only water present and are often regarded as pioneers of microbial colonization of stone surfaces [ 7 ]. Heterotrophic organisms, in turn, consume the carbon compounds released by photoautotrophs [ 8 ]. During mutual metabolism, microorganisms may secrete acidic substances that corrode building surfaces, while others deposit pigments that lead to discoloration [ 9 , 10 ]. Fungal hyphae can penetrate the brick and stone, causing physical damage. Moreover, the high water-retention capacity of biocrusts reduces evaporation rates, thereby creating a favourable microenvironment for microbial survival and accelerating biodeterioration [ 11 ]. Previous studies have shown that environmental factors significantly influence the microbial community structure of brick- and stone-based heritage. For instance, the bacterial and fungal communities on the surfaces of the Florence Cathedral are affected by temperature and humidity [ 12 ]. The diversity of fungal communities in subterranean tomb murals is influenced by temperature and relative humidity [ 13 ]. However, a systematic understanding of the microbial composition of biocrusts on stone monuments and the key factors shaping biocrust formation remains limited. In particular, the synergistic mechanisms among microorganisms from the three domains of life (bacteria, fungi, and archaea) in biocrust formation and biodeterioration remain poorly understood. Therefore, to gain a more comprehensive and in-depth understanding of the microbiological mechanisms underlying biocrust formation and the biodeterioration of stone monuments, this study focuses on the typical black biocrusts on the limestone walls of the Rectangular Tower in the Imperial Xiaoling Mausoleum. Using high-throughput sequencing, we simultaneously analysed the community structures of bacteria, fungi, and archaea in the biocrusts. By constructing microbial co-occurrence networks and analysing topological attributes and multivariate statistics, we aimed to identify keystone species that play critical roles in biocrust formation and biodeterioration. Furthermore, we seek to elucidate their potential functions in the biodeterioration of stone monuments by correlating these key taxa with physicochemical factors. This research aims to provide a scientific basis for understanding the ecological mechanisms of biocrust-induced deterioration and for developing targeted conservation strategies for stone cultural heritage. 2. Materials and methods 2.1. Sample collection Samples were collected in May 2025 in Nanjing (118°49'22' E, 32°33'51'' N), Jiangsu Province, China. This study employed a non-destructive method to collect the widely distributed black biocrust samples from the limestone wall of the Rectangular Tower in the Xiaoling Tomb of the Ming Dynasty. Specifically, three samples (C1, C2, and C3) were collected from the right corner of the Rectangular Tower, and the other three (C4, C5, and C6) were collected from the left corner (Fig. 1 a). All six samples were used as biological replicates for the study. All samples were packaged and stored at 4°C before subsequent analyses. 2.2. Ion chromatography analysis The biocrust samples were ground into a homogeneous powder using a quartz mortar (Fig. 1 b). Next, 1 g of the powder was added to 7 mL of ultrapure water, mixed for 15 minutes in a vortex mixer, and then extracted in an ultrasonic bath for 10 minutes to obtain a soluble salt solution. Subsequently, the solution was centrifuged at 5000 g for 5 minutes to collect the supernatant, which was then filtered through a 0.22 µm microporous membrane for subsequent determination of anion and cation concentrations. Upon the detection limit of ion chromatography, the initial concentration would be diluted if necessary. Finally, the prepared supernatant was injected into an ion chromatograph to detect anion and cation concentrations. The anion concentration was measured using the Dionex™ Aquion™ ICS 2100 (Thermo Fisher Scientific, USA) system equipped with the column IonPac™ AS19 (4 × 250 mm). The cation concentration was examined using the Dionex™ ICS 6000 (Thermo Fisher Scientific, USA) system with the column IonPacTM CS12A (4×250 mm). The entire detection was carried out at 25°C. 2.3. XRD analysis of biocrusts The collected biocrust samples were dried and ground to approximately 300 mesh using a natural agate mortar. Before testing, the powdered samples were evenly spread on the sample stage and analyzed for phase identification using an X-ray diffractometer (D8 ADVANCE, Bruker, USA). The testing conditions were as follows: tube voltage, 40 kV; tube current, 40 mA; Cu target; scanning range, 5°-120°; step size, 0.0194°; scanning speed, 0.2 °/min; and step-scan mode. The data were analyzed using Jade 9.0 software and the PDF-4-2009 database was referred for compositional identification. 2.4. Microbial activity analysis To evaluate microbial activity of the collected biological crusts, microscopic analysis was conducted using the LIVE/DEAD™ Bac Light™ Bacterial Viability Kits (Thermo Fisher Scientific, USA). Fresh biocrust samples were ground to 400-mesh using a natural agate mortar. A total of 3 mL of sterile physiological saline solution was added to 0.1 g of powder to make a suspension. Following the manufacturer's instructions, components A and B of the dye were mixed uniformly in equal volumes. Then, 3 µL of the dye compounds were thoroughly mixed with 1 mL of the suspension. The final mixture was stained in the dark at room temperature for 15 minutes. Eventually, 1 µL of the stained sample was loaded into a confocal dish and observed using an A1/SIM/STORM confocal microscope (Nikon, Japan). 2.5. Microscopy analysis Before sampling, biocrusts were observed in situ with a portable microscope (3R-MSBTVTY, Anty, China) to obtain an overview of microbial community colonization. For scanning electron microscopy (SEM) analysis, the samples were dehydrated and dried in an oven at 37°C for 1 hour [ 14 ], and the observation surfaces were gold-coated under vacuum conditions. The morphological and structural characteristics of the prepared samples were examined using the Quanta 250 (FEI, USA) scanning electron microscope. 2.6. DNA extraction and sequencing Following the manufacturer's instructions, the DNeasy® PowerSoil® Pro Kit 50 (QIAGEN, Germany) was used to extract genomic DNA. The concentration and purity of DNA extracts were measured using a Thermo Scientific NanoDrop One (Thermo Fisher Scientific, MA, USA). PCR amplification was performed on the V4-V5 regions of the ribosomal gene and the ITS1 region using target-specific primers (bacteria: 515F- GTGCCAGCMGCCGCGGTAA, 907R- CCGTCAATTCMTTTRAGTTT; archaea: Arch519F- CAGCCGCCGCGGTAA, Arch915R- GTGCTCCCCCGCCAATTCCT; and fungi: ITS1F- CTTGGTCATTTAGAGGAAGTAA, ITS2R- GCTGCGTTCTTCATCGATGC). Electrophoresis of PCR products is conducted on a 1.5% agarose gel to assess the fragment length and concentration. Samples with main bands falling within the normal range were suitable for further experimentation. Following concentration comparisons of PCR products using GeneTools Analysis Software (Version 4.03.05.0, SynGene), the required volume for each sample was calculated based on the principle of equal mass, and the PCR products were then mixed. The PCR mixture was recovered using the E.Z.N.A.® Gel Extraction Kit (Omega, USA) D2500-03, with target DNA fragments eluted in TE buffer. Library construction was carried out following the standard protocol of the ALFA-SEQ DNA Library Prep Kit, and the size of the library fragments was evaluated on the Qsep400 High-Throughput Nucleic Acid & Protein Analysis System (Hangzhou Houze Biotechnology Ltd., China). The library concentration was measured using a Qubit 4.0 (Thermo Fisher Scientific, USA). The constructed amplicon libraries were sequenced on either the Illumina or MGI platform using PE250 chemistry (Guangdong Magigene Biotechnology Ltd., China). The high-throughput sequencing data supporting this study were available in the National Center for Biotechnology Information (NCBI) under accession no. PRJNA1380739. 2.7. Bioinformatics analyses Paired-end reads were assigned to samples based on their unique barcode and truncated by cutting off the barcode and primer sequences. Paired-end reads were merged using FLASH ( http://ccb.jhu.edu/software/FLASH/ ) [ 15 ], a very fast and accurate analysis tool, which was designed to merge paired-end reads when at least some of the reads overlap the read generated from the opposite end of the same DNA fragment, and the splicing sequences were called raw tags. Quality filtering of the raw tags was performed using fastp to obtain high-quality Clean Tags [ 16 ]. The tags were compared with the reference databases (Silva database https://www.arb-silva.de/ for 16S/18S; Unite database https://unite.ut.ee/ for ITS) using the UCHIME Algorithm ( http://www.drive5.com/usearch/manual/uchime_algo.html ) to detect chimeric sequences, and the chimeric sequences were then removed [ 17 ]. Finally, the effective tags were obtained. The entire microbiome analysis was performed using the Quantitative Insights into Microbial Ecology (QIIME, version 2021.4) tool. 2.8. Statistical analysis and data visualization Violin plots were generated using GraphPad Prism 9.5 to display the physicochemical properties of the samples. Based on the QIIME 2 analysis, α-diversity box charts were plotted using GraphPad Prism 9.5. Bar charts illustrating the community structure of bacterial phyla across the six samples were created with GraphPad Prism 9.5. Heatmaps were performed to visualize microbial community structures at the bacterial genus level using the “pheatmap” package in R v.4.4.3 ( https://www.r-project.org/ ). Prior to network construction, Random Matrix Theory (RMT) was used to select an appropriate similarity threshold. Molecular Ecological Network Analysis (MENA) was conducted based on the relative abundance of OTUs across different treatments. For network construction in this study, only OTUs that appeared in at least 4 of the 6 biological replicate samples were retained [ 18 ]. All network analyses were performed using the Molecular Ecological Network Analysis Pipeline (MENAP, http://129.15.40.240/mena/ ) [ 19 ]. The network was separated into different modules using the greedy modularity optimization method on MENAP. The resulting node and edge files were visualized in Gephi v.0.9.2. Based on differences in OTU relative abundance among modules within the co-occurrence network, both within-module connectivity ( Zi ) and among-module connectivity ( Pi ) were calculated for each node. Mantel’s test was carried out to examine the relationships between the chemical properties and keystone taxa using the “linkET” and “ggplot2” packages [ 20 ]. 3. Results 3.1. Physicochemical properties of biological crusts suggest substantial calcium loss The crystal structure and chemical composition of the biological crusts were analyzed by X-ray diffraction. The XRD patterns of all six samples exhibited major diffraction peaks at 2θ = 20.5°, 26.3°, and 29.3°, which were identified as CaCO 3 , SiO 2, and Na 2 Mg(SO 4 ) 2 (H 2 O) 4 , respectively (Fig. 2 a). Phase analysis indicated that the main components of the biological crusts were calcium carbonate, silica, and loweite, with consistent composition observed across all six samples. Previous studies report that the Rectangular Tower was built using limestone [ 21 ], which is primarily composed of calcium carbonate. This is also consistent with the XRD results in this study, suggesting a potential loss of calcium carbonate from the limestone. To investigate the potential chemical mechanisms underlying biocrust-induced biodeterioration, the soluble salt content of the biological crusts was measured. Four anions (Cl − , SO 4 2− , NO 3 − , NO 2 − ) and five cations (Mg 2+ , NH 4 + , Na + , K + , Ca 2+ ) were detected in the six samples (Fig. 2 b). Overall, the anion content followed the order: SO 4 2− > NO 3 − > Cl − > NO 2 − , while the contents of cations were ordered as Ca 2+ > K + > Mg 2+ > NH 4 + > Na + . Notably, Ca 2+ content was consistently highest in the biocrusts, suggesting substantial calcium released from the built materials. Taken together, it could be inferred that biocrusts have accumulated substantial amounts of soluble nitrate and sulfate, in the context of which the formation of biocrusts promotes the loss of calcium from the Rectangular Tower's built environment. 3.2. Microbial interactions with stone induce the formation of biological crusts Optical microscopy revealed an abundance of fibrous cells in the biocrusts at the site, indicating colonization by filamentous cells (Fig. 3 a). Next, microbial activity in the biocrusts was evaluated using fluorescence staining to confirm the presence of a microbial community. Under the confocal microscope, the green fluorescent signals were significantly stronger in both quantity and intensity than the red fluorescent signals (Fig. 3 b, 3 c), indicating the presence of numerous metabolically active cells in the biocrusts [ 22 ]. To further confirm the morphology and microstructure of microbial communities in the biocrusts, scanning electron microscopy (SEM) analysis was performed under different magnifications. Similarly, hyphal cells were visible in the biocrusts (Fig. 3 d), around which many microparticles were present (Fig. 3 e). These microparticles might be fragments of deteriorated monuments or secondary biomineralization [ 23 ], mainly because the hyphae of fungi and cyanobacteria penetrate into the stone substrate, ultimately leading to the loosening and detachment of mineral particles [ 24 – 26 ]. Previous research has demonstrated that such (bio)mechanical damage is a key initial step in biodeterioration [ 1 ]. Furthermore, microbial extracellular polymeric substances, such as polysaccharides, lipids, and proteins, can exhibit chelating properties, enabling them to bind minerals effectively and accelerate biocrust formation [ 23 , 24 , 27 ]. These observations showed visual evidence of active microbial colonization within the biological crusts. Exploring the microbiomes in biological crusts will provide a crucial basis for understanding their role in the biodeterioration of stone monuments [ 28 , 29 ]. Thus, further investigation into microbial communities and their interactions with the physicochemical properties of biological crusts is essential to uncover the microbiomes shaping the formation of biological crusts on limestone monuments in the Xiaoling Tomb of the Ming Dynasty. 3.3. Microbial diversity and community of biological crusts Upon confirming the presence of a substantial number of active microorganisms, we investigated their diversity and composition in the biocrusts. This aimed to reveal the microbial communities associated with the biodeterioration of the Rectangular Tower and to explore the potential mechanisms underlying biodeterioration driven by biocrust formation. Generally, bacteria showed the highest biodiversity, followed by fungi, while archaea had the lowest (Fig. 4 a). Bacterial communities across all samples were primarily composed of eight phyla, ranked in order of relative abundance as Cyanobacteria, Chloroflexi, Actinobacteria, Proteobacteria, Acidobacteria, Bacteroidota, Planctomycota, and Deinococcota (Fig. 4 b). Notably, two phototropic bacterial phyla, Cyanobacteria and Chloroflexi, predominated in the biocrusts, suggesting that photosynthesis might be a crucial process involved in biocrust formation [ 30 ]. Consistently, at the genus level (Fig. 4 c), the most abundant genera were o__Cyanobacteriales (accounting for approximately 19%), Chalicogloea_CCALA_975 (approximately 13%), and AKIW781 (approximately 10%), which were all members of Cyanobacteria. Fungal communities in the biological crusts mainly consisted of Ascomycota, Basidiomycota, and Chytridiomycota (Fig. 4 d). The dominant genera were Ciboria (accounting for approximately 12%), Pleosporales_gen_Incertae_sedis (approximately 11%), and Anthracina (approximately 7%, Fig. 4 e). These fungi have often been observed in the arid and semi-arid environments [ 31 ], which is consistent with the properties of the niches on the surface of stone monuments. Interestingly, almost all the detected archaea belonged to the phylum Crenarchaeota (Fig. 4 f). At the genus level (Fig. 4 g), the archaeal community was dominated by Candidatus_ Nitrocosmicus and several genera within the family Nitrososphaeraceae . It is known that Candidatus_ Nitrocosmicus is a classic ammonia-oxidizing archaeon capable of oxidizing ammonia to nitrite [ 32 ], while all cultured members of the Nitrososphaeraceae family are capable of chemolithoautotrophic growth through ammonia oxidation and carbon dioxide fixation [ 33 ]. Based on these metabolic characteristics, it can be reasonably inferred that the archaea detected in the biological crusts are primarily involved in the nitrogen cycle. This metabolic activity may also constitute a potential mechanism of biodeterioration. Although we have gained a general understanding of microbiomes in biological crusts, the keystone taxa that shape their formation and drive the biodeterioration process remain unclear. Therefore, a combination of co-occurrence network analysis and Mantel tests could help identify the potential keystone taxa responsible for biocrust formation and the associated biodeterioration. 3.4. Keystone taxa shaping the formation of biological crusts To identify key species, we constructed a microbial co-occurrence network from bacterial, fungal, and archaeal communities (Fig. 5 a). The network comprised 536 nodes and 839 edges, with 47.08% of the correlations being positive. Based on differences in OUT relative abundance among modules within the co-occurrence network, the within-module connectivity ( Zi ) and among-module connectivity ( Pi ) were calculated for each node. Species were categorized into the following four types: (i) peripherals ( Zi ≤ 2.5, Pi ≤ 0.62), which have few links and are almost always connected to nodes within their own modules; (ii) connectors ( Zi ≤ 2.5, Pi > 0.62), which are highly connected to multiple modules; (iii) module hubs ( Zi > 2.5, Pi ≤ 0.62), which are highly connected to many nodes within their module; and (iv) network hubs ( Zi > 2.5, Pi > 0.62), which act as module hubs and connectors. Except for peripheral nodes, the other three categories were considered keystone taxa due to their crucial roles in the network topology [ 19 ]. Thus, 12 keystone taxa belonging to 11 genera were identified (Fig. 5 b) and highlighted in the network diagram (Fig. 5 a). Moreover, most of these key species had high abundances within their own modules, and some (e.g., Pestalotiopsis , Pleosporales_gen_Incertae_sedis , and Roseiflexaceae gen.1 ) were even clustered within the same module. Both fungal genera are typical saprophytes or facultative parasites, possessing robust lignocellulolytic enzyme systems. Positioned at the terminal stage of the organic carbon decomposition chain, they degrade recalcitrant organic matter, with Pestalotiopsis recognized as a symbiont in lichens [ 34 ]. In contrast, the bacterial genus Roseiflexaceae gen. 1 may be at the front of the chain or work alongside other organisms in the chain. Powered by light energy, the microbiomes in the biocrusts could convert inorganic carbon into organic carbon or directly use early decomposition products, creating a small-scale carbon cycle nearby [ 35 ]. In addition, Scytonema_PCC-7110 and Spirosomaceae gen. 1 were located within the same module. Scytonema is among the most prevalent genera in biocrusts and plays a significant role in nitrogen fixation [ 36 – 38 ]. They are also a producer of extracellular polymeric substances (EPS), with their filaments encased in a thick mucilaginous sheath composed mainly of polysaccharides and glycoproteins [ 39 ]. This sheath facilitates substrate attachment and promotes the formation of biocrusts, as shown in Fig. 3 a. Meanwhile, Spirosomaceae gen. 1 belongs to the "cytophagia" group and degrades complex polysaccharides [ 40 ]. In natural environments, the abundant EPS produced by Scytonema serves as a crucial carbon and energy source for heterotrophic bacteria, including Spirosomaceae gen.1 . The latter, in turn, recycles and mineralizes these organic compounds, thereby driving the carbon cycle. Thus, these two microbial taxa might form a consortium: Scytonema spp. provide Spirosomaceae gen. 1 with organic carbon and nitrogen-fixation products, while the latter may help maintain local microenvironmental stability. To better elucidate the relationship between key species and potential biodeterioration processes, we applied the Mantel test to compare the abundances of different key species with the physicochemical properties of the biological crusts. The Mantel test calculates the correlation between two matrices and determines its statistical significance through permutation testing [ 41 ]. The Mantel test indicated that Ca 2+ content was significantly correlated with SO 4 2− and Cl − , but had no significant correlation with NO 2 − or NO 3 − (Fig. 5 c). This finding diverges from our earlier inference that both nitrates and sulfates jointly promote biodeterioration, suggesting that the retention of Ca 2+ in the bio-deteriorated crusts may rely more on the involvement of excess hydrochloric acid (or chlorides) and sulfuric acid to maintain its dissolution and migration. Meanwhile, the fact that SO 4 2− exhibits the highest concentration among all anions further supports this interpretation (Fig. 2 b). In the Mantel test, two genera c__Cyanobacteriia gen.1 and Setophaeosphaerias showed a significant correlation with NO 3 − ( P < 0.05), and c__ Agaricomycetes gen.1 demonstrated a highly significant correlation with NH 4 + ( P < 0.01), suggesting that these taxa are likely involved in nitrogen cycling in the biocrusts [ 42 – 44 ]. Notably, many studies have indicated that the genus Setophaeosphaeria is a dominant fungus in plant litter under slightly acidic conditions [ 45 ]. Since the bio-deteriorated crusts typically exhibit a weakly acidic environment due to the presence of organic and inorganic acids produced by microbial metabolism, this fungal genus is likely well-adapted to the biocrust microenvironment, where it may play an important ecological role in shaping biocrust formation. Furthermore, the fungal genus Plectosphaerella showed significant correlations with SO 4 2− , Cl ⁻ , K + , and Mg 2+ ( P < 0.05), suggesting that it may be a potential keystone taxon involved in biodeterioration of the stone monuments. Together, c__Cyanobacteriia gen.1 , Setophaeosphaeria , c__Agaricomycetes gen.1 , and Plectosphaerella are likely the keystone taxa responsible for biocrust formation and the associated biodeterioration. 4. Discussion To elucidate the association between microbial communities and biocrust formation on the limestone wall of the Rectangular Tower in the Imperial Xiaoling Mausoleum, this study integrated high-throughput sequencing data with physicochemical measurements. We examined not only bacteria but also profiled the archaeal and fungal communities simultaneously. By constructing topological networks and applying Mantel analysis, key microbial groups shaping biocrust formation were identified. Although 11 keystone taxa at the genus level were identified to shape the formation of biocrusts, statistical analysis indicated that only 4 of these keystone taxa showed significant correlations with physicochemical factors associated with biodeterioration. This suggests that further research on the biodeterioration of stone monuments should extend beyond community diversity metrics and focus more on the functional analysis of microorganisms. Previous studies have shown that the biodeterioration of stone is often closely linked to fungal and plant-related activities. Asunción also observed that persistent endolithic fungal growth, including both lichenized and non-lichenized fungal hyphae, contributed to the observed biodeterioration processes through alterations induced by their internal penetration [ 46 ]. Among the four final key taxa we identified, only one belonged to Bacteria (c__Cyanobacteriia gen.1 ), while the remaining three ( Setophaeosphaeria , c__Agaricomycetes gen.1 , and Plectosphaerella ) belonged to Fungi. This further supports the view that fungi are the prime deteriogens of stone monuments and buildings. Biocrusts of the Rectangular Tower exhibit multiple forms of deterioration, including calcium deposits, secondary mineralization, and exfoliation. Future research needs to consider their synergistic effects and incorporate longer time scales and a broader range of climatic conditions [ 4 , 6 ]. This will help refine our understanding of the succession of keystone taxa and their associated metabolic patterns during the biodeterioration process of the Rectangular Tower in the Imperial Xiaoling Mausoleum. Furthermore, integrating multi-omics technologies, such as metagenomics and metatranscriptomics, can provide deeper insights into the metabolic processes of key taxa, clarifying the biochemical mechanisms driving biodeterioration [ 47 ]. Combining culture-dependent and culture-independent techniques with chemical analytical methods will yield a more comprehensive understanding of the complex biodeterioration processes affecting stone monuments [ 48 ], thereby facilitating the development of more effective conservation strategies [ 49 ]. Moreover, a comparative analysis of microbial community structures and functions across heritage sites in different climatic zones will help establish a universal predictive model for the biodeterioration of cultural heritage. In summary, this study successfully identified the keystone species shaping the formation of biocrusts and involved in biodeterioration of the Rectangular Tower in the Imperial Xiaoling Mausoleum. We claim that it is essential to conduct case-specific diagnostics to identify the keystone taxa and their metabolic functions before implementing protective interventions [ 50 ]. Our study not only enhances understanding of the mechanisms underlying stone heritage biodeterioration during biocrust formation but also promotes the advancement of cultural heritage conservation science toward greater precision and systematic development. Declarations Funding This study was funded by the Basic Research Program of Jiangsu Province (Grant No. BK20250086) and the National Natural Science Foundation of China (Grant Nos. 32570139 and 32370105). Competing Interests The authors declare no competing interests. Author Contributions X.L. and F.W. designed and managed the project. W.W., X.H. and X.L. performed laboratory assays, analyzed the data, and interpreted the results. W.W. wrote the manuscript. X.L. and F.W. edited and wrote sections of the manuscript. All authors reviewed the manuscript and approved this submission. Data Availability The raw gene seuqence data supporting this study were available in the National Center for Biotechnology Information (NCBI) under accession no. PRJNA1380739. References Warscheid T, Braams J: Biodeterioration of stone: a review . International Biodeterioration & Biodegradation 2000, 46 (4):343-368. Gorbushina AA: Life on the rocks . Environmental Microbiology 2007, 9 (7):1613-1631. Sun C, Gao J, Wang S: Investigation and Disease Analysis of Brick Buildings in Ming Xiaoling Mausoleum . Chinese & Overseas Architecture 2025(6):129-134. Yang Y, Deng Y, Cai C, Wang F, Fang Y, Duan X: Biocrusts’ impact on hydrological processes and erosion dynamics: A review . Geoderma 2025, 459 :117383. Cao Y, Bowker MA, Delgado-Baquerizo M, Xiao B: Biocrusts protect the Great Wall of China from erosion . Science Advances 2023, 9 (49):eadk5892. Weber BA-O, Belnap J, Büdel B, Antoninka AJ, Barger NN, Chaudhary VB, Darrouzet-Nardi A, Eldridge DJ, Faist AM, Ferrenberg S et al : What is a biocrust? A refined, contemporary definition for a broadening research community . Biological reviews of the Cambridge Philosophical Society 2022, 97(5) :1768-1785. Bellinzoni AM, Caneva G, Ricci S: Ecological trends in travertine colonisation by pioneer algae and plant communities . International Biodeterioration & Biodegradation 2003, 51 (3):203-210. Beraldi-Campesi H, Hartnett He Fau - Anbar A, Anbar A Fau - Gordon GW, Gordon Gw Fau - Garcia-Pichel F, Garcia-Pichel F: Effect of biological soil crusts on soil elemental concentrations: implications for biogeochemistry and as traceable biosignatures of ancient life on land . Geobiology 2009, 7(3) :348-359. Xiong W, Tao Y, Wang P, Wu K, Chen L: Impact of Environmental Factors on the Formation and Development of Biological Soil Crusts in Lime Concrete Materials of Building Facades . Applied Sciences 2022, 12 (6):2974. Leplat J, Bousta F, François A, Guiavarc'h M, Mertz J-D, Brissaud D: The pink staircase of Sully-sur-Loire castle: Even bacteria like historic stonework . International Biodeterioration & Biodegradation 2019, 145 :104805. Tighe M, Haling RE, Flavel RJ, Young IM: Ecological Succession, Hydrology and Carbon Acquisition of Biological Soil Crusts Measured at the Micro-Scale . PLOS ONE 2012, 7 (10):e48565. Checcucci A, Borruso L, Petrocchi D, Perito B: Diversity and metabolic profile of the microbial communities inhabiting the darkened white marble of Florence Cathedral . International Biodeterioration & Biodegradation 2022, 171 :105420. Ma W, Wu F, Tian T, He D, Zhang Q, Gu J-D, Duan Y, Ma D, Wang W, Feng H: Fungal diversity and its contribution to the biodeterioration of mural paintings in two 1700-year-old tombs of China . International Biodeterioration & Biodegradation 2020, 152 :104972. Cai X, Sun L, Wan L: Investigation of microbial community on the Ming Dynasty Wall at Nanjing and an exploration of the effect of algal bio- weathering on the wall brick . Sciences of Conservation and Archaeology 2016, 28 (2):9. Magoč T, Salzberg SL: FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics (Oxford, England) 2011, 27 (21):2957-2963. Bokulich NA, Subramanian S, Faith JJ, Gevers D, Gordon JI, Knight R, Mills DA, Caporaso JG: Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing . Nature Methods 2013, 10 (1):57-59. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R: UCHIME improves sensitivity and speed of chimera detection. Bioinformatics (Oxford, England) 2011, 27 (16):2194-2200. Zhou J, Deng Y, Luo F, He Z, Tu Q, Zhi X: Functional Molecular Ecological Networks . mBio 2010, 1 (4):10.1128/mbio.00169-00110. Deng Y, Jiang Y-H, Yang Y, He Z, Luo F, Zhou J: Molecular ecological network analyses . BMC Bioinformatics 2012, 13 (1):113. Huang H: linkET: Everything is Linkable ; 2021. Xingyu S, Xiaodan L, Yiming K: Research in the Brick and Stone Construction of Fang-cheng in the Ming Xiaoling Mausoleum in Nanjing . Time Architecture 2015(6):21-25. Schifano E, Cavallini D, De Bellis G, Bracciale MP, Felici AC, Santarelli ML, Sarto MS, Uccelletti D: Antibacterial Effect of Zinc Oxide-Based Nanomaterials on Environmental Biodeteriogens Affecting Historical Buildings . Nanomaterials 2020, 10 (2):335. Liu X, Koestler RJ, Warscheid T, Katayama Y, Gu J-D: Microbial deterioration and sustainable conservation of stone monuments and buildings . Nature Sustainability 2020, 3 (12):991-1004. Ma C, Fang Z, Li X, Liu X: Identification of bacterial communities involved in bioweathering crusts on limestone sculptures of the Longmen Grottoes . In: Coatings. vol. 13; 2023: 1506. Wang Y, Zhang H, Liu X, Liu X, Song W: Fungal communities in the biofilms colonizing the basalt sculptures of the Leizhou Stone Dogs and assessment of a conservation measure . npj Heritage Science 2021, 9 (1):36. Wu F, Zhang Y, Gu J-D, He D, Zhang G, Liu X, Guo Q, Cui H, Zhao J, Feng H: Community assembly, potential functions and interactions between fungi and microalgae associated with biodeterioration of sandstone at the Beishiku Temple in Northwest China . Science of The Total Environment 2022, 835 :155372. Hokputsa S, Hu C, Paulsen BS, Harding SEJCP: A physico-chemical comparative study on extracellular carbohydrate polymers from five desert algae . Carbohydrate Polymers 2003, 54 :27-32. Wang L, Huang J, Sanmartín P, Martino PD, Wu F, Urzì CE, Gu J-D, Liu X: Water determines geomicrobiological impact on stone heritage . Nature Geoscience 2025, 18 (2):108-111. Liu X, Qian Y, Wu F, Wang Y, Wang W, Gu J-D: Biofilms on stone monuments: biodeterioration or bioprotection? Trends in Microbiology 2022, 30 (9):816-819. Bryant DA, Liu Z, Li T, Zhao F, Costas AMG, Klatt CG, Ward DM, Frigaard N-U, Overmann J: Comparative and Functional Genomics of Anoxygenic Green Bacteria from the Taxa Chlorobi, Chloroflexi, and Acidobacteria . In: Functional Genomics and Evolution of Photosynthetic Systems. Edited by Burnap R, Vermaas W. Dordrecht: Springer Netherlands; 2012: 47-102. Tidimalo C, Maximiliano O, Karen J, Lebre PH, Bernard O, Michelle G, Oagile D, Cowan DA: Microbial diversity in the arid and semi-arid soils of Botswana . Environ Microbiol Rep 2024, 16 (6):e70044. Sauder LA, Albertsen M, Engel K, Schwarz J, Nielsen PH, Wagner M, Neufeld JD: Cultivation and characterization of Candidatus Nitrosocosmicus exaquare, an ammonia-oxidizing archaeon from a municipal wastewater treatment system . The ISME Journal 2017, 11 (5):1142-1157. Kerou M, Schleper C: Nitrososphaeraceae . In: Bergey's Manual of Systematics of Archaea and Bacteria. 2016: 1-2. Maharachchikumbura SSN, Guo L-D, Chukeatirote E, Bahkali AH, Hyde KD: Pestalotiopsis—morphology, phylogeny, biochemistry and diversity . Fungal Diversity 2011, 50 (1):167-187. Hanada S: The Phylum Chloroflexi, the Family Chloroflexaceae, and the Related Phototrophic Families Oscillochloridaceae and Roseiflexaceae . In: The Prokaryotes: Other Major Lineages of Bacteria and The Archaea. Edited by Rosenberg E, DeLong EF, Lory S, Stackebrandt E, Thompson F. Berlin, Heidelberg: Springer Berlin Heidelberg; 2014: 515-532. Yeager CM, Kornosky JL, Morgan RE, Cain EC, Garcia-Pichel F, Housman DC, Belnap J, Kuske CR: Three distinct clades of cultured heterocystous cyanobacteria constitute the dominant N2-fixing members of biological soil crusts of the Colorado Plateau, USA . FEMS Microbiology Ecology 2007, 60 (1):85-97. Sant’Anna CLJNH: Scytonemataceae (Cyanophyceae) from the state of São Paulo, southern Brazil . Nova Hedwigia 1988, 46 :519-539. Abrantes GH, Gücker B, Chaves RC, Boëchat IG, Figueredo CC: Epilithic biofilms provide large amounts of nitrogen to tropical mountain landscapes . Environmental Microbiology 2023, 25 (12):3592-3603. Komárek J, Kling H, Komárková J: 4 - FILAMENTOUS CYANOBACTERIA . In: Freshwater Algae of North America. Edited by Wehr JD, Sheath RG. Burlington: Academic Press; 2003: 117-196. Raj HD, Maloy SR: Family Spirosomaceae: Gram-Negative Ring-Forming Aerobic Bacteria . Critical Reviews in Microbiology 1990, 17 (5):329-364. Mantel N: The detection of disease clustering and a generalized regression approach. Cancer research 1967, 27 (2):209-220. Huang Y, Li P, Chen G, Peng L, Chen X: The production of cyanobacterial carbon under nitrogen-limited cultivation and its potential for nitrate removal . Chemosphere 2018, 190 :1-8. Chen X, Wang K, Li X, Qiao Y, Dong K, Yang L: Microcystis blooms aggravate the diurnal alternation of nitrification and nitrate reduction in the water column in Lake Taihu . Science of The Total Environment 2021, 767 :144884. Gao J, Liu G, Xiong Z, Cao X, Zhou Y, Song C: Dissolved organic nitrogen and phosphorus derived from different cyanobacteria regulate distinctly different nitrate reduction pathways in sediments . Water Research 2025, 287 :124520. Du J, Qv W, Niu Y, Yuan S, Zhang L, Yang H, Zhang Y: Co-exposures of acid rain and ZnO nanoparticles accelerate decomposition of aquatic leaf litter . Journal of Hazardous Materials 2022, 426 :128141. de los Ríos A, Cámara B, García del Cura MÁ, Rico VJ, Galván V, Ascaso C: Deteriorating effects of lichen and microbial colonization of carbonate building rocks in the Romanesque churches of Segovia (Spain) . Science of The Total Environment 2009, 407 (3):1123-1134. Fu X, Wu F, Liu X: Bio-archive of cultural heritage microbiomes for sustainable conservation in the multi-omics era . Advanced Genetics 2025, 6 (4):e00046. Liu X, Qian Y, Wang Y, Wu F, Wang W, Gu J-D: Innovative approaches for the processes involved in microbial biodeterioration of cultural heritage materials . Current Opinion in Biotechnology 2022, 75 :102716. Wang L, Ma C, Wu F, Liu X: Identification and screening of acid-secreting bacterial strains isolated from limestone of the Longmen Grottoes monuments . International Biodeterioration & Biodegradation 2026, 208 :106255. Ma C, Zhang X, Wu F, Liu X: Identifying keystone taxa and metabolisms of epilithic biofilms is crucial to the conservation of stone heritage from biodeterioration . Frontiers in Microbiology 2025, Volume 16 - 2025 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 07 Apr, 2026 Reviews received at journal 07 Apr, 2026 Reviews received at journal 06 Apr, 2026 Reviewers agreed at journal 18 Mar, 2026 Reviewers agreed at journal 17 Mar, 2026 Reviewers invited by journal 17 Mar, 2026 Editor assigned by journal 11 Mar, 2026 Submission checks completed at journal 11 Mar, 2026 First submitted to journal 09 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8923180","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":608356818,"identity":"67598c07-2590-45f3-8570-57c719b62113","order_by":0,"name":"Weijia Wang","email":"","orcid":"","institution":"Nanjing University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Weijia","middleName":"","lastName":"Wang","suffix":""},{"id":608356819,"identity":"76c0f55a-5ca6-4f4c-9b02-2e6164654ad3","order_by":1,"name":"Xiaofang Huang","email":"","orcid":"","institution":"Nanjing University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Xiaofang","middleName":"","lastName":"Huang","suffix":""},{"id":608356820,"identity":"7fa8f47d-c38f-4a0e-b4f4-c1f2c6475851","order_by":2,"name":"Fasi Wu","email":"","orcid":"","institution":"National Research Center for Conservation of Ancient Wall Paintings and Earthen Sites, Dunhuang Academy","correspondingAuthor":false,"prefix":"","firstName":"Fasi","middleName":"","lastName":"Wu","suffix":""},{"id":608356821,"identity":"4fc8d913-17a2-4928-9160-c5811e812aa1","order_by":3,"name":"Xiaobo Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIie3PMQrCMBSA4Vce1KW1a7p4huyCZ1EyeIPi4NAidPIAgsVjOKc8cJJ2LbSDLk4OHV0EE4trGzfB/JCQwPsIAbDZfjGGsYQVYHdzjYijyFkT/IKAk+qTKeF1kpB/aEa8LCW0EUGwj/tJmOUx+ccb8kqAsysIWCP7ScAWmpAiCOinBJzN+4n7JpkiJQE+TUj3SqyIFICOCdF/ybMTYVgJnm+LpceqAcLrDbX3NYlxmV8vj2g6CXYD5JPQm1TLM5tXzYwnbTab7f96AfboRXhyYzejAAAAAElFTkSuQmCC","orcid":"","institution":"Nanjing University of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Xiaobo","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2026-02-20 07:08:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8923180/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8923180/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105066254,"identity":"c7d633e3-2a27-44cd-8739-9cf6a8f7001b","added_by":"auto","created_at":"2026-03-20 14:02:30","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1604036,"visible":true,"origin":"","legend":"\u003cp\u003eAn overview of the experimental design. \u003cstrong\u003ea,\u003c/strong\u003e Panorama of the Rectangular Tower viewed from the front. \u003cstrong\u003eb,\u003c/strong\u003e The limestone wall of the Rectangular Tower colonized by black biocrusts.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8923180/v1/04228ae9d4b974d73161f3f7.png"},{"id":105066253,"identity":"69b5690b-539f-488e-af21-8b80d1d5ac35","added_by":"auto","created_at":"2026-03-20 14:02:30","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":22506,"visible":true,"origin":"","legend":"\u003cp\u003ePhysicochemical properties of the biocrusts.\u003cstrong\u003e a, \u003c/strong\u003eXRD analysis of the biocrusts. Digitals at the top of each peak correspond to the individual chemicals. \u003cstrong\u003eb, \u003c/strong\u003eContents of soluble ions of the biocrusts.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8923180/v1/a9b8e20d2f366c325ad66f84.png"},{"id":105066256,"identity":"4759c4a7-698e-4bbb-ad8e-d833566046b9","added_by":"auto","created_at":"2026-03-20 14:02:30","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2407883,"visible":true,"origin":"","legend":"\u003cp\u003eMicroscopic images of the biocrusts.\u003cstrong\u003e a,\u003c/strong\u003e Portable microscopic image of the biocrusts in situ. Confocal microscopic images of the biocrusts after staining with green (\u003cstrong\u003eb\u003c/strong\u003e) and red (\u003cstrong\u003ec\u003c/strong\u003e) fluorescence. The SYTO9 green fluorescence nucleic acid stain can stain live cells, whereas the red fluorescence stain, propidium iodide, stains only dead cells. Thus, under confocal microscopy, green fluorescence indicates live cells, whereas red fluorescence represents dead cells. SEM images of the biocrusts at different magnifications (\u003cstrong\u003ed\u003c/strong\u003e, 4000 folds; \u003cstrong\u003ee\u003c/strong\u003e, 10000 folds). Blue arrows represent hyphal cells (\u003cstrong\u003ed\u003c/strong\u003e), whereas red arrows indicate mineral particles (\u003cstrong\u003ee\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8923180/v1/c2a681c73d5db6f2bac04c04.png"},{"id":105066255,"identity":"481cc996-fa52-4d04-969e-e65244719b55","added_by":"auto","created_at":"2026-03-20 14:02:30","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":123061,"visible":true,"origin":"","legend":"\u003cp\u003eMicrobial profiles of the biocrusts.\u003cstrong\u003e a, \u003c/strong\u003eDiversity indices of microbial communities in the biocrusts. \u003cstrong\u003eb,\u003c/strong\u003e Bacterial populations at the phylum level. \u003cstrong\u003ec,\u003c/strong\u003eBacterial compositions at the genus level. \u003cstrong\u003ed,\u003c/strong\u003e Fungal populations at the phylum level. \u003cstrong\u003ee,\u003c/strong\u003e Fungal compositions at the genus level. \u003cstrong\u003ef, \u003c/strong\u003eArchaeal populations at the phylum level.\u003cstrong\u003e g,\u003c/strong\u003e Archaeal compositions at the genus level. Unclassified taxa and those with a relative abundance of \u0026lt;1% were grouped as \"Others\".\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8923180/v1/23136eb84f491ed14dce34ab.png"},{"id":105066257,"identity":"33a14dfe-cd48-4e73-82b5-d59ef27af657","added_by":"auto","created_at":"2026-03-20 14:02:30","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":217503,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelations among microbial communities and between keystone taxa and physicochemical factors. \u003cstrong\u003ea\u003c/strong\u003e, Co-occurrence network among bacterial, fungal, and archaeal communities. Each node represents an OUT; node size indicates relative abundance; and node color is assigned by module, with modules with relative abundance less than 1% shown in gray. Red lines indicate positive correlations, while blue lines indicate negative correlations. \u003cstrong\u003eb. \u003c/strong\u003eModule-connectivity of microbial communities. Each node represents an OUT and/or species from Panel \u003cstrong\u003ea\u003c/strong\u003e and is colored according to its topological role. The topological role of each species is determined based on a scatter plot of within-module connectivity (\u003cem\u003eZi\u003c/em\u003e) versus among-module connectivity (\u003cem\u003ePi\u003c/em\u003e). \u003cstrong\u003ec.\u003c/strong\u003eCorrelation network between keystone taxa and physicochemical properties. Line thickness represents the strength of the correlation. \u003cem\u003eP\u003c/em\u003e-values indicate significance levels (*, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001; and ****, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8923180/v1/56bddca390492587cbc5e6a2.png"},{"id":105562860,"identity":"17ab68b9-4af8-4e3c-994c-6bcefa06dbf4","added_by":"auto","created_at":"2026-03-27 12:44:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6879930,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8923180/v1/07281ccc-5a08-4c85-9d4a-34c7aee7670a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification of keystone taxa shaping biocrust formation and biodeterioration of limestone monuments in the Xiaoling Tomb of the Ming Dynasty","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eStone monuments serve as crucial carriers of human civilization and are widely distributed worldwide. They not only embody the outstanding achievements of ancient art and craftsmanship but also stand as tangible witnesses to historical transformations. However, during long-term open-air preservation, these heritage sites are generally subjected to dual damage from biotic and abiotic processes, leading to various forms of deterioration, including cracks, exfoliation, salt crystallization, and microbial colonization. Among these, biodeterioration caused by microbial colonization, growth, and metabolism has become a severe challenge threatening the long-term conservation of stone monuments [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eConstructed in the mid-14th century, the Imperial Xiaoling Mausoleum is a representative example of imperial tombs of the Ming and Qing dynasties and was inscribed on the UNESCO World Heritage List in 2003. As part of the Imperial Xiaoling Mausoleum, the Rectangular Tower has long been exposed to a warm, humid subtropical climate. Its surfaces have developed prominent biological erosion characterized by the formation of black biocrusts [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Such biocrusts not only extensively cover the walls, significantly impairing the heritage's aesthetic appearance, but may also accelerate the dissolution of minerals and structural deterioration, posing a potential threat to the long-term preservation of the site.\u003c/p\u003e \u003cp\u003eBiocrusts typically consist of a complex microecosystem formed by various microorganisms\u0026mdash;including bacteria, fungi, algae, and archaea\u0026mdash;along with mineral particles and extracellular polymeric substances [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Photoautotrophic organisms, such as algae and cyanobacteria, are key contributors to biocrust formation [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. They can colonize outdoor stone monuments with only water present and are often regarded as pioneers of microbial colonization of stone surfaces [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Heterotrophic organisms, in turn, consume the carbon compounds released by photoautotrophs [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. During mutual metabolism, microorganisms may secrete acidic substances that corrode building surfaces, while others deposit pigments that lead to discoloration [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Fungal hyphae can penetrate the brick and stone, causing physical damage. Moreover, the high water-retention capacity of biocrusts reduces evaporation rates, thereby creating a favourable microenvironment for microbial survival and accelerating biodeterioration [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePrevious studies have shown that environmental factors significantly influence the microbial community structure of brick- and stone-based heritage. For instance, the bacterial and fungal communities on the surfaces of the Florence Cathedral are affected by temperature and humidity [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The diversity of fungal communities in subterranean tomb murals is influenced by temperature and relative humidity [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. However, a systematic understanding of the microbial composition of biocrusts on stone monuments and the key factors shaping biocrust formation remains limited. In particular, the synergistic mechanisms among microorganisms from the three domains of life (bacteria, fungi, and archaea) in biocrust formation and biodeterioration remain poorly understood.\u003c/p\u003e \u003cp\u003eTherefore, to gain a more comprehensive and in-depth understanding of the microbiological mechanisms underlying biocrust formation and the biodeterioration of stone monuments, this study focuses on the typical black biocrusts on the limestone walls of the Rectangular Tower in the Imperial Xiaoling Mausoleum. Using high-throughput sequencing, we simultaneously analysed the community structures of bacteria, fungi, and archaea in the biocrusts. By constructing microbial co-occurrence networks and analysing topological attributes and multivariate statistics, we aimed to identify keystone species that play critical roles in biocrust formation and biodeterioration. Furthermore, we seek to elucidate their potential functions in the biodeterioration of stone monuments by correlating these key taxa with physicochemical factors. This research aims to provide a scientific basis for understanding the ecological mechanisms of biocrust-induced deterioration and for developing targeted conservation strategies for stone cultural heritage.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Sample collection\u003c/h2\u003e \u003cp\u003eSamples were collected in May 2025 in Nanjing (118\u0026deg;49'22' E, 32\u0026deg;33'51'' N), Jiangsu Province, China. This study employed a non-destructive method to collect the widely distributed black biocrust samples from the limestone wall of the Rectangular Tower in the Xiaoling Tomb of the Ming Dynasty. Specifically, three samples (C1, C2, and C3) were collected from the right corner of the Rectangular Tower, and the other three (C4, C5, and C6) were collected from the left corner (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). All six samples were used as biological replicates for the study. All samples were packaged and stored at 4\u0026deg;C before subsequent analyses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Ion chromatography analysis\u003c/h2\u003e \u003cp\u003eThe biocrust samples were ground into a homogeneous powder using a quartz mortar (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Next, 1 g of the powder was added to 7 mL of ultrapure water, mixed for 15 minutes in a vortex mixer, and then extracted in an ultrasonic bath for 10 minutes to obtain a soluble salt solution. Subsequently, the solution was centrifuged at 5000 \u003cem\u003eg\u003c/em\u003e for 5 minutes to collect the supernatant, which was then filtered through a 0.22 \u0026micro;m microporous membrane for subsequent determination of anion and cation concentrations. Upon the detection limit of ion chromatography, the initial concentration would be diluted if necessary. Finally, the prepared supernatant was injected into an ion chromatograph to detect anion and cation concentrations. The anion concentration was measured using the Dionex\u0026trade; Aquion\u0026trade; ICS 2100 (Thermo Fisher Scientific, USA) system equipped with the column IonPac\u0026trade; AS19 (4 \u0026times; 250 mm). The cation concentration was examined using the Dionex\u0026trade; ICS 6000 (Thermo Fisher Scientific, USA) system with the column IonPacTM CS12A (4\u0026times;250 mm). The entire detection was carried out at 25\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. XRD analysis of biocrusts\u003c/h2\u003e \u003cp\u003eThe collected biocrust samples were dried and ground to approximately 300 mesh using a natural agate mortar. Before testing, the powdered samples were evenly spread on the sample stage and analyzed for phase identification using an X-ray diffractometer (D8 ADVANCE, Bruker, USA). The testing conditions were as follows: tube voltage, 40 kV; tube current, 40 mA; Cu target; scanning range, 5\u0026deg;-120\u0026deg;; step size, 0.0194\u0026deg;; scanning speed, 0.2 \u0026deg;/min; and step-scan mode. The data were analyzed using Jade 9.0 software and the PDF-4-2009 database was referred for compositional identification.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Microbial activity analysis\u003c/h2\u003e \u003cp\u003eTo evaluate microbial activity of the collected biological crusts, microscopic analysis was conducted using the LIVE/DEAD\u0026trade; \u003cem\u003eBac\u003c/em\u003eLight\u0026trade; Bacterial Viability Kits (Thermo Fisher Scientific, USA). Fresh biocrust samples were ground to 400-mesh using a natural agate mortar. A total of 3 mL of sterile physiological saline solution was added to 0.1 g of powder to make a suspension. Following the manufacturer's instructions, components A and B of the dye were mixed uniformly in equal volumes. Then, 3 \u0026micro;L of the dye compounds were thoroughly mixed with 1 mL of the suspension. The final mixture was stained in the dark at room temperature for 15 minutes. Eventually, 1 \u0026micro;L of the stained sample was loaded into a confocal dish and observed using an A1/SIM/STORM confocal microscope (Nikon, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Microscopy analysis\u003c/h2\u003e \u003cp\u003eBefore sampling, biocrusts were observed in situ with a portable microscope (3R-MSBTVTY, Anty, China) to obtain an overview of microbial community colonization. For scanning electron microscopy (SEM) analysis, the samples were dehydrated and dried in an oven at 37\u0026deg;C for 1 hour [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], and the observation surfaces were gold-coated under vacuum conditions. The morphological and structural characteristics of the prepared samples were examined using the Quanta 250 (FEI, USA) scanning electron microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. DNA extraction and sequencing\u003c/h2\u003e \u003cp\u003eFollowing the manufacturer's instructions, the DNeasy\u0026reg; PowerSoil\u0026reg; Pro Kit 50 (QIAGEN, Germany) was used to extract genomic DNA. The concentration and purity of DNA extracts were measured using a Thermo Scientific NanoDrop One (Thermo Fisher Scientific, MA, USA).\u003c/p\u003e \u003cp\u003ePCR amplification was performed on the V4-V5 regions of the ribosomal gene and the ITS1 region using target-specific primers (bacteria: 515F- GTGCCAGCMGCCGCGGTAA, 907R- CCGTCAATTCMTTTRAGTTT; archaea: Arch519F- CAGCCGCCGCGGTAA, Arch915R- GTGCTCCCCCGCCAATTCCT; and fungi: ITS1F- CTTGGTCATTTAGAGGAAGTAA, ITS2R- GCTGCGTTCTTCATCGATGC). Electrophoresis of PCR products is conducted on a 1.5% agarose gel to assess the fragment length and concentration. Samples with main bands falling within the normal range were suitable for further experimentation. Following concentration comparisons of PCR products using GeneTools Analysis Software (Version 4.03.05.0, SynGene), the required volume for each sample was calculated based on the principle of equal mass, and the PCR products were then mixed. The PCR mixture was recovered using the E.Z.N.A.\u0026reg; Gel Extraction Kit (Omega, USA) D2500-03, with target DNA fragments eluted in TE buffer.\u003c/p\u003e \u003cp\u003eLibrary construction was carried out following the standard protocol of the ALFA-SEQ DNA Library Prep Kit, and the size of the library fragments was evaluated on the Qsep400 High-Throughput Nucleic Acid \u0026amp; Protein Analysis System (Hangzhou Houze Biotechnology Ltd., China). The library concentration was measured using a Qubit 4.0 (Thermo Fisher Scientific, USA). The constructed amplicon libraries were sequenced on either the Illumina or MGI platform using PE250 chemistry (Guangdong Magigene Biotechnology Ltd., China). The high-throughput sequencing data supporting this study were available in the National Center for Biotechnology Information (NCBI) under accession no. PRJNA1380739.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Bioinformatics analyses\u003c/h2\u003e \u003cp\u003ePaired-end reads were assigned to samples based on their unique barcode and truncated by cutting off the barcode and primer sequences. Paired-end reads were merged using FLASH (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://ccb.jhu.edu/software/FLASH/\u003c/span\u003e\u003cspan address=\"http://ccb.jhu.edu/software/FLASH/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], a very fast and accurate analysis tool, which was designed to merge paired-end reads when at least some of the reads overlap the read generated from the opposite end of the same DNA fragment, and the splicing sequences were called raw tags.\u003c/p\u003e \u003cp\u003eQuality filtering of the raw tags was performed using fastp to obtain high-quality Clean Tags [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The tags were compared with the reference databases (Silva database \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.arb-silva.de/\u003c/span\u003e\u003cspan address=\"https://www.arb-silva.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e for 16S/18S; Unite database \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://unite.ut.ee/\u003c/span\u003e\u003cspan address=\"https://unite.ut.ee/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e for ITS) using the UCHIME Algorithm (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.drive5.com/usearch/manual/uchime_algo.html\u003c/span\u003e\u003cspan address=\"http://www.drive5.com/usearch/manual/uchime_algo.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to detect chimeric sequences, and the chimeric sequences were then removed [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Finally, the effective tags were obtained. The entire microbiome analysis was performed using the Quantitative Insights into Microbial Ecology (QIIME, version 2021.4) tool.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Statistical analysis and data visualization\u003c/h2\u003e \u003cp\u003eViolin plots were generated using GraphPad Prism 9.5 to display the physicochemical properties of the samples. Based on the QIIME 2 analysis, α-diversity box charts were plotted using GraphPad Prism 9.5. Bar charts illustrating the community structure of bacterial phyla across the six samples were created with GraphPad Prism 9.5. Heatmaps were performed to visualize microbial community structures at the bacterial genus level using the \u0026ldquo;pheatmap\u0026rdquo; package in R v.4.4.3 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.r-project.org/\u003c/span\u003e\u003cspan address=\"https://www.r-project.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrior to network construction, Random Matrix Theory (RMT) was used to select an appropriate similarity threshold. Molecular Ecological Network Analysis (MENA) was conducted based on the relative abundance of OTUs across different treatments. For network construction in this study, only OTUs that appeared in at least 4 of the 6 biological replicate samples were retained [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. All network analyses were performed using the Molecular Ecological Network Analysis Pipeline (MENAP, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://129.15.40.240/mena/\u003c/span\u003e\u003cspan address=\"http://129.15.40.240/mena/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The network was separated into different modules using the greedy modularity optimization method on MENAP. The resulting node and edge files were visualized in Gephi v.0.9.2. Based on differences in OTU relative abundance among modules within the co-occurrence network, both within-module connectivity (\u003cem\u003eZi\u003c/em\u003e) and among-module connectivity (\u003cem\u003ePi\u003c/em\u003e) were calculated for each node. Mantel\u0026rsquo;s test was carried out to examine the relationships between the chemical properties and keystone taxa using the \u0026ldquo;linkET\u0026rdquo; and \u0026ldquo;ggplot2\u0026rdquo; packages [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Physicochemical properties of biological crusts suggest substantial calcium loss\u003c/h2\u003e \u003cp\u003eThe crystal structure and chemical composition of the biological crusts were analyzed by X-ray diffraction. The XRD patterns of all six samples exhibited major diffraction peaks at 2θ\u0026thinsp;=\u0026thinsp;20.5\u0026deg;, 26.3\u0026deg;, and 29.3\u0026deg;, which were identified as CaCO\u003csub\u003e3\u003c/sub\u003e, SiO\u003csub\u003e2,\u003c/sub\u003e and Na\u003csub\u003e2\u003c/sub\u003eMg(SO\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003e(H\u003csub\u003e2\u003c/sub\u003eO)\u003csub\u003e4\u003c/sub\u003e, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Phase analysis indicated that the main components of the biological crusts were calcium carbonate, silica, and loweite, with consistent composition observed across all six samples. Previous studies report that the Rectangular Tower was built using limestone [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], which is primarily composed of calcium carbonate. This is also consistent with the XRD results in this study, suggesting a potential loss of calcium carbonate from the limestone.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate the potential chemical mechanisms underlying biocrust-induced biodeterioration, the soluble salt content of the biological crusts was measured. Four anions (Cl\u003csup\u003e\u0026minus;\u003c/sup\u003e, SO\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e2\u0026minus;\u003c/sup\u003e, NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e, NO\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e) and five cations (Mg\u003csup\u003e2+\u003c/sup\u003e, NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e, Na\u003csup\u003e+\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e, Ca\u003csup\u003e2+\u003c/sup\u003e) were detected in the six samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Overall, the anion content followed the order: SO\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e2\u0026minus;\u003c/sup\u003e \u0026gt; NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e \u0026gt; Cl\u003csup\u003e\u0026minus;\u003c/sup\u003e \u0026gt; NO\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e, while the contents of cations were ordered as Ca\u003csup\u003e2+\u003c/sup\u003e \u0026gt; K\u003csup\u003e+\u003c/sup\u003e \u0026gt; Mg\u003csup\u003e2+\u003c/sup\u003e \u0026gt; NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e \u0026gt; Na\u003csup\u003e+\u003c/sup\u003e. Notably, Ca\u003csup\u003e2+\u003c/sup\u003e content was consistently highest in the biocrusts, suggesting substantial calcium released from the built materials. Taken together, it could be inferred that biocrusts have accumulated substantial amounts of soluble nitrate and sulfate, in the context of which the formation of biocrusts promotes the loss of calcium from the Rectangular Tower's built environment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Microbial interactions with stone induce the formation of biological crusts\u003c/h2\u003e \u003cp\u003eOptical microscopy revealed an abundance of fibrous cells in the biocrusts at the site, indicating colonization by filamentous cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Next, microbial activity in the biocrusts was evaluated using fluorescence staining to confirm the presence of a microbial community. Under the confocal microscope, the green fluorescent signals were significantly stronger in both quantity and intensity than the red fluorescent signals (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec), indicating the presence of numerous metabolically active cells in the biocrusts [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further confirm the morphology and microstructure of microbial communities in the biocrusts, scanning electron microscopy (SEM) analysis was performed under different magnifications. Similarly, hyphal cells were visible in the biocrusts (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed), around which many microparticles were present (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee). These microparticles might be fragments of deteriorated monuments or secondary biomineralization [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], mainly because the hyphae of fungi and cyanobacteria penetrate into the stone substrate, ultimately leading to the loosening and detachment of mineral particles [\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Previous research has demonstrated that such (bio)mechanical damage is a key initial step in biodeterioration [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Furthermore, microbial extracellular polymeric substances, such as polysaccharides, lipids, and proteins, can exhibit chelating properties, enabling them to bind minerals effectively and accelerate biocrust formation [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThese observations showed visual evidence of active microbial colonization within the biological crusts. Exploring the microbiomes in biological crusts will provide a crucial basis for understanding their role in the biodeterioration of stone monuments [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Thus, further investigation into microbial communities and their interactions with the physicochemical properties of biological crusts is essential to uncover the microbiomes shaping the formation of biological crusts on limestone monuments in the Xiaoling Tomb of the Ming Dynasty.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Microbial diversity and community of biological crusts\u003c/h2\u003e \u003cp\u003eUpon confirming the presence of a substantial number of active microorganisms, we investigated their diversity and composition in the biocrusts. This aimed to reveal the microbial communities associated with the biodeterioration of the Rectangular Tower and to explore the potential mechanisms underlying biodeterioration driven by biocrust formation. Generally, bacteria showed the highest biodiversity, followed by fungi, while archaea had the lowest (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBacterial communities across all samples were primarily composed of eight phyla, ranked in order of relative abundance as Cyanobacteria, Chloroflexi, Actinobacteria, Proteobacteria, Acidobacteria, Bacteroidota, Planctomycota, and Deinococcota (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Notably, two phototropic bacterial phyla, Cyanobacteria and Chloroflexi, predominated in the biocrusts, suggesting that photosynthesis might be a crucial process involved in biocrust formation [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Consistently, at the genus level (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec), the most abundant genera were o__Cyanobacteriales (accounting for approximately 19%), \u003cem\u003eChalicogloea_CCALA_975\u003c/em\u003e (approximately 13%), and \u003cem\u003eAKIW781\u003c/em\u003e (approximately 10%), which were all members of Cyanobacteria.\u003c/p\u003e \u003cp\u003eFungal communities in the biological crusts mainly consisted of Ascomycota, Basidiomycota, and Chytridiomycota (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). The dominant genera were \u003cem\u003eCiboria\u003c/em\u003e (accounting for approximately 12%), \u003cem\u003ePleosporales_gen_Incertae_sedis\u003c/em\u003e (approximately 11%), and \u003cem\u003eAnthracina\u003c/em\u003e (approximately 7%, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). These fungi have often been observed in the arid and semi-arid environments [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], which is consistent with the properties of the niches on the surface of stone monuments.\u003c/p\u003e \u003cp\u003eInterestingly, almost all the detected archaea belonged to the phylum Crenarchaeota (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). At the genus level (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg), the archaeal community was dominated by \u003cem\u003eCandidatus_\u003c/em\u003eNitrocosmicus and several genera within the family \u003cem\u003eNitrososphaeraceae\u003c/em\u003e. It is known that \u003cem\u003eCandidatus_\u003c/em\u003eNitrocosmicus is a classic ammonia-oxidizing archaeon capable of oxidizing ammonia to nitrite [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], while all cultured members of the \u003cem\u003eNitrososphaeraceae\u003c/em\u003e family are capable of chemolithoautotrophic growth through ammonia oxidation and carbon dioxide fixation [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Based on these metabolic characteristics, it can be reasonably inferred that the archaea detected in the biological crusts are primarily involved in the nitrogen cycle. This metabolic activity may also constitute a potential mechanism of biodeterioration.\u003c/p\u003e \u003cp\u003eAlthough we have gained a general understanding of microbiomes in biological crusts, the keystone taxa that shape their formation and drive the biodeterioration process remain unclear. Therefore, a combination of co-occurrence network analysis and Mantel tests could help identify the potential keystone taxa responsible for biocrust formation and the associated biodeterioration.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Keystone taxa shaping the formation of biological crusts\u003c/h2\u003e \u003cp\u003eTo identify key species, we constructed a microbial co-occurrence network from bacterial, fungal, and archaeal communities (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). The network comprised 536 nodes and 839 edges, with 47.08% of the correlations being positive. Based on differences in OUT relative abundance among modules within the co-occurrence network, the within-module connectivity (\u003cem\u003eZi\u003c/em\u003e) and among-module connectivity (\u003cem\u003ePi\u003c/em\u003e) were calculated for each node. Species were categorized into the following four types: (i) peripherals (\u003cem\u003eZi\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;2.5, \u003cem\u003ePi\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.62), which have few links and are almost always connected to nodes within their own modules; (ii) connectors (\u003cem\u003eZi\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;2.5, \u003cem\u003ePi\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.62), which are highly connected to multiple modules; (iii) module hubs (\u003cem\u003eZi\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;2.5, \u003cem\u003ePi\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.62), which are highly connected to many nodes within their module; and (iv) network hubs (\u003cem\u003eZi\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;2.5, \u003cem\u003ePi\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.62), which act as module hubs and connectors. Except for peripheral nodes, the other three categories were considered keystone taxa due to their crucial roles in the network topology [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Thus, 12 keystone taxa belonging to 11 genera were identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb) and highlighted in the network diagram (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). Moreover, most of these key species had high abundances within their own modules, and some (e.g., \u003cem\u003ePestalotiopsis\u003c/em\u003e, \u003cem\u003ePleosporales_gen_Incertae_sedis\u003c/em\u003e, and Roseiflexaceae \u003cem\u003egen.1\u003c/em\u003e) were even clustered within the same module. Both fungal genera are typical saprophytes or facultative parasites, possessing robust lignocellulolytic enzyme systems. Positioned at the terminal stage of the organic carbon decomposition chain, they degrade recalcitrant organic matter, with \u003cem\u003ePestalotiopsis\u003c/em\u003e recognized as a symbiont in lichens [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In contrast, the bacterial genus \u003cem\u003eRoseiflexaceae gen. 1\u003c/em\u003e may be at the front of the chain or work alongside other organisms in the chain. Powered by light energy, the microbiomes in the biocrusts could convert inorganic carbon into organic carbon or directly use early decomposition products, creating a small-scale carbon cycle nearby [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In addition, \u003cem\u003eScytonema_PCC-7110\u003c/em\u003e and \u003cem\u003eSpirosomaceae gen. 1\u003c/em\u003e were located within the same module. \u003cem\u003eScytonema\u003c/em\u003e is among the most prevalent genera in biocrusts and plays a significant role in nitrogen fixation [\u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. They are also a producer of extracellular polymeric substances (EPS), with their filaments encased in a thick mucilaginous sheath composed mainly of polysaccharides and glycoproteins [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. This sheath facilitates substrate attachment and promotes the formation of biocrusts, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea. Meanwhile, \u003cem\u003eSpirosomaceae gen. 1\u003c/em\u003e belongs to the \"cytophagia\" group and degrades complex polysaccharides [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In natural environments, the abundant EPS produced by \u003cem\u003eScytonema\u003c/em\u003e serves as a crucial carbon and energy source for heterotrophic bacteria, including \u003cem\u003eSpirosomaceae gen.1\u003c/em\u003e. The latter, in turn, recycles and mineralizes these organic compounds, thereby driving the carbon cycle. Thus, these two microbial taxa might form a consortium: \u003cem\u003eScytonema\u003c/em\u003e spp. provide \u003cem\u003eSpirosomaceae gen. 1\u003c/em\u003e with organic carbon and nitrogen-fixation products, while the latter may help maintain local microenvironmental stability.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo better elucidate the relationship between key species and potential biodeterioration processes, we applied the Mantel test to compare the abundances of different key species with the physicochemical properties of the biological crusts. The Mantel test calculates the correlation between two matrices and determines its statistical significance through permutation testing [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The Mantel test indicated that Ca\u003csup\u003e2+\u003c/sup\u003e content was significantly correlated with SO\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e2\u0026minus;\u003c/sup\u003e and Cl\u003csup\u003e\u0026minus;\u003c/sup\u003e, but had no significant correlation with NO\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e or NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). This finding diverges from our earlier inference that both nitrates and sulfates jointly promote biodeterioration, suggesting that the retention of Ca\u003csup\u003e2+\u003c/sup\u003e in the bio-deteriorated crusts may rely more on the involvement of excess hydrochloric acid (or chlorides) and sulfuric acid to maintain its dissolution and migration. Meanwhile, the fact that SO\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e2\u0026minus;\u003c/sup\u003e exhibits the highest concentration among all anions further supports this interpretation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003eIn the Mantel test, two genera c__Cyanobacteriia \u003cem\u003egen.1\u003c/em\u003e and \u003cem\u003eSetophaeosphaerias\u003c/em\u003e showed a significant correlation with NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and c__\u003cem\u003eAgaricomycetes gen.1\u003c/em\u003e demonstrated a highly significant correlation with NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), suggesting that these taxa are likely involved in nitrogen cycling in the biocrusts [\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Notably, many studies have indicated that the genus \u003cem\u003eSetophaeosphaeria\u003c/em\u003e is a dominant fungus in plant litter under slightly acidic conditions [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Since the bio-deteriorated crusts typically exhibit a weakly acidic environment due to the presence of organic and inorganic acids produced by microbial metabolism, this fungal genus is likely well-adapted to the biocrust microenvironment, where it may play an important ecological role in shaping biocrust formation. Furthermore, the fungal genus \u003cem\u003ePlectosphaerella\u003c/em\u003e showed significant correlations with SO\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e2\u0026minus;\u003c/sup\u003e, Cl\u003csup\u003e⁻\u003c/sup\u003e, K\u003csup\u003e+\u003c/sup\u003e, and Mg\u003csup\u003e2+\u003c/sup\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), suggesting that it may be a potential keystone taxon involved in biodeterioration of the stone monuments. Together, c__Cyanobacteriia \u003cem\u003egen.1\u003c/em\u003e, \u003cem\u003eSetophaeosphaeria\u003c/em\u003e, c__Agaricomycetes \u003cem\u003egen.1\u003c/em\u003e, and \u003cem\u003ePlectosphaerella\u003c/em\u003e are likely the keystone taxa responsible for biocrust formation and the associated biodeterioration.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eTo elucidate the association between microbial communities and biocrust formation on the limestone wall of the Rectangular Tower in the Imperial Xiaoling Mausoleum, this study integrated high-throughput sequencing data with physicochemical measurements. We examined not only bacteria but also profiled the archaeal and fungal communities simultaneously. By constructing topological networks and applying Mantel analysis, key microbial groups shaping biocrust formation were identified.\u003c/p\u003e \u003cp\u003eAlthough 11 keystone taxa at the genus level were identified to shape the formation of biocrusts, statistical analysis indicated that only 4 of these keystone taxa showed significant correlations with physicochemical factors associated with biodeterioration. This suggests that further research on the biodeterioration of stone monuments should extend beyond community diversity metrics and focus more on the functional analysis of microorganisms. Previous studies have shown that the biodeterioration of stone is often closely linked to fungal and plant-related activities. Asunci\u0026oacute;n also observed that persistent endolithic fungal growth, including both lichenized and non-lichenized fungal hyphae, contributed to the observed biodeterioration processes through alterations induced by their internal penetration [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Among the four final key taxa we identified, only one belonged to Bacteria (c__Cyanobacteriia \u003cem\u003egen.1\u003c/em\u003e), while the remaining three (\u003cem\u003eSetophaeosphaeria\u003c/em\u003e, c__Agaricomycetes \u003cem\u003egen.1\u003c/em\u003e, and \u003cem\u003ePlectosphaerella\u003c/em\u003e) belonged to Fungi. This further supports the view that fungi are the prime deteriogens of stone monuments and buildings.\u003c/p\u003e \u003cp\u003eBiocrusts of the Rectangular Tower exhibit multiple forms of deterioration, including calcium deposits, secondary mineralization, and exfoliation. Future research needs to consider their synergistic effects and incorporate longer time scales and a broader range of climatic conditions [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This will help refine our understanding of the succession of keystone taxa and their associated metabolic patterns during the biodeterioration process of the Rectangular Tower in the Imperial Xiaoling Mausoleum. Furthermore, integrating multi-omics technologies, such as metagenomics and metatranscriptomics, can provide deeper insights into the metabolic processes of key taxa, clarifying the biochemical mechanisms driving biodeterioration [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Combining culture-dependent and culture-independent techniques with chemical analytical methods will yield a more comprehensive understanding of the complex biodeterioration processes affecting stone monuments [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], thereby facilitating the development of more effective conservation strategies [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Moreover, a comparative analysis of microbial community structures and functions across heritage sites in different climatic zones will help establish a universal predictive model for the biodeterioration of cultural heritage.\u003c/p\u003e \u003cp\u003eIn summary, this study successfully identified the keystone species shaping the formation of biocrusts and involved in biodeterioration of the Rectangular Tower in the Imperial Xiaoling Mausoleum. We claim that it is essential to conduct case-specific diagnostics to identify the keystone taxa and their metabolic functions before implementing protective interventions [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Our study not only enhances understanding of the mechanisms underlying stone heritage biodeterioration during biocrust formation but also promotes the advancement of cultural heritage conservation science toward greater precision and systematic development.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis study was funded by the Basic Research Program of Jiangsu Province (Grant No. BK20250086) and the National Natural Science Foundation of China (Grant Nos. 32570139 and 32370105).\u003c/p\u003e\n\u003cp\u003eCompeting Interests\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003eAuthor Contributions\u003c/p\u003e\n\u003cp\u003eX.L. and F.W. designed and managed the project. W.W., X.H. and X.L. performed laboratory assays, analyzed the data, and interpreted the results. W.W. wrote the manuscript. X.L. and F.W. edited and wrote sections of the manuscript. All authors reviewed the manuscript and approved this submission.\u003c/p\u003e\n\u003cp\u003eData Availability\u003c/p\u003e\n\u003cp\u003eThe raw gene seuqence data supporting this study were available in the National Center for Biotechnology Information (NCBI) under accession no. PRJNA1380739.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eWarscheid T, Braams J: \u003cstrong\u003eBiodeterioration of stone: a review\u003c/strong\u003e. \u003cem\u003eInternational Biodeterioration \u0026amp; Biodegradation\u0026nbsp;\u003c/em\u003e2000, \u003cstrong\u003e46\u003c/strong\u003e(4):343-368.\u003c/li\u003e\n \u003cli\u003eGorbushina AA: \u003cstrong\u003eLife on the rocks\u003c/strong\u003e. \u003cem\u003eEnvironmental Microbiology\u0026nbsp;\u003c/em\u003e2007, \u003cstrong\u003e9\u003c/strong\u003e(7):1613-1631.\u003c/li\u003e\n \u003cli\u003eSun C, Gao J, Wang S: \u003cstrong\u003eInvestigation and Disease Analysis of Brick Buildings in Ming Xiaoling Mausoleum\u003c/strong\u003e. \u003cem\u003eChinese\u0026nbsp;\u003c/em\u003e\u003cem\u003e&\u003c/em\u003e\u003cem\u003e\u0026nbsp;Overseas Architecture\u0026nbsp;\u003c/em\u003e2025(6):129-134.\u003c/li\u003e\n \u003cli\u003eYang Y, Deng Y, Cai C, Wang F, Fang Y, Duan X: \u003cstrong\u003eBiocrusts\u0026rsquo; impact on hydrological processes and erosion dynamics: A review\u003c/strong\u003e. \u003cem\u003eGeoderma\u0026nbsp;\u003c/em\u003e2025, \u003cstrong\u003e459\u003c/strong\u003e:117383.\u003c/li\u003e\n \u003cli\u003eCao Y, Bowker MA, Delgado-Baquerizo M, Xiao B: \u003cstrong\u003eBiocrusts protect the Great Wall of China from erosion\u003c/strong\u003e. \u003cem\u003eScience Advances\u0026nbsp;\u003c/em\u003e2023, \u003cstrong\u003e9\u003c/strong\u003e(49):eadk5892.\u003c/li\u003e\n \u003cli\u003eWeber BA-O, Belnap J, B\u0026uuml;del B, Antoninka AJ, Barger NN, Chaudhary VB, Darrouzet-Nardi A, Eldridge DJ, Faist AM, Ferrenberg S\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eWhat is a biocrust? A refined, contemporary definition for a broadening research community\u003c/strong\u003e. \u003cem\u003eBiological reviews of the Cambridge Philosophical Society\u0026nbsp;\u003c/em\u003e2022, \u003cstrong\u003e97(5)\u003c/strong\u003e:1768-1785.\u003c/li\u003e\n \u003cli\u003eBellinzoni AM, Caneva G, Ricci S: \u003cstrong\u003eEcological trends in travertine colonisation by pioneer algae and plant communities\u003c/strong\u003e. \u003cem\u003eInternational Biodeterioration \u0026amp; Biodegradation\u0026nbsp;\u003c/em\u003e2003, \u003cstrong\u003e51\u003c/strong\u003e(3):203-210.\u003c/li\u003e\n \u003cli\u003eBeraldi-Campesi H, Hartnett He Fau - Anbar A, Anbar A Fau - Gordon GW, Gordon Gw Fau - Garcia-Pichel F, Garcia-Pichel F: \u003cstrong\u003eEffect of biological soil crusts on soil elemental concentrations: implications for biogeochemistry and as traceable biosignatures of ancient life on land\u003c/strong\u003e. \u003cem\u003eGeobiology\u0026nbsp;\u003c/em\u003e2009, \u003cstrong\u003e7(3)\u003c/strong\u003e:348-359.\u003c/li\u003e\n \u003cli\u003eXiong W, Tao Y, Wang P, Wu K, Chen L: \u003cstrong\u003eImpact of Environmental Factors on the Formation and Development of Biological Soil Crusts in Lime Concrete Materials of Building Facades\u003c/strong\u003e. \u003cem\u003eApplied Sciences\u0026nbsp;\u003c/em\u003e2022, \u003cstrong\u003e12\u003c/strong\u003e(6):2974.\u003c/li\u003e\n \u003cli\u003eLeplat J, Bousta F, Fran\u0026ccedil;ois A, Guiavarc\u0026apos;h M, Mertz J-D, Brissaud D: \u003cstrong\u003eThe pink staircase of Sully-sur-Loire castle: Even bacteria like historic stonework\u003c/strong\u003e. \u003cem\u003eInternational Biodeterioration \u0026amp; Biodegradation\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e145\u003c/strong\u003e:104805.\u003c/li\u003e\n \u003cli\u003eTighe M, Haling RE, Flavel RJ, Young IM: \u003cstrong\u003eEcological Succession, Hydrology and Carbon Acquisition of Biological Soil Crusts Measured at the Micro-Scale\u003c/strong\u003e. \u003cem\u003ePLOS ONE\u0026nbsp;\u003c/em\u003e2012, \u003cstrong\u003e7\u003c/strong\u003e(10):e48565.\u003c/li\u003e\n \u003cli\u003eCheccucci A, Borruso L, Petrocchi D, Perito B: \u003cstrong\u003eDiversity and metabolic profile of the microbial communities inhabiting the darkened white marble of Florence Cathedral\u003c/strong\u003e. \u003cem\u003eInternational Biodeterioration \u0026amp; Biodegradation\u0026nbsp;\u003c/em\u003e2022, \u003cstrong\u003e171\u003c/strong\u003e:105420.\u003c/li\u003e\n \u003cli\u003eMa W, Wu F, Tian T, He D, Zhang Q, Gu J-D, Duan Y, Ma D, Wang W, Feng H: \u003cstrong\u003eFungal diversity and its contribution to the biodeterioration of mural paintings in two 1700-year-old tombs of China\u003c/strong\u003e. \u003cem\u003eInternational Biodeterioration \u0026amp; Biodegradation\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e152\u003c/strong\u003e:104972.\u003c/li\u003e\n \u003cli\u003eCai X, Sun L, Wan L: \u003cstrong\u003eInvestigation of microbial community on the Ming Dynasty Wall at Nanjing and an exploration of the effect of algal bio- weathering on the wall brick\u003c/strong\u003e. \u003cem\u003eSciences of Conservation and Archaeology\u0026nbsp;\u003c/em\u003e2016, \u003cstrong\u003e28\u003c/strong\u003e(2):9.\u003c/li\u003e\n \u003cli\u003eMagoč T, Salzberg SL: \u003cstrong\u003eFLASH: fast length adjustment of short reads to improve genome assemblies.\u003c/strong\u003e \u003cem\u003eBioinformatics (Oxford, England)\u0026nbsp;\u003c/em\u003e2011, \u003cstrong\u003e27\u003c/strong\u003e(21):2957-2963.\u003c/li\u003e\n \u003cli\u003eBokulich NA, Subramanian S, Faith JJ, Gevers D, Gordon JI, Knight R, Mills DA, Caporaso JG: \u003cstrong\u003eQuality-filtering vastly improves diversity estimates from Illumina amplicon sequencing\u003c/strong\u003e. \u003cem\u003eNature Methods\u0026nbsp;\u003c/em\u003e2013, \u003cstrong\u003e10\u003c/strong\u003e(1):57-59.\u003c/li\u003e\n \u003cli\u003eEdgar RC, Haas BJ, Clemente JC, Quince C, Knight R: \u003cstrong\u003eUCHIME improves sensitivity and speed of chimera detection.\u003c/strong\u003e \u003cem\u003eBioinformatics (Oxford, England)\u0026nbsp;\u003c/em\u003e2011, \u003cstrong\u003e27\u003c/strong\u003e(16):2194-2200.\u003c/li\u003e\n \u003cli\u003eZhou J, Deng Y, Luo F, He Z, Tu Q, Zhi X: \u003cstrong\u003eFunctional Molecular Ecological Networks\u003c/strong\u003e. \u003cem\u003emBio\u0026nbsp;\u003c/em\u003e2010, \u003cstrong\u003e1\u003c/strong\u003e(4):10.1128/mbio.00169-00110.\u003c/li\u003e\n \u003cli\u003eDeng Y, Jiang Y-H, Yang Y, He Z, Luo F, Zhou J: \u003cstrong\u003eMolecular ecological network analyses\u003c/strong\u003e. \u003cem\u003eBMC Bioinformatics\u0026nbsp;\u003c/em\u003e2012, \u003cstrong\u003e13\u003c/strong\u003e(1):113.\u003c/li\u003e\n \u003cli\u003eHuang H: \u003cstrong\u003elinkET: Everything is Linkable\u003c/strong\u003e; 2021.\u003c/li\u003e\n \u003cli\u003eXingyu S, Xiaodan L, Yiming K: \u003cstrong\u003eResearch in the Brick and Stone Construction of Fang-cheng in the Ming Xiaoling Mausoleum in Nanjing\u003c/strong\u003e. \u003cem\u003eTime Architecture\u0026nbsp;\u003c/em\u003e2015(6):21-25.\u003c/li\u003e\n \u003cli\u003eSchifano E, Cavallini D, De Bellis G, Bracciale MP, Felici AC, Santarelli ML, Sarto MS, Uccelletti D: \u003cstrong\u003eAntibacterial Effect of Zinc Oxide-Based Nanomaterials on Environmental Biodeteriogens Affecting Historical Buildings\u003c/strong\u003e. \u003cem\u003eNanomaterials\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e10\u003c/strong\u003e(2):335.\u003c/li\u003e\n \u003cli\u003eLiu X, Koestler RJ, Warscheid T, Katayama Y, Gu J-D: \u003cstrong\u003eMicrobial deterioration and sustainable conservation of stone monuments and buildings\u003c/strong\u003e. \u003cem\u003eNature Sustainability\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e3\u003c/strong\u003e(12):991-1004.\u003c/li\u003e\n \u003cli\u003eMa C, Fang Z, Li X, Liu X: \u003cstrong\u003eIdentification of bacterial communities involved in bioweathering crusts on limestone sculptures of the Longmen Grottoes\u003c/strong\u003e. In: \u003cem\u003eCoatings.\u003c/em\u003e vol. 13; 2023: 1506.\u003c/li\u003e\n \u003cli\u003eWang Y, Zhang H, Liu X, Liu X, Song W: \u003cstrong\u003eFungal communities in the biofilms colonizing the basalt sculptures of the Leizhou Stone Dogs and assessment of a conservation measure\u003c/strong\u003e. \u003cem\u003enpj Heritage Science\u0026nbsp;\u003c/em\u003e2021, \u003cstrong\u003e9\u003c/strong\u003e(1):36.\u003c/li\u003e\n \u003cli\u003eWu F, Zhang Y, Gu J-D, He D, Zhang G, Liu X, Guo Q, Cui H, Zhao J, Feng H: \u003cstrong\u003eCommunity assembly, potential functions and interactions between fungi and microalgae associated with biodeterioration of sandstone at the Beishiku Temple in Northwest China\u003c/strong\u003e. \u003cem\u003eScience of The Total Environment\u0026nbsp;\u003c/em\u003e2022, \u003cstrong\u003e835\u003c/strong\u003e:155372.\u003c/li\u003e\n \u003cli\u003eHokputsa S, Hu C, Paulsen BS, Harding SEJCP: \u003cstrong\u003eA physico-chemical comparative study on extracellular carbohydrate polymers from five desert algae\u003c/strong\u003e. \u003cem\u003eCarbohydrate Polymers\u0026nbsp;\u003c/em\u003e2003, \u003cstrong\u003e54\u003c/strong\u003e:27-32.\u003c/li\u003e\n \u003cli\u003eWang L, Huang J, Sanmart\u0026iacute;n P, Martino PD, Wu F, Urz\u0026igrave; CE, Gu J-D, Liu X: \u003cstrong\u003eWater determines geomicrobiological impact on stone heritage\u003c/strong\u003e. \u003cem\u003eNature Geoscience\u0026nbsp;\u003c/em\u003e2025, \u003cstrong\u003e18\u003c/strong\u003e(2):108-111.\u003c/li\u003e\n \u003cli\u003eLiu X, Qian Y, Wu F, Wang Y, Wang W, Gu J-D: \u003cstrong\u003eBiofilms on stone monuments: biodeterioration or bioprotection?\u003c/strong\u003e \u003cem\u003eTrends in Microbiology\u0026nbsp;\u003c/em\u003e2022, \u003cstrong\u003e30\u003c/strong\u003e(9):816-819.\u003c/li\u003e\n \u003cli\u003eBryant DA, Liu Z, Li T, Zhao F, Costas AMG, Klatt CG, Ward DM, Frigaard N-U, Overmann J: \u003cstrong\u003eComparative and Functional Genomics of Anoxygenic Green Bacteria from the Taxa Chlorobi, Chloroflexi, and Acidobacteria\u003c/strong\u003e. In: \u003cem\u003eFunctional Genomics and Evolution of Photosynthetic Systems.\u003c/em\u003e Edited by Burnap R, Vermaas W. Dordrecht: Springer Netherlands; 2012: 47-102.\u003c/li\u003e\n \u003cli\u003eTidimalo C, Maximiliano O, Karen J, Lebre PH, Bernard O, Michelle G, Oagile D, Cowan DA: \u003cstrong\u003eMicrobial diversity in the arid and semi-arid soils of Botswana\u003c/strong\u003e. \u003cem\u003eEnviron Microbiol Rep\u0026nbsp;\u003c/em\u003e2024, \u003cstrong\u003e16\u003c/strong\u003e(6):e70044.\u003c/li\u003e\n \u003cli\u003eSauder LA, Albertsen M, Engel K, Schwarz J, Nielsen PH, Wagner M, Neufeld JD: \u003cstrong\u003eCultivation and characterization of Candidatus Nitrosocosmicus exaquare, an ammonia-oxidizing archaeon from a municipal wastewater treatment system\u003c/strong\u003e. \u003cem\u003eThe ISME Journal\u0026nbsp;\u003c/em\u003e2017, \u003cstrong\u003e11\u003c/strong\u003e(5):1142-1157.\u003c/li\u003e\n \u003cli\u003eKerou M, Schleper C: \u003cstrong\u003eNitrososphaeraceae\u003c/strong\u003e. In: \u003cem\u003eBergey\u0026apos;s Manual of Systematics of Archaea and Bacteria.\u003c/em\u003e 2016: 1-2.\u003c/li\u003e\n \u003cli\u003eMaharachchikumbura SSN, Guo L-D, Chukeatirote E, Bahkali AH, Hyde KD: \u003cstrong\u003ePestalotiopsis\u0026mdash;morphology, phylogeny, biochemistry and diversity\u003c/strong\u003e. \u003cem\u003eFungal Diversity\u0026nbsp;\u003c/em\u003e2011, \u003cstrong\u003e50\u003c/strong\u003e(1):167-187.\u003c/li\u003e\n \u003cli\u003eHanada S: \u003cstrong\u003eThe Phylum Chloroflexi, the Family Chloroflexaceae, and the Related Phototrophic Families Oscillochloridaceae and Roseiflexaceae\u003c/strong\u003e. In: \u003cem\u003eThe Prokaryotes: Other Major Lineages of Bacteria and The Archaea.\u003c/em\u003e Edited by Rosenberg E, DeLong EF, Lory S, Stackebrandt E, Thompson F. Berlin, Heidelberg: Springer Berlin Heidelberg; 2014: 515-532.\u003c/li\u003e\n \u003cli\u003eYeager CM, Kornosky JL, Morgan RE, Cain EC, Garcia-Pichel F, Housman DC, Belnap J, Kuske CR: \u003cstrong\u003eThree distinct clades of cultured heterocystous cyanobacteria constitute the dominant N2-fixing members of biological soil crusts of the Colorado Plateau, USA\u003c/strong\u003e. \u003cem\u003eFEMS Microbiology Ecology\u0026nbsp;\u003c/em\u003e2007, \u003cstrong\u003e60\u003c/strong\u003e(1):85-97.\u003c/li\u003e\n \u003cli\u003eSant\u0026rsquo;Anna CLJNH: \u003cstrong\u003eScytonemataceae (Cyanophyceae) from the state of S\u0026atilde;o Paulo, southern Brazil\u003c/strong\u003e. \u003cem\u003eNova Hedwigia\u0026nbsp;\u003c/em\u003e1988, \u003cstrong\u003e46\u003c/strong\u003e:519-539.\u003c/li\u003e\n \u003cli\u003eAbrantes GH, G\u0026uuml;cker B, Chaves RC, Bo\u0026euml;chat IG, Figueredo CC: \u003cstrong\u003eEpilithic biofilms provide large amounts of nitrogen to tropical mountain landscapes\u003c/strong\u003e. \u003cem\u003eEnvironmental Microbiology\u0026nbsp;\u003c/em\u003e2023, \u003cstrong\u003e25\u003c/strong\u003e(12):3592-3603.\u003c/li\u003e\n \u003cli\u003eKom\u0026aacute;rek J, Kling H, Kom\u0026aacute;rkov\u0026aacute; J: \u003cstrong\u003e4 - FILAMENTOUS CYANOBACTERIA\u003c/strong\u003e. In: \u003cem\u003eFreshwater Algae of North America.\u003c/em\u003e Edited by Wehr JD, Sheath RG. Burlington: Academic Press; 2003: 117-196.\u003c/li\u003e\n \u003cli\u003eRaj HD, Maloy SR: \u003cstrong\u003eFamily Spirosomaceae: Gram-Negative Ring-Forming Aerobic Bacteria\u003c/strong\u003e. \u003cem\u003eCritical Reviews in Microbiology\u0026nbsp;\u003c/em\u003e1990, \u003cstrong\u003e17\u003c/strong\u003e(5):329-364.\u003c/li\u003e\n \u003cli\u003eMantel N: \u003cstrong\u003eThe detection of disease clustering and a generalized regression approach.\u003c/strong\u003e \u003cem\u003eCancer research\u0026nbsp;\u003c/em\u003e1967, \u003cstrong\u003e27\u003c/strong\u003e(2):209-220.\u003c/li\u003e\n \u003cli\u003eHuang Y, Li P, Chen G, Peng L, Chen X: \u003cstrong\u003eThe production of cyanobacterial carbon under nitrogen-limited cultivation and its potential for nitrate removal\u003c/strong\u003e. \u003cem\u003eChemosphere\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e190\u003c/strong\u003e:1-8.\u003c/li\u003e\n \u003cli\u003eChen X, Wang K, Li X, Qiao Y, Dong K, Yang L: \u003cstrong\u003eMicrocystis blooms aggravate the diurnal alternation of nitrification and nitrate reduction in the water column in Lake Taihu\u003c/strong\u003e. \u003cem\u003eScience of The Total Environment\u0026nbsp;\u003c/em\u003e2021, \u003cstrong\u003e767\u003c/strong\u003e:144884.\u003c/li\u003e\n \u003cli\u003eGao J, Liu G, Xiong Z, Cao X, Zhou Y, Song C: \u003cstrong\u003eDissolved organic nitrogen and phosphorus derived from different cyanobacteria regulate distinctly different nitrate reduction pathways in sediments\u003c/strong\u003e. \u003cem\u003eWater Research\u0026nbsp;\u003c/em\u003e2025, \u003cstrong\u003e287\u003c/strong\u003e:124520.\u003c/li\u003e\n \u003cli\u003eDu J, Qv W, Niu Y, Yuan S, Zhang L, Yang H, Zhang Y: \u003cstrong\u003eCo-exposures of acid rain and ZnO nanoparticles accelerate decomposition of aquatic leaf litter\u003c/strong\u003e. \u003cem\u003eJournal of Hazardous Materials\u0026nbsp;\u003c/em\u003e2022, \u003cstrong\u003e426\u003c/strong\u003e:128141.\u003c/li\u003e\n \u003cli\u003ede los R\u0026iacute;os A, C\u0026aacute;mara B, Garc\u0026iacute;a del Cura M\u0026Aacute;, Rico VJ, Galv\u0026aacute;n V, Ascaso C: \u003cstrong\u003eDeteriorating effects of lichen and microbial colonization of carbonate building rocks in the Romanesque churches of Segovia (Spain)\u003c/strong\u003e. \u003cem\u003eScience of The Total Environment\u0026nbsp;\u003c/em\u003e2009, \u003cstrong\u003e407\u003c/strong\u003e(3):1123-1134.\u003c/li\u003e\n \u003cli\u003eFu X, Wu F, Liu X: \u003cstrong\u003eBio-archive of cultural heritage microbiomes for sustainable conservation in the multi-omics era\u003c/strong\u003e. \u003cem\u003eAdvanced Genetics\u0026nbsp;\u003c/em\u003e2025, \u003cstrong\u003e6\u003c/strong\u003e(4):e00046.\u003c/li\u003e\n \u003cli\u003eLiu X, Qian Y, Wang Y, Wu F, Wang W, Gu J-D: \u003cstrong\u003eInnovative approaches for the processes involved in microbial biodeterioration of cultural heritage materials\u003c/strong\u003e. \u003cem\u003eCurrent Opinion in Biotechnology\u0026nbsp;\u003c/em\u003e2022, \u003cstrong\u003e75\u003c/strong\u003e:102716.\u003c/li\u003e\n \u003cli\u003eWang L, Ma C, Wu F, Liu X: \u003cstrong\u003eIdentification and screening of acid-secreting bacterial strains isolated from limestone of the Longmen Grottoes monuments\u003c/strong\u003e. \u003cem\u003eInternational Biodeterioration \u0026amp; Biodegradation\u0026nbsp;\u003c/em\u003e2026, \u003cstrong\u003e208\u003c/strong\u003e:106255.\u003c/li\u003e\n \u003cli\u003eMa C, Zhang X, Wu F, Liu X: \u003cstrong\u003eIdentifying keystone taxa and metabolisms of epilithic biofilms is crucial to the conservation of stone heritage from biodeterioration\u003c/strong\u003e. \u003cem\u003eFrontiers in Microbiology\u0026nbsp;\u003c/em\u003e2025, \u003cstrong\u003eVolume 16 - 2025\u003c/strong\u003e.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"environmental-microbiome","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"sigs","sideBox":"Learn more about [Environmental Microbiome](https://environmentalmicrobiome.biomedcentral.com)","snPcode":"40793","submissionUrl":"https://submission.nature.com/new-submission/40793/3","title":"Environmental Microbiome","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8923180/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8923180/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe limestone monuments of the Rectangular Tower in the Xiaoling Tomb of the Ming Dynasty, created in the mid-14th century, are biodeteriorating due to environmental exposure, leading to the formation of black biocrusts. However, the microbiomes shaping biocrust formation and the biodeterioration involved remain unclear, which largely challenges the conservation of stone monuments at this archaeological site. Here, we systematically investigated the physicochemical properties and microbial communities of biocrusts to identify keystone taxa that shape their formation and biodeterioration. Physicochemical analysis showed that biological crusts contribute to substantial calcium loss of the limestone monuments. Microscopy and spectroscopy indicated that microbial interactions with limestone promote the formation of biological crusts. High-throughput sequencing revealed that two photosynthetic bacterial phyla, Cyanobacteria and Chloroflexi, predominated in the biocrusts, suggesting that photosynthesis might be a crucial process involved in biocrust formation. Moreover, fungal communities in the biological crusts mainly consisted of Ascomycota, Basidiomycota, and Chytridiomycota, with archaeal communities purely dominated by Crenarchaeota. Microbial co-occurrence network and correlation analyses identified 12 keystone taxa across 11 genera that shape biocrust formation. Importantly, \u003cem\u003eScytonema\u003c/em\u003e could provide organic carbon and nitrogen fixation for \u003cem\u003eSpirosomaceae\u003c/em\u003e, and \u003cem\u003eCyanobacteriia\u003c/em\u003e, \u003cem\u003eSetophaeosphaeria\u003c/em\u003e, \u003cem\u003eAgaricomycetes\u003c/em\u003e, and \u003cem\u003ePlectosphaerella\u003c/em\u003e are likely the keystone taxa responsible for both biocrust formation and the associated biodeterioration. Additionally, two predominant ammonia-oxidizing archaea, \u003cem\u003eNitrososphaeraceae\u003c/em\u003e and \u003cem\u003eCandidatus_\u003c/em\u003eNitrocosmicus, could support chemolithoautotrophic growth in the microbiome by oxidizing ammonia and fixing carbon dioxide. Together, these findings underscore the need for targeted conservation strategies to mitigate microbial biodeterioration of stone monuments during biocrust formation.\u003c/p\u003e","manuscriptTitle":"Identification of keystone taxa shaping biocrust formation and biodeterioration of limestone monuments in the Xiaoling Tomb of the Ming Dynasty","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-20 14:02:25","doi":"10.21203/rs.3.rs-8923180/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-07T15:29:15+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-07T10:44:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-07T01:45:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"213429161824124986616873843528984879665","date":"2026-03-18T11:49:35+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"11336632637079412035491447217772855110","date":"2026-03-18T02:10:50+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-17T23:29:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-11T11:54:20+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-11T07:05:24+00:00","index":"","fulltext":""},{"type":"submitted","content":"Environmental Microbiome","date":"2026-03-10T03:56:52+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"environmental-microbiome","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"sigs","sideBox":"Learn more about [Environmental Microbiome](https://environmentalmicrobiome.biomedcentral.com)","snPcode":"40793","submissionUrl":"https://submission.nature.com/new-submission/40793/3","title":"Environmental Microbiome","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"61e94718-d89c-4fed-addb-bcb34281a7e0","owner":[],"postedDate":"March 20th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-18T14:54:27+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-20 14:02:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8923180","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8923180","identity":"rs-8923180","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00