Fever of unknown origin revealing testicular nocardiosis: a case report and literature review

A 75-year-old man was admitted for fever of unknown origin. He had previously been diagnosed with polymyalgia rheumatica, for which a treatment with methylprednisolone 16 mg once a day (OD) was begun 4 months before admission. Methotrexate 10 mg weekly had been introduced 2 months before his admission. He had a past history of acquired amegacaryocytic thrombocytopenia that had been treated with cyclosporin more than 10 years ago. After his two-month vacation in South of France, where he had been gardening without wearing gloves, he developed a fever above 39 °C with complaints of sore throat. Amoxicillin-clavulanic acid was started after the patient was seen in the emergency room of another hospital. As the fever persisted, he presented to the emergency room of our institution. An atypical papular skin rash with a necrotic lesion on the back of the left hand, combined with his recent vacation location, prompted an initial suspicion of Mediterranean spotted fever (Fig.  1 ). Fig. 1 Skin necrotic lesion on the back of the hand Skin necrotic lesion on the back of the hand Therefore, doxycycline 100 mg BID was introduced as an empirical treatment. Antibiotics were continued for 7 days. Meanwhile, a first serologic test for Rickettsia conorii turned negative. Fever and malaise persisted for more than two weeks in total and, after a week of ineffective doxycycline, antibiotics were discontinued. After 2 weeks of pyrexia, the patient was hospitalized in our internal medicine department. He initially complained primarily about fatigue. He had no arthralgia. Nobody close to him was sick and there was no history of animal exposure. On admission, his vital signs were as follows: body temperature 37,8 °C; pulse rate 66/min; and blood pressure 110/60 mmHg. A physical examination revealed virtual disappearance of the skin lesions and a new aortic heart murmur. First-line laboratory analyses showed an elevation of the C-reactive protein level (CRP) at 45,0 mg/L (normal value < 5,0 mg/L). Transesophageal echocardiography did not show any evidence of infective endocarditis. A chest, abdomen and brain computed tomography (CT) was unremarkable. Methotrexate was discontinued on admission. No obvious sign of vasculitis was noted on CT brain angiography. Serologic testing for Brucella, Rickettsia conorii and R. mooseri, Coxiella burnetii, Bartonella henselae , Borrelia burgdorferi , Treponema pallidum and human immunodeficiency virus proved negative. Cytomegalovirus and Epstein-Barr virus serologies were compatible with past infection. Rheumatoid factor and antinuclear antibodies turned negative. Repeated blood cultures remained sterile even after prolonged incubation of 7 days. After 3 weeks of unexplained intermittent pyrexia, the patient was diagnosed with fever of unknown origin. Then, he mentioned a new scrotal swelling and left epididymo-orchitis was confirmed by ultrasound. Urinalysis was normal with no pyuria. Levofloxacin 500 mg OD was started empirically. In spite of a decrease in pain, swelling and CRP level, testis induration persisted. Scrotal abscesses appeared after one week of antibiotic therapy and despite increased levofloxacin doses, they evolved to necrosis. Left orchiectomy was performed. Clindamycin 600 mg TDS and ceftriaxone 2 g OD were started empirically. The dose of methylprednisolone was progressively reduced to a nadir of 2 mg OD. Nocardia brasiliensis yielded from the testicular biopsy culture. High dose intravenous trimethoprim-sulfamethoxazole (TMP-SMX) (20 mg TMP/kg/day) was started on the 20th day of hospitalization. Ceftriaxone was increased to 2 g BID to treat potential brain involvement. Gadolinium contrast-enhanced magnetic resonance imaging (MRI) of the brain subsequently revealed multiple micro-abscesses mostly in the nucleus nuclei, dura-mater enhancement in the spinal bulb and ventriculitis (Fig.  2 ). Spinal cord MRI showed a “ring-enhancement” in right posterolateral area of the spinal cord in D12-L1, which was consistent with a 2 mm-abscess (Fig.  3 ). Fig. 2 MRI of brain T1 (+ gadolinium) sequence, showing multiple micro-abscesses (hyperintensities pointed by the arrows) MRI of brain T1 (+ gadolinium) sequence, showing multiple micro-abscesses (hyperintensities pointed by the arrows) Fig. 3 MRI of spinal cord T1 (+ gadolinium) sequence, showing a 2-mm abscess with a “ring enhancement” in right posterolateral area of the spinal cord in D12-L1 (arrow) MRI of spinal cord T1 (+ gadolinium) sequence, showing a 2-mm abscess with a “ring enhancement” in right posterolateral area of the spinal cord in D12-L1 (arrow) A F-18 fluorodeoxyglucose positron emission tomography/CT was performed to assess the extent of invasive nocardiosis but was unremarkable. Multi-susceptibility was confirmed and dual parenteral antibiotic therapy with TMP-SMX and ceftriaxone was pursued for 6 weeks. Histopathologically, signs of inflammation were observed in the testicular biopsy, as well as filamentous branching bacilli. Direct Gram staining showed the typical gram-positive, beaded, filamentous bacilli (Fig.  4 ). Fig. 4 Microscopic image of a gram-stained smear of N. brasiliensis from testicular biopsy, demonstrating the typical gram-positive filamentous bacilli. Magnification, x1000 Microscopic image of a gram-stained smear of N. brasiliensis from testicular biopsy, demonstrating the typical gram-positive filamentous bacilli. Magnification, x1000 The colonies displayed also partial acid-fastness with the modified form of auramine-rhodamine stain (Fig.  5 ). Fig. 5 Microscopic image of auramine-rhodamine modified stained smear of N. brasiliensis from testicular biopsy. Magnification, x1000 Microscopic image of auramine-rhodamine modified stained smear of N. brasiliensis from testicular biopsy. Magnification, x1000 After 72 h incubation in 5% CO 2 at 37 °C on sheep blood agar, colonies grew, appearing as chalky white cotton balls because of the presence of abundant aerial filaments (Fig.  6 ). Fig. 6 Colonies of N. brasiliensis grown on blood agar plate Colonies of N. brasiliensis grown on blood agar plate Nocardia brasiliensis was identified by matrix-associated laser desorption ionization-time of flight mass spectrometry (MALDI-TOF Biotyper Sirius IVD version 4.2.100; Bruker Daltonics, Bremen, Germany) with a reliable score value (2.06). To confirm the germ identification, 16S rRNA gene sequencing using universal primers (27F: 5’AGAGTTTGATCMTGGCTCAG3’ and 1492R: 5’TACGGYTACCTTGTTACGACTT3’; NF1: 5’TWACACATGCAAGTCGARCG3’ and NF2: 5’CCAACATCTCACGACACGAG3’) was performed on cultured colonies. Its yielded sequence (1025 bp) had 99.90% homology with N. brasiliensis strain DSM AUSMDU00024985 (GenBank accession no.: CP046171.1 ) by using the NCBI database and the EZBiocloud. The antimicrobial susceptibility testing was performed by minimum inhibitory concentration (MIC) using E-test gradient strips (BioMérieux, Marcy l’Etoile, France) and interpreted following Clinical and Laboratory Standards Institute (CLSI) M62-ED1:2018 guidelines for Nocardia (Table  1 ). Table 1 Antimicrobial susceptibility of patient’s clinical isolate N. brasiliensis Antibiotics MIC (µg/mL) Interpretation by CLSI M62 guidelines Amoxicillin-clavulanic acid 0.500 S Ceftriaxone 1.000 S Meropenem 2.000 S Clindamycin 0.380 S Moxifloxacin 0.125 S TMP-SMX 0.125 S Linezolid 1.000 S Antimicrobial susceptibility of patient’s clinical isolate N. brasiliensis

Clinical evolution was marked by a slow improvement of the patient’s general condition. Fever gradually decreased in intensity and frequency. Control brain and spinal cord MRI’s were obtained shortly before the end of the 6 weeks of parenteral bitherapy (Figs.  7 and 8 ): a slight regression of the brain micro-abscesses was observed, and they appeared to be less enhanced by gadolinium, while the spinal cord lesion remained stable. Fig. 7 RMI of brain T1 (+ gadolinium) sequence, performed after 6 weeks of antibiotics, showing slight regression of the abscesses RMI of brain T1 (+ gadolinium) sequence, performed after 6 weeks of antibiotics, showing slight regression of the abscesses Fig. 8 RMI of spinal cord T1(+ gadolinium) sequence, performed after 6 weeks of antibiotics, showing a stable abscess (arrow) RMI of spinal cord T1(+ gadolinium) sequence, performed after 6 weeks of antibiotics, showing a stable abscess (arrow) High dose TMP-SMX was then switched from parenteral to oral route and pursued as a monotherapy. At the time of writing these lines, the patient has just been discharged from the rehabilitation department after almost 6 months of treatment. Another control brain MRI showed further reduction of the abscesses. Clinically, the patient still has some walking impairment that requires physiotherapy, with slow but constant improvement. TMP-SMX is meant to be pursued for 6 months thereafter.

Members of the genus Nocardia are aerobic, Gram-positive, beaded, and partially acid-fast bacilli with the microscopic appearance of branching hyphae, belonging to the Corynebacterineae suborder. They are ubiquitous soil organisms. As an opportunistic pathogen, inhalation and skin inoculation are the most common routes of infection. Lungs and skin are the most frequent sites of nocardiosis. Testis is a highly unusual location for nocardiosis. We herein report the case of an immunocompromised patient with fever of unknown origin unmasking disseminated nocardiosis involving testis, brain and spinal cord. We have included a literature review on previous case reports of genitourinary and urological nocardiosis.

To the best of our knowledge, this is the first case of N. brasiliensis simultaneously infecting skin, testis, brain and spinal cord in an immunocompromised patient. Our case highlights the difficulty of nocardiosis diagnosis due to complex clinical manifestations. Even though pulmonary, neurological and dermatological involvement are commonly described, the two latter forms may have, as in our patient, tricky clinical presentations and the disease may spread to virtually any organ such as testis. Knowledge on atypical forms of nocardiosis remains scarce. With our case, we aim to both raise clinician’s awareness and add our experience to the handful of cases described in the literature.

Nocardiosis most commonly affects immunocompromised patients but may occur in immunocompetent hosts [ 1 – 4 ]. Disseminated nocardiosis is defined as the involvement of at least two non-contiguous organs and/or demonstration of bloodstream infection [ 1 , 2 , 4 , 5 ]. The most frequently infected sites are the lungs, brain and skin [ 3 , 6 , 7 ]. Fever at presentation is inconstant [ 1 – 4 ]. Diagnosing nocardiosis only by skin inspection is difficult because Nocardia lesions are not specific. They may appear as papules, pustules, nodules and skin infiltration [ 1 , 5 , 6 ]. In our case, with the patient’s epidemiological context, the skin lesions were considered suspicious of a rickettsial disease at the time of presentation. Nocardia skin inoculation while gardening seems to be the pathway to infection in our patient. Nocardia infects the central nervous system (CNS) in one-third of all cases and it usually manifests as brain abscess while meningitis is rare [ 5 , 8 ]. Multiple abscesses are seen in 50–80% of the patients [ 6 ]. It has been very rarely reported with N. brasiliensis . Patients sometimes present with headache, nausea, vomiting, seizure or alteration in consciousness [ 1 , 7 ]. CNS invasion may nevertheless be asymptomatic and missing the diagnosis of CNS nocardiosis may cause treatment delay and failure. It has been suggested to perform systematic brain MRI to all patients with a diagnosis of nocardiosis [ 5 , 6 ]. In our case, lumbar puncture was discussed but not performed because of thrombocytopenia (less than 50 000 platelets/µL), reactions to previous platelet transfusions and clinical improvement with antibiotics. Besides, Nocardia is only exceptionally identified in cerebral spinal fluid culture [ 8 ]. Although invasive nocardiosis is generally considered to occur through hematogenous dissemination, identifying Nocardia species on blood culture is very uncommon [ 2 , 5 ]. Infections of the urinary and urological systems are usually caused by species of the family Enterobacteriaceae ; Nocardia infection is extremely rare [ 4 , 8 , 9 ]. We searched PubMed for English-language reports of genitourinary and urological nocardiosis from 1970 to 2022. We found 36 complete cases previously published in the literature [ 9 – 41 ] (Table  2 ). All except four cases (nr 17, 27, 29 and 31) involved immunocompromised hosts, mostly transplant patients and patients on corticosteroids. Kidneys, prostate and testes were the most commonly infected organs. N. asteroides was the most frequent pathogen. Implication of N. brasiliensis causing urological and genitourinary infection seems rarer but all cases reported skin involvement. It has been described that this strain is more prevalent in cutaneous infections [ 1 , 9 ]. In our case, N. brasiliensis is thought to have spread hematogenously from the skin to testicular, cerebral and spinal cord sites. Table 2 Cases of genitourinary and urological nocardiosis reported in the literature Nr Year Author (reference) Nocardia species Age (years), gender Underlying conditions Immunosuppressants Clinical presentation Nocardia identification specimen type Sites of Nocardia infection Diagnosis delay Antibiotic empirical treatment Antibiotic targeted treatment (+ duration if specified) Surgical management Outcome + follow-up 1 1964 Mahvi et al. [ 10 ] N. brasiliensis 32, M Multiple myeloma Corticosteroids Anorexia Weight loss Abdominal pain Renal abscess Skin abscess (autopsy) Kidney Skin Blood Lungs 2 months penicillin sulfonamide None Deceased 20 days after admission 2 1971 Young et al. [ 11 ] N. asteroides 53, M Hodgkin’s lymphoma Alkylating agents Corticosteroids Vinca alkaloid Hemoptysis Weight loss Fever Sputum Scalp abscess Renal and cerebellar abscesses (autopsy) Lung Brain Kidney 2 days isoniazide + streptomycin sulfonamide None Deceased 3 days after targeted treatment 3 1971 Young et al. [ 11 ] N. asteroides 26, M Hodgkin’s lymphoma NR Fever Sputum Renal abscess Cerebral abscess (autopsy) Lung Kidney Brain NR NR NR None Deceased 3 days after targeted treatment 4 1971 Young et al. [ 11 ] N. asteroides 41, F Lymphosarcoma NR Fever Sputum Renal abscess (autopsy) Lung Kidney NR methicillin + chloramphenicol Then cephalothin NR None Deceased 6 days after targeted treatment 5 1971 Young et al. [ 11 ] N. asteroides 44, M Chronic myelogenous leukemia Alkylating agent Corticosteroids Oral + pharyngeal ulcers Recurrence with adenopathy, fever and scrotal swelling Oral scraping Sputum Testicular abscess (autopsy) Mouth Pharynx Lung Testis 3 weeks None sulfonamide None Deceased 6 weeks after admission 6 1973 Diamond et al. [ 12 ]. N. brasiliensis 65, M Systemic lupus erythematosus Diabetes mellitus Corticosteroids Fever Nodular skin lesions Scrotal swelling Recurrence 1 year later Skin lesion Urine Urine Skin Prostate Prostate NR None sulfonamide Then tetracycline (2 months) sulfonamide (12 months) None No recurrence 1 year after targeted treatment Deceased 1 year after remission 7 1974 Geelhoed et al. [ 13 ] N. asteroides 70, M Waldenström’s macroglobulinemia Lung adenocarcinoma Corticosteroids Hemoptysis Scrotal swelling Testicular abscess Sputum Testis Lung 6 weeks chloramphenicol + tetracycline Then sulfonamide sulfonamide Orchiectomy Deceased 8 1976 Strong et al. [ 14 ] N. asteroides 61, M Myeloproliferative disorder Splenectomy Corticosteroids Alkylating agents Persistent urinary infection Fever Testicular abscess BAL fluid Testis Prostate Lungs Liver NR cephalothin + gentamicin + carbenicillin + sulfadiazine + ampicillin + cycloserine Orchiectomy Deceased 17 days after admission 9 1986 Wheeler et al. [ 15 ] N. asteroides 44, M Heart Tx Corticosteroids Azathioprine Cyclosporin Scrotal swelling Decreasing vision Testicular abscess Testis Eye NR tetracycline sulfonamide Orchiectomy Survived 3 months after follow-up 10 1992 Parmentier et al. [ 16 ] N. farcinica 36, M HIV infection NR Fever Loin pain Renal abscess Sputum Kidney Lungs NR None imipenem + rifampin (2 months) Nephrectomy Survived 4 months after follow-up 11 1994 Shohaib S [ 17 ] N. asteroides 45, F Kidney Tx Cyclosporin Corticosteroids Azathioprine Abdominal pain Fever Perinephric abscess Kidney Iliopsoas muscle NR ciprofloxacin + cefuroxime ciprofloxacin + cefuroxime (more than 1 month) None Survived 1 year after follow-up 12 1994 Lopez et al. [ 18 ] N. asteroides 52, M Liver Tx Cyclosporin Corticosteroids Azathioprine Scrotal swelling Subcutaneous abscess Skin abscess Subcutaneous tissue Testis NR None TMP-SMX (9 months) Orchiectomy Survived 2 years after follow-up 13 1994 Miralles et al. [ 19 ] N. farcinica 24, M HIV infection NR Fever Weight loss Cough Recurrence with headache, hemiparesis Renal abscess BAL fluid CSF Kidneys Lungs Brain NR cefixime Then TMP-SMX + zidovudine TMP-SMX Switch doxycyclin + ciprofloxacin TMP-SMX None Survived 14 1996 Salahuddin et al. [ 20 ] N. asteroides 47, F Type 1 diabetes None Dysuria Loin pain Fever Urine Blood Kidney Blood NR NR sulfonamide None Survived 15 2000 Torres et al. [ 40 ] N. farcinica 85, M Non-Hodgkin lymphoma COPD Alkylating agent Corticosteroids Fever Cough Malaise Fatigue Urine Blood Kidney Blood Lung 15 days cefotaxime + indomethacin cefotaxime + indomethacin None Deceased 20 days after admission 16 2001 Frangié et al. [ 21 ] N. nova 50, M Kidney Tx Tacrolimus Mycophenolate mofetil Corticosteroids Fever Abdominal pain Perinephric abscess Kidney NR vancomycin + imipenem imipenem (2 months) Switch roxithromycin (7 months) None Survived after 8 months of follow-up 17 2003 Benes et al. [ 22 ] N. asteroides 55, F None None Skin lesions Fever Abdominal pain Fatigue Skin pustules and ulcer Peritoneal cavity fluid Skin Kidney Liver Peritoneal cavity Lungs (suspected) More than 3 months ampicillin, cefadroxil, roxithromycin gentamicin, cephazolin, oxacillin, clindamycin, ciprofloxacin, rifampicin TMP-SMX + amikacin Switch cefotaxime + amikacin (9 weeks) Nephrectomy Surgical drainage Survived after 3 years of follow-up 18 2003 Qu et al. [ 23 ] N. asteroides 37, M Small bowel Tx Corticosteroids Tacrolimus Azathioprine Dysuria Suprapubic pain Scrotal swelling Fever Urine Blood Prostate Blood 4 days ciprofloxacin Then ampicillin-sulbactam ceftriaxone + TMP-SMX (6 months) None Survived at discharge of hospital 19 2005 Routh et al. [ 24 ] N. asteroides 78, M p-ANCA GN Alkylating agents Corticosteroids Fatigue Weight loss Fever Scrotal swelling Testicular abscess Blood Testis Blood NR None TMP-SMX Then meropenem + tetracycline (6 months) Orchiectomy Survived at discharge of hospital 20 2005 Severo et al. [ 25 ] N.farcinica 76, M Chronic low back pain Corticosteroids Cough Fever Thyroid abscess Sputum Blood Thyroid Lungs Blood Heart Kidney Brain Bones Soft tissue (autopsy) NR None TMP-SMX None Deceased on the second day of treatment 21 2006 Kepkep et al. [ 26 ] Nocardia sp. 32, F Pregnancy None Fatigue Fever Vomiting Pelvic pain Tubo-ovarian abscess Appendicitis Ovary Appendix Lungs (suspected) 40 days cefazolin TMP-SMX (6 months) Salpingo-oophorectomy + appendicectomy Survived after 6 months of treatment 22 2006 Gallo et al. [ 27 ] Nocardia sp. 68, F Vulvar leiomyosarcoma NR Painful lesion in the right hemivulva Vulvar lesion biopsy Vulva Bone NR None TMP-SMX (5 months) Vulvectomy Survived after 6 months of follow-up 23 2007 Van Luin et al. [ 41 ] N. farcinica 52, M Kidney Tx Mycophenolate mofetil Tacrolimus Corticosteroids Abdominal pain Fever Renal abscess Kidney NR vancomycin imipenem/cilastatin Then TMP-SMX (6 months) Transplantectomy Survived 4 years after discharge of hospital 24 2009 Dehghani et al. [ 28 ] Nocardia sp 22, M T-cell ALL Stem cell Tx Alkylating agents Cyclosporin Methotrexate Corticosteroids Fever Hematuria Scrotal swelling Convulsions Testicular abscess Testis Brain NR ceftriaxone TMP-SMX (2 weeks) None Deceased 3 weeks after discharge of hospital 25 2011 Tanioka et al. [ 29 ] N. farcinica 59, F Myasthenia gravis Corticosteroids Tacrolimus Malaise Cough Breath shortness Sputum Lungs Kidney Brain Blood 4 days piperacillin-tazobactam + ciprofloxacin imipenem-cilastatin + TMP-SMX Then meropenem + amikacin Then linezolid (38 days) Then TMP None Survived at discharge of hospital 26 2012 De Montmollin et al. [ 30 ] N. farcinica 68, F Anorexia nervosa None Weight loss Fever Dyspnea Renal abscess Kidney Lungs Brain NR ceftriaxone + erythromycin TMP-SMX + amikacin + imipenem + ciprofloxacin None Deceased 2 months after the start of therapy 27 2013 Yamaguchi et al. [ 31 ] N. brasiliensis 77, M None None Skin infection Arthralgia Fever Scrotal swelling Skin biopsy Testicular abscess Skin Testis 16 days acyclovir + cefepime Then vancomycin meropenem + vancomycin Then TMP-SMX (4 months) + minocycline + imipenem + cilastatin (2 months) Orchiectomy Survived at discharge of hospital 28 2015 Poisnel et al. [ 32 ] N. veterana 51, M Glioblastoma Chronic kidney disease Chemotherapy Corticosteroids Chest pain Weight loss Dysuria Urine Blood Prostate Blood Lungs (suspected) 4 days TMP-SMX + ceftriaxone TMP-SMX + ceftriaxone None Deceased 2 months after admission 29 2016 Eren et al. [ 33 ] N. otitidiscaviarum 69, F None None Hemiparesis Fever Renal abscess Brain abscess Kidney Brain 5 days ceftriaxone + metronidazole meropenem + amikacin Switch meropenem + TMP-SMX (8 weeks) Then TMP-SMX only (1 year) Stereotaxic craniotomy Survived after 1 year of targeted antibiotic 30 2016 Scorey et al. [ 34 ] N. farcinica 68, M Psoriasis and psoriatic arthritis Corticosteroids Etanercept Dysuria Abdominal pain Fever Blood Prostate Blood NR ceftriaxone + gentamicin + flucloxacillin Switch ciprofloxacin ciprofloxacin + TMP-SMX (8 months) None Survived after targeted treatment 31 2017 Bonifaz et al. [ 35 ] N. brasiliensis 24, F NR NR Fever Weight loss Fatigue Perineal and loin pain Skin nodules at medial thigh, on the external genital tract and pelvis Ovarian biopsy Ovary Perineum Thigh Pelvis NR None amikacin + TMP-SMX + Switch amoxicillin/clavulanate + TMP-SMX None Survived after 6 months of follow-up 32 2018 Roy et al. [ 36 ] N. paucivorans 63, F Lung Tx Mycophenolate mofetil Tacrolimus Corticosteroids Abdominal pain Nausea Vomiting Renal abscess Kidney NR None imipenem + TMP-SMX (8 weeks) Then TMP-SMX (9–12 months) Nephrectomy Survived at discharge of hospital 33 2019 Sakamaki et al. [ 9 ] N. farcinica 70, M Interstitial lung disease Diabetes mellitus Corticosteroids Cyclosporin Turbid urine Urine Prostate NR levofloxacin TMP-SMX Switch imipenem/cilastatin Switch TMP-SMX + amoxicillin/clavulanate (12 months) None Survived at discharge of hospital 34 2021 Marques et al. [ 37 ] Nocardia sp. 78, M Heavy alcohol consumption None Seizures Fever Cough Prostate abscess Prostate Brain Lung Liver Kidney Spleen NR amoxicillin-clavulanate Then ceftriaxone + metronidazole TMP-SMX + amikacin + imipenem (8 months) ceftriaxone + amoxicillin/clavulanate (4 months) None Survived after 12 months of follow-up 35 2021 Pan et al. [ 38 ] N. farcinica 66, F Idiopathic membranous nephropathy Corticosteroids Tacrolimus Cyclophosphamide Fever Fatigue EBUS-TBNA biopsy of the pulmonary lesions Lungs Brain Kidney 3 months cephalosporin + levofloxacin (3 weeks) Piperacillin-tazobactam (8 days) meropenem + TMP-SMX (2 weeks) Switch TMP-SMX (6 months) None Survived after 6 months of follow-up 36 2022 Shen et al. [ 39 ] Nocardia sp. 66, F Diabetes mellitus Adenomyosis Leiomyoma Chronic cervicitis None Abdominal pain Pollakiuria Difficult defecation Tubo-ovarian abscess Ovary Uterus Colon Rectum NR ceftriaxone + metronidazole + doxycycline Switch to imipenem + doxycycline imipenem + doxycycline (14 days) Total hysterectomy and bilateral adnexectomy Survived at discharge of hospital Legend: ALL = acute lymphoblastic leukemia; BAL = bronchoalveolar lavage; COPD = chronic obstructive pulmonary disease; CSF = cerebrospinal fluid, EBUS-TBNA = endobronchial ultrasound-guided transbronchial needle aspiration; F = female; HIV = human immunodeficiency virus; M = man; NA = not applicable; NR = not reported; p-ANCA GN = perinuclear antineutrophil cytoplasmic antibody-positive glomerulonephritis; sp. = species; Tx = transplantation; TMP-SMX = trimethoprim-sulfamethoxazole Cases of genitourinary and urological nocardiosis reported in the literature Anorexia Weight loss Abdominal pain Renal abscess Skin abscess (autopsy) Kidney Skin Blood Lungs Alkylating agents Corticosteroids Vinca alkaloid Hemoptysis Weight loss Fever Sputum Scalp abscess Renal and cerebellar abscesses (autopsy) Lung Brain Kidney Sputum Renal abscess Cerebral abscess (autopsy) Lung Kidney Brain Sputum Renal abscess (autopsy) Lung Kidney methicillin + chloramphenicol Then cephalothin Alkylating agent Corticosteroids Oral + pharyngeal ulcers Recurrence with adenopathy, fever and scrotal swelling Oral scraping Sputum Testicular abscess (autopsy) Mouth Pharynx Lung Testis Systemic lupus erythematosus Diabetes mellitus Fever Nodular skin lesions Scrotal swelling Recurrence 1 year later Skin lesion Urine Urine Skin Prostate Prostate sulfonamide Then tetracycline (2 months) sulfonamide (12 months) No recurrence 1 year after targeted treatment Deceased 1 year after remission Waldenström’s macroglobulinemia Lung adenocarcinoma Hemoptysis Scrotal swelling Testicular abscess Sputum Testis Lung chloramphenicol + tetracycline Then sulfonamide Myeloproliferative disorder Splenectomy Corticosteroids Alkylating agents Persistent urinary infection Fever Testicular abscess BAL fluid Testis Prostate Lungs Liver + carbenicillin + sulfadiazine + ampicillin + cycloserine Corticosteroids Azathioprine Cyclosporin Scrotal swelling Decreasing vision Testis Eye Fever Loin pain Renal abscess Sputum Kidney Lungs Cyclosporin Corticosteroids Azathioprine Abdominal pain Fever Kidney Iliopsoas muscle Cyclosporin Corticosteroids Azathioprine Scrotal swelling Subcutaneous abscess Subcutaneous tissue Testis Fever Weight loss Cough Recurrence with headache, hemiparesis Renal abscess BAL fluid CSF Kidneys Lungs Brain cefixime Then TMP-SMX + zidovudine TMP-SMX Switch doxycyclin + ciprofloxacin TMP-SMX Dysuria Loin pain Fever Urine Blood Kidney Blood Non-Hodgkin lymphoma COPD Alkylating agent Corticosteroids Fever Cough Malaise Fatigue Urine Blood Kidney Blood Lung Tacrolimus Mycophenolate mofetil Corticosteroids Fever Abdominal pain imipenem (2 months) Switch roxithromycin (7 months) Skin lesions Fever Abdominal pain Fatigue Skin pustules and ulcer Peritoneal cavity fluid Skin Kidney Liver Peritoneal cavity Lungs (suspected) ampicillin, cefadroxil, roxithromycin gentamicin, cephazolin, oxacillin, clindamycin, ciprofloxacin, rifampicin TMP-SMX + amikacin Switch cefotaxime + amikacin (9 weeks) Nephrectomy Surgical drainage Corticosteroids Tacrolimus Azathioprine Dysuria Suprapubic pain Scrotal swelling Fever Urine Blood Prostate Blood ciprofloxacin Then ampicillin-sulbactam Alkylating agents Corticosteroids Fatigue Weight loss Fever Scrotal swelling Testicular abscess Blood Testis Blood TMP-SMX Then meropenem + tetracycline (6 months) Cough Fever Thyroid abscess Sputum Blood Thyroid Lungs Blood Heart Kidney Brain Bones Soft tissue (autopsy) Fatigue Fever Vomiting Pelvic pain Tubo-ovarian abscess Appendicitis Ovary Appendix Lungs (suspected) Vulva Bone Mycophenolate mofetil Tacrolimus Corticosteroids Abdominal pain Fever imipenem/cilastatin Then TMP-SMX (6 months) T-cell ALL Stem cell Tx Alkylating agents Cyclosporin Methotrexate Corticosteroids Fever Hematuria Scrotal swelling Convulsions Testis Brain Corticosteroids Tacrolimus Malaise Cough Breath shortness Lungs Kidney Brain Blood imipenem-cilastatin + TMP-SMX Then meropenem + amikacin Then linezolid (38 days) Then TMP Weight loss Fever Dyspnea Kidney Lungs Brain Skin infection Arthralgia Fever Scrotal swelling Skin biopsy Testicular abscess Skin Testis acyclovir + cefepime Then vancomycin meropenem + vancomycin Then TMP-SMX (4 months) + minocycline + imipenem + cilastatin (2 months) Glioblastoma Chronic kidney disease Chemotherapy Corticosteroids Chest pain Weight loss Dysuria Urine Blood Prostate Blood Lungs (suspected) Hemiparesis Fever Renal abscess Brain abscess Kidney Brain meropenem + amikacin Switch meropenem + TMP-SMX (8 weeks) Then TMP-SMX only (1 year) Corticosteroids Etanercept Dysuria Abdominal pain Fever Prostate Blood ceftriaxone + gentamicin + flucloxacillin Switch ciprofloxacin Fever Weight loss Fatigue Perineal and loin pain Skin nodules at medial thigh, on the external genital tract and pelvis Ovary Perineum Thigh Pelvis Mycophenolate mofetil Tacrolimus Corticosteroids Abdominal pain Nausea Vomiting imipenem + TMP-SMX (8 weeks) Then TMP-SMX (9–12 months) Interstitial lung disease Diabetes mellitus Corticosteroids Cyclosporin TMP-SMX Switch imipenem/cilastatin Switch TMP-SMX + amoxicillin/clavulanate (12 months) Seizures Fever Cough Prostate Brain Lung Liver Kidney Spleen amoxicillin-clavulanate Then ceftriaxone + metronidazole TMP-SMX + amikacin + imipenem (8 months) ceftriaxone + amoxicillin/clavulanate (4 months) Corticosteroids Tacrolimus Cyclophosphamide Fever Fatigue Lungs Brain Kidney cephalosporin + levofloxacin (3 weeks) Piperacillin-tazobactam (8 days) meropenem + TMP-SMX (2 weeks) Switch TMP-SMX (6 months) Diabetes mellitus Adenomyosis Leiomyoma Chronic cervicitis Abdominal pain Pollakiuria Difficult defecation Ovary Uterus Colon Rectum ceftriaxone + metronidazole + doxycycline Switch to imipenem + doxycycline Legend: ALL = acute lymphoblastic leukemia; BAL = bronchoalveolar lavage; COPD = chronic obstructive pulmonary disease; CSF = cerebrospinal fluid, EBUS-TBNA = endobronchial ultrasound-guided transbronchial needle aspiration; F = female; HIV = human immunodeficiency virus; M = man; NA = not applicable; NR = not reported; p-ANCA GN = perinuclear antineutrophil cytoplasmic antibody-positive glomerulonephritis; sp. = species; Tx = transplantation; TMP-SMX = trimethoprim-sulfamethoxazole The diagnosis of nocardiosis requires the identification of Nocardia in a bacteriological sample. Nocardia can be isolated by culture from different samples such as sputum, bronchoalveolar lavage fluid, abscess fluid and blood [ 4 , 7 ]. Because of the slow-growing nature of Nocardia , isolates can take up to 2 weeks to grow on routine culture media used in clinical laboratories, making them difficult to identify [ 7 ]. Nevertheless, identification of Nocardia species is important because antimicrobial susceptibility varies among species [ 1 , 2 , 4 – 7 ]. Optimal management for nocardiosis has not been established because of the lack of comparative controlled studies, due to the rarity of the cases. TMP-SMX remains the first-choice agent due to good responses as observed since 1950s and because of its good penetration in the CNS [ 1 , 5 , 6 ]. The main adverse reactions to high-dose TMP-SMX therapy are myelosuppression, hepatotoxicity, renal insufficiency and allergic reaction. Linezolid is a good alternative for disseminated and CNS nocardiosis, but its toxicity includes a high risk of myelosuppression and peripheral neuropathy [ 1 ]. Initial multidrug therapy is recommended for most forms of nocardiosis (except limited skin infection). Therapeutic changes should be based on initial therapy, susceptibility results and individual specificities. Treatment duration is generally extended to minimize the risk of disease relapse [ 6 ]. Nocardia infections may recur because of the slow replication of the pathogen and its intracellular presence [ 7 ]. Immunodeficient hosts and/or patients with CNS nocardiosis should receive at least 12 months of antimicrobial therapy (initially intravenous therapy for 4–6 weeks followed by oral agent for 6–12 months) [ 1 , 6 , 38 ]. Neurosurgical drainage should be considered in case of large brain abscess not responding to antimicrobial therapy. Patients with surgical and antibiotics therapy had lower mortality [ 6 ].