Activation of Toll and IMD pathways in the Drosophila brain following local and systemic bacterial infection

Activation of Toll and IMD pathways in the Drosophila brain following local and systemic bacterial infection | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Activation of Toll and IMD pathways in the Drosophila brain following local and systemic bacterial infection View ORCID Profile Sameekshya Mainali , Isaac Toles , Paige Magid , View ORCID Profile Jordan Grammer , Lauren Harper , Elizabeth Kitchens , Kaitlin Davis , View ORCID Profile Stanislava Chtarbanova doi: https://doi.org/10.1101/2025.10.20.683553 Sameekshya Mainali 1 Department of Biological Sciences, University of Alabama , Tuscaloosa, AL-35487 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Sameekshya Mainali Isaac Toles 1 Department of Biological Sciences, University of Alabama , Tuscaloosa, AL-35487 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Paige Magid 1 Department of Biological Sciences, University of Alabama , Tuscaloosa, AL-35487 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jordan Grammer 1 Department of Biological Sciences, University of Alabama , Tuscaloosa, AL-35487 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jordan Grammer Lauren Harper 1 Department of Biological Sciences, University of Alabama , Tuscaloosa, AL-35487 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Elizabeth Kitchens 1 Department of Biological Sciences, University of Alabama , Tuscaloosa, AL-35487 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kaitlin Davis 1 Department of Biological Sciences, University of Alabama , Tuscaloosa, AL-35487 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Stanislava Chtarbanova 1 Department of Biological Sciences, University of Alabama , Tuscaloosa, AL-35487 2 Center for Convergent Bioscience and Medicine, University of Alabama , Tuscaloosa, AL-35487 3 Alabama Life Research Institute, University of Alabama , Tuscaloosa, AL-35487 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Stanislava Chtarbanova For correspondence: schtarbanova{at}ua.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Brain infections are often life-threatening and have been linked to the development of neurodegenerative diseases. The fruit fly Drosophila melanogaster is a valuable experimental model to study immunity and the pathophysiology of brain infections. The exact cellular pathways through which brain-specific immune responses are mounted in Drosophila , however, remain poorly characterized. Here, we investigated how brain-specific or systemic infection with Micrococcus luteus and Escherichia coli bacteria activates the Drosophila NF-κB innate immune pathways Toll and immune deficiency (IMD) in the central nervous system of the fly. We tested the hypothesis that these pathways are acutely activated in the Drosophila brain, and that their activation persists over time, even if bacteria have been cleared. We demonstrate that in control genotypes, brain-specific bacterial infection leads to Drosomycin ( Drs , Toll pathway) and Diptericin B ( DiptB , IMD pathway) upregulation and that glia appear to be the primary cell type mounting this immune response at both early and later stages of infection, although some activation is observed in neurons as well. We show that the upregulation of Drs and DiptB expression also depends on canonical components of the Toll and IMD pathways, respectively. Interestingly, we found that systemic infection with M. luteus leads to brain-specific Drs activation and that signals from the fat body and hemocytes can activate the Toll pathway in the brain, pointing to an inter-organ communication. Together, these results contribute to our understanding of how non-lethal bacterial infections result in activation of NF-κB immunity in Drosophila brain that could potentially be targeted to prevent progression of neurodegeneration. Highlights Brain immunity is induced following bacterial brain infection and depends on canonical NF-κB pathway components. NF-κB signaling pathways are induced acutely and persist over time after bacterial brain infection. Host functional immunity clears bacteria in the brain post-bacterial brain infection. Glia are the main brain cell type in which NF-κB immunity is induced at both early and later stages of bacterial infection. Introduction Central nervous system (CNS) infections caused by bacteria, viruses, fungi, or parasites can lead to long-term neurological damage or death. The human CNS is protected by an innate immune system primarily via resident immune cells such as microglia and astrocytes. These cells are crucial for mounting a defense against various external threats, including infections and injuries ( Lye and Chtarbanova, 2018 ; Rodríguez et al., 2022 ). Following a brain infection, an innate immune inflammatory cascade is initiated, which proceeds through multiple cellular and molecular phases that help in clearing the pathogen ( Lotz et al., 2021 ; Zindler and Zipp, 2010 ). This immediate, short-term acute immune response is beneficial and promotes tissue healing ( Postolache et al., 2020 ). However, the nature of this immune response can shift from protective to detrimental. For instance, in the context of brain injuries, prolonged and chronic activation of the immune system, particularly the sustained response of macrophages (including microglia), can lead to a secondary phase of tissue damage. This chronic neuroinflammation is a significant factor in long-term functional loss. It is characterized by the persistent release of inflammatory molecules that can be toxic to neurons and other surrounding brain cells ( Larrea et al., 2023 ; Swanson et al., 2020a ; Winkler et al., 2025 ). Thus, appropriate immune reactions in the brain are indispensable to reducing the harmful effects of infection and maintaining overall brain health. The fruit fly Drosophila melanogaster is a powerful model organism that shares conserved Nuclear Factor kappa B (NF-κB) innate immune signaling pathways with mammals, including the Toll pathway, which is similar to mammalian Toll-like receptor (TLR) and Interleukin-1 receptor (IL-1R) pathway, and the immune deficiency (IMD) pathway which is similar to the mammalian Tumor Necrosis Factor Receptor (TNFR) pathway. Following systemic infection, activation of both pathways depends on the recognition of microbial cell wall components or virulence factors by Drosophila pattern recognition receptors (PRRs) ( Lemaitre and Hoffmann, 2007 ; Liegeois and Ferrandon, 2022 ). The Toll pathway is activated by microbial peptidoglycans through activation of an extracellular ligand, Spatzle (Spz) ( Leclerc and Reichhart, 2004 ). The Peptidoglycan recognition protein-SA (PGRP-SA)/Gram-negative bacteria binding protein 1 (GNBP1) complex, which is necessary for recognizing and responding to Gram-positive bacteria or the Gram-negative bacteria binding protein 3 (GNBP3), essential for sensing fungal infections, initiates a signaling cascade that leads to cleavage of Spz involving multiple proteolytic activities, particularly Spatzle-Processing Enzyme (SPE) ( Jang et al., 2006 ; Shan et al., 2023 ). Spz is synthesized as an inactive precursor molecule, which is cleaved into its active form by SPE. Cleaved Spz, binds to the Toll receptor, which is located on the cell membrane. This recognition initiates a downstream signaling pathway that involves phosphorylation and degradation of Cactus, an inhibitor of the NF-κB transcription factors Dorsal and Dorsal-related immunity factor (Dif) ( Lemaitre and Hoffmann, 2007 ; Rutschmann et al., 2000 ). Upon Cactus degradation, Dif translocates to the nucleus and initiates transcription of many genes, including genes encoding antimicrobial peptides (AMPs), with Drosomycin being a key target ( Lemaitre et al., 1997 ). On the other hand, DAP-type peptidoglycan of Gram-negative bacteria binds to the transmembrane receptor PGRP-LC that is found in the cell membrane, or the intracellular receptor Peptidoglycan Recognition Protein-LE (PGRP-LE), and activates the IMD pathway ( Liegeois and Ferrandon, 2022 ). Upon binding, a cascade of signaling events occurs, recruiting a complex formed of the adaptor proteins Imd, Fas-associated death domain (Fadd), and a caspase, Death-related ced-3 (Dredd). This complex activates the downstream IMD signaling components, resulting in the activation of the NF-κB transcription factor Relish (Rel). Rel translocates into the nucleus and initiates the transcription of many genes, including genes encoding AMPs, with Diptericin being a key target ( Myllymaki et al., 2014 ). Subsequently, these AMPs directly target pathogens and combat microbial threats. To prevent overstimulation and possible tissue damage, immune activation in Drosophila is also kept in check via negative regulatory mechanisms ( Lee and Ferrandon, 2011 ). This is particularly important in tissues such as the nervous system, which have minimal regenerative capacity. In Drosophila , mutations in several negative regulators resulting in excessive NF-κB pathway activation lead to neurodegeneration, altered locomotor behavior, and shorter lifespan ( Cao et al., 2013 ; Kounatidis et al., 2017 ). Additionally, direct introduction of a bacterial mix of Micrococcus luteus ( M. luteus , Gram-positive bacteria) and Escherichia coli ( E. coli , Gram-negative bacteria) into the fly brain leads to an NF-κB-mediated inflammatory response, which causes progressive neurodegeneration accompanied by impaired locomotor behavior ( Cao et al., 2013 ). Understanding the upstream steps of innate immune activation in the brain could therefore provide new insights about the pathophysiology of neurodegeneration. While systemic activation of innate immunity in response to bacterial pathogens in Drosophila has been characterized in great detail, the activation and the nature of innate immune reactions in tissues such as the brain remain understudied. One study showed that systemic infection performed by injecting Drosophila larvae with Group B Streptococcus (GBS) bacteria (Gram-positive bacteria) can trigger an inflammatory response via the activation of NF-κB signaling, which also leads to the recruitment of hemocytes (the fly equivalent to mammalian macrophages) to the brain ( Winkler et al., 2021 ). Because GBS is lethal to larvae it is difficult to examine neuroinflammatory responses that may persist following bacterial challenge and contribute to development of neurological sequalae over time. To address this gap in research, in this study, we utilized adult Drosophila melanogaster to study infection-induced neuroinflammation. We investigated how non-lethal brain infection and systemic infection with M. luteus and E. coli affect immune activation in the brain of control genotypes and various mutants of the Toll and IMD pathways. We show that bacterial infection leads to an acute (6-48h) Diptericin B ( DiptB) and Drosomycin ( Drs ) upregulation in wild-type (WT) control brains, and that this activation persists for up to two weeks following the initial challenge. We find that the IMD pathway mediates DiptB expression in the brain following E. coli brain infection and that the Toll pathway mediates Drs expression in the brain following M. luteus brain infection. We further show that functional immunity cleared the bacterial load in the brain 12h post-brain infection indicating that the long-term activation of immunity is not associated with the presence of live bacteria that have not been cleared by the host. We also demonstrate that systemic M. luteus infection leads to Drs expression in the brain of control genotypes, activation that is mediated via signals from the periphery. Using immunohistochemistry and a co-localization approach, we also show that following bacterial challenge, Toll and IMD pathways are primarily activated in glial cells in the brain. Materials and methods Drosophila stocks and handling Drosophila stocks were amplified and maintained on standard Nutri-Fly® Bloomington formulation food (Cat #: 66-113) in a 25°C incubator. 0-3 days-old flies were collected and aged for 2-3 days before experiments were conducted. For experiments involving aging up to two weeks old, flies were flipped every 2-3 days in a fresh food-containing vial until the desired age was reached. The following Drosophila stocks were used as control genotypes: y 1 w 67C23 (BL_6599), Dipt-LacZ, Drs-GFP, y 1 , w* (BL_55707), w 1118 (gift from Dr. R. John Manak), and Relish +/+ (genetic background control for Relish del mutants; a gift from Dr. David Wassarman; ( Swanson et al., 2020b )). AMP::GFP flies including Attacin::GFP and Cecropin::GFP were obtained from Dr. David Wassarman, originally described in ( Tzou et al., 2000 ). RNAi lines used include UAS- MyD88 RNAi (BL_36107) and UAS- Spz RNAi (BL_34699). GAL4 driver lines used include ppl-GAL4 (BL_58768), Hml-GAL4 (BL_30140), Repo-GAL4 (BL_7415). Mutants used in this study include Dipt-LacZ, Drs-GFP, y 1 , w*, cn 1 , bw 1 , Dif 1 (BL_36559), Tak1 2 (BL_26272), Dredd B118 (BL_55712), Myd88 mutants ( MyD88 c03881 allele ( Tauszig-Delamasure et al., 2002 ), kind gift from Dr. Dominique Ferrandon), Relish E20 (BL_55714), and Relish del (gift from Dr. David Wassarman, ( Swanson et al., 2020b )). Only male flies were used in all experiments. Bacterial strains and infections The stock bacterial cultures of Gram-positive Micrococcus luteus (Ward’s Science #85WOGG6), Gram-negative Escherichia coli (ATCC #11775), and Ampicillin-resistant Escherichia coli (HB101 + pGLO) were obtained from the Microbiological collection at the Department of Biological Sciences at The University of Alabama. Liquid bacterial cultures were grown in an Erlenmeyer flask containing 50 mL of LB media ( M. luteus and E. coli ). Ampicillin-resistant E.coli were grown in an Erlenmeyer flask containing 50 mL of LB media supplemented with 100 ug/mL Ampicillin (Alfa Aesar, Cat # J60977). Flasks were shaken overnight in the shaker at 161 rpm at 30°C for M. luteus and 37°C for E.coli. The next day, the optical density of the overnight suspension was measured, adjusted to OD 600nm = 0.2, and centrifuged at 4000 rpm for 10 minutes at 4°C. After centrifugation, the culture supernatant was discarded, and the obtained pellets were used for the infection experiment. To prepare heat-killed bacterial cultures, the overnight-grown bacterial suspensions were autoclaved at liquid cycle for 30 min at 121°C and 15psi. Autoclaved bacterial suspensions were streaked on Tryptic Soy Agar (TSA) plates to verify that the heat treatment worked (no bacterial colonies were observed after 48h incubation at 37°C for E. coli and 30°C for M. luteus ). Non-infected flies were directly processed for experiments without any injection treatment. For sterile injury and bacterial infection, flies were subjected to the following treatments-Sterile injury: Flies were directly pricked either into the head through the left or right eye (brain infection) or the cuticle on one side of the thorax (systemic infection) with a thin minutien pin (0.1 mm) (Roboz Surgical, Cat. # RS-6083-10) mounted on a pin holder. Before the poke, the minutien pin was briefly dipped into EtOH70% solution and gently wiped with a Kim wipe. Bacterial infection: The minutien pin was dipped into the concentrated live or heat-killed bacterial pellets between each fly. Like the sterile injury, flies were injected either in the head or the thorax (brain and systemic infection, respectively). Following injection flies were incubated at 25°C until used for experiments. Bacterial load quantification For bacterial load quantification in Drosophila heads, overnight-grown Ampicillin-resistant Escherichia coli (HB101 + pGLO) and Micrococcus luteus (Ward’s Science #85WOGG6) were used to cause brain and systemic infection, as described above. Brain- and systemically infected flies with either of the bacteria were incubated at 25°C for 12 hours and 48 hours post-infection to calculate colony forming units (CFUs) per 5 heads. For bacterial load determination in whole flies, flies systemically infected with ampicillin-resistant E. coli were incubated at 25°C for 12 hours and 24 hours post-infection to calculate CFUs per whole fly. After incubation at respective time points, either 5 heads or a whole fly were transferred into a microcentrifuge tube containing 100 µL of sterile PBS1X and homogenized for ∼3-4 min using a sterile pestle. After homogenization, 1:100 serial dilutions were performed, and 10 µL of the 10^5, 10^6, and 10^7 dilutions from the homogenates were plated on TSA plates and incubated at 37 °C for 24 hours for E. coli infected samples and at 30 °C for 48 hours for M. luteus infected samples. Bacterial colonies were counted, and the number of colonies per mL of a sample was calculated by using the formula: CFU/mL (number of colonies * dilution factor)/ volume transferred onto the plate. RNA extraction and gene expression analysis Drosophila brains were dissected using forceps (Dumostar style 5, biological forceps, Electron Microscopy Sciences, Cat. # 72705-01) wiped with EtOH70%, by holding the sharply pointed forceps in the fly’s head and tearing apart the cuticle from the head. Brains were dissected at the rate of ∼ 40-50 brains/hour. ∼15 dissected brains were gently transferred into a microcentrifuge tube containing 400 uL of an RNAlater solution (Thermo Fischer, Cat. # AM7020) and stored at −20°C until further used. RNA was extracted from ∼15 brains using the Quick-RNA™ Micro Prep Kit (Zymo Research, Cat. # R1050) according to the manufacturer’s instructions, with the following modification: 1. Brains were homogenized for 2 minutes instead of the recommended 1 minute. 2. The DNAse1 treatment was extended from 20 min to 30 min at room temperature and centrifuged for 1 min instead of 30 sec. 3. After adding 700μL of RNA Wash Buffer to the filter column, centrifugation was done for 1 min instead of 30 sec. 4. For the final RNA elution step, 15μL of DNase/RNase-Free Water was directly added to the column and centrifuged for 1 min instead of 30 sec. The concentration (ng/μL) of eluted RNA was measured using the NanoDrop One (Thermo Scientific™). The extracted RNA was stored at −20°C in the freezer until it was used for cDNA synthesis. The High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Cat. #: 4368814) was used to synthesize cDNA according to the manufacturer’s protocol. The initial RNA mass used for all samples was 250 ng. The reaction cycle was: 10 minutes at 25°C, 120 minutes at 37°C, 5 min at 85°C and pause at 4°C. Samples were stored at −20°C until further use. For the real-time qPCR reaction, cDNA was diluted 5 times. All samples were run in technical triplicates and nuclease-free water was used as a negative control. Briefly, each reaction consisted of 5 μ L Power Track Sybr Green (Applied Biosystems), 0.5 μ L forward primer (10 μ M), 0.5 μ L reverse primer (10 μ M) and 3 μ L nuclease-free water that was added to 1 μ L of diluted cDNA. The housekeeping gene RpL32 was used as an endogenous control for the normalization of gene expression. The genes of interest measured in this study include Diptericin B ( DiptB ) and Drosomycin ( Drs ). Sequences of Forward (FW) and Reverse (RV) primers are as follows (in 5’è 3’ orientation): RpL32 : FW: AAGAAGCGCACCAAGCACTTCATC, RV: TCTGTTGTCGATACCCTTGGGCTT; Drs : FW: CGTGAGAACCTTTTCCAATATGATG, RV: TCCCAGGACCACCAGCAT ( Cao et al., 2013 ); DiptB : FW: ACCGCACTACCCACTCAAT, RV: GGTCCACACCTTCTGGTGAC ( Cao et al., 2013 ); BomS2 : FW: AGTCGTCACCGTCTTTGTGTT, RV: CAGTATTTGCAGTCCCCGTTG ( Xu et al., 2023 ). The qPCR reaction was carried out in a Step-One-Plus machine (Applied Biosystems) using the standard two-hour quantitative analysis including a melt curve reaction. The following reaction cycle conditions were: 95°C for 10 minutes, 40 repetitions of 95°C for 15 seconds followed by lowering the temperature to 60°C for 1 minute. Then, one round of 95°C for 15 seconds, 60°C for 1 minute, and finally 95°C for 15 seconds. Relative gene expression was determined using the formula 2^ ( RpL32 C t value) / 2^ (the gene of interest C t value) and was log 2-transformed prior statistical analyses. Immunostaining and imaging 5-day-old male Attacin::GFP , Cecropin::GFP , and Dipt-LacZ, Drs-GFP, y 1 , w* flies were subjected to different injection treatment conditions. Brains were dissected at different time points post-infection: 24 hours (to address early immune activation) and 2 weeks (to address long-term immune activation). Brains were dissected in PBS1X and were fixed using Paraformaldehyde (4%PFA) in PBS1X for 30 min by gently rotating on a shaker. Next, the fixative solution was removed, and the brains were washed with 0.1% PBS-Triton X (PBS-T) 3 times on a shaker, each for at least 15 minutes at room temperature. After the third wash, brains were incubated in a blocking solution using PBS-T with 4% Normal Goat Serum (MP Biomedicals, Cat. # ICN19135680) for 1 hour at room temperature. Following this step, primary antibodies diluted in blocking solution were added to the brains and incubated overnight in the refrigerator at 4°C. The primary antibodies were used as follows: chicken-anti-GFP (1:1000) (Invitrogen, Cat. # A10262), Mouse-anti-Repo (1:50) (DSHB, Cat. # 8D12), the monoclonal antibody developed by Corey Goodman was obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of the NIH and maintained at The University of Iowa, Department of Biology, Iowa City, IA 52242, Rat-anti-Elav (1:100) (DSHB, Cat. # 7E8A10), the monoclonal antibody developed by Gerald M. Rubin was obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of the NIH and maintained at The University of Iowa, Department of Biology, Iowa City, IA 52242, and Rabbit-anti-ß-galactosidase (1:100) (Invitrogen, Cat. # A11132). After removing primary antibodies, brains were washed with PBS-T on a rotating shaker 3 times for 15 minutes at room temperature. Then, secondary antibodies diluted in 0.1% PBS-T were added to the brains, and samples were covered with aluminum foil to protect them from light and incubated for 3 hours at room temperature on a rotating shaker. The secondary antibodies were used as follows: goat-anti-chicken Alexa Fluor 488 (1:500) (Invitrogen, Cat. # A11039), goat-anti-mouse Alexa Fluor 568 (1:500) (Invitrogen, Cat. # A11031), goat-anti-rat Alexa Fluor 633 (1:500) (Invitrogen, Cat. # A21094), goat-anti-rabbit Alexa Fluor 405 (1:1000) (Invitrogen, Cat. # A31556). After removing secondary antibodies, brains were washed with PBS-T on a rotating shaker 3 times for 15 minutes at room temperature. Finally, brains were mounted on a microscopic slide into a drop of ProLong™ Diamond Antifade Mountant (Invitrogen, Cat. # P36961) and covered with a glass coverslip. Z-stacks of entire brains were obtained under a 20X objective on a confocal microscope (Nikon Eclipse Ti2 Laser Scanning Confocal Microscope) using the same camera settings for all treatment conditions and time points. To detect specific morphological characteristics of glial cell subtypes, the 40X oil immersion objective was used to obtain higher-magnification images. Acquired images at both 20X and 40X were further analyzed using Fiji ImageJ2 (Version: 2.3.0/1.53q) software. Unless otherwise specified, a maximum projection of 3 slices per sample from n=3 brains were examined per experimental condition. Images were enhanced using the ‘Brightness and contrast’ function in Fiji ImageJ2 to improve visualization; however, measurements of fluorescence intensity were done on unmanipulated files. Fluorescence intensity plots (GFP, Repo and Elav) were generated by selecting a region of interest (ROI) using a single image chosen from the corresponding z-stacks. Measurements were done using the ‘Plot profile’ function in Fiji ImageJ2 for the same ROI across all fluorescence channels. Statistical analysis Statistical analysis was done using GraphPad Prism v.10 software. Statistics are based on a 2-way ANOVA test, with Tukey’s post-test for multiple comparisons. P-values of P < 0.05 were considered significant. Results Canonical IMD pathway components mediate DiptB expression in the brain following E. coli brain infection To test whether IMD pathway components are implicated in response to E. coli infection, we tested Tak1 2 and Dredd B118 mutants in the IMD pathway. We measured Diptericin ( DiptB ) 6 h post-injury (hpi) in brain samples of the control genotype y 1 w 67C23 and Tak1 2 and Dredd B118 flies after brain and systemic injection, respectively. At 6 hpi we observed that in brains of the control strain both sterile injury and E. coli infection resulted in significant DiptB upregulation (P=0.0062 and P<0.0001, respectively) compared with non-injected flies ( Fig. 1A , Table S1) . However, the difference between sterile brain injury and E. coli brain infection was not significant (P=0.2359), suggesting that at this time point brain injury alone resulted in upregulation of DiptB . When compared to systemic E. coli infection, brain E. coli infection resulted in significantly higher DiptB brain expression (P=0.0003) ( Fig. 1A , Table S1) . Similarly, we did not observe a significant difference in DiptB expression in the brain of the control strain between sterile brain injury and sterile systemic injury (P=0.2299) ( Fig. 1A , Table S1) . As additional controls activating the immune system without causing live infection, we performed brain and systemic injections using heat-killed E. coli (HK E. coli ). We observed significant DiptB induction in the brain of the control strain post-HK E. coli brain infection compared to non-infected cohorts (P<0.0001) ( Fig. 1A , Table S1) . However, we did not observe significant DiptB induction in the brain of the control strain post-HK E. coli brain infection compared to sterile brain injured cohorts (P=0.4131) ( Fig. 1A , Table S1) . Moreover, we observed significant DiptB induction in the brain of the control strain post-HK E. coli brain infection in comparison to post-HK E. coli systemic infection (P=0.0006) ( Fig. 1A ) . Systemic infection did not significantly induce DiptB in the brain of the control strain post -E. coli when compared to systemic sterile injury (P>0.9999) ( Fig. 1A , Table S1) . Both IMD pathway mutants Tak1 2 and Dredd B118 failed to induce DiptB expression after both brain and systemic live and HK E.coli infection, suggesting that DiptB expression in the brain depends on these canonical components of the pathway ( Fig. 1A , Table S1) . Altogether, these results indicate that brain-specific, but not systemic infection with live or HK E.coli stimulates the upregulation of DiptB in the brain, and that this response is IMD pathway-dependent. Download figure Open in new tab Figure 1. Dependence of brain-specific AMP expression on Drosophila IMD and Toll pathways. (A) DiptB gene expression was measured in control genotype and IMD pathway mutants’ brain tissue 6h post-head (brain) and thorax (systemic) E. coli infection. (B-C) Drs gene expression was measured in control genotypes and Toll pathway mutants’ brain tissue 24h post-head (brain) and thorax (systemic) M. luteus infection. N =15 dissected brains were used per replicate, with n=3 biological replicates (individual symbols on the graph) for each experimental treatment. (A-C) , DiptB and Drs expression levels were normalized to the housekeeping gene RpL32 and log transformed. Mean ± SEM are shown and asterisks shown above the standard deviation bars denote significant differences in the pairwise control comparisons. *: P<0.05, **: P<0.01, ***: P < 0.001, ****: P<0.0001, ns: not significant based on a 2-way ANOVA test, with Tukey’s post-test for multiple comparisons. Canonical Toll pathway components mediate Drs gene expression in the brain following M. luteus brain infection We next evaluated the contribution of the Toll pathway in the activation of brain immunity following infection with the Gram-positive bacterium M. luteus . We assayed brain expression of the AMP gene Drosomycin ( Drs ) in two Toll pathway mutants ( MyD88 and Dif 1 ) and their controls ( w 1118 and Dipt-LacZ, Drs-GFP y 1 w* , respectively) at 24 hpi. ( Fig. 1B, C , Table S1). We observed that following sterile brain injury in comparison to the non-infected cohort, Drs gene expression was significantly induced in the w 1118 brain (P<0.0001), but this was not the case in Dipt-LacZ, Drs-GFP y 1 w* brains (P=0.9888) ( Fig. 1B, C , Table S1) . This could represent a genotype-specific difference in response to brain injury. However, in both control strains, brain-specific M. luteus infection resulted in significantly induced Drs expression in comparison to non-infected cohorts (P<0.0001 for w 1118 , Fig. 1B , and P=0.0089 for Dipt-LacZ, Drs-GFP y 1 w* , Fig. 1C , Table S1) . Drs was significantly induced in the w 1118 brains post- M. luteus brain infection in comparison to post-sterile brain injury (P<0.0001) ( Fig. 1B , Table S1) . However, this difference was not significant in the brains of the second control genotype (P=0.1575) ( Fig. 1C , Table S1) . We didn’t observe significant Drs expression in w 1118 brains post-sterile brain injury compared to sterile systemic injury (P-value=0.5878) ( Fig. 1B , Table S1) . However, the second control genotype strain Dipt-LacZ, Drs-GFP y 1 w* displayed a significant difference in brain Drs expression between the sterile brain injury cohort compared to the sterile systemic injury cohort (P=0.0004) ( Fig. 1C , Table S1) . HK M. luteus brain injection resulted in significant Drs induction in comparison to sterile brain injured cohorts (P<0.0001) and non-injected cohorts (P<0.0001) ( Fig. 1B ) . Drs induction was significant in w 1118 brains post-HK M. luteus brain infection in comparison to post-HK M. luteus systemic infection (P=0.0003) ( Fig. 1B , Table S1) . However, this difference in Drs expression was not significant in the second control genotype (P=0.9622) ( Fig. 1C , Table S1) . Drs expression was significantly lower in the two Toll pathway mutants we tested ( Myd88 and Dif) after brain and systemic live and HK M. luteus infection. As an additional readout of Toll pathway activation, we measured BomS2 gene expression in w 1118 and MyD88 post-brain and systemic M. luteus infection. BomS2 expression was significantly lower in MyD88 mutant compared to w 1118 post brain M. luteus infection (P=0.0129), and systemic M. luteus infection (P=0.009), suggesting that Drs and BomS2 upregulation following infection in the brain is Toll pathway-dependent ( Fig. 1B, 1C , and Fig. S1 ) (Table 1) . Interestingly, we didn’t observe significant Drs expression in the w 1118 brain post systemic vs brain M. luteus infection (P= 0.9532) ( Fig. 1B , Table S1) . Similarly, we didn’t observe significant Drs expression in Dipt-LacZ, Drs-GFP y 1 w* brain post systemic vs brain M. luteus infection (P= 0.9999) ( Fig. 1C , Table S1) . Together, these results indicate that both brain-specific and systemic infection with M. luteus trigger Drs upregulation in the brain, which also appears to depend on the Toll pathway. Signals from the fat body and hemocytes activate the Toll pathway in the brain, inducing Drs expression We next investigated how systemic M. luteus infection leads to brain Drs expression ( Fig. 1B, C , Table S2) . The hypothetical model ( Fig. 2A ) outlines the idea that following systemic infection, the upstream component of the Toll pathway Spz , a circulating cytokine in the hemolymph (HL), which is synthesized mainly by fat body and hemocytes, can in its active form following processing by Spatzle Processing Enzyme (SPE) diffuse and reach the brain to stimulate Toll pathway activation in this tissue. We hypothesized that Spatzle (Spz) is synthesized by organs outside the brain following M. luteus systemic infection and released in the hemolymph. After activation, Spatzle would circulate and bind the Toll receptor on different tissues, including the fat body and hemocytes in the periphery, as well as glial cells in the nervous system, activating the Toll pathway, inducing brain-specific Drs activation. To test this hypothesis, we knocked down the genes encoding Spz in the fat body ( Ppl-Gal4>UAS-Spz RNAi ), hemocytes ( Hml-Gal4>UAS-Spz RNAi ), and glia ( Repo-Gal4>UAS-Spz RNAi ) ( Fig. 2 A-C, Table S2) and knocked down the adaptor MyD88 , which functions downstream of the Toll receptor in the fat body ( Ppl-Gal4>UAS-MyD88 RNAi ), hemocytes ( Hml-Gal4>UAS-MyD88 RNAi ), and glia ( Repo-Gal4>UAS-MyD88 RNAi ) ( Fig. 2 D-F, Table S2) and measured Drs expression 24h post-brain and systemic M. luteus infection. Flies expressing one copy of each of the Gal4 drivers used served as controls. In the case of direct brain infection, in driver controls, we observed significant Drs expression at 24h post-brain M. luteus infection compared to non-injected cohorts ( P <0.0001, Fig. 2 B-G, Table S2) . Similarly, Drs expression in the brain was significantly upregulated in driver controls post-brain M. luteus infection compared to their sterile brain-injured counterparts ( P <0.0001, Fig. 2 B-G, Table S2) . These results recapitulate the upregulation of Drs in two control genotype brains following M. luteus infection of this tissue ( Fig. 1 B, C, Table S2 ). While in both Spz and MyD88 KD flies, Drs expression was significantly upregulated post-brain M. luteus infection compared to their non-injected and sterile brain-injured counterparts ( P<0.0001, Fig. 2 B-G, Table S2) , the expression of this AMP was significantly reduced in comparison to their respective driver controls ( P<0.0001, Fig. 2B-G , Table S2) . In the case of systemic infection, in driver controls, we observed significantly increased Drs brain expression at 24h post-systemic M. luteus infection compared to non-injected and sterile systemic-injured cohorts ( P<0.0001, Fig. 2 B-G, Table S2) . This is consistent with the upregulation of Drs following systemic M. luteus infection in the brains of the two control genotypes ( Fig. 1 B, C, Table S2 ). In both Spz and MyD88 KD flies, Drs expression was significantly upregulated post-systemic M. luteus infection compared to the non-injected and sterile brain-injured cohorts ( P<0.0001, Fig. 2 B-G, Table S2) . However, compared to their respective driver controls, both Spz and MyD88 KD flies displayed significantly reduced Drs expression in the brain post-systemic M. luteus infection ( P<0.0001, Fig. 2 B-G, Table S2) (P<0.0001). This suggests that Spz, which is required to activate the Toll pathway in the brain, could be produced by each of those tissues — i.e., both systemic (fat body/hemocytes) and locally in the brain (glia). Independent of MyD88, as long as more Spz is produced by the fat body and hemocytes, it presumably gets into the brain and activates the Toll pathway, inducing Drs expression. Since Spz is an upstream component of Toll signaling we decided to knock down MyD88 and see if the downstream adaptor knockdown reduces response in the receiving tissue and possibly fits the canonical pathway order (Toll → MyD88 → Tube → Pelle → Dif/Dorsal → target AMPs like Drosomycin ). Our results imply that both systemic (fat body and hemocyte) and local brain (glia) cells receive MyD88/Toll signals, resulting in intracellular pathway activation required for brain Drosomycin induction. Altogether, these results suggest that the brain’s response to systemic infection follows the canonical Spz →Toll →MyD88 signaling in brain Drs induction following M. luteus infection. Download figure Open in new tab Figure 2. Fat body, hemocytes, and glia contribute to brain Drs upregulation following systemic M. luteus infection. (A) Proposed working model showing systemically derived Spz activating the Toll pathway in the glia following M. luteus infection. (B-D) Drs gene expression was measured in Spz knockdown flies and their respective Gal-4 driver controls at 24h post-brain and systemic M. luteus infection. Spz knockdown was performed in glia, fat body, and hemocytes, respectively. (E-G) Drs gene expression was measured in MyD88 knockdown flies and their respective Gal-4 driver controls at 24h post-brain and systemic M. luteus infection. MyD88 knockdown was performed in glia, fat body, and hemocytes, respectively. Drs expression levels were normalized to the housekeeping gene RpL32 and log transformed. Mean ± SEM; ***P < .005 based on a 2-way ANOVA test, with Tukey’s post-test for multiple comparisons. ns, not significant. Asterisks shown above the standard deviation bars denote significant differences in the pairwise control comparisons. DiptB and Drs expression is activated in the brain acutely after bacterial brain infection, and this activation persists over time To further assess acute and long-term immune activation of the IMD and Toll pathways in response to direct brain infection with E. coli and M. luteus , we measured DiptB and Drs gene expression at subsequent time points: 6-48h and 2 weeks. In y 1 w 67C23 (control strain used for IMD pathway mutants) E. coli infected brains, at 6 hpi, we did not observe a significant DiptB expression compared to sterile injured cohorts (P>0.9999). However, at 12h, 24h, 36h, 48h, and up to 2 weeks (P<0.0001), the effect of the injury resolved ( Fig. 3A , Table S3) . Moreover, DiptB expression in E. coli- infected brains at 6 hpi. was not significantly different from DiptB expression in E.coli- infected brains for the remaining time points, such as 12h (P=0.3276), 24h (P=0.9278), 36h (P=0.8148) and 48h (0.3708), except 6h vs 12h, which is highly significant (P<0.0001) and persisted for up to 2 weeks, but not significant (P=0.9694) ( Fig. 3A , Table S3) . Similarly, in w 1118 and Dipt-LacZ, Drs-GFP y 1 w* (two control strains used for Toll pathway mutants) M. luteus infected brains, at 24 hpi, Drs was significantly induced in M. luteus -infected brains compared to sterile-injured cohorts (P=0.0015) ( Fig. 3B , Table S3 ) and (P=0.0029) ( Fig. 3C , Table S3) . At 36h post- M. luteus infection, Drs was significantly upregulated in w 1118 control brains compared to 24 hpi (P= 0.0019), and it persisted for up to 2 weeks, although Drs expression is non-significant compared to 24h post M. luteus infection (P=0.0734) ( Fig. 3B , Table S3) . In Dipt-LacZ, Drs-GFP y 1 w* control brains, Drs persistently activated up to 2 weeks, although the Drs expression is not significant compared to 24h post M. luteus infection (P=0.4371) ( Fig. 3C , Table S3) . Taken together, these results show that DiptB is upregulated acutely from 6-48h post- E. coli brain infection, and that Drs is upregulated from 12h to 48h post- M. luteus brain infection. In comparison to sterile-injured cohorts, the expression of both genes remained significantly upregulated for up to 2 weeks post-brain bacterial infection, indicating long-term activation of the immune response. Download figure Open in new tab Figure 3. NF-κB brain immunity is acutely induced following direct bacterial challenge. The immune response persists over time, indicating long-term immune activation. (A) DiptB gene expression was measured in control y 1 w 67c23 genotype brains at different time points (6h-48h) and 2 weeks post E. coli brain infection to assay acute and long-term immune activation, respectively. (B-C) Drs gene expression was measured in w 1118 and Dipt-LacZ, Drs-GFP y 1 w* control genotype brains at different time points (24h-48h) and 2 weeks post M. luteus infection to assay acute and long-term immune activation, respectively. Both DiptB and Drs expression levels were normalized to the housekeeping gene RpL32 . Mean ± SEM; ***P < .005 based on a 2-way ANOVA test, with Tukey’s post-test for multiple comparisons. ns, not significant. Asterisks shown above the standard deviation bars denote significant differences in the pairwise control comparisons. Host functional immunity clears the bacterial load in control flies but not in NF-kB mutants Previously, in control genotype flies, we observed that host immunity was activated for up to 2 weeks after bacterial challenge raising the possibility that bacteria persist and stimulate immune responses in the brain. Therefore, to see if this long-term activated immunity is the result of non-cleared bacteria in the brain, we counted bacterial colonies in whole heads post-brain and systemic infection by performing a CFU assay. At 0h post-brain and systemic E. coli infection, we did not observe a significant difference in bacterial colony count in the head of WT control flies and mutants, except for Rel +/+ vs Rel E20 (P=0.0354) ( Fig. 4A , Table S4, S5) . At 12h post-brain and systemic infection with E. coli and M. luteus , bacteria were completely cleared from the head of control strains in all experiments ( Fig. 4A-D , Table S4, S5). At 12h post-brain and systemic E. coli infection, bacterial colonies in the mutants’ head ( Rel del mutant and Rel E20 ) ( P< 0.0001, Fig. 4A-B , Table S4, S5) persisted at significantly higher levels compared to Rel +/+ . At 48h, E.coli was cleared in the Rel +/+ head, whereas mutants died post-brain and systemic E. coli infection. The systemic E. coli infection in the whole fly was used as an additional control to verify that Rel del mutants accumulated more CFUs until they died at 48h post-infection ( Fig. S2 , Table S4, S5) . Similarly, at 0h post-brain and systemic M. luteus infection, we didn’t observe a significant difference in bacterial colony count in the heads of Dipt-LacZ, Drs-GFP y 1 w* controls, and Dif 1 mutant post-brain (P=0.7116) ( Fig. 4C , Table S4, S5) and systemic M. luteus infection (P= 0.9999) ( Fig. 4D , Table S4, S5) . At 12h and 48h, M. luteus colonies persisted in the heads of Dif 1 mutant post-brain ( Fig. 4C , Table S4, S5) and systemic ( Fig. 4D , Table S4, S5) infection. However, M. luteus was cleared in the head of control flies post-brain and systemic infection at respective time points. Together, these results indicate that host functional immunity clears the pathogen load, and long-term activated immunity is not associated with the presence of live bacteria in the brain. Glial cells primarily activate the brain’s immune response after E. coli and M. luteus brain infection To determine whether glia, neurons or both are the primary source of AMP expression during the early and later stages of infection (24h and 2w-post-brain infection), we performed immunohistochemistry (IHC) on Attacin::GFP ( Att::GFP ), an AMP primarily regulated by the IMD pathway in response to Gram-negative bacteria, and Drosomycin::GFP ( Drs::GFP ) brains that express Repo in glial cells and Elav in neuronal cells. In Att::GFP flies, we observed that in response to sterile injury, some GFP expression was seen to co-localize with glia and neuronal markers at both 24h and 2 weeks post injury ( Fig. 5A, B, C ) ; however, it was to a much higher extent in the E. coli -infected brains at both timepoints ( Fig. 5A, B, C ). These results suggest that glia are the primary cell type in which the IMD pathway is acutely and persistently activated after E.coli brain infection. We performed IHC in a second reporter line, Cecropin::GFP , for which we also found that E. coli brain infection resulted in upregulation of GFP at 24 hpi, which co-localized with the glial marker Repo ( Fig. S3 A, B ). While some neuronal expression of GFP is observed, these results support the idea that glia are the main cell type in which the IMD pathway is activated after E. coli infection. Download figure Open in new tab Figure 4. Functional immunity clears bacterial load in the Drosophila heads post-brain and systemic infection. (A) Ampicillin-resistant E. coli colonies were counted in Rel +/+ ( Rel del - control) and two Relish mutants ( Rel del mutant and Rel E20 ) heads post-brain infection and (B) post-systemic infection at different time points. (C) M. luteus colonies were counted in control Dipt-LacZ, Drs-GFP y 1 w* and Dif 1 mutant post-brain infection and (D) post-systemic infection at different time points. Bacterial counts were done by plating the adult homogenates of 5 Drosophila heads that were previously infected with ampicillin-resistant E. coli and M. luteus in the brain and the thorax (systemic) on TSA plates containing ampicillin. The data shown are the number of colony-forming units (CFU) per 5 Drosophila head/replicate obtained at various time points post-brain and systemic bacterial infection. In all experiments, colonies counted at 0h represent the immediate bacterial load without aging the flies’ post-infection. Mean ± SEM; ***P < .005 based on a 2-way ANOVA test, with Tukey’s post-test for multiple comparisons. ns, not significant. Asterisks shown above the standard deviation bars denote significant differences in the pairwise control comparisons. Download figure Open in new tab Figure 5. Glial cells are the primary source of acute and chronic AMP expression in Attacin::GFP brains post- E. coli brain infection. (A) Representative confocal images (20X) of 5-day-old Att::GFP brains 24h and 2w post-sterile injury and E. coli brain infection, immunostained for GFP (green), the glial marker Repo (red), and the neuronal marker Elav (magenta). Drosophila brain tissue is delineated with the discontinued line. A maximum projection of 3 z-stack slices per sample from n=3 brains were examined per experimental condition. White square boxes indicate the region of interest that was examined at higher magnification. (B) Representative confocal images (40X) of the area marked by the white square boxes in (A) of 5-day-old Att::GFP flies 24h and 2w post-sterile brain injury and E. coli brain infection. Co-localization between GFP and Repo is indicated with arrows, while co-localization between GFP and Elav is indicated with the arrowhead. Scalebars: 50µm. (C) Fluorescence intensity plots in selected brain areas (indicated by the yellow lines on the image merging GFP, Repo, and Elav) for the indicated samples. Overlapping peaks indicating co-localization between GFP and Repo (asterisks) and between GFP and Elav (pound symbol) are shown. A.U.: arbitrary units. We next tested how M. luteus infection affected the acute and persistent expression of GFP in the brain of Drs::GFP flies, used as a readout for the Toll pathway. In Drs::GFP flies, we observed that in response to sterile injury, some GFP expressions were seen to co-localize with glia and neuronal markers at both 24h and 2 weeks post injury ( Fig. 6A, B, C ) ; however, it was to a much higher extent in the M. luteus -infected brains at both timepoints ( Fig. 6A, B, C ) . The glial co-localization is more pronounced in the control-injected brain at 24h post-sterile brain injury compared to 2 weeks post-injection, suggesting an effect of the injury alone. In the case of M. luteus brain infection, more glial and less neuronal co-localization was observed at 2 weeks post- M. luteus infection, suggesting that the sustained inflammatory response showed continued glial activity and marked glial co-localization with the reporter. Altogether, these results indicate that glial cells are the primary cell type in the Drosophila brain that activate NF-kB immunity after acute and long-term bacterial brain infection. Download figure Open in new tab Figure 6. Glial cells are the primary source of acute and chronic AMP expression in Drosomycin::GFP brains post- M. luteus brain infection. (A) Representative confocal images (20X) of 5-day-old , Drs::GFP brains 24h and 2w post-sterile injury and M. luteus brain infection expressing reporter GFP in both glia and neurons and immunostained for GFP (green), the glial marker Repo (red), and the neuronal marker Elav (magenta). Drosophila brain tissue is delineated with the discontinued line. A maximum projection of 3 z-stack slices per sample from n=3 brains were examined per experimental condition. White square boxes indicate the region of interest that was examined at higher magnification. (B) Representative confocal images (40X) of the area marked by the white square boxes in (A) of 5-day-old Drs::GFP flies 24h and 2w post-sterile brain injury, and M. luteus brain infection. Co-localization between GFP and Repo is indicated with arrows, while co-localization between GFP and Elav is indicated with the arrowhead. Scalebars: 50µm. (C) Fluorescence intensity plots in selected brain areas (indicated by the yellow lines on the image merging GFP, Repo, and Elav) for the indicated samples. Overlapping peaks indicating co-localization between GFP and Repo (asterisks) and between GFP and Elav (pound symbol) are shown. A.U.: arbitrary units. Discussion This study shows that AMP expression is activated acutely and chronically in the brain by both brain-specific and systemic bacterial infection. To understand the underlying mechanism, we used Toll and IMD pathway mutants and compared immune gene expression to their wild-type counterparts. Through this approach, we assessed the Drosomycin ( Drs ) and Diptericin B ( DiptB ) gene expression in the Drosophila brain to precisely determine the pathways’ involvement in activating brain innate immunity under various treatment conditions. Tak1 and Dredd are crucial components of the IMD pathway that activate NF-κB signaling in the Drosophila brain following an E. coli infection ( Leulier et al., 2000 ; Vidal et al., 2001 ). We directly compared DiptB expression in y 1 w 67c23 ( wild-type ) vs mutants ( Tak1 and Dredd) brains in the case of brain E. coli infection and systemic E. coli infection. Previous work has shown that Tak1 and Dredd mutants are highly susceptible to gram-negative bacterial infection, failing to upregulate the Diptericin gene after E. coli infection ( Leulier et al., 2000 ; Vidal et al., 2001 ). Consistent with this finding, we observed that both IMD pathway mutants showed impaired DiptB induction in the brain compared to wild type , following brain and systemic infection. Furthermore, in y 1 w 67c23 controls, we noted that direct E. coli brain infection showed higher DiptB expression in the brain compared to systemic E. coli infection. These results highlight that brain-specific DiptB expression is IMD pathway-dependent and validate the function of the IMD pathway components in controlling and mediating the brain’s innate immune response. Our results showed the elevated DiptB expression in the brain 6h post- E . coli brain infection compared to non-injected (P<0.0001) and systemic infection (P=0.0003) (Table S3) . We observed DiptB activation at 12h, 24h, 36h, 48h, and up to 2 weeks post-brain infection, indicating the NF-κB activation profile ranging from acute to chronic. While the IMD pathway is highly effective against fast-replicating bacteria like E. coli because the pathway response via DiptB activation is quick ∼6 hpi ( Buchon et al., 2009 ; Lemaitre and Hoffmann, 2007 ; Lemaitre et al., 1997 ) we assessed if activated immunity would clear the E. coli load in the brain over time. We decided to count E. coli load in the brain post-direct brain infection and systemic infection; therefore, Rel +/+ and two Relish mutants ( Rel del/del and Rel E20 ) were infected with Ampicillin-resistant E. coli (HB101 + pGLO) directly in the head and on the thorax. The ampicillin-resistant E. coli was used to determine if the bacteria are cleared or if they continue to replicate. If this was the case, consequently, this could result in a long-term activation of immunity in the brain is due to the persistence of bacteria. We used Rel mutants as a positive control in our CFU assay, in which E. coli proliferated at 12h post-brain and systemic infection, and both mutants tested died at 48h post-brain and systemic infection. In contrast, in the heads of Rel +/+ (controls), the E. coli load at 12h post-brain and systemic infections significantly dropped to zero colonies, indicating complete bacterial clearance in the head. This suggests that the functional IMD pathway is necessary to clear E.coli from the head after infection. The dynamics of host resistance might change throughout the course of infection ( Howick and Lazzaro, 2017 ). A previous study that injected 18.4nL of E. coli in the thorax measured bacterial load as CFU per fly and showed that E. coli load significantly reduced over time, with zero mortality at 72h post-infection, considering 24h and 72h as acute infection phase time-points and 1 week as a long-term chronic infection phase in their experiment. Another study ( Kutzer and Armitage, 2016 ) showed that the host didn’t clear the E. coli load at 1-week p.i. However, our results showed complete E. coli clearance in the head at 12h post brain infection, as well as in a whole fly 12h post systemic infection ( Fig. S2 , Table S4) . We believe that E. coli infection in the brain and thorax activated the IMD pathway and had been effectively kept in check by the host immune system, failing to proliferate in number. It has been reported that activated antimicrobial defenses can act in the host hemolymph for weeks post-infection, most probably to control persistent bacterial infections ( Makarova et al., 2016a , b ). Nevertheless, various factors such as E. coli strain, sex, mating status, treatment (feeding vs non-feeding), and mode of bacterial introduction (pinprick vs dose nanoinjector) could largely contribute to discrepancies in the E. coli load over time ( Khalil et al., 2015 ). We wanted to further determine if DiptB expression in the brain resolved after bacterial clearance or persisted over time. Despite bacterial clearance, we found that DiptB is significantly induced in the brain up to 2 weeks, indicating chronic immune activation. The acute short-term activated IMD pathway in the context of brain injury is crucial for survival of infection and tissue repair ( Nayak and Mishra, 2022 ; Zhai et al., 2018 ) whereas several studies have reported that prolonged activation of IMD signaling is detrimental because it promotes neuroinflammation, causing neurodegeneration ( Kounatidis and Chtarbanova, 2018 ). In both vertebrates and invertebrates, chronic activation of glial cells is a hallmark of neuroinflammation ( Garschall and Flatt, 2018 ; Kounatidis and Chtarbanova, 2018 ; Petersen et al., 2013 ). The study led by ( Cao et al., 2013 ) used a mixture of E. coli and M. luteus to assess if an activated immune response in the CNS triggers neurodegeneration. They showed that persistently activated AMP expressions in glia or neurons can trigger neurodegeneration. Here, we utilized bacteria ( E. coli and M. luteus ) separately in our experiments to infect the Drosophila brain directly in the head and in the thorax. In agreement with the findings of Cao et al ., our RT-qPCR results show elevated DiptB expression in the Drosophila brain. Additionally, immunostaining showed continued glial and some neuronal co-localization of GFP (for the IMD pathway reporter Att::GFP ) in direct E. coli -infected brain at early (24h) and later (2 weeks) stages of infection. These sustained glial-mediated immune responses for an extended period indicate the shift from a transient acute response to a chronic one, raising the possibility of subsequent neuronal damage. In concurrence with the RT-qPCR results, our immunostaining results detected the reporter GFP signal in dissected brains when the injection was done in the head. Our results also align with previous findings showing that Att::GFP reporter expression in the brain was activated following brain-specific, but not systemic injection of a mixture of E.coli and M.luteus . Additionally, a lower GFP signal in control flies (sterile-injured flies), further confirms preferential activation of the immune response in the brain in bacterially injected flies. Therefore, the canonical IMD pathway mediates DiptB gene expression in the brain following bacterial brain infections, and systemic infection in the thorax doesn’t contribute to affecting gene expression in the brain over time. The Toll pathway is another key regulator of NF-κB signaling in Drosophila that primarily defends against Gram-positive bacteria and fungi ( Lemaitre and Hoffmann, 2007 ). MyD88 and Dif are crucial components of the Toll pathway, where Drosophila MyD88 (dMyD88) is an adaptor protein playing a similar role for inflammatory signaling pathways downstream of mammalian Toll-like receptor (TLR) ( Horng and Medzhitov, 2001 ) while Dif is the main transcription factor acting downstream of the Toll receptor, mediating innate immune response via AMPs, including Drs gene expression ( Lemaitre and Hoffmann, 2007 ). We directly compared the Drs expression in w 1118 and Dipt-LacZ, Drs-GFP wild-type controls vs Myd88 and Dif 1 mutant brains in the case of both brain and systemic M. luteus infection. Bomanin genes are considered another set of Toll pathway-specific targets ( Clemmons et al., 2015 ). Therefore, we measured Bomanin gene as an additional readout of the Toll pathway. We observed that BomS2 gene expression was reduced in Toll pathway mutant’s brain compared to their controls at 24h post brain and systemic M.luteus infection ( Fig. S1 ) (Table S1) . Our results showed that both MyD88 and Dif 1 mutants failed to induce Drs gene expression in the brain upon direct brain and systemic M. luteus infection. However, interestingly, we observed that Drs gene was significantly induced in the wild-type brain post-systemic M. luteus infection. We didn’t expect bacterial infection in the thorax to induce an immune response in the brain, nor AMPs expressed in the fat body or in the cells outside of the CNS to enter the brain. Several studies have highlighted the significant evidence of neurodegenerative disease, not only as an outcome of CNS disorders, but also because of inter-organ communication. For instance, in a Drosophila model of Alzheimer’s disease (AD), enteric infection increased hemocyte motility and recruitment to the brain with an increase in oxidative stress, highlighting the gut-brain crosstalk ( Wu et al., 2017 ). In a fly model of Parkinson’s Disease (PD), systemic infection contributed to disease pathogenesis via an inflammatory cascade and its downstream effects on dopaminergic neurons ( Nayak and Mishra, 2022 ). Following systemic infection, the Drosophila fat body, a crucial immune organ and the primary site of antimicrobial peptide (AMP) production, releases signaling molecules, cytokines, and various AMPs into the hemolymph. These secreted molecules travel through hemolymph and signal to the brain, influencing CNS immune responses ( Wang et al., 2024 ; Yu et al., 2022 ). It has been reported that a leukocytic antimicrobial peptide, Bactenecin, which is mainly present in bovine neutrophils, can directly cause cytotoxicity to cultured neurons and glia ( Radermacher et al., 1993 ). However, in the Drosophila model, there is no direct evidence of fat body-derived AMPs crossing the BBB and mounting an immune response in the brain upon systemic bacterial infection. However, following systemic infection, AMP expression has been observed in the Drosophila head, possibly due to a local or peripheral immune response ( Lee et al., 2024 ). Based on our results, Drs gene expressed in the brain after systemic M. luteus infection could be due to signals from organs like the fat body and hemocytes activating the Toll pathway in the brain. They revealed that the systemic M. luteus infection upregulated Drs expression in the brain, and later, Drs induction was significantly suppressed in the brain when Spz was knocked down in the fat body ( Vincent et al., 2022 ). Other research evidence in Drosophila larvae showed that Spatzle secreted from hemocytes acts as a signal to the fat body in activating the Toll pathway, leading to Drs expression. These findings demonstrate the critical role of the fat body in immune signaling to the brain and show a link between the cellular and humoral immune responses. This emphasizes the importance of inter-organ communication in the Drosophila innate immune response by orchestrating a cytokine-based regulatory signal that is analogous to the mammalian immune system ( Shia et al., 2009 ). Like for the IMD pathway, we observed persistent Drs activation in the brain of y 1 w 67C23 (control strains for Toll pathway’s mutant) flies at 12h, 24h, 36h, 48h, and up to 2 weeks post-brain infection, indicating the NF-kB activation profile ranging from acute to chronic. At 12h post-brain infection, M. luteus load reduced to 0 colonies in Dipt-LacZ, Drs-GFP y 1 w* control brain, indicating complete bacterial clearance. Similarly, upon systemic infection, M. luteus load reduced to 0 colonies, suggesting that the activated Toll pathway contributed to host resistance via functional Drs activation. At both direct brain and systemic infection, M. luteus proliferated in the Dif 1 mutant’s head up to 48 hours, but the mutants didn’t die consistent with previous studies that this bacterium induces Toll-dependent Drs expression but doesn’t kill Toll pathway mutants but ( De Gregorio et al., 2002 ; Rutschmann et al., 2000 ). Despite bacterial clearance, our RT-qPCR results showed elevated Drs expression in the brain for up to 2 weeks, coupled with immunostaining showing continued glial-specific co-localization of Drs::GFP (for Drosomycin ) in direct M. luteus- infected brain at early (24h) and later (2 weeks) stages of infection. The RT-qPCR results showing induced Drs expression in the brain post-systemic M. luteus infection were further validated by staining results that showed mostly glial and some neuronal co-localization of Drs::GFP at 24 hpi ( Fig. S3 C, D, E ) (Table S1) . Previous studies have shown that heat-killed bacteria, similar to live bacteria, can activate the immune system and induce AMPs ( Noh et al., 2022 ). It has been reported that oral administration of non-pathogenic gram-positive and gram-negative heat-killed bacteria activated Toll and IMD pathways, inducing Drosomycin and Diptericin genes, respectively ( Wen et al., 2019 ). Concurrent to their observation of killed bacteria, our pin-prick method of heat-killed bacterial infection showed enhanced DiptB and Drs expression in the brain post-brain infection in both pathways. In the context of a diseased brain, such as penetrating traumatic brain injury (pTBI), there is evidence that the same AMPs were upregulated by both pathways ( Marischuk et al., 2021 ). To understand the complexity of pathway activation in the context of bacterial brain infection, we decided to see if a crosstalk between the Toll and IMD NF-κB pathways exists, or if their activation in the brain happens independently. Thus, we measured both DiptB and Drs expression in the wild type control brain at 24h post E.coli infection ( Fig. S4 A ) (Table S1) and at 6h post M.luteus infection ( Fig. S4 B ) (Table S1) and observed that both DiptB and Drs genes were coregulated by both pathways, highlighting a possible crosstalk. A recent study highlighting the communication pathway between the brain and muscles during infection has revealed that acute CNS infections initiate a long-term reduction in motor function, which indicates that a systemic, rather than a direct neuronal mechanism, is at play ( Yang et al., 2024 ). Our results showing long-term activated immunity in the brain, either via direct brain infection or systemic infection, could potentially exacerbate neuronal death through local inflammation, contributing to neurodegeneration ( Lee et al., 2024 ; Stuart et al., 2022 ). Conclusion and limitations We performed RT-qPCR on dissected brain post-brain and systemic bacterial infection and validated our immune gene expression results via immunostaining with specific tissue markers showing glia as the primary cell type activating immune response at early and later stages of infection. However, there are still some limitations to our study that warrant further consideration. To address the central question of whether long-term activated immune response is deleterious to neuronal health, we will require histological analysis to observe neuronal integrity and behavioral assay as a sensitive readout of neuronal dysfunction. Measuring the life span of those flies that cleared the bacteria after 12 hpi compared to the non-infected cohort would give us an idea about the overall fitness cost of chronic immune activation. To better understand the behavior of Drosophila post-infection, their locomotory activity could be measured via a climbing assay or an automated video tracking assay to see if neuroinflammation leads to either hyperactivity or causes a decline in their general activity ( Bolus et al., 2020 ; Mainali et al., 2025 ). To further assess the cellular aspect of immune response, a phagocytic assay needs to be performed to see if the activated glia engulf the bacteria or if glial phagocytic ability is altered during the long-term immune activation that persists. We can extend the immunohistochemical analysis to other AMPs to better characterize glial cell subtypes involved in immune activation at early and later stages of infection. Our approach of using Drosophila as a model to study infection-induced neuroinflammation and its link to neuropathology aims to understand the role of various players in NF-κB pathways and characterize cell-type-specific mechanisms at both early and later stages of infection. This study advances knowledge of how non-lethal brain bacterial infection results in the activation of NF-κB immunity that could be targeted to prevent or halt progression of neurodegeneration. Funding SM was supported by a teaching assistantship from the University of Alabama graduate school, a Graduate Council Fellowship from the University of Alabama, and a graduate research assistantship in Cell and Molecular Biology from the Department of Biological Sciences at UA in the form of summer stipend awards. This work was also supported by start-up funds from the University of Alabama to SC and by a grant from the Merrymac/McKinley foundation awarded through the Alabama Life Research Institute to SC. Authors contributions SC conceptualized the study, with input from SM. SM, IT, PM, JG, LH, EK, KD and SC performed experiments; SM, IT, PM, JG, LH and SC analyzed data. SM wrote the original draft. SC contributed to manuscript writing, review and editing. Supplemental figures legends Download figure Open in new tab Supplemental Figure S1. BomS2 gene expression measured in controls and Toll pathway mutants’ brain tissue 24h post-head (brain) and thorax (systemic) M. luteus infection. N =15 dissected brains per replicate, with n=3 biological replicates (individual symbols on the graph) per treatment. BomS2 expression levels were normalized to the housekeeping gene RpL32 and log transformed. Mean ± SEM; ***P < .005 based on a 2-way ANOVA test, with Tukey’s post-test for multiple comparisons. ns, not significant. Asterisks shown above the standard deviation bars denote significant differences in the pairwise control comparisons. Download figure Open in new tab Supplemental Figure S2. Ampicillin-resistant E. coli colonies were counted in the whole fly of Rel +/+ (control) and Rel del/del mutants post- E. coli systemic infection at different time points. Bacterial counts were done by plating the homogenates of 1 whole Drosophila that were previously infected with ampicillin-resistant E. coli in the thorax (systemic) on TSA plates containing ampicillin. The data shown is the number of colony-forming units (CFU) per 1 Drosophila /replicate obtained at various time points post-systemic E. coli infection. Colonies counted at 0h represent the immediate bacterial load following E. coli introduction in the fly hemocoel. Mean ± SEM; ***P < .005 based on a 2-way ANOVA test, with Tukey’s post-test for multiple comparisons. ns, not significant. Asterisks shown above the standard deviation bars denote significant differences in the pairwise control comparisons. Download figure Open in new tab Supplemental Figure S3. (A) Representative confocal stack images (20X) of 4-7 days old , Cecropin::GFP brains 24h post- E. coli brain infection. Brains of non-injected flies or sterile-injured brains were used as controls. Drosophila brain tissue is delineated with the discontinued line. Maximum projection of 5 slices per sample from n=3 brains was examined per experimental condition. Immunostaining for GFP (green), the glial marker Repo (red), and the neuronal marker Elav (blue) shows co-localization primarily between GFP-expressing cells and Repo (arrows) in E. coli -infected brains. (B) Fluorescence intensity plots in selected brain areas (indicated by the yellow lines on the image merging GFP, Repo, and Elav) for the indicated samples. Overlapping peaks indicating co-localization between GFP and Repo (asterisks) and between GFP and Elav (pound symbol) are shown. A.U.: arbitrary units. (C) Representative confocal images (20X) of 5-day-old , Drs::GFP brains 24h post-sterile thorax injury and M. luteus thorax infection (systemic infection), immunostained for GFP (green), the glial marker Repo (red), and the neuronal marker Elav (magenta). Drosophila brain tissue is delineated with the discontinued line. White square boxes indicate the region of interest that was examined at higher magnification. (D) Representative confocal images (40X) of 5-day-old Drs::GFP , GFP was colocalized with Repo in the brain 24h post systemic M. luteus infection, indicated by white arrow heads. Co-localization between GFP and Repo is indicated with arrows, while co-localization between GFP and Elav is indicated with the arrowhead. (A, C, D) Scalebars: 50 µm. (E) Fluorescence intensity plots in selected brain areas (indicated by the yellow lines on the image merging GFP, Repo, and Elav) for the indicated samples. Overlapping peaks indicating co-localization between GFP and Repo (asterisks) and between GFP and Elav (pound symbol) are shown. A.U.: arbitrary units. Download figure Open in new tab Supplemental Figure S4. (A) DiptB and Drs gene expression were measured in the control y 1 w 67c23 genotype brains 24h post-head (brain) and thorax (systemic) E. coli infection. N =15 dissected brains per replicate, with n=3 biological replicates (individual symbols on the graph) per treatment. DiptB and Drs expression levels were normalized to the housekeeping gene RpL32 and log-transformed. Mean ± SEM; ***P < .005 based on a 2-way ANOVA test, with Tukey’s post-test for multiple comparisons. ns, not significant. Asterisks shown above the standard deviation bars denote significant differences in the pairwise control comparisons. (B) Drs and DiptB gene expression were measured in control w 1118 genotype brains 6h post-head (brain) and thorax (systemic) M. luteus infection. N =15 dissected brains were used per replicate, with n=3 biological replicates (individual symbols on the graph) per treatment. Drs and DiptB expression levels were normalized to the housekeeping gene RpL32 and log transformed. Mean ± SEM; ***P < .005 based on a 2-way ANOVA test, with Tukey’s post-test for multiple comparisons. ns, not significant. Asterisks shown above the standard deviation bars denote significant differences in the pairwise control comparisons. Acknowledgments We are grateful to Dr. Kim Lackey and the Optical Analysis Facility for assistance with confocal microscopy, and to Patrice Crawford for kindly providing the bacterial culture used throughout our infection experiments. We would also like to thank Brantley Johnson for assistance with fly handling, amplifying, and maintenance of stocks. We also acknowledge the valuable intellectual input and helpful suggestions from our colleagues of the Ganetzky joint lab meeting. Funder Information Declared Merrymac/McKinley Foundation University of Alabama Graduate School References ↵ Bolus , H. , Crocker , K. , Boekhoff-Falk , G. , Chtarbanova , S ., 2020 . Modeling Neurodegenerative Disorders in Drosophila melanogaster . Int J Mol Sci 21 . ↵ Buchon , N. , Broderick , N.A. , Poidevin , M. , Pradervand , S. , Lemaitre , B ., 2009 . Drosophila intestinal response to bacterial infection: activation of host defense and stem cell proliferation . Cell Host Microbe 5 , 200 – 211 . OpenUrl CrossRef PubMed Web of Science ↵ Cao , Y. , Chtarbanova , S. , Petersen , A.J. , Ganetzky , B ., 2013 . Dnr1 mutations cause neurodegeneration in Drosophila by activating the innate immune response in the brain . Proc Natl Acad Sci U S A 110 , E1752 – 1760 . OpenUrl Abstract / FREE Full Text ↵ Clemmons , A.W. , Lindsay , S.A. , Wasserman , S.A ., 2015 . An effector Peptide family required for Drosophila toll-mediated immunity . PLoS Pathog 11 , e1004876 . OpenUrl CrossRef PubMed ↵ De Gregorio , E. , Spellman , P.T. , Tzou , P. , Rubin , G.M. , Lemaitre , B. , 2002 . The Toll and Imd pathways are the major regulators of the immune response in Drosophila . Embo j 21 , 2568 – 2579 . OpenUrl Abstract / FREE Full Text ↵ Garschall , K. , Flatt , T ., 2018 . The interplay between immunity and aging in Drosophila . F1000Res 7 , 160 . OpenUrl ↵ Horng , T. , Medzhitov , R ., 2001 . Drosophila MyD88 is an adapter in the Toll signaling pathway . Proc Natl Acad Sci U S A 98 , 12654 – 12658 . OpenUrl Abstract / FREE Full Text ↵ Howick , V.M. , Lazzaro , B.P ., 2017 . The genetic architecture of defence as resistance to and tolerance of bacterial infection in Drosophila melanogaster . Mol Ecol 26 , 1533 – 1546 . OpenUrl CrossRef PubMed ↵ Jang , I.H. , Chosa , N. , Kim , S.H. , Nam , H.J. , Lemaitre , B. , Ochiai , M. , Kambris , Z. , Brun , S. , Hashimoto , C. , Ashida , M. , Brey , P.T. , Lee , W.J ., 2006 . A Spatzle-processing enzyme required for toll signaling activation in Drosophila innate immunity . Dev Cell 10 , 45 – 55 . OpenUrl CrossRef PubMed Web of Science ↵ Khalil , S. , Jacobson , E. , Chambers , M.C. , Lazzaro , B.P ., 2015 . Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. J Vis Exp , e 52613 . ↵ Kounatidis , I. , Chtarbanova , S ., 2018 . Role of Glial Immunity in Lifespan Determination: A Drosophila Perspective . Front Immunol 9 , 1362 . OpenUrl CrossRef PubMed ↵ Kounatidis , I. , Chtarbanova , S. , Cao , Y. , Hayne , M. , Jayanth , D. , Ganetzky , B. , Ligoxygakis , P ., 2017 . NF-kappaB Immunity in the Brain Determines Fly Lifespan in Healthy Aging and Age-Related Neurodegeneration . Cell Rep 19 , 836 – 848 . OpenUrl CrossRef PubMed ↵ Kutzer , M.A. , Armitage , S.A ., 2016 . The effect of diet and time after bacterial infection on fecundity, resistance, and tolerance in Drosophila melanogaster . Ecol Evol 6 , 4229 – 4242 . OpenUrl CrossRef PubMed ↵ Larrea , A. , Elexpe , A. , Diez-Martin , E. , Torrecilla , M. , Astigarraga , E. , Barreda-Gomez , G. , 2023 . Neuroinflammation in the Evolution of Motor Function in Stroke and Trauma Patients: Treatment and Potential Biomarkers . Curr Issues Mol Biol 45 , 8552 - 8585 . OpenUrl PubMed ↵ Leclerc , V. , Reichhart , J.M ., 2004 . The immune response of Drosophila melanogaster . Immunol Rev 198 , 59 – 71 . OpenUrl CrossRef PubMed Web of Science ↵ Lee , K.Z. , Ferrandon , D ., 2011 . Negative regulation of immune responses on the fly . Embo j 30 , 988 – 990 . OpenUrl Abstract / FREE Full Text ↵ Lee , S. , Silverman , N. , Gao , F.B ., 2024 . Emerging roles of antimicrobial peptides in innate immunity, neuronal function, and neurodegeneration . Trends Neurosci 47 , 949 – 961 . OpenUrl PubMed ↵ Lemaitre , B. , Hoffmann , J ., 2007 . The host defense of Drosophila melanogaster . Annu Rev Immunol 25 , 697 – 743 . OpenUrl CrossRef PubMed Web of Science ↵ Lemaitre , B. , Reichhart , J.M. , Hoffmann , J.A ., 1997 . Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms . Proc Natl Acad Sci U S A 94 , 14614 – 14619 . OpenUrl Abstract / FREE Full Text ↵ Leulier , F. , Rodriguez , A. , Khush , R.S. , Abrams , J.M. , Lemaitre , B ., 2000 . The Drosophila caspase Dredd is required to resist gram-negative bacterial infection . EMBO Rep 1 , 353 – 358 . OpenUrl Abstract / FREE Full Text ↵ Liegeois , S. , Ferrandon , D. , 2022 . Sensing microbial infections in the Drosophila melanogaster genetic model organism . Immunogenetics 74 , 35 – 62 . OpenUrl CrossRef PubMed ↵ Lotz , S.K. , Blackhurst , B.M. , Reagin , K.L. , Funk , K.E ., 2021 . Microbial Infections Are a Risk Factor for Neurodegenerative Diseases . Front Cell Neurosci 15 , 691136 . OpenUrl CrossRef PubMed ↵ Lye , S.H. , Chtarbanova , S ., 2018 . Drosophila as a Model to Study Brain Innate Immunity in Health and Disease . Int J Mol Sci 19 . ↵ Mainali , S. , Majlish , A.N.K. , Lee , Y.R. , Lee , H. , Iyengar , A. , Chtarbanova , S. , 2025 . A Tool Kit to Model Neurodegenerative Disease in Drosophila melanogaster , in: Muñoz-Torrero , D. (Ed.), Methods in Neurodegenerative Disease Drug Discovery . Springer US , New York, NY , pp. 283 – 312 . ↵ Makarova , O. , Rodriguez-Rojas , A. , Eravci , M. , Weise , C. , Dobson , A. , Johnston , P. , Rolff , J ., 2016a . Antimicrobial defence and persistent infection in insects revisited . Philos Trans R Soc Lond B Biol Sci 371 . ↵ Makarova , O. , Rodriguez-Rojas , A. , Eravci , M. , Weise , C. , Dobson , A. , Johnston , P. , Rolff , J ., 2016b . Correction to: ‘Antimicrobial defence and persistent infection in insects revisited’ . Philos Trans R Soc Lond B Biol Sci 371 . ↵ Marischuk , K. , Crocker , K.L. , Ahern-Djamali , S. , Boekhoff-Falk , G ., 2021 . Innate immunity pathways activate cell proliferation after penetrating traumatic brain injury in adult Drosophila . bioRxiv , 2021.2009.2001.458615. ↵ Myllymaki , H. , Valanne , S. , Ramet , M ., 2014 . The Drosophila imd signaling pathway . J Immunol 192 , 3455 – 3462 . OpenUrl Abstract / FREE Full Text ↵ Nayak , N. , Mishra , M ., 2022 . Drosophila melanogaster as a model to understand the mechanisms of infection mediated neuroinflammation in neurodegenerative diseases . J Integr Neurosci 21 , 66 . OpenUrl PubMed ↵ Noh , H.J. , Park , J.M. , Kwon , Y.J. , Kim , K. , Park , S.Y. , Kim , I. , Lim , J.H. , Kim , B.K. , Kim , B.Y ., 2022 . Immunostimulatory Effect of Heat-Killed Probiotics on RAW264.7 Macrophages . J Microbiol Biotechnol 32 , 638 – 644 . OpenUrl PubMed ↵ Petersen , A.J. , Katzenberger , R.J. , Wassarman , D.A ., 2013 . The innate immune response transcription factor relish is necessary for neurodegeneration in a Drosophila model of ataxia-telangiectasia . Genetics 194 , 133 – 142 . OpenUrl Abstract / FREE Full Text ↵ Postolache , T.T. , Wadhawan , A. , Can , A. , Lowry , C.A. , Woodbury , M. , Makkar , H. , Hoisington , A.J. , Scott , A.J. , Potocki , E. , Benros , M.E. , Stiller , J.W ., 2020 . Inflammation in Traumatic Brain Injury . J Alzheimers Dis 74 , 1 – 28 . OpenUrl PubMed ↵ Radermacher , S.W. , Schoop , V.M. , Schluesener , H.J ., 1993 . Bactenecin, a leukocytic antimicrobial peptide, is cytotoxic to neuronal and glial cells . J Neurosci Res 36 , 657 – 662 . OpenUrl CrossRef PubMed Web of Science ↵ Rodríguez , A.M. , Rodríguez , J. , Giambartolomei , G.H ., 2022 . Microglia at the Crossroads of Pathogen-Induced Neuroinflammation . ASN Neuro 14 , 17590914221104566 . OpenUrl CrossRef PubMed ↵ Rutschmann , S. , Jung , A.C. , Hetru , C. , Reichhart , J.M. , Hoffmann , J.A. , Ferrandon , D ., 2000 . The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila . Immunity 12 , 569 – 580 . OpenUrl CrossRef PubMed Web of Science ↵ Shan , T. , Wang , Y. , Bhattarai , K. , Jiang , H ., 2023 . An evolutionarily conserved serine protease network mediates melanization and Toll activation in Drosophila . Sci Adv 9 , eadk2756 . OpenUrl PubMed ↵ Shia , A.K. , Glittenberg , M. , Thompson , G. , Weber , A.N. , Reichhart , J.M. , Ligoxygakis , P ., 2009 . Toll-dependent antimicrobial responses in Drosophila larval fat body require Spatzle secreted by haemocytes . J Cell Sci 122 , 4505 – 4515 . OpenUrl Abstract / FREE Full Text ↵ Stuart , B.A.R. , Franitza , A.L. , E , L. , 2022 . Regulatory Roles of Antimicrobial Peptides in the Nervous System: Implications for Neuronal Aging . Front Cell Neurosci 16 , 843790 . OpenUrl PubMed ↵ Swanson , L.C. , Rimkus , S.A. , Ganetzky , B. , Wassarman , D.A ., 2020a . Loss of the Antimicrobial Peptide Metchnikowin Protects Against Traumatic Brain Injury Outcomes in Drosophila melanogaster . G3 (Bethesda) 10 , 3109 – 3119 . OpenUrl Abstract / FREE Full Text ↵ Swanson , L.C. , Trujillo , E.A. , Thiede , G.H. , Katzenberger , R.J. , Shishkova , E. , Coon , J.J. , Ganetzky , B. , Wassarman , D.A ., 2020b . Survival Following Traumatic Brain Injury in Drosophila Is Increased by Heterozygosity for a Mutation of the NF-κB Innate Immune Response Transcription Factor Relish . Genetics 216 , 1117 – 1136 . OpenUrl Abstract / FREE Full Text ↵ Tauszig-Delamasure , S. , Bilak , H. , Capovilla , M. , Hoffmann , J.A. , Imler , J.L ., 2002 . Drosophila MyD88 is required for the response to fungal and Gram-positive bacterial infections . Nat Immunol 3 , 91 – 97 . OpenUrl CrossRef PubMed Web of Science ↵ Tzou , P. , Ohresser , S. , Ferrandon , D. , Capovilla , M. , Reichhart , J.M. , Lemaitre , B. , Hoffmann , J.A. , Imler , J.L ., 2000 . Tissue-specific inducible expression of antimicrobial peptide genes in Drosophila surface epithelia . Immunity 13 , 737 – 748 . OpenUrl CrossRef PubMed Web of Science ↵ Vidal , S. , Khush , R.S. , Leulier , F. , Tzou , P. , Nakamura , M. , Lemaitre , B ., 2001 . Mutations in the Drosophila dTAK1 gene reveal a conserved function for MAPKKKs in the control of rel/NF- kappaB-dependent innate immune responses . Genes Dev 15 , 1900 – 1912 . OpenUrl Abstract / FREE Full Text ↵ Vincent , C.M. , Beckwith , E.J. , Simoes da Silva , C.J. , Pearson , W.H. , Kierdorf , K. , Gilestro , G.F. , Dionne , M.S. , 2022 . Infection increases activity via Toll dependent and independent mechanisms in Drosophila melanogaster . PLoS Pathog 18 , e1010826 . OpenUrl CrossRef PubMed ↵ Wang , Y. , Saito , K. , Tanimoto , H. , Grunwald Kadow , I.C. , 2024 . A Bidirectional Brain-Fat Body Axis for Pathogen Avoidance . bioRxiv , 2024.2011.2002.621634. ↵ Wen , Y. , He , Z. , Xu , T. , Jiao , Y. , Liu , X. , Wang , Y.F. , Yu , X.Q ., 2019 . Ingestion of killed bacteria activates antimicrobial peptide genes in Drosophila melanogaster and protects flies from septic infection . Dev Comp Immunol 95 , 10 – 18 . OpenUrl CrossRef PubMed ↵ Winkler , B. , Funke , D. , Benmimoun , B. , Speder , P. , Rey , S. , Logan , M.A. , Klambt , C ., 2021 . Brain inflammation triggers macrophage invasion across the blood-brain barrier in Drosophila during pupal stages . Sci Adv 7 , eabh0050 . OpenUrl CrossRef PubMed ↵ Winkler , B. , Funke , D. , Klambt , C ., 2025 . Macrophage invasion into the Drosophila brain requires JAK/STAT-dependent MMP activation in the blood-brain barrier . PLoS Biol 23 , e3003035 . OpenUrl CrossRef PubMed ↵ Wu , S.C. , Cao , Z.S. , Chang , K.M. , Juang , J.L ., 2017 . Intestinal microbial dysbiosis aggravates the progression of Alzheimer’s disease in Drosophila . Nat Commun 8 , 24 . OpenUrl CrossRef PubMed ↵ Xu , R. , Lou , Y. , Tidu , A. , Bulet , P. , Heinekamp , T. , Martin , F. , Brakhage , A. , Li , Z. , Liégeois , S. , Ferrandon , D ., 2023 . The Toll pathway mediates Drosophila resilience to Aspergillus mycotoxins through specific Bomanins . EMBO reports 24 , e56036 . OpenUrl CrossRef PubMed ↵ Yang , S. , Tian , M. , Dai , Y. , Wang , R. , Yamada , S. , Feng , S. , Wang , Y. , Chhangani , D. , Ou , T. , Li , W. , Guo , X. , McAdow , J. , Rincon-Limas , D.E. , Yin , X. , Tai , W. , Cheng , G. , Johnson , A ., 2024 . Infection and chronic disease activate a systemic brain-muscle signaling axis . Sci Immunol 9 , eadm7908 . OpenUrl PubMed ↵ Yu , S. , Luo , F. , Xu , Y. , Zhang , Y. , Jin , L.H ., 2022 . Drosophila Innate Immunity Involves Multiple Signaling Pathways and Coordinated Communication Between Different Tissues . Front Immunol 13 , 905370 . OpenUrl CrossRef PubMed ↵ Zhai , Z. , Huang , X. , Yin , Y ., 2018 . Beyond immunity: The Imd pathway as a coordinator of host defense, organismal physiology and behavior . Dev Comp Immunol 83 , 51 – 59 . OpenUrl CrossRef PubMed ↵ Zindler , E. , Zipp , F ., 2010 . Neuronal injury in chronic CNS inflammation . Best Pract Res Clin Anaesthesiol 24 , 551 – 562 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted October 20, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Activation of Toll and IMD pathways in the Drosophila brain following local and systemic bacterial infection Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Activation of Toll and IMD pathways in the Drosophila brain following local and systemic bacterial infection Sameekshya Mainali , Isaac Toles , Paige Magid , Jordan Grammer , Lauren Harper , Elizabeth Kitchens , Kaitlin Davis , Stanislava Chtarbanova bioRxiv 2025.10.20.683553; doi: https://doi.org/10.1101/2025.10.20.683553 Share This Article: Copy Citation Tools Activation of Toll and IMD pathways in the Drosophila brain following local and systemic bacterial infection Sameekshya Mainali , Isaac Toles , Paige Magid , Jordan Grammer , Lauren Harper , Elizabeth Kitchens , Kaitlin Davis , Stanislava Chtarbanova bioRxiv 2025.10.20.683553; doi: https://doi.org/10.1101/2025.10.20.683553 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Immunology Subject Areas All Articles Animal Behavior and Cognition (7622) Biochemistry (17645) Bioengineering (13867) Bioinformatics (41873) Biophysics (21420) Cancer Biology (18550) Cell Biology (25447) Clinical Trials (138) Developmental Biology (13361) Ecology (19866) Epidemiology (2067) Evolutionary Biology (24289) Genetics (15587) Genomics (22473) Immunology (17707) Microbiology (40322) Molecular Biology (17144) Neuroscience (88457) Paleontology (666) Pathology (2826) Pharmacology and Toxicology (4815) Physiology (7634) Plant Biology (15111) Scientific Communication and Education (2042) Synthetic Biology (4285) Systems Biology (9813) Zoology (2268)