Melittin - A Main Component of Bee Venom: A Promising Therapeutic Agent for Neuroprotection through Nrf2/HO-1 Pathway Activation

Melittin - A Main Component of Bee Venom: A Promising Therapeutic Agent for Neuroprotection through Nrf2/HO-1 Pathway Activation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Melittin - A Main Component of Bee Venom: A Promising Therapeutic Agent for Neuroprotection through Nrf2/HO-1 Pathway Activation Jaehee Yoo, Cong Duc Nguyen, Hai-Anh Ha, Sang Jun Jeong, Ji Hye Yang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4626190/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The Nrf2/HO-1 pathway, known for its significant role in regulating innate antioxidant defense mechanisms, is increasingly being recognized for its potential in neuroprotection studies. Derived from bee venom, melittin's neuroprotective effects are raising interest. This study confirms that melittin specificity upregulated the weaken Nrf2/HO-1 signaling in mice brain. Interestingly, we also revealed melittin’s efficient tactic, as the restored redox balance alone gradually stabilized other regulations of the mouse hippocampus. Using a scopolamine-induced, a common and effective neurodegeneration model in mice, chemical analysis revealed that melittin crosses the compromised blood-brain barrier, accumulates in the hippocampus, and significantly enhances neurogenesis and cognitive function in scopolamine-induced mice. Careful observation in mice showed: first signs of changes within 5 hours after melittin administration were the restoration of the Nrf2/HO-1 system and suppresses oxidative stress. After this event, from 7 to 12.5 hours after administration were the rebalancing of inflammation, apoptosis, neurotrophic factors, cholinergic function, and mitochondrial performance. This chain reaction underscores the redox balance's role in reviving multiple neuronal functions. Evidence of enhancement in mouse hippocampus led to further exploration with hippocampal cell line HT22. Immunofluorescence analysis showed melittin-induced Nrf2 translocation to the nucleus, which would initiating the translation of antioxidant genes like HO-1. Pathway inhibitors pinpointed melittin's direct influence on the Nrf2/HO-1 pathway. 3D docking models and pull-down assays suggested melittin's direct interaction with Keap1, Nrf2/HO-1’s activator. Overall, this study not only highlighted melittin specifically effect on Nrf2/HO-1, thus, rebalancing cellular redox, but also showed that this is a effective multi-effect therapeutic strategy against neurodegeneration. melittin bee venom neurodegeneration antioxidant Keap1 Nrf2 HO-1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1. Introduction The brain especially is more vulnerable than other organs to oxidative stress. During the aging process, redox unbalances resulting from metabolism plays a detrimental role in cellular regulation [ 1 ]. Lipid peroxidation, induced by excessive oxidative, yields unstable byproducts such as lipid hydroperoxides, which undergo non-enzymatic decomposition to produce aldehydes like malondialdehyde. These harmful compounds ultimately form covalent adducts that modify critical proteins, ultimately impairing neuron function, trigger inflammation, apoptosis, leading to neuronal cell loss[ 2 , 3 ]. Combating neuro aging has always been a top-notch debate. Recent studies suggested that neutralizing oxidative stress and restoring cellular redox balance can offer a greater holistic recovery approach than implementing anti inflammation strategies. Genes related to antioxidants and detoxification help maintain cellular balance, preventing inflammation triggers[ 4 – 6 ]. Contemporary research strongly emphasizes the role of imbalanced reactive oxygen species (ROS) and excessive electrophiles as primary instigators of neural dysfunction. Nrf2, a transcription factor that governs antioxidant gene expression, plays a pivotal role in this context [ 7 ]. Nrf2 binds to the antioxidant response element (ARE) to initiate the transcription of key antioxidants and phase two detoxifying enzymes [ 10 , 11 ]. Nrf2 activity is anticipated to serve as a defense against various diseases, including cancer, neurodegenerative disorders, cardiovascular diseases, acute lung injury, and autoimmune conditions [ 8 , 9 ]. The HO-1 antioxidant enzyme, a primary product of Nrf2-ARE activation, represents a major intrinsic cellular defense against oxidative stress and toxins, helping to maintain cellular homeostasis and prevent damage-induced inflammatory responses [ 10 , 11 ]. Decreased Nrf2/HO-1 activation has been observed in neurodegenerative disorders [ 12 ], and reactivation of this pathway is a comprehensive anti-neurodegenerative strategy [ 12 – 18 ]. Bee venom, particularly its main component melittin, is gaining increasing attention for its neuroprotective effects [ 19 , 20 ]. Although previous renal studies have shown that melittin can restore cellular redox balance via the Nrf2/HO-1 pathway [ 21 ], the precise mechanisms and the sequence of interactions leading to its final therapeutic effects remain unclear. Additionally, to our knowledge, no research has yet investigated whether melittin can cross the blood-brain barrier and upregulate the Nrf2/HO-1 system in an in vivo neurodegenerative context. Figure 1 The proposed action of melittin in combating neurodegeneration involves its interaction with the Keap1/Nrf2/HO-1 pathway. Specifically, melittin may interact directly with the Keap1 molecule, which is a crucial step in this process. This interaction leads to the activation of the cellular antioxidant system. Once activated, this system effectively neutralizes harmful reactive oxygen species (ROS), which are known to contribute to neurodegenerative conditions. This holistic mechanism positions melittin as a potential therapeutic agent for neurodegenerative diseases by bolstering the body's natural defense against oxidative. The scopolamine model used in this study, widely used to induce memory deficits and cognitive impairment in mice, is essential for Alzheimer's research and treatment exploration. By blocking muscarinic receptors and generating oxidative stress, scopolamine mimics Alzheimer's cognitive deficits, enabling assessment of various therapeutic compounds and extracts[ 22 – 24 ]. Unlike other intracerebroventricular models, this study uses subcutaneous scopolamine injection in the mouse abdomen. This method preserves the brain's physical integrity, allowing for the examination of melittin's ability to cross the blood-brain barrier. As in vivo study focuses on the hippocampus due to its crucial role in learning and memory, for more in-depth in vitro experiments, we used glutamate-induced stress on mouse hippocampal HT22 cells. This is a widely employed in vitro model, that mimics brain stress, causing programmed cell death, mitochondrial dysfunction, and ROS generation. These effects mirror mechanisms seen in psychiatric and neurodegenerative diseases, making it a valuable model for studying stress-induced neuronal damage. [ 25 – 29 ]. Previous works using a range of melittin has discovered its’ dosage dependent neuroprotective effect, but these research were clearly not intensive enough to prove what is the targeted mechanisms [ 30 , 31 ]. In this research, we pick one dosage from that range and study more intensively how melittin impacts on mice brain, particularly focusing on the hippocampus and its regulatory mechanisms. This in vivo research gave good evidence to melittin's ability to penetrate the disrupted blood-brain barrier in neurodegenerative mice. Our investigation demonstrated for the first time that melittin directly interacts with and reactivates the compromised Nrf2/HO-1 pathway, effectively restoring cellular redox balance. This reactivation establishes a foundation for the natural recovery of various downstream processes, including inflammation, apoptosis, neurotrophic factor regulation, cholinergic function, and mitochondrial performance. This finding was further substantiated by in vitro experiments conducted on mouse HT22 hippocampus cells. 2. Material and Method 2.1. Animal and Group Segregation One hundred and twenty-two 6-week-old male BALB/c mice were obtained from Samtaco (Gyeonggi-do, Republic of Korea). The mice were housed under controlled conditions, including a 12-hour light-dark cycle at a temperature of 25 ± 3°C and constant humidity. Food and water were provided ad libitum. After a 6-day acclimatization period, the mice were randomly divided into groups for two in vivo experiments. First In Vivo Experiment ( Fig. 2 ): The mice were divided into four groups with eight mice each: 1. Control group: PBS intraperitoneally (I.P.) and subcutaneously (S.C.) 2. Melittin-only group: PBS I.P. and Melittin 0.1 mg/kg S.C. 3. Scopolamine-only group: Scopolamine 1 mg/kg I.P. and PBS S.C. 4. Scopolamine and Melittin group: Scopolamine 1 mg/kg I.P. and Melittin 0.1 mg/kg S.C. These groups underwent treatments, behavioral tests, and were then sacrificed for biochemical analysis (Fig. 3 – 5 ). Second In Vivo Experiment ( Fig. 6 ): The mice were divided into three groups with thirty mice each: 1. Group 1: Received scopolamine 1 mg/kg I.P. from days 1 to 4. 2. Group 2: Received scopolamine 1 mg/kg I.P. from days 1 to 4 and additional melittin treatment (0.1 mg/kg S.C.) on the final day. 3. Group 3: Received 0.1 ml PBS I.P. from day 1, serving as a reference normal group. This experiment aimed to evaluate the time-dependent effects of melittin on multiple signaling pathways, including Nrf2 activity, HO-1 gene expression, ROS and GSH levels, iNOS, TNF-α, IL-1β, and IL-6 gene expression, as well as hippocampal Ach and ATP levels, BDNF, and Bcl-2 gene expression. At each time point, five mice from each group were sacrificed, and hippocampal samples were analyzed (Fig. 7 ). This study was conducted in accordance with the Guide for the Care and Use of Laboratory Animals of the National Research Council (NRC, 1996) and was approved by the Committee of Animal Care and Experimentation of Dongshin University, Korea (DSU2021-01-07). Mice were randomly selected for sacrifice and group assignments using a random number generator ( www.calculator.net ). The scopolamine was administered I.P. at 4:00 am. Melittin was administered S.C. at 9:00 am at a non-acupoint (Hypochondrium 10 mm above the iliac crest) to avoid interference from acupuncture effects. PBS injection served as the placebo. Behavioural experiments for the assigned group were conducted at 7:00 PM. Melittin with 97% purity was used (M4171, Sigma-Aldrich, MO, USA). The chosen dosage of 0.1 mg/kg was based on previous studies demonstrating its efficacy in suppressing neurodegenerative symptoms in mice. 2.2 Morris Water Maze Test Ten hours after the scopolamine injection − 5 hours after melittin injection, the behavior experiment commenced. The Morris water maze was assembled by filling a black circular tank with water (diameter: 120 cm & height: 50 cm) decorated by various graphical indicators on a pole in a fixed position during the whole experiment. Water temperature was maintained at 22 ± 2℃. The tank area was virtually split into four quadrants: southeast, northeast, southwest, and northwest. A white platform with 10 cm diameter and 25 cm height – was placed in the middle of the northwest quadrant. The swimming movement of the mice was evaluated using the Any-Maze software (Stoelting Co., Wood Dale, U.S.A.). On day 1, an adaptation exercise was accomplished. The animals were permitted to swim freely for 100 s in the tank with the observable platform 1 cm above the water. This was performed three times a day for every mouse; if a mouse was incapable of finding the platform, it was manually led to the position. From day 2 to day 5. The platform was submerged 1 cm below its surface. The mouse was laid at the center of the northeast quadrant in the first experiment and at the center of the southwest quadrant in the second experiment. The mouse was then allowed to find the platform within 100 s, and if the platform could not be found within 100 s, the mouse was moved to the platform and kept for 10 s. The mouse was then gently placed in a warm water bag and moved back to the cage. After the above experiment, each mouse was allowed to swing freely for 120s in the tank, however the platform was removed. The swimming patterns were collected to create heatmaps to evaluate each group memory of the platform position. 2.3 Y-Maze Test On day 6, 10 hours after the scopolamine injection − 5 hours after melittin injection, Y-maze task was executed. The Y-maze is a three-arm maze (40 cm in length, 3 cm in width, and 12 cm high) in which the three arms, made of black polyvinyl plastic, are symmetrically separated at 120°. Mice were initially placed within the same arm, and the arm entry order was recorded over a 5 min period. In this experiment, a spontaneous alternation was defined as entries into all three arms consecutively: ABC, CAB, or BCA, but not BAB, ABA, or CAC. The ANY-maze animal behavior monitoring software (Stoelting Co., Wood Dale, IL, USA) was used to record and determine the results. 2.4 Collection Of Brain Hippocampal Tissue The hippocampus was specifically chosen for its importance in the formation and recalling of memory, this organ is also the focus of Alzheimer's studies [ 32 – 34 ]. For in vivo experiment 1 (sections 3.1 –3.3) mice were sacrificed on the 6th day after the Y maze test. For in vivo experiment 2 (sections 3.4) 5 mice from each group were analyzed at each time point. All mice were anesthetized with isoflurane 3.5% induction for 3 minutes and 1.5–2.0% maintenance, blood was collected from left ventricles, each mouse was carefully perfused with 7 ml of ice-cold saline and 5 ml ice cold 5% paraformaldehyde, subsequently, their brains were collected. The brains were immediately rinsed with physio- logical saline, and the hippocampus were collected. Subsequently, these samples were subjected to further biochemical analysis on the same day, where 5 right hemispheres from 5 different animals of each group were further fixed in ice cold 5% paraformaldehyde again for immuno-histochemistry analysis. 2.5 Extraction For Melittin from Hippocampal Tissue Hippocampal tissue was homogenized with − 20 o C cold methanol (0.25 mL per 50 mg tissue), then − 20 o C cold chloroform (0.25 mL per 50 mg tissue) were added, mixed, and incubated at 2 o C for 15 min. Subsequently ice-cold water (0.25 mL per 50 mg tissue) was added, then the sample was mixed and incubated once more. Phase separation was made by centrifuging the mixture at 13,000 rpm for 5 min at 4℃, the upper aqueous phase containing melittin was collected, these were then freeze dried and then solute in 25µL distilled water for Mass spectrometer analysis. 2.6 Mass Spectrometry Analysis for melittin quantification and Keap1 qualification For melittin quantification: The melittin after being extracted from the brain’s hippocampus was then went through LC − MS/MS for analysis. Establishment of baseline as well as peak spiking and quantitative calculations was closely followed a former publish research. The system comprised of an Ultimate 3000 UHPLC, and mass detection was accomplished using an LTQ-Orbitrap Velos (Thermo Fisher Scientific, San Jose, CA). The analytical was column Accucore™ C18 + UHPLC of 1.5 µm particle size, diameter of 2.1 x 100 mm. The flow rate was set at 0.3 mL/min. Sample injection volume was set at 2.0 µL. Two eluent solvents: water (A) and acetonitrile (B) were used with following gradient: 0–3 min: B at 5%; 3–9 min: B to 100%, 9-9.5 min: hold B at 100. The interface was at the voltage of 4.6 kV and the temperature of 270°C, the detection voltage was at 1.97 kV. In the positive ionization mode, mass survey scans were performed in the FT cell with the span of 100 to 1,400 m/z. The automatic gain control was 1 x 10 6 ions. Commercial standard melittin (M4171, Sigma-Aldrich, MO, U.S.A.) was utilized to define analysis condition and melittin peak retention time. The main peak in TIC was evaluated by typical un-fragmented mass spectrometry profile of melittin. This value was then confirmed with result of other studies [ 35 ]; subsequently, this specific mass data is the indicator to detect melittin the analyzed samples. For Keap1 qualification: Following the visualization of suspected Keap1 band at around 60 kDa position, which will be explained later. To avoid noise in mass analysis caused by Coomassie staining, another identical membrane to the one exhibited in Fig. 10 was used, but it was stained only with Keap1 primary and secondary antibodies. Then, the similar suspected Keap1 band around 60 kDa was marked and excised carefully so it only contains the suspected band, thus increased purity after extraction. The membrane section was incubated in stripping buffer to remove antibodies and staining reagents. Proteins that attached on this small piece of membrane were removed by using eluting solution 50% acetonitrile (ACN) and 0.1% trifluoroacetic acid (TFA), then evaporated to collect only protein in a test tube before trypsin digestion and MALDI analysis. The resulting peptides were purified using Zip-tip C18, then mixed with an α-cyano-4-hydroxycinnamic acid matrix (2.5 mg/ml) containing 50% ACN and 0.1% TFA, and dried on stainless steel targets. MALDI-TOF MS analysis was performed using an AXIMA-TOF2 mass spectrometer in positive ion mode, settings including a 19 kV source voltage, 5 kHz laser frequency, and 15 µJ laser energy. We confirmed the presence of Keap1 by matching significant peaks at m/z 1803.95, 2066.79, and 2135.1 of the commercial standard mouse Keap1 (OPCA03207, Aviva Systems Biology Corporation 6370, San Diego, CA USA). 2.7 Doublecortin (DCX) immuno-histochemistry staining Post-fixed brain hemispheres were incubated in 27% sucrose for another 24 h at 4°C. After being frozen, brain hemispheres were sliced into 30 µm sagittal sections. At room temperature, sections were blocked in with 6% bovine calf serum for blocking, and then in doublecortin primary antibody (1:400, 2 h), rinsed and then incubated with Alexa Fluor 488 secondary antibody (Ex/Em = 490/525 nm, 1:400, 2 h). After two additional rinses slides were covered in Fluoromount™ Aqueous Mounting Medium then topped with glass coverslips and were sent for microscopic imaging. The images of hippocampal dentate gyrus area were photographed using the Invitrogen EVOS FL Auto Imaging System (Thermo Fisher Scientific, Waltham, MA, USA) with a 20× objective, DCX positive cell were counted in a same area and compared between each group. 2.8 Extraction of nuclear and cytosolic proteins for Nrf2 determination To extract both nuclear and cytosolic NRF2, we started by homogenizing hippocampus samples using a hypotonic buffer consisting of 10 mM Tris-HCl (pH 7.5), 10 mM NaCl, and 3 mM MgCl2, which allows cellular swelling while maintaining nuclear integrity, and perform this in cold conditions to prevent protein degradation. Then we centrifuged the homogenate at 1,000 x g for 10 minutes at 4°C to pellet the nuclei; retain the supernatant as it contains the cytosolic proteins was stored for western blot analysis. Resuspend the nuclear pellet in a high-salt nuclear extraction buffer containing detergents and protease/phosphatase inhibitors. After a further high-speed centrifugation at 15,000 x g for 30 minutes at 4°C, the supernatant containing nuclear proteins was collected. 2.8 Western blot analysis Hippocampus samples were homogenized in a 50 mM tris aminomethane hydrochloric acid (Tris-HCl, pH 7.4), solution with phosphate inhibitor and protease inhibitor, at approximately 2°C. First, samples were centrifuged at 12,000 rpm, at temperature 4°C for 10 min, a BCA protein analysis kit (ab102536, Abcam, Cambridge, UK) was used to measure total protein content to normalize this parameter among samples. The protein content was mixed with a 25% volume loading buffer and heated at 95°C for 5 min. Then, an amount of 20 µg protein was loaded into wells and electrophoresed via 8% SDS-PAGE gel. Subsequently, separated proteins were transferred onto a polyvinylidene fluoride membrane (PVDF) membrane. Thereafter, 5% non-fat milk was used to block this membrane at room temperature for 1 h and incubated with anti-Lamin B (MABS492, MercK KGaA, Darmstadt, Germany), anti- HO-1 (ab52947, Abcam, Cambridge, UK), anti-BDNF (MABN79, MercK KGaA, Darmstadt, Germany), anti-p-CREB (06-519, Sigma-Aldrich, MO, U.S.A.), anti-iNOS (ab178945, Abcam, Cam- bridge, UK), anti-mAchR (m1M9808, Merck KGaA, Darmstadt, Germany) and anti-β- actin (ab8226, Abcam, Cambridge, UK). After initial antibody probing, the membrane was treated with stripping buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 100 mM β-mercaptoethanol) at 55°C for 30 minutes. The membrane was then washed with TBS-T three times for 10 minutes each. This allowed for re-probing with a new antibody or staining with Coomassie Brilliant Blue to visualize all proteins. Thereafter, at room temperature, membranes were first rinsed in phosphate- buffered saline with Tween 20 and then incubated with (HRP)-conjugated anti-rabbit secondary antibody (G-21234, Thermofisher, Massachusetts, USA). Another rinse by PBST, then membranes were treated with ECL prime kit (GERPN2236, Sigma-Aldrich, MO, USA). The Amersham™ ImageQuant™ system (Boston, USA) was used to capture the proteins signals, quantitative analysis was carried out via ImageJ ( http://imagej.nih.gov/ ). 2.9 Biochemical assays The hippocampus was homogenized PBS at 3℃, then centrifuged at 10,000 × g for 10 min at 4℃ with 10% homogenates, the upper layer, known as tissue’s proteins extract, was collected, and stored at -80℃ for biochemical assessment. Total protein content was measured via a BCA Protein Assay Kit (ab102536, Abcam, Cambridge, UK). Examinations on cholinergic system were carried out via AchE kit (ab138871, Abcam, Cambridge, UK), Ach kit (STA-603, Cell Biolabs, CA, USA), ATP level assay kit (ab83355, Abcam, Cam- bridge, UK), and GSH kit (ab239727, Abcam, Cambridge, UK). For tissue ROS measurement, extracts were mixed with DCFDA (15 µM final concentration), and incubated at 37°C for 45 minutes in the dark. Measure the fluorescence intensity using a microplate reader at excitation/emission wavelengths of 485/535 nm. Increased fluorescence indicates higher ROS levels. For DNA binding assay. After the nucleus proteins were extracted as in the 2.8 section. Assays were carried out using the DNA-binding activity of Nrf2 was valued using the Trans-AM® Nrf2 kit (Catalog Nos. 50296, Active Motif, Carlsbad, CA, USA). Briefly, in the commercial ELISA plate, 15 µg of collected nuclear extract was incubated with the antioxidant response element (ARE) consensus sequence as well as immobilized mutated or wild-type competitor oligonucleotides. The detection for bound Nrf2 was made via anti-Nrf2 primary antibody (1:1000) and HRP-conjugated secondary antibody (1:1000). This was followed by chromogenic reaction by TMB substrate, and the absorbance was assessed at 450 nm using a plate reader. 2.10 Quantitative PCR Assay From the homogenized hippocampus tissue, total RNA was separated by extraction by Trizol (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized via the PrimeScript RT kit (Takara Bio Inc., Osaka, Japan) corresponding to the manufacturer guidelines. PCR assay was executed with 1 µL of cDNA and primer at 0.3 µM. The instrument was a LightCycler® 480 System (F. Hoffmann-La Roche Ltd., Basel, Switzer- land) with the reaction medium as the TB Green Premix DimerEraserTM (Takara Bio Inc., Shiga, Japan). Sequent setup: initialization was first for 30 s at 95°C, then 40 cycles in amplification were made, subsequently denaturation in 5 s at 95°C, and for annealing and elongation in 30 s at 72°C. Normalization to those of β-actin gene was made. Primer sequences: HO-1: Forward 5′ CCTTCCCGAACATCGACAGCC-3′, Reverse 5′- GCAGCTCCTCAAACAGCTCAA-3′. BDNF exon IX: Forward 5′- GCCTTTGGAGCCTCCTCTAC − 3′ Reverse 5′- GCGGCATCCAGGTAATTTT − 3′. Bcl-2: Forward 5’- GCCACCTATCTGAATGACCACC − 3′ Reverse 5′- AGGAACCAGCGGTTGAAGCGC − 3′. iNOS: Forward 5’- CACCTTGGAGTTCACCCAGT − 3′, Reverse 5′- ACCACTCGTACTTGGGATGC − 3′. TNF-α: Forward 5’- GGTGCCTATGTCTCAGCCTCTT − 3′ Reverse 5′- GCCATAGAACTGATGAGAGGGAG − 3′. IL-6: Forward 5’- AGACAGCCACTCACCTCTTCAG − 3′, Reverse 5′- TTCTGCCAGTGCCTCTTTGCTG − 3′. IL-1β: Forward 5’- AGACAGCCACTCACCTCTTCAG − 3′, Reverse 5′- TTCTGCCAGTGCCTCTTTGCTG − 3′. β-actin: Forward (5′-CCAGAGCAAGAGAGGTATCC-3′, Reverse 5′-CTGTGGTGGTGAAGCTGTAG- 3′. 2.11, HT22 mouse hippocampal cell culture and treatment Mouse hippocampal HT22 cells (SCC129, Sigma-Aldrich, MO, USA) were cultured in DMEM supplemented with FBS (10%) and penicillin–streptomycin (1%) in 5% CO 2 environment at 37°C. After 5 passages to obtain cell stocks, the cell was prepared for seeding. The cells were cultured in 96-well plates at 1 × 10 4 cells/well density in 0.1 mL media. Twenty-four hours after seeding, cells were subjected to drugs treatments of melittin only, or melittin + glutamate, or melittin + glutamate + inhibitors, as per experiment. After treatments, these cells were incubated for another 12 h and then tested with the WST-8 kit for cell viability determination. Inhibitors were used to hint out which pathway might be the focus of melittin: JNK Inhibitor SP600125, HO-1 synthesis inhibitor SnPP procured from Sigma–Aldrich (St. Louis, MO, USA). The p38 inhibitor SB203580 from InvivoGen (San Diego, CA, USA). The Akt inhibitor MK-2206 from TargetMol (Wellesley Hills, MA, USA). 2.12. Nrf2 nuclear translocation immunohistochemistry of HT22 cell after melittin treatment After drugs treatments, at 0 hour and 6 hours, cell were fixed with methanol and were allowed to stand overnight with anti-Nrf2 primary antibody (ab31163, Abcam, Cambridge, UK) at 4°C, followed by incubation with GFP secondary antibody (A-11122, Thermo Fisher Scientific, Waltham, MA, USA) and DAPI (D1306, Thermo Fisher Scientific, Waltham, MA, USA) for another 1 h at room temperature. The cells were photographed using the Invitrogen EVOS FL Auto Imaging System (Thermo Fisher Scientific, Waltham, MA, USA) with a 40× objective. Quantitative analysis was carried out via ImageJ ( http://imagej.nih.gov/ ). 2.13. Molecular modeling and molecular docking To assess the binding affinities and interaction patterns of potential inhibitors with the target protein, molecular modeling and docking were performed. Initially, melittin structure were converted from Simplified Molecular Input Line Entry System (SMILES) codes into three-dimensional (3D) structures using Open Babel, an open-source tool designed for chemical data manipulation. Then, molecular docking was executed using AutoDock Vina, a recognized software for this purpose[ 36 , 37 ]. The procedure of performing docking was conducted as previously described[ 38 ]. The protein model for docking was sourced from the RCSB Protein Data Bank (PDB), specifically using the PDB code 7OFE to represent the target protein. AutoDock Vina's parameters were set to probe for optimal docking poses within a grid box centered at coordinates (-43.16, 21.16, -11.37) and sized 38.00 Å x 38.00 Å x 38.00 Å along the x, y, and z axes, respectively. The simulations explored up to nine binding modes per ligand, with an energy threshold of 3 kcal/mol and an exhaustiveness level of 128, ensuring a thorough exploration of the conformational space. Post-docking, the results were visualized and analyzed using Chimera and Discovery Studio Visualizer for highlighting hydrogen bonds, hydrophobic contacts, and the fit of ligand within the binding site on the protein. 2.14. Pull down assay The pull-down assay was conducted by attaching melittin to Epoxy-activated Sepharose 6B beads (obtained from Sigma, St. Louis, Missouri, USA). Initially, 1 mg of melittin was dissolved in 1 mL of a coupling buffer consisting of 0.1 M NaHCO 3 and 0.5 M NaCl at a pH of 11. The Sepharose 6B beads were first allowed to swell and were then cleansed with 1 mM HCl using a sintered glass filter. Subsequent washes were performed using the same coupling buffer. The beads were then combined with the melittin-infused coupling buffer and incubated at 4°C overnight. To block any non-specific binding sites, 1 M ethanolamine was used at 4°C overnight. The beads, now conjugated with melittin, underwent a series of washes with buffers alternating in pH — the first buffer containing 0.1 M acetate and 0.5 M NaCl at pH 4, and the second containing 0.1 M Tris-HCl and 0.5 M NaCl at pH 8. Post-washing, the beads were stabilized in a binding buffer containing 0.05 M Tris-HCl and 0.15 M NaCl at pH 7.5. Control beads without melittin were prepared using the same procedure. For the assay, HT22 cell lysates were prepared using PRO-PREBP lysis buffer and combined with either the melittin-conjugated Sepharose 6B or the control beads, followed by an overnight incubation at 4°C. Afterward, the beads were thoroughly washed three times with TBST and the proteins bound to the beads were eluted using SDS-loading buffer. These proteins were then separated using SDS-PAGE and analyzed via immunoblotting, employing antibodies specific to Keap1 with dilution 1:800 (A80790, Antibodies, Cambridge, UK), or later with Coomassie Brilliant Blue staining (6104-58-1, Sigma-Aldrich, MO, USA). 2.15. Statistical analysis SPSS version 18.0 was used for statistical analysis, and data were the form of mean ± SD. In quantitative measurements, data were analyzed using two-way ANOVA followed by Tukey's multiple comparison test. Differences between results were considered if the significant with p < 0.05. 3. Results Figure 2. In vivo experiment 1 (results shown in Fig. 3 – 5 ): The experimental scheme for melittin effects on behavior amnesia induced by scopolamine. After sacrifice, analysis was carried out for parameters: neurogenesis level,, Nrf2 DNA binding activity and HO-1 expression, ROS and GSH index; BDNF, p-CREB, Bcl-2, Bax, iNOS, and mAchR 1 protein expressions; AchE and Ach levels. 3.1. Chemical analysis proved melittin passing through disrupted BBB and accumulated within hippocampus tissue: The hippocampus was specifically chosen for its importance in the formation and recalling of memory, this brain organ is also the focus of Alzheimer's studies [ 32 – 34 ]. From the Total Ion chromatogram of commercial standard melittin (with a high purity of 98%), we detected a main peak and confirmed that to be the melittin. The peak tips’ retention time proximity 7.04 min. The regression equation was y = 130541x-60.074 (R2 = 0.9999) and was applied to calculate the level of melittin in samples (Fig. 3 A). Specific melittin mass pattern was based on signals broken down from this main peak: [M + 3H] 3+ m/z = 948.59 (Approximately 1/3 of melittin molecular weight), [M + 4H] 4+ m/z = 712.44 (Approximately 1/4 of melittin molecular weight), Melittin [M + 5H] 5+ m/z = 570.16 (Approximately 1/5 of melittin molecular weight), and Melittin [M + 6H] 6+ m/z = 475.30 (Approximately 1/6 of melittin molecular weight). Within the mass spectrometer chambers, each melittin molecules coupled with several H + resulted in the multiple m/z values detected. When scanning through all sample’s chromatograms at the m/z = 712.44 value, pinpoint retention time nearest to 7.04 min. This allows to detect and quantify melittin. As a result, from all mice groups, we detected only melittin in hippocampus of mice co treated with scopolamine and melittin. In the normal group as well as scopolamine only treated groups there was no amount of melittin near the suspected retention time of 7.04 min (Fig. 3 B). In scopolamine and melittin co-treated group, there was a significant amount of melittin detected in hippocampus tissue. As previous research mentioned, the administration of scopolamine can induce stress in the brain and clearly disrupt the BBB [ 39 – 41 ], this can facilitate the chance for large molecule such as melittin to enter the brain tissue such as hippocampus and produce direct effect on the hippocampal neurons. This change is BBB selectivity was reported before: when the BBB is weakened, even CD4 cells can travel into brain tissues, typically, the size of these cells restricts their entry through an intact blood-brain barrier (BBB)[ 42 ]. This is the first study to present evidence that melittin can penetrate the brain hippocampal tissue. The matter of BBB disruption which create a chance to melittin to enter hippocampal tissue is further mentioned in the discussion section (Fig. 3 B). We found weak melittin signals in the melittin only treated group samples. We explain this as: even though all mice were carefully perfused, there could still be a trace amount melittin in a very small blood volume left, despite after cleaning by perfusion (Fig. 3 B). 3.2. Melittin exhibited cognitive protective effect against scopolamine induced amnesia and recover in hippocampus neurons neurogenesis: In the water maze experiment assessing mice's long-term learning memory, notable findings emerged. Initially, scopolamine hindered cognitive function as training progressed, but on days 7–9, the scopolamine-treated group showed minor improvement, reducing latency from above 60 to around 50 seconds. Adding melittin treatment to scopolamine-pretreated mice significantly reduced escape time, nearly matching those without scopolamine (20–30 seconds). The normal and melittin-only groups showed little difference (Fig. 4 A). In the probe test, scopolamine impaired mouse memory of the platform's location, while melittin treatment improved their interaction, seen in the heatmap, and increased platform crossing times. The normal and melittin-only groups had similar high crossing times (Fig. 4 B). As the result of observing spontaneous alternation (%) in Y maze test which indicate short term memory ability [ 43 ], it was confirmed that scopolamine significantly decreased this the spontaneous alternation index, whereas melittin treatment significantly enhanced this suppression. There was no significant difference between the normal and melittin only treated group (Fig. 4 C). The brain's hippocampal physiology is closely tied to the neuroprocessing abilities of mice. One critical aspect of hippocampal function, the status of neuronal genesis in the dentate gyrus, is commonly studied due to its vital role in the development, recollection, and assessment of episodic memory. Brain sections were stained using the DCX antibody, a key marker for assessing neuronal neurogenesis state as it's expressed by developing neurons[ 32 , 33 , 44 ]. The results vividly illustrated the damage inflicted by scopolamine at an anatomical level. In the same region, the number of DCX-positive neurons decreased by approximately half compared to the normal group. However, the introduction of melittin significantly increased this count, confirming the neuroprotective effect of this drug against scopolamine-induced stress. Importantly, the group treated exclusively with melittin exhibited no significant difference from the normal group (Fig. 4 D). To further elucidate the effect of melittin on the hippocampus, we conducted more closely tests with the HT22 mouse hippocampal neurons in later parts. 3.3. Melittin showed wide neuroprotection effects in the examined hippocampus tissue: upregulation of antioxidant defenses and recovery of neurotrophic, inflammatory, and cholinergic functions in hippocampus tissue : In prior renal-disorder-related studies, it was documented that melittin played a role in modulating the nuclear translocation of the nuclear factor erythroid 2-like 2 (Nrf2), a pivotal transcription factor responsible for upregulating the expression of important antioxidant genes such as heme oxygenase-1 (HO-1)[ 21 ]. This intrinsic antioxidant barrier is important and is the cornerstone of combating oxidative stress and slowdown neurodegeneration[ 45 ]. This study is the first report to demonstrate that melittin did indeed could up regulated Nrf2/HO-1 system within animal brain’s tissue: In the hippocampus samples of scopolamine only treated mice, we could observe a collapse of the Nrf2/HO-1 system, as the nucleus Nrf2 level, its’ DNA binding activity and the HO-1 expression were only haft of that when compared to the normal group. When we administrated melittin to recuse this situation, this treatment induced Nrf2 nuclear translocation (figured by an increase in nucleus and reduction in cytoplasm Nrf2), which lead to the recovery of Nrf2 DNA binding activity and subsequently raising HO-1 production ( Fig. 5 A ) . As a result of the increased production of antioxidative enzymes, oxidative stress (ROS) levels are suppressed in the melittin, and scopolamine co-treated group compared to the group treated with scopolamine alone. Glutathione (GSH) is crucial in the oxidative stress defense system as it acts as a primary antioxidant, neutralizing reactive oxygen species (ROS) and repairing oxidative damage in cells. By acting as a natural buffer against ROS, GSH helps maintain cellular integrity and function. Its levels serve as a key indicator of tissue recovery from oxidative stress, with higher GSH concentrations reflecting improved cellular health and restoration of normal function in damaged tissues[ 46 ] (Fig. 5 B). ( Fig. 5 B ) . After proofs of cellular redox re-balancing, which it alone is not enough needed for enhanced neuronal regulations, we scanned a wide rage to see if other cellular regulations also improved by melittin: BDNF and p-CREB are crucial for neuronal survival and plasticity, and their reduced levels imply impaired neuronal health[ 47 ]. mAChR1 is essential for cognitive function, and its decreased expression suggests compromised neurotransmission[ 48 ]. iNOS was chosen as an inflammation marker due to its role in producing nitric oxide, leading to oxidative stress[ 49 , 50 ]. Bcl-2 promotes cell survival, and its reduction indicates increased cell death, while Bax promotes apoptosis, and its increase signifies heightened apoptotic activity[ 51 , 52 ]. With scopolamine-induced stress alone, we observed significantly decreased expression of key neuronal signaling proteins, including neurotrophic factors BDNF and p-CREB, and the neurotransmitter receptor mAChR1, indicating impaired neurotrophic support and cholinergic function. Scopolamine also increased inflammation, as evidenced by elevated iNOS protein levels, and promoted apoptosis by decreasing the anti-apoptotic protein Bcl-2 and increasing the pro-apoptotic protein Bax. When melittin was administered to these dysregulated mice, BDNF and p-CREB levels increased by approximately twofold, and mAChR1 levels nearly doubled, indicating recovery of neurotrophic support and cholinergic function. Melittin also reduced iNOS levels by about half, reflecting decreased inflammation, and normalized apoptotic signaling by increasing Bcl-2 levels by nearly 50% and decreasing Bax levels by about a third, suggesting an overall neuroprotective effect. Each protein marker was chosen for its critical role in neuronal survival: BDNF and p-CREB for neurotrophic support, Bcl-2 and Bax for apoptosis regulation, iNOS for inflammation, and mAChR1 for cholinergic function (Fig. 5 C). For the impact on the neurotransmitter system, an assessment of acetylcholinesterase activity and acetylcholine concentration in brain tissue revealed significant differences between the scopolamine group and the non-treatment group. Notably, the melittin. These findings suggest that melittin effectiveness is holistic across multiple aspects of neuro-recovery. Besides this, the melittin only treated group exhibited little alternations from the normal group which is suggested due to the melittin did not infiltrate into brain tissue as explained above. 3.4. Melittin enhance HO-1 gene expression as in the initially stage of action, prior to inflammation and neurotrophic factor response : Figure 6. In vivo experiment 2 (results shown in Fig. 7 ): The experimental for the effect of melittin in a time dependent manner on Nrf2 DNA binding activity; HO-1 gene expression, ROS and GSH levels; iNOS, TNF-α, IL-1β, and IL-6 gene expression; Brain Ach and ATP levels, BDNF and Bcl-2 gene expression. S.C., subcutaneous injection; I.P., Intraperitoneal injection; Scopolamine I.P.: 1mg/kg; Melittin S.C.: 0.1mg/kg. In this research, a second, more in depth, animal experiment was conducted ( Fig. 6 & Fig. 7 ). The positive effect of melittin treatment is holistic across a variety of aspects as presented above. There is a need to examine which direction might be the initial target of melittin. We performed a wide range of experiments periodically on mice after being treated with and/or melittin (Fig. 7 ). As gene transcriptions is highly sensitive and can reliably pinpoint which gene be being interacted by melittin in a prioritized manner[ 53 – 56 ]. Therefore, we based on gene expression observations, to indicate which pathway is the focus of action initially. The method of using Nrf2 DNA binding activity and HO-1 gene expression had been validated to align with Nrf2 nuclear translocation and HO-1 protein expression in previous section above, therefore these was applied to monitor in this experiment in huge quantity. Our results were astonishing. After administering scopolamine, both control and treated groups exhibited a reduction in nucleus Nrf2 DNA binding activity (which were shown to go hand-in-hand with the rate of Nrf2 nuclear translocation in section 3.3 above), decreased HO-1 gene expression, elevated hippocampal ROS, and lower GSH levels. However, when treated with melittin, significant changes in these antioxidant markers were observed as early as the 2.5th to 5th hour (Fig. 7 A). This was notably earlier than the improvements in inflammation parameters, which only became significant around the 10th hour: iNOS, TNF-α, IL-1β, and IL-6 gene expression (Fig. 7 B). Additionally, enhancements in cholinergic parameters like ACh levels, brain neurotrophic factor BDNF and anti-apoptosis Bcl-2 gene expressions, brain ATP levels were also significant, but again, not until the 10th hour (Fig. 7 C). For the first time, our study has revealed that melittin not only upregulates the weakened Nrf2/HO-1 pathway in animals at a neurodegenerative stage but also provides compelling evidence that this pathway is the initial focus of melittin's action. This discovery opens up new avenues for targeting neurodegenerative diseases and highlights the profound potential of melittin in therapeutic interventions. 3.5 In vitro experiments provide evidence of melittin's initial and directly activation of the Nrf2/HO-1 pathway, and ignore multiple inflammation and apoptosis related ERK, JNK, p38, Akt signaling pathways : After in vivo experiments on the mouse hippocampus demonstrated positive results, in this further in-depth in vitro study using the HT22 mouse hippocampal cell line, we aim to further investigate the mechanisms through which melittin exerts its effects. Glutamate negatively affects HT22 cells by causing oxidative stress, mitochondrial dysfunction, calcium overload, and apoptosis. This widely used in vitro model mimics brain stress and replicates mechanisms observed in psychiatric and neurodegenerative diseases, making it valuable for studying stress-induced neuronal damage and excitotoxicity [ 25 – 29 ]. In this section, we delve into the intriguing mechanisms by which melittin, a component of bee venom, actively interacts with the Nrf2/HO-1 pathway to exert a profound neuroprotective effect. This neuroprotection is of great interest due to its potential implications for the treatment of neurological disorders and the understanding of cellular stress responses. First, to identify the ideal concentration of melittin. The objective was to determine the highest melittin concentration that did not compromise the viability of HT22 cells, a crucial step to ensure the safety of this potent compound. It was found that 3 µM of melittin stood as the threshold concentration, effectively preserving the viability of HT22 cells (Fig. 8 A). Building upon this initial screening, we explored the neuroprotective potential of melittin in a dose-dependent manner. Concentrations ranging from 0.3 µM to 3 µM were tested against glutamate-induced stress. Our results revealed a dose-dependent neuroprotection, with higher melittin concentrations yielding more robust protective effects, the cell availability increased from about 50% up to 80% when treated with melittin (Fig. 8 B). The pivotal role of the Nrf2/HO-1 pathway in cellular defense against oxidative stress is well-established. When this system is activated Nrf2 is detached from Keap1 in cytosolic and move into the nucleus, attach to the ARE gene region to activate the transcription of antioxidant genes especially HO-1[ 57 , 58 ]. To gain insights into the cellular processes involved, we conducted fluorescent staining experiments. These experiments illuminated the dynamic translocation of Nrf2 into the nucleus following melittin treatment. Significantly, Nrf2 translocation was observed at concentrations of 1 µM and 3 µM of melittin, highlighting the engagement of this pathway in melittin-induced: Groups treat with melittin (despite treatment with glutamate) show in the 6th hour after treatment, an increase in green florescent signal that overlap the nucleus (which is stained in blue DAPI), especially the groups with 3 µM melittin exhibited very Nrf2 nuclear translocation that most of Nrf2 in the cytoplasm disappeared and almost all concentrated into the oval-shaped nucleus neuroprotection (Fig. 8 C). To find out which pathway or protein a drug targets, it is common to use inhibitors that slow down specific cellular defense response. These inhibitors help identify the drug's target because when the right inhibitor is used with melittin, it has the same target as the drug candidate, the pathway that the drug activates would now be slowed down. As a result, the drug becomes less effective specifically when co-treated with the right inhibitor[ 29 , 59 ] Melittin can activate antioxidant defenses via directly upregulation of the Keap1/Nrf2/HO-1 pathway. Or, indirectly via anti-inflammatory and anti-apoptosis responses, which in terms are closely modulated by critical proteins like ERK, JNK, p38, and Akt. Following this direction, we applied inhibitors of ERK, JNK, p38, Akt, and HO-1 synthesis proteins with their respectively concentrations. These inhibitors were used in previous research to determine target of interaction for Nrf2/HO-1 activation [ 29 , 59 ] We picked these concentrations, after screening with various dosages before, as they influenced similar cell availability of around 80% (statistically equivalent in comparison). This concentration selection is important, as we attempt to influence similar cell growth performance, as a baseline for later melittin intervention (Fig. 8 D). After introducing the above inhibitor with melittin, the treatment of all inhibitors reduces the drug’s protection. It is feasible since all the pathways are related in a broad sense to cellular recovery. However, the inhibitor that reduced the most this protection effect was HO-1 synthesis inhibitor. This implies that the most relevance to melittin direct activity is the Nrf2-HO-1 pathway (Fig. 8 E). 3.6 Docking affinity and stability of melittin on Keap1: potential impacts on Keap1/Nrf2 complex formation: The above in vivo (Fig. 5 A) and in vitro (Fig. 8 C) experiments all showed an increase translocation of Nrf2 from the cytoplasm into the nucleus. Typically, Nrf2 is held hostage within the cytoplasm by the Keap1/Nrf2 complex. Melittin action, can disguise as a natural defense stimulus to distort this complex’s stability via an attachment to the Keap1 molecule, which can liberate the intact Nrf2 from the complex and allow it to naturally move into the nucleus, where Nrf2 is the main promoter of important antioxidant gene expression such as HO-1[ 58 , 60 – 62 ]. In the molecular docking analysis, we observed several configurations of intermolecular interactions between melittin and Keap1, each exhibiting the highest predicted affinity of -7.6 kcal/mol across five docking patterns at the Keap1/Nrf2 interaction site (Fig. 9 ). The presence of diverse interaction types across these patterns suggests compensatory mechanisms that enhance stability and binding efficiency. Importantly, the strong affinity and stability of the melittin-Keap1 complexes could disrupt or modulate the Keap1-Nrf2 interaction, a critical regulator of cellular responses to oxidative stress. The interaction density in patterns 2 and 5 (Fig. 9 B, E) shows a significantly high number of van der Waals interactions, suggesting extensive surface contacts with Keap1. This is significant, as van der Waals interactions are highly crucial for the stability of protein-ligand complexes. Patterns 1, 3, and 5 (Fig. 9 A, C, & E ) exhibit a greater number of conventional hydrogen bonds, which are essential for specificity and stability in ligand binding. This indicates that these patterns might form particularly stable complexes with Keap1. The unique pi-donor hydrogen bond in pattern 4 (Fig. 9 D) likely facilitates specific and robust binding to certain Keap1 residues. Additionally, the carbon-hydrogen bonds in patterns 1 and 5 (Fig. 9 A, E) and pi-alkyl interactions in these patterns may influence the orientation and stability of melittin within the binding site. While the unfavorable donor-donor interactions noted in patterns 3 and 4 (Fig. 9 C, D) might generally be less favorable, their impact is seemingly neutralized by other stabilizing interactions, as evidenced by the consistent docking energy across all patterns. All these properties further suggest a good physical interaction of melittin and Keap1 possible. Following the 3D docking analysis elucidating the potential interaction between melittin and Keap1, a pull-down assay was conducted to experimentally confirm this interaction. The Keap1 protein is detected approximately at the 60 kDa position. In this assay, melittin was employed as the bait, conjugated on the Epoxy-activated Sepharose 6B beads, to target proteins including Keap1. In the depicted result (Fig. 10 ), the first lane shows the western blot analysis of the whole HT22 cell lysate, serving as a positive control. The second lane represents a negative control experiment, where the HT22 cell lysate was incubated with beads that were not conjugated with melittin. This lane showed no trace of Keap1, demonstrating that the beads alone do not cause any non-specific binding. This ensures that proteins shown in the third lane are those which specifically bound only to melittin, not bead’s bare surface. The HT22 cell lysate was then incubated with melittin-conjugated beads, which were subsequently collected, washed thoroughly to remove non-specifically bound proteins. SDS loading buffer, which typically contains sodium dodecyl sulfate (SDS), a strong anionic detergent, was employed to wash proteins like Keap1 from melittin-conjugated beads and analyzed by western blotting. The third lane shows the proteins released from the melittin-conjugated beads after washing, with the presence of Keap1 at the 60 kDa, similar to manufacturer description, then stained with Coomassie Brilliant Blue to visualize all proteins. The presence of Keap1 as the main protein bound to melittin beads demonstrates the selectivity of melittin for Keap1 and its potential to activate the downstream Nrf2/HO-1 pathway. Additionally, mass spectra analysis was conducted to compare the commercial standard Keap1 with the extracted protein sample. The spectra showed three significant peaks, specifically at m/z 1803.95, 2066.79, and 2135.1. These peaks were selected as the most dominant due to their high relative abundance and clear definition in both the commercial standard and the extracted sample spectra. The close match between the m/z values in the standard and extracted samples reinforces the conclusion that the extracted protein is indeed Keap1. Several peaks appear exclusively in the extracted sample and not in the standard Keap1 spectra. These peaks are likely attributable to other proteins western blot co-eluted during the extraction process. However, their significantly lower intensity indicates that these proteins are present in much smaller quantities compared to Keap1, and therefore do not represent major components in the sample. This congruence in m/z values supports the hypothesis of specific interaction and binding between melittin and Keap1. The results of the pull-down assay conclusively demonstrate the physical association between melittin and Keap1, directly supporting the findings from the docking simulations and providing robust evidence for the interaction at the molecular level. This comprehensive approach, combining western blot analysis, Coomassie staining, stripping and re-probing, and mass spectra comparison, ensures the specificity and accuracy of Keap1 extraction and identification. 4. Discussion In the initial part of our research, we focused on the ability of melittin to penetrate the blood-brain barrier (BBB). The mouse scopolamine-induced neurodegeneration model was utilized in much research to discover new anti-neurodegeneration drug candidates[ 22 – 24 , 63 – 65 ]. The brain disorders shown in this study displayed a considerable amount of neuro stress: increase in oxidative stress levels; increase in inflammatory responses; decline in neurotrophic, cholinergic system, and neuronal neurogenesis. In this study, melittin was only found in the hippocampal tissue of those: which were jointly pretreated with scopolamine to induce a neurodegenerative stage; but not in the normal mice receiving only melittin treatment. When the BBB is disrupted by neurodegenerative disease, this wall fails to filter many of the external elements and let them to migrate into brain tissues[ 39 – 41 ]. For example, when the barrier is weakened, CD4 cells, which their size usually limits them to enter through the BBB but also can be observed in the brain tissue[ 42 ]. We believe, normally, BBB filter out melittin cannot pass through BBB; but in this experiment, scopolamine induced BBB damage enough so that melittin could pass through as shown via the chemical analytical analysis, and this facilitate melittin to interact directly with neurons. While some studies have indicated that BBB disruption is an early event in neurodegenerative diseases[ 66 ], the recovery process appears to be slow and challenging. This hints that when melittin is administrative, there is certainly a window of time before BBB is fully healed that melittin can get through and go into the brain. Interestingly, this creates an interesting effect in this study that melittin only could past selectively through BBB of scopolamine induced neuro-degenerative animals, but not those in normal condition. This selective characteristic can be used as a useful hint for therapeutic strategies development. In previous cardiology and renal studies, which disease models that seem to lack the importance of BDNF/CREB signaling, melittin could help restore cellular redox balance via the Nrf2/HO-1 pathway[ 21 ]. In neurology, experiment carried out in HT22 cells revealed that melittin could upregulate Nrf2 presence in the nuclear and hence increase HO-1 production, thus reduce cellular oxidative stress parameters such as cellular ROS, MDA, LDH, and protein carbonyl levers[ 30 ]. However, on in vivo level, it remains elusive if melittin can upregulate the diminished Nrf2/HO-1 pathway in animals at a neuro-degenerative stage, also whether this pathway is the initial effect of melittin action or not. For the first time, this study revealed that melittin upregulates the diminished Nrf2/HO-1 pathway in the brain. The evidence demonstrated that melittin's initial action primarily involves enhancing HO-1 gene expression, occurring much earlier compared to the subsequent improvements in neurotrophic factors (BDNF and p-CREB), anti-apoptotic protein Bcl-2, inflammation markers (iNOS, TNF-α, IL-6, and IL-1β), and recovery of Ach and ATP levels. Additionally, our in vitro study using the HT22 cell line showed that melittin can liberate Nrf2 from the Keap1/Nrf2 complex, facilitating Nrf2's translocation into the nucleus and leading to increased HO-1 production, a novel finding. In details, there was indeed a positive change in the Nrf2/HO-1 pathway prior to inflammation parameters enhancements. This indicates the specific interaction mechanisms of melittin is rather up regulate intracellular antioxidant barrier rather than anti-inflammatory effect. Reduces neuroinflammation is a key strategy in to slow down aging brains[ 67 – 70 ]. Antioxidant and detoxification genes are believed to preserve cellular homeostasis and eliminate toxins before they can cause damage and activate inflammatory responses, also as cellar redox balance is restored cell regulation start to balance and over express inflammation cytokine tend to reduce[ 4 , 57 , 71 , 72 ]. In the brain, Microglia cells have functions similar to macrophage-like cells and contribute to homeostasis, as well as host cell defense and repair. Also, astrocytes cells offer structural, metabolic, and trophic assistance to neurons, and are also capable of producing inflammatory mediators. The activation of both cell types leads to extreme secretion of crucial proinflammatory cytokines such as iNOS, TNF-α, IL-6 and IL-1β. This facilitates negative consequences for neuronal viability and is a signature of inflammation mediated neurodegeneration[ 73 – 75 ]. Therefore, the expressions of TNF-α, iNOS, IL-6 and IL-1β inflammatory substances, were analyzed in this study. A similar pattern was seen, as the improvement of the Nrf2/HO-1 pathway was recorded much earlier, than the improvement of brain neurotrophic system signature proteins BDNF and CREB gene expression. Normalization of brain neurotrophic indicates a normal working neural cell neuronal cell health and functions. Beside a strengthen neurotrophic system can also support a more prominent recovery of cellular redox balance[ 72 ]. All these improvements stabilize cellular signaling matrixes, reduce apoptosis reactions and recover neuronal functions. From results seen above, the cholinergic and neurotransmitter system were also improved after melittin treatment. These are key targets of some well-known anti dementia drugs such as donepezil[ 76 , 77 ]. The muscarinic acetylcholine receptor M1 (mAchR1) is a subtype of M1-5[ 78 ]. M1 receptors are confined to cognitive-related brain regions, such as the hippocampus and cortex[ 79 ], they mediate the metabolic action of acetylcholine[ 80 ], and increase intracellular calcium concentrations to activate enzymes related to intracellular signaling systems[ 81 ]. The overall neuron’s health recovery by HO-1 enhancement also had positive effects on improving mice cholinergic system, as it had recovered the ATP level of mice brain, and therefore, improved inner-neuronal living and functions[82]. The revival cellular ATP represents that brain cells internal metabolisms functions were tilting back to normal. This cellular energy recovery significantly lags behind the cellular redox recovery in our experiment. Which reflects the truth that cellular ROS disrupts the function of mitochondria and disrupts ATP production as well as ignite apoptosis process, weaken all cellular survival attempt to retain stability [83,84]. The evidence adds strong ground to support the holistic value of the approach to upregulate cellular antioxidant mechanisms in curing neurodegenerative disorder. Additionally, melittin treatment decreased Bax and increased Bcl-2 levels, indicating a recovery of cell death mechanisms, which closely related to [85–87] performance. Bax promotes apoptosis by permeabilizing the mitochondrial membrane, while Bcl-2 inhibits this process. This recovery is crucial for maintaining neuronal integrity and function, highlighting melittin's neuroprotective effects. To delve deeper into the precise internal cellular signaling pathway responsible for this effect, we performed in vitro experiments using HT22 mouse hippocampal neurons. This experiment utilized a range of inhibitors to block potential pathways associated with Nrf2/HO-1 activation. These inhibitors help identify the drug's target because when the correct inhibitor is used, it shares the same target as the drug candidate, thus slowing down the pathway that the drug activates. Consequently, the drug becomes less effective, indicating that it was acting on the pathway, which was indicated by the respective inhibitor[ 29 , 59 ] The p38, ERK, JNK, and Akt pathways are intricately interconnected in various cellular defense mechanisms, encompassing processes such as inflammation, apoptosis, and cellular regeneration. Importantly, all these pathways can all upregulate the activity of the Nrf2/HO-1 system as stress-response reactions [29,87–90]. Interestingly, despite their roles, inhibitors of these four pathways fail to replicate the inhibition effect of the HO-1 synthesis inhibitor in effectively blocking melittin's cellular protection which really emphasize melittin direct influent on the Nrf2/HO-1 activation. Typically, Nrf2 is held hostage within the cytoplasm by the Keap1/Nrf2 complex. Melittin action, can disguise as a natural defense stimulus to distort this complex’s stability via physical attachments to the Keap1 molecule, which can liberate the intact Nrf2 from the complex and allow it to naturally move into the nucleus, where Nrf2 is the main promoter of important antioxidant gene expression such as HO-1[ 58 , 60 – 62 ]. The dry lab docking experiment revealed multiple interaction sites where melittin binds to Keap1 with a high affinity of -7.6 kcal/mol, as shown across the five analyzed docking patterns. These binding interactions likely disrupt the normal Keap1/Nrf2 interaction dynamics, thus releasing Nrf2. These docking simulations indicate a robust interaction profile, including a significant number of van der Waals forces and hydrogen bonds. These interactions are critical for the stability and specificity of melittin binding, which are essential factors in its ability to modulate the Keap1/Nrf2 complex effectively. The presence of unique interaction types such as pi-donor hydrogen bonds and pi-alkyl interactions in certain patterns further supports the hypothesis that melittin can induce conformational changes in Keap1, facilitating the release of Nrf2. Together with the results from the pulldown assay, these findings suggest that melittin's target is likely the direct interaction with Keap1, which promotes Nrf2 liberation and subsequently upregulates the cellular intraduct antioxidant system. Research has suggested that the disruption of the Keap1/Nrf2 interaction by small molecules can lead to enhanced expression of antioxidant response element (ARE)-driven genes like HO-1, which plays a pivotal role in cellular defense mechanisms against oxidative stress[ 60 ]. This potential makes melittin a promising candidate for therapeutic applications aimed at diseases characterized by oxidative stress and inflammation. The administration route for melittin commonly involves subcutaneous injection, a method that can lead to adverse effects if excessive. While melittin has shown promise in restoring cognitive function in neurodegenerative models, addressing its potential irritative properties and establishing an optimal human dosage are imperative[91]. Recent developments in disease research involving melittin have harnessed recombinant technology and computational bioinformatics to engineer specialized variants with modified amino acid sequences. These innovations have facilitated more effective augmentation and enhanced drug delivery, allowing for intravenous injection and targeted action on specific groups of malaria-infected cells[92]. Such advancements hold the potential to mitigate melittin's side effects and bolster its acceptance as a treatment option. 5. Conclusion In conclusion, our investigation demonstrated for the first time as we know that melittin directly interacts with and reactivates the compromised Nrf2/HO-1 pathway, effectively restoring cellular redox balance. This reactivation establishes a foundation for the natural recovery of various downstream processes, including inflammation, apoptosis, neurotrophic factor regulation, cholinergic function, and mitochondrial performance. These findings highlight melittin's potential as a holistic therapeutic agent for conditions marked by oxidative stress and inflammation, supporting the need for further clinical research to explore its therapeutic applications in neurodegenerative diseases. Abbreviations Nrf2: Nuclear factor erythroid 2–related factor 2; HO-1: Heme oxygenase-1; BV: Bee venom; I.P.: Intraperitoneally; S.C.: Subcutaneously; PBS: Phosphate-buffered saline; ROS: Reactive oxygen species; MDA: Malondialdehyde; LDH: Lactate dehydrogenase; DCX: Doublecortin; GSH: Glutathione; BDNF: Brain-derived neurotrophic factor; CREB: cAMP response element-binding protein; mAchR1: Muscarinic acetylcholine receptor; M1 iNOS: Inducible nitric oxide synthase; TNF-α: Tumor necrosis factor-alpha; IL-1β: Interleukin-1 beta; IL-6: Interleukin-6; Ach: Acetylcholine; ATP: Adenosine triphosphate; Bcl-2: B-cell lymphoma 2; PCR: Polymerase chain reaction; DMEM: Dulbecco's Modified Eagle Medium; FBS: Fetal bovine serum; HRP: Horseradish peroxidase; TMB: 3,3',5,5'-Tetramethylbenzidine; ELISA: Enzyme-linked immunosorbent assay; HT22: Mouse hippocampal cell line; SDS-PAGE: Sodium dodecyl sulfate–polyacrylamide gel electrophoresis; PVDF: Polyvinylidene fluoride; SPSS: Statistical Package for the Social Sciences; NRC: National Research Council; NRF: National Research Foundation; 3D: Three-dimensional; UHPLC: Ultra-high-performance liquid chromatography; MS/MS: Tandem mass spectrometry; TIC: Total ion chromatography; AchE: Acetylcholinesterase; DCF: Dichlorofluorescein; DNA: Deoxyribonucleic acid. Declarations Ethical Approval: This study was conducted in accordance with the Guide for Care and Use of Laboratory Animals of the National Research Council (NRC, 1996) and was approved by the Committee of Animal Care and Experiment of Dongshin University, Korea (DSU2021-01-07). Funding: This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT)—No. NRF-2021R1A2C20070411341282058250103 and NRF-2022R1I1A30682551241282058250102. Availability of data and materials: All data generated or analyzed during this study are included in this published article. Authors' contributions: YHJ, CDN, and HAH performed the experiment and wrote the manuscript. SJJ augmented the manuscript. GL, YJH , JCS, and JHK gave directional advice and managed the whole project. Consent for publication: The author gives our consent for the publication of identifiable details, which can include data and content to be published in the above Journal and Article. Informed Consent Statement: Not applicable Data Availability Statement: The data that support the findings of this study will be made available upon reasonable request. Competing of Interest: The authors declare no conflicts of interest that are directly relevant to the content of this manuscript. References Korean Neuropsychiatry (2018) National College of Korean Medicine Neuropsychiatry Textbook Compilation Committee. Third Edition. Seoul: Jipmoon Publishing Co Park DY, Kim H, Lee KJ (2019) Association between Thyroid-Related Hormones and Cognitive Function Patients with Alzheimer’s Disease and Mild Cognitive Impairment. Korean J Psychosom Med 27:60–68 Hwang BR, Kim H, Lee KJ (2012) Neuropsychiatric Symptoms in Patients with Mild Cognitive Impairment and Dementia of Alzheimer’s Type. Korean J Psychosom Med 20:105–111 Winston Wong (2020) Economic Burden of Alzheimer Disease and Managed Care Considerations Kim HJ, Baek SY, Sok DE, Lee KJ, Kim YJ, Kim MR (2020) Neuroprotective activity of polyphenol-rich ribes diacanthum pall against oxidative stress in glutamate-stimulated ht-22 cells and a scopolamine-induced amnesia animal model. Antioxidants 9:1–17 Cheignon C, Tomas M, Bonnefont-Rousselot D, Faller P, Hureau C, Collin F (2018) Oxidative stress and the amyloid beta peptide in Alzheimer’s disease. Redox Biol 14:450–464 Arslan J, Jamshed H, Qureshi H (2020) Early Detection and Prevention of Alzheimer’s Disease: Role of Oxidative Markers and Natural Antioxidants. Front Aging Neurosci. ;12 López N, Tormo C, de Blas I, Llinares I, Alom J (2013) Oxidative stress in Alzheimer’s disease and mild cognitive impairment with high sensitivity and specificity. J Alzheimer’s Disease 33:823–829 Cheng X, Ku C-H, Siow RCM (2013) Regulation of the Nrf2 antioxidant pathway by microRNAs: New players in micromanaging redox homeostasis. Free Radic Biol Med 64:4–11 Ishii T, Itoh K, Takahashi S, Sato H, Yanagawa T, Katoh Y et al (2000) Transcription Factor Nrf2 Coordinately Regulates a Group of Oxidative Stress-inducible Genes in Macrophages. J Biol Chem 275:16023–16029 Cho H-Y, Jedlicka AE, Reddy SPM, Kensler TW, Yamamoto M, Zhang L-Y et al (2002) Role of NRF2 in Protection Against Hyperoxic Lung Injury in Mice. Am J Respir Cell Mol Biol 26:175–182 Vargas MR, Johnson JA (2009) The Nrf2–ARE cytoprotective pathway in astrocytes. Expert Rev Mol Med 11:e17 Zhang DD (2006) Mechanistic Studies of the Nrf2-Keap1 Signaling Pathway. Drug Metab Rev 38:769–789 Tu W, Wang H, Li S, Liu Q, Sha H (2019) The anti-inflammatory and anti-oxidant mechanisms of the keap1/Nrf2/ARE signaling pathway in chronic diseases. Aging Dis 10:637–651 Jurcau A (2021) The role of natural antioxidants in the prevention of dementia—where do we stand and future perspectives. Nutrients 13:1–22 Solleiro-Villavicencio H, Rivas-Arancibia S (2018) Effect of chronic oxidative stress on neuroinflammatory response mediated by CD4 + T cells in neurodegenerative diseases. Front Cell Neurosci 12:1–13 Ramsey CP, Glass CA, Montgomery MB, Lindl KA, Ritson GP, Chia LA et al (2007) Expression of Nrf2 in Neurodegenerative Diseases. NIH Public Access 66:75–85 Osama A, Zhang J, Yao J, Xiaojun Yao JF (2020) Nrf2: a dark horse in Alzheimer’s disease treatment. Ageing Res Rev. ;64 Nakao A, Otterbein LE, Overhaus M, Sarady JK, Tsung A, Kimizuka K et al (2004) Biliverdin protects the functional integrity of a transplanted syngeneic small bowel. Gastroenterology 127:595–606 Li L, Grenard P, van Nhieu JT, Julien B, Mallat A, Habib A et al (2003) Heme oxygenase-1 is an antifibrogenic protein in human hepatic myofibroblasts. Gastroenterology 125:460–469 Wang T, Zhang J, Xiao A, Liu W, Shang Y, An J (2016) Melittin ameliorates CVB3-induced myocarditis via activation of the HDAC2-mediated GSK-3β/Nrf2/ARE signaling pathway. Biochem Biophys Res Commun 480:126–131 Kim JY, Leem J, Hong HL (2021) Melittin Ameliorates Endotoxin-Induced Acute Kidney Injury by Inhibiting Inflammation, Oxidative Stress, and Cell Death in Mice. Oxid Med Cell Longev. ;2021 Wang L, Yang NN, Shi GX, Wang LQ, Li QQ, Yang JW et al (2021) Acupuncture Attenuates Blood Pressure via Inducing the Expression of nNOS. Evidence-based Complementary and Alternative Medicine. ;2021 Nguyen T-T-L, Kim JW, Choi H-I, Maeng H-J, Koo T-S (2022) Development of an LC-MS/MS Method for ARV-110, a PROTAC Molecule, and Applications to Pharmacokinetic Studies. Molecules 27:1977 Hematyar M, Soleimani M, Es-haghi A, Rezaei Mokarram A (2018) Synergistic co-delivery of doxorubicin and melittin using functionalized magnetic nanoparticles for cancer treatment: loading and in vitro release study by LC–MS/MS. Artif Cells Nanomed Biotechnol 46:S1226–S1235 Huang S, Wang J, Guo Z, Wang Y, Liu C (2020) Quantitative measurement of melittin in Asian honeybee venom using a new method including UPLC-QqTOF-MS. Toxins (Basel). ;12 Zhang R, Yang D, Zhou C, Cheng K, Liu Z, Chen L et al (2012) β-Actin as a loading control for plasma-based Western blot analysis of major depressive disorder patients. Anal Biochem 427:116–120 Gilda JE, Gomes AV (2015) Western blotting using in-gel protein labeling as a normalization control: stain-free technology. Methods Mol Biol 1295:381–391 Jankowska U, Latosinska A, Skupien-Rabian B, Swiderska B, Dziedzicka-Wasylewska M, Kedracka-Krok S (2016) Optimized procedure of extraction, purification and proteomic analysis of nuclear proteins from mouse brain. J Neurosci Methods 261:1–9 Kim KW, Quang TH, Ko W, Kim DC, Yoon CS, Oh H et al (2018) Anti-neuroinflammatory effects of cudraflavanone a isolated from the chloroform fraction of Cudrania Tricuspidata root bark. Pharm Biol 56:192–200 Lewis KN, Wason E, Edrey YH, Kristan DM, Nevo E, Buffenstein R (2015) Regulation of Nrf2 signaling and longevity in naturally long-lived rodents. Proc Natl Acad Sci U S A 112:3722–3727 Park G, Moon BC, Oh DS, Kim YU, Park MK (2021) Enhanced Nrf2 up-regulation by extracellular basic pH in a human skin equivalent system. J Cell Mol Med 25:3646–3653 Zhao H, Wong RJ, Nguyen X, Kalish F, Mizobuchi M, Vreman HJ et al (2006) Expression and regulation of heme oxygenase isozymes in the developing mouse cortex. Pediatr Res 60:518–523 Tomás FJB, Turko P, Heilmann H, Trimbuch T, Yanagawa Y, Vida I et al (2020) BDNF expression in cortical GABAergic interneurons. Int J Mol Sci. ;21 Gobert AP, Verriere T, Asim M, Barry DP, Piazuelo MB, de Sablet T et al (2014) Heme Oxygenase-1 Dysregulates Macrophage Polarization and the Immune Response to Helicobacter pylori. J Immunol 193:3013–3022 Jamal F, Singh MK, Hansa J, Pushpanjali, Ahmad G, Dikhit MR et al (2020) Leishmania-Specific Promiscuous Membrane Protein Tubulin Folding Cofactor D Divulges Th1/Th2 Polarization in the Host via ERK-1/2 and p38 MAPK Signaling Cascade. Front Immunol. ;11 Kooreman NG, de Almeida PE, Stack JP, Nelakanti Rv, Diecke S, Shao NY et al (2017) Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics. Cell Rep 20:1978–1990 Bhasym A, Annarapu GK, Saha S, Shrimali N, Gupta S, Seth T et al (2019) Neutrophils develop rapid proinflammatory response after engulfing Hb-activated platelets under intravascular hemolysis. Clin Exp Immunol 197:131–140 Sweeney MD, Sagare AP, Zlokovic B (2018) v. Blood-brain barrier breakdown in Alzheimer disease and other neurodegenerative disorders. Nat Reviews Neurol 14:133–150 Zhang Z yong, Jiang M, Fang J, Yang M, feng, Zhang S, Yin Y, xin et al (2017) Enhanced Therapeutic Potential of Nano-Curcumin Against Subarachnoid Hemorrhage-Induced Blood–Brain Barrier Disruption Through Inhibition of Inflammatory Response and Oxidative Stress. Mol Neurobiol. ;54:1–14 Song K, Li Y, Zhang H, An N, Wei Y, Wang L et al (2020) Oxidative Stress-Mediated Blood-Brain Barrier (BBB) Disruption in Neurological Diseases. Oxidative Medicine and Cellular Longevity. ;2020 Kraeuter AK, Guest PC, Sarnyai Z (2019) The Y-Maze for Assessment of Spatial Working and Reference Memory in Mice. Methods in Molecular Biology. Humana Press Inc., pp 105–111 Nguyen CD, Lee G (2021) Neuroprotective activity of melittin—the main component of bee venom—Against oxidative stress induced by Aβ25–35 in in vitro and in vivo models. Antioxidants. ;10 Huang R, Wallqvist A, Thanki N, Covell DG (2005) Linking pathway gene expressions to the growth inhibition response from the National Cancer Institute’s anticancer screen and drug mechanism of action. Pharmacogenom J 5:381–399 de Nadal E, Ammerer G, Posas F (2011) Controlling gene expression in response to stress. Nat Rev Genet 12:833–845 Spriggs KA, Bushell M, Willis AE (2010) Translational Regulation of Gene Expression during Conditions of Cell Stress. Mol Cell 40:228–237 Barbosa C, Peixeiro I, Romão L (2013) Gene Expression Regulation by Upstream Open Reading Frames and Human Disease. PLoS Genet. ;9 Chung ES, Lee G, Lee C, Ye M, Chung H, Kim H et al (2015) Bee Venom Phospholipase A 2, a Novel Foxp3 + Regulatory T Cell Inducer, Protects Dopaminergic Neurons by Modulating Neuroinflammatory Responses in a Mouse Model of Parkinson’s Disease. J Immunol 195:4853–4860 Zhang X, Xue X, Xian L, Guo Z, Ito Y, Sun W (2016) Potential neuroprotection of protodioscin against cerebral ischemia-reperfusion injury in rats through intervening inflammation and apoptosis. Steroids 113:52–63 Diaz A, Limon D, Chávez R, Zenteno E, Guevara J (2012) Aβ25–35 injection into the temporal cortex induces chronic inflammation that contributes to neurodegeneration and spatial memory impairment in rats. J Alzheimer’s Disease 30:505–522 Im EJ, Kim SJ, Hong SB, Park JK, Rhee MH (2016) Anti-Inflammatory Activity of Bee Venom in BV2 Microglial Cells: Mediation of MyD88-Dependent NF-B Signaling Pathway. Evidence-based Complementary and Alternative Medicine. ;2016 Kwon HS, Koh SH (2020) Neuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes. Translational Neurodegeneration. ;9 Minogue AM, Barrett JP, Lynch MA (2012) LPS-induced release of IL-6 from glia modulates production of IL-1β in a JAK2-dependent manner Pozniak PD, White MK, Khalili K (2014) TNF-α/NF-κB signaling in the CNS: Possible connection to EPHB2. J Neuroimmune Pharmacol 9:133–141 Frankola KA, Greig NH, Luo W, Tweedie D Targeting TNF-alpha to elucidate and ameliorate neuroinflammation in neurodegenerative diseases Tu W, Wang H, Li S, Liu Q, Sha H (2019) The anti-inflammatory and anti-oxidant mechanisms of the keap1/Nrf2/ARE signaling pathway in chronic diseases. Aging Disease 10:637–651 Satoh T, McKercher SR, Lipton SA (2013) Nrf2/ARE-mediated antioxidant actions of pro-electrophilic drugs. Free Radic Biol Med 65:645–657 Duc Nguyen C, Yoo J, Kim M, Jang H, No KO, Hwang S et al (2022) Title: Bee venom activates the Nrf2/OH-1 and TrkB/CREB/BDNF pathways in neuronal cell responses against oxidative stress induced by Aβ 1–42 Hannan MA, Dash R, Sohag AAM, Haque MN, Moon IS (2020) Neuroprotection Against Oxidative Stress: Phytochemicals Targeting TrkB Signaling and the Nrf2-ARE Antioxidant System. Front Mol Neurosci. ;13 July Baek SY, Li FY, Kim DH, Kim SJ, Kim MR (2020) Enteromorpha prolifera Extract Improves Memory in Scopolamine-Treated Mice via Downregulating Amyloid-β Expression and Upregulating BDNF/TrkB Pathway. Antioxidants 9:620 von Bohlen O (2018) von Bohlen und Halbach V. BDNF effects on dendritic spine morphology and hippocampal function. Cell Tissue Res 373:729–741 Colucci-D’Amato L, Speranza L, Volpicelli F, Neurotrophic Factor BDNF (2020) Physiological Functions and Therapeutic Potential in Depression, Neurodegeneration and Brain Cancer. Int J Mol Sci 21:7777 Lu B, Nagappan G, Lu Y (2014) BDNF and Synaptic Plasticity, Cognitive Function, and Dysfunction. pp. 223–50 Wen AY, Sakamoto KM, Miller LS (2010) The Role of the Transcription Factor CREB in Immune Function. J Immunol 185:6413–6419 Saura CA, Valero J (2011) The role of CREB signaling in Alzheimer’s disease and other cognitive disorders. Rev Neurosci. ;22 Paramanik V, Thakur MK (2013) Role of CREB signaling in aging brain. Arch Ital Biol 151:33–42 Baek SY, Kim MR (2020) Neuroprotective effect of carotenoid-rich enteromorpha prolifera extract via TrkB/Akt pathway against oxidative stress in hippocampal neuronal cells. Mar Drugs. ;18 Yoo JM, Lee BD, Sok DE, Ma JY, Kim MR (2017) Neuroprotective action of N-acetyl serotonin in oxidative stress-induced apoptosis through the activation of both TrkB/CREB/BDNF pathway and Akt/Nrf2/Antioxidant enzyme in neuronal cells. Redox Biol 11:592–599 Cells N, Lee BD, Yoo J, Baek SY, Li FY, Sok D et al (2019) Antioxidant Enzyme Formation via TrkB / Akt Pathway Activation for Neuroprotection against Oxidative Stress-Induced Apoptosis in Hippocampal. Antioxidants. ;:1–14 Bartkowska K, Paquin A, Gauthier AS, Kaplan DR, Miller FD (2007) Trk signaling regulates neural precursor cell proliferation and differentiation during cortical development. Development 134:4369–4380 Francis PT (2005) The interplay of neurotransmitters in Alzheimer’s disease. CNS Spectr. ;10 11 SUPPL. 18:6–9 Birks JS, Harvey RJ (2018) Donepezil for dementia due to Alzheimer’s disease. Cochrane Database of Systematic Reviews. ;2018 Nobili F, Vitali P, Canfora M, Girtler N, de Leo C, Mariani G et al Effects of long-term Donepezil therapy on rCBF of Alzheimer’s patients Ishii, Masaru (2006) Kurachi Yoshihisa. Muscarinic acetylcholine receptors. Curr Pharm Des 12:3573–3581 Porter AC, Bymaster FP, DeLapp NW, Yamada M, Wess J, Hamilton SE et al (2002) M1 muscarinic receptor signaling in mouse hippocampus and cortex. Brain Res 944:82–89 Eglen RM (2006) Muscarinic receptor subtypes in neuronal and non-neuronal cholinergic function. Auton Autacoid Pharmacol 26:219–233 Park DJ (2000) The Role and the Regulation of phospholipase C. The Role and the Regulation of phospholipase C. 15:333–341 Lee JS, Kim HG, Lee HW, Han JM, Lee SK, Kim DW et al (2015) Hippocampal memory enhancing activity of pine needle extract against scopolamine-induced amnesia in a mouse model. Sci Rep. ;5 May Hu H, Zhang R, Zhang Y, Xia Z, Hu Y (2010) Role of CREB in the regulatory action of sarsasapogenin on muscarinic M1 receptor density during cell aging. FEBS Lett 584:1549–1552 Masasuke Yoshida EM, ATP TH, SYNTHASE — A, MARVELLOUSROTARY ENGINE OF THE CELL. MOLECULAR CELLBIOLOGY (2001). https://doi.org/10.1038/35089509 Szeto HH, Liu S, Soong Y, Wu D, Darrah SF, Cheng FY et al Mitochondria-targeted peptide accelerates ATP recovery and reduces ischemic kidney injury. Journal of the America Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4626190","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":323938107,"identity":"46aff62e-f0a7-4c30-b9a9-ceaec3707362","order_by":0,"name":"Jaehee Yoo","email":"","orcid":"","institution":"DongShin University","correspondingAuthor":false,"prefix":"","firstName":"Jaehee","middleName":"","lastName":"Yoo","suffix":""},{"id":323938108,"identity":"808c433f-7113-4797-bbdf-51b70596a210","order_by":1,"name":"Cong Duc Nguyen","email":"","orcid":"","institution":"DongShin University","correspondingAuthor":false,"prefix":"","firstName":"Cong","middleName":"Duc","lastName":"Nguyen","suffix":""},{"id":323938109,"identity":"a70f1752-3f6e-47dd-a956-1f2eef3227ac","order_by":2,"name":"Hai-Anh Ha","email":"","orcid":"","institution":"Duy Tan University","correspondingAuthor":false,"prefix":"","firstName":"Hai-Anh","middleName":"","lastName":"Ha","suffix":""},{"id":323938110,"identity":"f75ad10b-2da4-497f-9c87-9cbdb417af40","order_by":3,"name":"Sang Jun Jeong","email":"","orcid":"","institution":"DongShin University","correspondingAuthor":false,"prefix":"","firstName":"Sang","middleName":"Jun","lastName":"Jeong","suffix":""},{"id":323938111,"identity":"cfcd8cde-7587-4577-a830-1516ce530dfb","order_by":4,"name":"Ji Hye Yang","email":"","orcid":"","institution":"DongShin University","correspondingAuthor":false,"prefix":"","firstName":"Ji","middleName":"Hye","lastName":"Yang","suffix":""},{"id":323938112,"identity":"e2acc5cb-177b-41d3-b10c-40a8592a23b7","order_by":5,"name":"Gihyun Lee","email":"","orcid":"","institution":"DongShin University","correspondingAuthor":false,"prefix":"","firstName":"Gihyun","middleName":"","lastName":"Lee","suffix":""},{"id":323938113,"identity":"82e47ffd-7846-4941-b366-1060cbd03ec9","order_by":6,"name":"Jeong Cheol Shin","email":"","orcid":"","institution":"DongShin University","correspondingAuthor":false,"prefix":"","firstName":"Jeong","middleName":"Cheol","lastName":"Shin","suffix":""},{"id":323938114,"identity":"3cdebf37-cab1-42ff-9223-aa9d60cdd3d6","order_by":7,"name":"Jae-Hong Kim","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIiWNgGAWjYBACezhL/vEBCQiLDb8WwwY4My2BOC0GB+DMHAMitdxIfvbwS41NnrzDmY83f7YxyPM3sKV9wK8lzdxY5lhaseHB3s3WvG0MhjMOsB2egV9LDpu0ZMPhxI3NvNukGdsYGDcwsDcTcBhMSxvPM0mgw+yJ0iL5EahlPg8PmwTQYYkbGNgO49Vi2PPMTJrhWFriBgk2Y2uecxLJMw6zJePVYs+e/EzyR41N4vwZzA9v/iizse1vbzPGqwUEmHkY4BEEjBpmghoYGBh/AAn5BiJUjoJRMApGwcgEAK+ARq1QIaQUAAAAAElFTkSuQmCC","orcid":"","institution":"DongShin University","correspondingAuthor":true,"prefix":"","firstName":"Jae-Hong","middleName":"","lastName":"Kim","suffix":""}],"badges":[],"createdAt":"2024-06-23 17:47:39","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4626190/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4626190/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60323773,"identity":"f9203355-d452-4926-96f9-800a6405902d","added_by":"auto","created_at":"2024-07-15 14:43:05","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":338509,"visible":true,"origin":"","legend":"\u003cp\u003eThe proposed action of melittin in combating neurodegeneration involves its interaction with the Keap1/Nrf2/HO-1 pathway. Specifically, melittin may interact directly with the Keap1 molecule, which is a crucial step in this process. This interaction leads to the activation of the cellular antioxidant system. Once activated, this system effectively neutralizes harmful reactive oxygen species (ROS), which are known to contribute to neurodegenerative conditions. This holistic mechanism positions melittin as a potential therapeutic agent for neurodegenerative diseases by bolstering the body's natural defense against oxidative.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/82643fa588f8f1051317d6e7.png"},{"id":60324500,"identity":"d2fbbc47-2b17-487d-8105-ee7bf6434d8a","added_by":"auto","created_at":"2024-07-15 14:51:05","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":243377,"visible":true,"origin":"","legend":"\u003cp\u003eIn vivo experiment 1 (results shown in \u003cstrong\u003eFig 3-5\u003c/strong\u003e): The experimental scheme for melittin effects on behavior amnesia induced by scopolamine. After sacrifice, analysis was carried out for parameters: neurogenesis level, , Nrf2 DNA binding activity and HO-1 expression, ROS and GSH index; BDNF, p-CREB, Bcl-2, Bax, iNOS, and mAchR 1 protein expressions; AchE and Ach levels.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/180ca1ce4bc6f3fd152a221e.png"},{"id":60323771,"identity":"d65de513-9db6-457a-afaa-5859f52b3344","added_by":"auto","created_at":"2024-07-15 14:43:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":272708,"visible":true,"origin":"","legend":"\u003cp\u003eMass spectrometry analysis provided evidence of melittin passing through disrupted blood brain barrier and accumulated in hippocampus tissue. \u003cstrong\u003e(A) \u003c/strong\u003eTotal ion chromatography and full mass scan of the commercial standard melittin peak. \u003cstrong\u003e(B) \u003c/strong\u003eThe value m/z=712.44 was used to scan across samples to identify and quantify the melittin signal. These discover melittin peaks was check again via there full mass scan to fit with the presented full mass characteristic. # p\u0026lt;0.01 compared with the melittin only treated group.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/2d2ce590eb410455e17fbc16.png"},{"id":60324525,"identity":"755db23c-3fb6-4894-8d45-843078d3aa2a","added_by":"auto","created_at":"2024-07-15 14:51:05","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":766326,"visible":true,"origin":"","legend":"\u003cp\u003eMelittin reverses cognitive impairment in scopolamine-treated mice. \u003cstrong\u003e(A) \u003c/strong\u003eDays 3-5, mice were allowed to swim freely for 100 s to find the platform. The escape latency time to target escape was recorded days 7 to 9. \u003cstrong\u003e(B) \u003c/strong\u003eThe platform was removed, and mice were allowed to swim freely for 120 s. Platform crossing times in the probe test were recorded, the coverage position of where animals swam in each group was used to generate average heatmap of each group. \u003cstrong\u003e(C) \u003c/strong\u003eOn day 6, Y-maze track of one representative animal from each group and spontaneous alternation percentage result. Behavioral score of mice were sharply enhanced by melittin treatment (\u003cstrong\u003eD\u003c/strong\u003e) Histochemistry analysis indicated that scopolamine suppression on neurogenesis was significantly reversed by melittin. Images showed the hippocampal dentate gyrus region, stained by DCX anti body. # p\u0026lt;0.01 compared with the naive group. * p\u0026lt;0.05 compared with scopolamine group; ** p\u0026lt;0.01 compared with scopolamine group. Measurements were carried out triplicated, total animal tested n=5/group.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/5985f88a95f7a4791f9dc515.jpeg"},{"id":60323772,"identity":"bb6ab373-8793-42fc-aab2-30b7a0e608d3","added_by":"auto","created_at":"2024-07-15 14:43:05","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":456824,"visible":true,"origin":"","legend":"\u003cp\u003eMelittin effects in hippocampus tissue signaling regulations, including reactivation of intrinsic antioxidant barrier, suppress oxidative stress, inflammation, stimulate neurotrophic and cholinergic systems. \u003cstrong\u003e(A) \u003c/strong\u003eWesten blot experiment of whole cell, cytoplasm, and nucleus extracts from hippocampus tissue showed melittin enhanced the migration of Nrf2 into the nucleus, which is weaken with scopolamine treatment. Thus, the increased presence of Nrf2 in the nucleus upregulated the important HO-1 antioxidant enzyme to neutralize cellular oxidative stress. Lamin-B was used as the housekeeping marker for nuclear proteins, while β-Actin served as the housekeeping protein for cytoplasmic proteins. No detectable lamin-B was found in the cytoplasm, and no detectable β-Actin was found in the nucleus. This indicates that the extraction process was successful, resulting in a clear separation of nuclear and cytoplasmic proteins. (\u003cstrong\u003eB) \u003c/strong\u003eOxidative stress key makers ROS and GSH levels were all enhanced after melittin treatment. \u003cstrong\u003e(C) \u003c/strong\u003eThe figure shows Western blot results and quantification of markers for multiple regulation system: neurotrophic BDNF and p-CREB, apoptosis Bcl-2 and Bax, inflammation iNOS, and cholinergic mAChR1 proteins expressions under different treatments. Scopolamine significantly altered the expression of these proteins, while co-treatment with Melittin (0.1 mg/kg) restored their levels towards normal. This indicates Melittin's potential neuroprotective effect in a scopolamine-induced model. \u003cstrong\u003e(D) \u003c/strong\u003eMelittin enhanced cholinergic system AchE activity (fold) and Ach concentration (nmol/mg protein). # p\u0026lt;0.001 compared with the non-treatment group; * p\u0026lt;0.05 compared with Scopolamine group; ** p\u0026lt;0.01 compared with Scopolamine group. Measurements were carried out triplicated, total animal tested n=5/group.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/db1e32de5ca3bdd2dbc02496.png"},{"id":60323776,"identity":"f56f0941-705f-4649-9c80-cc219eeb55a3","added_by":"auto","created_at":"2024-07-15 14:43:05","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":190072,"visible":true,"origin":"","legend":"\u003cp\u003eIn vivo\u003cstrong\u003e \u003c/strong\u003eexperiment 2 (results shown in figure 7): The experimental for the effect of melittin in a time dependent manner on Nrf2 DNA binding activity; HO-1 gene expression, ROS and GSH levels; iNOS, TNF-α, IL-1β, and IL-6 gene expression; Brain Ach and ATP levels, BDNF and Bcl-2 gene expression. S.C., subcutaneous injection; I.P., Intraperitoneal injection; Scopolamine I.P.: 1mg/kg; Melittin S.C.: 0.1mg/kg.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/635cd320f91dee13215538e7.png"},{"id":60323777,"identity":"6b7ba456-cf11-4f8f-a159-7a9a1f5fe733","added_by":"auto","created_at":"2024-07-15 14:43:05","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":466064,"visible":true,"origin":"","legend":"\u003cp\u003eThe findings suggest that the foremost notable impacts, happened in the earlier stage (0 to 5 hours) after melittin administration were the restoration of Nrf2 DNA binding activity, leading to an increase in HO-1 gene expression to maintain cellular redox equilibrium; This first event was then subsequently followed by the rebalancing of inflammatory, apoptotic, cholinergic, and neurotrophic systems all happened in the later state (7.5 to 12.5 hours). \u003cstrong\u003e(A)\u003c/strong\u003e Early activation and fortification of antioxidant mechanisms by Melittin: Within just 5 hours of administration, a substantial elevation in Nrf2 DNA binding activity was observed. This subsequently triggered a pronounced rise in HO-1 gene expression, resulting in decreased levels of brain tissue ROS and enhanced GSH levels. (\u003cstrong\u003eB\u003c/strong\u003e) The expression of key inflammation regulators, including iNOS, TNF-α, IL-6, and IL-1β, was assessed. The results indicate that the stabilization of the inflammatory state did not become significant until the 10th hour. (\u003cstrong\u003eC\u003c/strong\u003e) Enhancement of acetylcholine neurotransmitters, brain ATP content, as well as Brain-derived neurotrophic factors BDNF and Bcl-2 anti-apoptosis gene expression, all exhibited no significant changes until the 10th hour (to the right of the blue dotted line); * p\u0026lt;0.01 compared with scopolamine only treated group; ** p\u0026lt;0.001 compared with scopolamine only treated group; Five animals from each group were sacrificed at each time point for the analysis. Measurements were carried out triplicated, total animal tested n=5/group.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/fe1142b0c3d8b4da07edfe79.png"},{"id":60324526,"identity":"2e7f281a-c8c7-4665-858c-70ee58aceb17","added_by":"auto","created_at":"2024-07-15 14:51:05","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":588064,"visible":true,"origin":"","legend":"\u003cp\u003eIn vitro experiment with mouse hippocampal HT22 proposes that melittin directly engages with the Nrf2/HO-1 pathway to elicit a neuroprotective effect. \u003cstrong\u003e(A)\u003c/strong\u003e Screening for the optimal concentration of bee venom revealed that 3 μM melittin was the highest concentration that did not compromise HT22 cell viability 12 hours after treatment. \u003cstrong\u003e(B)\u003c/strong\u003e Melittin exhibited a dose-dependent neuroprotective effect in the range of 0.3-3 μM against glutamate-induced stress, results measured 12 hours after treatment. \u003cstrong\u003e(C)\u003c/strong\u003e Fluorescent staining revealed Nrf2 translocation into the nucleus following melittin treatment, with a significant nuclear Nrf2 signal at 1 and 3 μM concentrations. In the red-dotted squares, green, fluorescent Nrf2 signals overlap with the blue neuron nucleus. Higher melittin concentrations increase Nrf2 accumulation in the nucleus, indicating melittin promotes Nrf2 nuclear translocation in a concentration-dependent manner.4 \u003cstrong\u003e(D\u0026amp;E)\u003c/strong\u003e To elucidate the pathway most closely associated with melittin activity, various inhibitors targeting ERK, JNK, p38, Akt, and HO-1 synthesis were employed. \u003cstrong\u003e(D)\u003c/strong\u003e Inhibitor concentrations that inhibited approximately 80% of HT22 cell viability were identified. \u003cstrong\u003e(E) \u003c/strong\u003eCo-treatment of these concentrations with melittin and glutamate revealed that the HO-1 synthesis inhibitor exhibited the most pronounced reversal of melittin's positive effects. Data are presented as mean ± standard deviation values of triple determinations. # \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 vs. control; * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 and ** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs. glutamate only treatment group; Ჶ p\u0026gt;0.05 Statistical equivalence. Measurements were carried out triplicated.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/5dfd49389b5785ac661b9044.png"},{"id":60323775,"identity":"a21952f7-dd72-4e54-836b-7d29168eee86","added_by":"auto","created_at":"2024-07-15 14:43:05","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1395149,"visible":true,"origin":"","legend":"\u003cp\u003eThe docking models of melittin onto Keap1, depicting the interaction patterns observed across multiple docking simulations. \u003cstrong\u003e(A, B, C, D, and E)\u003c/strong\u003eThese figures represent distinct docking patterns, highlighting the diverse binding orientations and interactions between melittin and Keap1. The figure provides insight into the robust interaction profile of melittin with Keap1, showcasing key features such as van der Waals forces, hydrogen bonds, and unique interaction types like pi-donor hydrogen bonds and pi-alkyl interactions. These interactions contribute to the stability and specificity of melittin binding, crucial for its modulatory effects on the Keap1/Nrf2 complex and subsequent release of Nrf2.\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/1dc1e17873be4676f117890f.png"},{"id":60323779,"identity":"9228f451-445f-4cc5-8ae0-16c4e69f9aa7","added_by":"auto","created_at":"2024-07-15 14:43:05","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":830654,"visible":true,"origin":"","legend":"\u003cp\u003eThe pull-down assay conducted on HT22 cell lysate to validate the physical interaction between melittin and Keap1. This assay confirms the binding of melittin to Keap1 by capturing Keap1 protein complexes using melittin as bait. The presence of Keap1 in the pulled-down samples, extracted from melittin conjugated beads indicates a direct physical association between Keap1 and melittin. This experimental validation corroborates the docking simulations and biochemical findings, providing robust evidence for the interaction between melittin and Keap1 at the protein level.\u003c/p\u003e","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/0fbd789a5200c9e245392b8c.png"},{"id":68062226,"identity":"bd5f01d5-9603-4279-822f-f083328ea80b","added_by":"auto","created_at":"2024-11-02 05:31:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6654427,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4626190/v1/4df2b6bb-cd3c-47be-a474-e0aa30dba0a9.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Melittin - A Main Component of Bee Venom: A Promising Therapeutic Agent for Neuroprotection through Nrf2/HO-1 Pathway Activation","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe brain especially is more vulnerable than other organs to oxidative stress. During the aging process, redox unbalances resulting from metabolism plays a detrimental role in cellular regulation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Lipid peroxidation, induced by excessive oxidative, yields unstable byproducts such as lipid hydroperoxides, which undergo non-enzymatic decomposition to produce aldehydes like malondialdehyde. These harmful compounds ultimately form covalent adducts that modify critical proteins, ultimately impairing neuron function, trigger inflammation, apoptosis, leading to neuronal cell loss[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCombating neuro aging has always been a top-notch debate. Recent studies suggested that neutralizing oxidative stress and restoring cellular redox balance can offer a greater holistic recovery approach than implementing anti inflammation strategies. Genes related to antioxidants and detoxification help maintain cellular balance, preventing inflammation triggers[\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Contemporary research strongly emphasizes the role of imbalanced reactive oxygen species (ROS) and excessive electrophiles as primary instigators of neural dysfunction. Nrf2, a transcription factor that governs antioxidant gene expression, plays a pivotal role in this context [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Nrf2 binds to the antioxidant response element (ARE) to initiate the transcription of key antioxidants and phase two detoxifying enzymes [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Nrf2 activity is anticipated to serve as a defense against various diseases, including cancer, neurodegenerative disorders, cardiovascular diseases, acute lung injury, and autoimmune conditions [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The HO-1 antioxidant enzyme, a primary product of Nrf2-ARE activation, represents a major intrinsic cellular defense against oxidative stress and toxins, helping to maintain cellular homeostasis and prevent damage-induced inflammatory responses [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Decreased Nrf2/HO-1 activation has been observed in neurodegenerative disorders [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], and reactivation of this pathway is a comprehensive anti-neurodegenerative strategy [\u003cspan additionalcitationids=\"CR13 CR14 CR15 CR16 CR17\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e Bee venom, particularly its main component melittin, is gaining increasing attention for its neuroprotective effects [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Although previous renal studies have shown that melittin can restore cellular redox balance via the Nrf2/HO-1 pathway [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], the precise mechanisms and the sequence of interactions leading to its final therapeutic effects remain unclear. Additionally, to our knowledge, no research has yet investigated whether melittin can cross the blood-brain barrier and upregulate the Nrf2/HO-1 system in an in vivo neurodegenerative context.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eFigure 1\u003c/strong\u003e \u003cp\u003eThe proposed action of melittin in combating neurodegeneration involves its interaction with the Keap1/Nrf2/HO-1 pathway. Specifically, melittin may interact directly with the Keap1 molecule, which is a crucial step in this process. This interaction leads to the activation of the cellular antioxidant system. Once activated, this system effectively neutralizes harmful reactive oxygen species (ROS), which are known to contribute to neurodegenerative conditions. This holistic mechanism positions melittin as a potential therapeutic agent for neurodegenerative diseases by bolstering the body's natural defense against oxidative.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe scopolamine model used in this study, widely used to induce memory deficits and cognitive impairment in mice, is essential for Alzheimer's research and treatment exploration. By blocking muscarinic receptors and generating oxidative stress, scopolamine mimics Alzheimer's cognitive deficits, enabling assessment of various therapeutic compounds and extracts[\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Unlike other intracerebroventricular models, this study uses subcutaneous scopolamine injection in the mouse abdomen. This method preserves the brain's physical integrity, allowing for the examination of melittin's ability to cross the blood-brain barrier. As in vivo study focuses on the hippocampus due to its crucial role in learning and memory, for more in-depth in vitro experiments, we used glutamate-induced stress on mouse hippocampal HT22 cells. This is a widely employed in vitro model, that mimics brain stress, causing programmed cell death, mitochondrial dysfunction, and ROS generation. These effects mirror mechanisms seen in psychiatric and neurodegenerative diseases, making it a valuable model for studying stress-induced neuronal damage. [\u003cspan additionalcitationids=\"CR26 CR27 CR28\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePrevious works using a range of melittin has discovered its\u0026rsquo; dosage dependent neuroprotective effect, but these research were clearly not intensive enough to prove what is the targeted mechanisms [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In this research, we pick one dosage from that range and study more intensively how melittin impacts on mice brain, particularly focusing on the hippocampus and its regulatory mechanisms. This in vivo research gave good evidence to melittin's ability to penetrate the disrupted blood-brain barrier in neurodegenerative mice. Our investigation demonstrated for the first time that melittin directly interacts with and reactivates the compromised Nrf2/HO-1 pathway, effectively restoring cellular redox balance. This reactivation establishes a foundation for the natural recovery of various downstream processes, including inflammation, apoptosis, neurotrophic factor regulation, cholinergic function, and mitochondrial performance. This finding was further substantiated by \u003cem\u003ein vitro\u003c/em\u003e experiments conducted on mouse HT22 hippocampus cells.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"2. Material and Method","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. \u003cem\u003eAnimal and Group Segregation\u003c/em\u003e\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eOne hundred and twenty-two 6-week-old male BALB/c mice were obtained from Samtaco (Gyeonggi-do, Republic of Korea). The mice were housed under controlled conditions, including a 12-hour light-dark cycle at a temperature of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;3\u0026deg;C and constant humidity. Food and water were provided ad libitum. After a 6-day acclimatization period, the mice were randomly divided into groups for two in vivo experiments.\u003c/p\u003e \u003cp\u003eFirst In Vivo Experiment (\u003cb\u003eFig.\u0026nbsp;2\u003c/b\u003e):\u003c/p\u003e \u003cp\u003eThe mice were divided into four groups with eight mice each:\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e1. Control group: PBS intraperitoneally (I.P.) and subcutaneously (S.C.)\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cp\u003e2. Melittin-only group: PBS I.P. and Melittin 0.1 mg/kg S.C.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cp\u003e3. Scopolamine-only group: Scopolamine 1 mg/kg I.P. and PBS S.C.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003cspan\u003e \u003cp\u003e4. Scopolamine and Melittin group: Scopolamine 1 mg/kg I.P. and Melittin 0.1 mg/kg S.C.\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThese groups underwent treatments, behavioral tests, and were then sacrificed for biochemical analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSecond In Vivo Experiment (\u003cb\u003eFig.\u0026nbsp;6\u003c/b\u003e):\u003c/p\u003e \u003cp\u003eThe mice were divided into three groups with thirty mice each:\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e1. Group 1: Received scopolamine 1 mg/kg I.P. from days 1 to 4.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cp\u003e2. Group 2: Received scopolamine 1 mg/kg I.P. from days 1 to 4 and additional melittin treatment (0.1 mg/kg S.C.) on the final day.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cp\u003e3. Group 3: Received 0.1 ml PBS I.P. from day 1, serving as a reference normal group.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003c/ol\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThis experiment aimed to evaluate the time-dependent effects of melittin on multiple signaling pathways, including Nrf2 activity, HO-1 gene expression, ROS and GSH levels, iNOS, TNF-α, IL-1β, and IL-6 gene expression, as well as hippocampal Ach and ATP levels, BDNF, and Bcl-2 gene expression. At each time point, five mice from each group were sacrificed, and hippocampal samples were analyzed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e This study was conducted in accordance with the Guide for the Care and Use of Laboratory Animals of the National Research Council (NRC, 1996) and was approved by the Committee of Animal Care and Experimentation of Dongshin University, Korea (DSU2021-01-07). Mice were randomly selected for sacrifice and group assignments using a random number generator (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.calculator.net\" target=\"_blank\"\u003ewww.calculator.net\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.calculator.net\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The scopolamine was administered I.P. at 4:00 am. Melittin was administered S.C. at 9:00 am at a non-acupoint (Hypochondrium 10 mm above the iliac crest) to avoid interference from acupuncture effects. PBS injection served as the placebo. Behavioural experiments for the assigned group were conducted at 7:00 PM.\u003c/p\u003e\u003cp\u003eMelittin with 97% purity was used (M4171, Sigma-Aldrich, MO, USA). The chosen dosage of 0.1 mg/kg was based on previous studies demonstrating its efficacy in suppressing neurodegenerative symptoms in mice.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Morris Water Maze Test\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTen hours after the scopolamine injection \u0026minus;\u0026thinsp;5 hours after melittin injection, the behavior experiment commenced. The Morris water maze was assembled by filling a black circular tank with water (diameter: 120 cm \u0026amp; height: 50 cm) decorated by various graphical indicators on a pole in a fixed position during the whole experiment. Water temperature was maintained at 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2℃. The tank area was virtually split into four quadrants: southeast, northeast, southwest, and northwest. A white platform with 10 cm diameter and 25 cm height \u0026ndash; was placed in the middle of the northwest quadrant. The swimming movement of the mice was evaluated using the Any-Maze software (Stoelting Co., Wood Dale, U.S.A.).\u003c/p\u003e \u003cp\u003eOn day 1, an adaptation exercise was accomplished. The animals were permitted to swim freely for 100 s in the tank with the observable platform 1 cm above the water. This was performed three times a day for every mouse; if a mouse was incapable of finding the platform, it was manually led to the position.\u003c/p\u003e \u003cp\u003eFrom day 2 to day 5. The platform was submerged 1 cm below its surface. The mouse was laid at the center of the northeast quadrant in the first experiment and at the center of the southwest quadrant in the second experiment. The mouse was then allowed to find the platform within 100 s, and if the platform could not be found within 100 s, the mouse was moved to the platform and kept for 10 s. The mouse was then gently placed in a warm water bag and moved back to the cage.\u003c/p\u003e \u003cp\u003eAfter the above experiment, each mouse was allowed to swing freely for 120s in the tank, however the platform was removed. The swimming patterns were collected to create heatmaps to evaluate each group memory of the platform position.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Y-Maze Test\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eOn day 6, 10 hours after the scopolamine injection \u0026minus;\u0026thinsp;5 hours after melittin injection, Y-maze task was executed. The Y-maze is a three-arm maze (40 cm in length, 3 cm in width, and 12 cm high) in which the three arms, made of black polyvinyl plastic, are symmetrically separated at 120\u0026deg;. Mice were initially placed within the same arm, and the arm entry order was recorded over a 5 min period. In this experiment, a spontaneous alternation was defined as entries into all three arms consecutively: ABC, CAB, or BCA, but not BAB, ABA, or CAC. The ANY-maze animal behavior monitoring software (Stoelting Co., Wood Dale, IL, USA) was used to record and determine the results.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Collection Of Brain Hippocampal Tissue\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe hippocampus was specifically chosen for its importance in the formation and recalling of memory, this organ is also the focus of Alzheimer's studies [\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. For \u003cem\u003ein vivo\u003c/em\u003e experiment 1 (sections \u003cspan refid=\"Sec19\" class=\"InternalRef\"\u003e3.1\u003c/span\u003e\u0026ndash;3.3) mice were sacrificed on the 6th day after the Y maze test. For \u003cem\u003ein vivo\u003c/em\u003e experiment 2 (sections 3.4) 5 mice from each group were analyzed at each time point. All mice were anesthetized with isoflurane 3.5% induction for 3 minutes and 1.5\u0026ndash;2.0% maintenance, blood was collected from left ventricles, each mouse was carefully perfused with 7 ml of ice-cold saline and 5 ml ice cold 5% paraformaldehyde, subsequently, their brains were collected. The brains were immediately rinsed with physio- logical saline, and the hippocampus were collected. Subsequently, these samples were subjected to further biochemical analysis on the same day, where 5 right hemispheres from 5 different animals of each group were further fixed in ice cold 5% paraformaldehyde again for immuno-histochemistry analysis.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Extraction For Melittin from Hippocampal Tissue\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eHippocampal tissue was homogenized with \u0026minus;\u0026thinsp;20\u003csup\u003eo\u003c/sup\u003eC cold methanol (0.25 mL per 50 mg tissue), then \u0026minus;\u0026thinsp;20\u003csup\u003eo\u003c/sup\u003eC cold chloroform (0.25 mL per 50 mg tissue) were added, mixed, and incubated at 2\u003csup\u003eo\u003c/sup\u003eC for 15 min. Subsequently ice-cold water (0.25 mL per 50 mg tissue) was added, then the sample was mixed and incubated once more. Phase separation was made by centrifuging the mixture at 13,000 rpm for 5 min at 4℃, the upper aqueous phase containing melittin was collected, these were then freeze dried and then solute in 25\u0026micro;L distilled water for Mass spectrometer analysis.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Mass Spectrometry Analysis for melittin quantification and Keap1 qualification\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eFor melittin quantification: The melittin after being extracted from the brain\u0026rsquo;s hippocampus was then went through LC\u0026thinsp;\u0026minus;\u0026thinsp;MS/MS for analysis. Establishment of baseline as well as peak spiking and quantitative calculations was closely followed a former publish research. The system comprised of an Ultimate 3000 UHPLC, and mass detection was accomplished using an LTQ-Orbitrap Velos (Thermo Fisher Scientific, San Jose, CA). The analytical was column Accucore\u0026trade; C18\u0026thinsp;+\u0026thinsp;UHPLC of 1.5 \u0026micro;m particle size, diameter of 2.1 x 100 mm. The flow rate was set at 0.3 mL/min. Sample injection volume was set at 2.0 \u0026micro;L. Two eluent solvents: water (A) and acetonitrile (B) were used with following gradient: 0\u0026ndash;3 min: B at 5%; 3\u0026ndash;9 min: B to 100%, 9-9.5 min: hold B at 100. The interface was at the voltage of 4.6 kV and the temperature of 270\u0026deg;C, the detection voltage was at 1.97 kV. In the positive ionization mode, mass survey scans were performed in the FT cell with the span of 100 to 1,400 m/z. The automatic gain control was 1 x 10\u003csup\u003e6\u003c/sup\u003e ions. Commercial standard melittin (M4171, Sigma-Aldrich, MO, U.S.A.) was utilized to define analysis condition and melittin peak retention time. The main peak in TIC was evaluated by typical un-fragmented mass spectrometry profile of melittin. This value was then confirmed with result of other studies [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]; subsequently, this specific mass data is the indicator to detect melittin the analyzed samples.\u003c/p\u003e \u003cp\u003eFor Keap1 qualification: Following the visualization of suspected Keap1 band at around 60 kDa position, which will be explained later. To avoid noise in mass analysis caused by Coomassie staining, another identical membrane to the one exhibited in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e10\u003c/span\u003e was used, but it was stained only with Keap1 primary and secondary antibodies. Then, the similar suspected Keap1 band around 60 kDa was marked and excised carefully so it only contains the suspected band, thus increased purity after extraction. The membrane section was incubated in stripping buffer to remove antibodies and staining reagents. Proteins that attached on this small piece of membrane were removed by using eluting solution 50% acetonitrile (ACN) and 0.1% trifluoroacetic acid (TFA), then evaporated to collect only protein in a test tube before trypsin digestion and MALDI analysis. The resulting peptides were purified using Zip-tip C18, then mixed with an α-cyano-4-hydroxycinnamic acid matrix (2.5 mg/ml) containing 50% ACN and 0.1% TFA, and dried on stainless steel targets. MALDI-TOF MS analysis was performed using an AXIMA-TOF2 mass spectrometer in positive ion mode, settings including a 19 kV source voltage, 5 kHz laser frequency, and 15 \u0026micro;J laser energy. We confirmed the presence of Keap1 by matching significant peaks at m/z 1803.95, 2066.79, and 2135.1 of the commercial standard mouse Keap1 (OPCA03207, Aviva Systems Biology Corporation 6370, San Diego, CA USA).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Doublecortin (DCX) immuno-histochemistry staining\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003ePost-fixed brain hemispheres were incubated in 27% sucrose for another 24 h at 4\u0026deg;C. After being frozen, brain hemispheres were sliced into 30 \u0026micro;m sagittal sections. At room temperature, sections were blocked in with 6% bovine calf serum for blocking, and then in doublecortin primary antibody (1:400, 2 h), rinsed and then incubated with Alexa Fluor 488 secondary antibody (Ex/Em\u0026thinsp;=\u0026thinsp;490/525 nm, 1:400, 2 h). After two additional rinses slides were covered in Fluoromount\u0026trade; Aqueous Mounting Medium then topped with glass coverslips and were sent for microscopic imaging. The images of hippocampal dentate gyrus area were photographed using the Invitrogen EVOS FL Auto Imaging System (Thermo Fisher Scientific, Waltham, MA, USA) with a 20\u0026times; objective, DCX positive cell were counted in a same area and compared between each group.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Extraction of nuclear and cytosolic proteins for Nrf2 determination\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTo extract both nuclear and cytosolic NRF2, we started by homogenizing hippocampus samples using a hypotonic buffer consisting of 10 mM Tris-HCl (pH 7.5), 10 mM NaCl, and 3 mM MgCl2, which allows cellular swelling while maintaining nuclear integrity, and perform this in cold conditions to prevent protein degradation. Then we centrifuged the homogenate at 1,000 x g for 10 minutes at 4\u0026deg;C to pellet the nuclei; retain the supernatant as it contains the cytosolic proteins was stored for western blot analysis. Resuspend the nuclear pellet in a high-salt nuclear extraction buffer containing detergents and protease/phosphatase inhibitors. After a further high-speed centrifugation at 15,000 x g for 30 minutes at 4\u0026deg;C, the supernatant containing nuclear proteins was collected.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Western blot analysis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eHippocampus samples were homogenized in a 50 mM tris aminomethane hydrochloric acid (Tris-HCl, pH 7.4), solution with phosphate inhibitor and protease inhibitor, at approximately 2\u0026deg;C. First, samples were centrifuged at 12,000 rpm, at temperature 4\u0026deg;C for 10 min, a BCA protein analysis kit (ab102536, Abcam, Cambridge, UK) was used to measure total protein content to normalize this parameter among samples. The protein content was mixed with a 25% volume loading buffer and heated at 95\u0026deg;C for 5 min. Then, an amount of 20 \u0026micro;g protein was loaded into wells and electrophoresed via 8% SDS-PAGE gel. Subsequently, separated proteins were transferred onto a polyvinylidene fluoride membrane (PVDF) membrane. Thereafter, 5% non-fat milk was used to block this membrane at room temperature for 1 h and incubated with anti-Lamin B (MABS492, MercK KGaA, Darmstadt, Germany), anti- HO-1 (ab52947, Abcam, Cambridge, UK), anti-BDNF (MABN79, MercK KGaA, Darmstadt, Germany), anti-p-CREB (06-519, Sigma-Aldrich, MO, U.S.A.), anti-iNOS (ab178945, Abcam, Cam- bridge, UK), anti-mAchR (m1M9808, Merck KGaA, Darmstadt, Germany) and anti-β- actin (ab8226, Abcam, Cambridge, UK). After initial antibody probing, the membrane was treated with stripping buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 100 mM β-mercaptoethanol) at 55\u0026deg;C for 30 minutes. The membrane was then washed with TBS-T three times for 10 minutes each. This allowed for re-probing with a new antibody or staining with Coomassie Brilliant Blue to visualize all proteins.\u003c/p\u003e \u003cp\u003eThereafter, at room temperature, membranes were first rinsed in phosphate- buffered saline with Tween 20 and then incubated with (HRP)-conjugated anti-rabbit secondary antibody (G-21234, Thermofisher, Massachusetts, USA). Another rinse by PBST, then membranes were treated with ECL prime kit (GERPN2236, Sigma-Aldrich, MO, USA). The Amersham\u0026trade; ImageQuant\u0026trade; system (Boston, USA) was used to capture the proteins signals, quantitative analysis was carried out via ImageJ (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://imagej.nih.gov/\u003c/span\u003e\u003cspan address=\"http://imagej.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Biochemical assays\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe hippocampus was homogenized PBS at 3℃, then centrifuged at 10,000 \u0026times; g for 10 min at 4℃ with 10% homogenates, the upper layer, known as tissue\u0026rsquo;s proteins extract, was collected, and stored at -80℃ for biochemical assessment.\u003c/p\u003e \u003cp\u003eTotal protein content was measured via a BCA Protein Assay Kit (ab102536, Abcam, Cambridge, UK). Examinations on cholinergic system were carried out via AchE kit (ab138871, Abcam, Cambridge, UK), Ach kit (STA-603, Cell Biolabs, CA, USA), ATP level assay kit (ab83355, Abcam, Cam- bridge, UK), and GSH kit (ab239727, Abcam, Cambridge, UK). For tissue ROS measurement, extracts were mixed with DCFDA (15 \u0026micro;M final concentration), and incubated at 37\u0026deg;C for 45 minutes in the dark. Measure the fluorescence intensity using a microplate reader at excitation/emission wavelengths of 485/535 nm. Increased fluorescence indicates higher ROS levels.\u003c/p\u003e \u003cp\u003eFor DNA binding assay. After the nucleus proteins were extracted as in the 2.8 section. Assays were carried out using the DNA-binding activity of Nrf2 was valued using the Trans-AM\u0026reg; Nrf2 kit (Catalog Nos. 50296, Active Motif, Carlsbad, CA, USA). Briefly, in the commercial ELISA plate, 15 \u0026micro;g of collected nuclear extract was incubated with the antioxidant response element (ARE) consensus sequence as well as immobilized mutated or wild-type competitor oligonucleotides. The detection for bound Nrf2 was made via anti-Nrf2 primary antibody (1:1000) and HRP-conjugated secondary antibody (1:1000). This was followed by chromogenic reaction by TMB substrate, and the absorbance was assessed at 450 nm using a plate reader.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Quantitative PCR Assay\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eFrom the homogenized hippocampus tissue, total RNA was separated by extraction by Trizol (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized via the PrimeScript RT kit (Takara Bio Inc., Osaka, Japan) corresponding to the manufacturer guidelines. PCR assay was executed with 1 \u0026micro;L of cDNA and primer at 0.3 \u0026micro;M. The instrument was a LightCycler\u0026reg; 480 System (F. Hoffmann-La Roche Ltd., Basel, Switzer- land) with the reaction medium as the TB Green Premix DimerEraserTM (Takara Bio Inc., Shiga, Japan). Sequent setup: initialization was first for 30 s at 95\u0026deg;C, then 40 cycles in amplification were made, subsequently denaturation in 5 s at 95\u0026deg;C, and for annealing and elongation in 30 s at 72\u0026deg;C. Normalization to those of β-actin gene was made. Primer sequences:\u003c/p\u003e \u003cp\u003eHO-1:\u003c/p\u003e \u003cp\u003eForward 5\u0026prime; CCTTCCCGAACATCGACAGCC-3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse 5\u0026prime;- GCAGCTCCTCAAACAGCTCAA-3\u0026prime;.\u003c/p\u003e \u003cp\u003eBDNF exon IX:\u003c/p\u003e \u003cp\u003eForward 5\u0026prime;- GCCTTTGGAGCCTCCTCTAC \u0026minus;\u0026thinsp;3\u0026prime;\u003c/p\u003e \u003cp\u003eReverse 5\u0026prime;- GCGGCATCCAGGTAATTTT \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eBcl-2:\u003c/p\u003e \u003cp\u003eForward 5\u0026rsquo;- GCCACCTATCTGAATGACCACC \u0026minus;\u0026thinsp;3\u0026prime;\u003c/p\u003e \u003cp\u003eReverse 5\u0026prime;- AGGAACCAGCGGTTGAAGCGC \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eiNOS:\u003c/p\u003e \u003cp\u003eForward 5\u0026rsquo;- CACCTTGGAGTTCACCCAGT \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse 5\u0026prime;- ACCACTCGTACTTGGGATGC \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eTNF-α:\u003c/p\u003e \u003cp\u003eForward 5\u0026rsquo;- GGTGCCTATGTCTCAGCCTCTT \u0026minus;\u0026thinsp;3\u0026prime;\u003c/p\u003e \u003cp\u003eReverse 5\u0026prime;- GCCATAGAACTGATGAGAGGGAG \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eIL-6:\u003c/p\u003e \u003cp\u003eForward 5\u0026rsquo;- AGACAGCCACTCACCTCTTCAG \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse 5\u0026prime;- TTCTGCCAGTGCCTCTTTGCTG \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eIL-1β:\u003c/p\u003e \u003cp\u003eForward 5\u0026rsquo;- AGACAGCCACTCACCTCTTCAG \u0026minus;\u0026thinsp;3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse 5\u0026prime;- TTCTGCCAGTGCCTCTTTGCTG \u0026minus;\u0026thinsp;3\u0026prime;.\u003c/p\u003e \u003cp\u003eβ-actin:\u003c/p\u003e \u003cp\u003eForward (5\u0026prime;-CCAGAGCAAGAGAGGTATCC-3\u0026prime;,\u003c/p\u003e \u003cp\u003eReverse 5\u0026prime;-CTGTGGTGGTGAAGCTGTAG- 3\u0026prime;.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.11, HT22 mouse hippocampal cell culture and treatment\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eMouse hippocampal HT22 cells (SCC129, Sigma-Aldrich, MO, USA) were cultured in DMEM supplemented with FBS (10%) and penicillin\u0026ndash;streptomycin (1%) in 5% CO\u003csub\u003e2\u003c/sub\u003e environment at 37\u0026deg;C. After 5 passages to obtain cell stocks, the cell was prepared for seeding. The cells were cultured in 96-well plates at 1 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well density in 0.1 mL media. Twenty-four hours after seeding, cells were subjected to drugs treatments of melittin only, or melittin\u0026thinsp;+\u0026thinsp;glutamate, or melittin\u0026thinsp;+\u0026thinsp;glutamate\u0026thinsp;+\u0026thinsp;inhibitors, as per experiment. After treatments, these cells were incubated for another 12 h and then tested with the WST-8 kit for cell viability determination. Inhibitors were used to hint out which pathway might be the focus of melittin: JNK Inhibitor SP600125, HO-1 synthesis inhibitor SnPP procured from Sigma\u0026ndash;Aldrich (St. Louis, MO, USA). The p38 inhibitor SB203580 from InvivoGen (San Diego, CA, USA). The Akt inhibitor MK-2206 from TargetMol (Wellesley Hills, MA, USA).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.12. Nrf2 nuclear translocation immunohistochemistry of HT22 cell after melittin treatment\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eAfter drugs treatments, at 0 hour and 6 hours, cell were fixed with methanol and were allowed to stand overnight with anti-Nrf2 primary antibody (ab31163, Abcam, Cambridge, UK) at 4\u0026deg;C, followed by incubation with GFP secondary antibody (A-11122, Thermo Fisher Scientific, Waltham, MA, USA) and DAPI (D1306, Thermo Fisher Scientific, Waltham, MA, USA) for another 1 h at room temperature. The cells were photographed using the Invitrogen EVOS FL Auto Imaging System (Thermo Fisher Scientific, Waltham, MA, USA) with a 40\u0026times; objective. Quantitative analysis was carried out via ImageJ (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://imagej.nih.gov/\u003c/span\u003e\u003cspan address=\"http://imagej.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.13. Molecular modeling and molecular docking\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTo assess the binding affinities and interaction patterns of potential inhibitors with the target protein, molecular modeling and docking were performed. Initially, melittin structure were converted from Simplified Molecular Input Line Entry System (SMILES) codes into three-dimensional (3D) structures using Open Babel, an open-source tool designed for chemical data manipulation. Then, molecular docking was executed using AutoDock Vina, a recognized software for this purpose[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The procedure of performing docking was conducted as previously described[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The protein model for docking was sourced from the RCSB Protein Data Bank (PDB), specifically using the PDB code \u003cb\u003e7OFE\u003c/b\u003e to represent the target protein. AutoDock Vina's parameters were set to probe for optimal docking poses within a grid box centered at coordinates (-43.16, 21.16, -11.37) and sized 38.00 \u0026Aring; x 38.00 \u0026Aring; x 38.00 \u0026Aring; along the x, y, and z axes, respectively. The simulations explored up to nine binding modes per ligand, with an energy threshold of 3 kcal/mol and an exhaustiveness level of 128, ensuring a thorough exploration of the conformational space. Post-docking, the results were visualized and analyzed using Chimera and Discovery Studio Visualizer for highlighting hydrogen bonds, hydrophobic contacts, and the fit of ligand within the binding site on the protein.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.14. Pull down assay\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe pull-down assay was conducted by attaching melittin to Epoxy-activated Sepharose 6B beads (obtained from Sigma, St. Louis, Missouri, USA). Initially, 1 mg of melittin was dissolved in 1 mL of a coupling buffer consisting of 0.1 M NaHCO\u003csub\u003e3\u003c/sub\u003e and 0.5 M NaCl at a pH of 11. The Sepharose 6B beads were first allowed to swell and were then cleansed with 1 mM HCl using a sintered glass filter. Subsequent washes were performed using the same coupling buffer. The beads were then combined with the melittin-infused coupling buffer and incubated at 4\u0026deg;C overnight. To block any non-specific binding sites, 1 M ethanolamine was used at 4\u0026deg;C overnight. The beads, now conjugated with melittin, underwent a series of washes with buffers alternating in pH \u0026mdash; the first buffer containing 0.1 M acetate and 0.5 M NaCl at pH 4, and the second containing 0.1 M Tris-HCl and 0.5 M NaCl at pH 8. Post-washing, the beads were stabilized in a binding buffer containing 0.05 M Tris-HCl and 0.15 M NaCl at pH 7.5. Control beads without melittin were prepared using the same procedure. For the assay, HT22 cell lysates were prepared using PRO-PREBP lysis buffer and combined with either the melittin-conjugated Sepharose 6B or the control beads, followed by an overnight incubation at 4\u0026deg;C. Afterward, the beads were thoroughly washed three times with TBST and the proteins bound to the beads were eluted using SDS-loading buffer. These proteins were then separated using SDS-PAGE and analyzed via immunoblotting, employing antibodies specific to Keap1 with dilution 1:800 (A80790, Antibodies, Cambridge, UK), or later with Coomassie Brilliant Blue staining (6104-58-1, Sigma-Aldrich, MO, USA).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.15. Statistical analysis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eSPSS version 18.0 was used for statistical analysis, and data were the form of mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. In quantitative measurements, data were analyzed using two-way ANOVA followed by Tukey's multiple comparison test. Differences between results were considered if the significant with p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e "},{"header":"3. Results","content":"\u003cp\u003e \u003cb\u003eFigure 2.\u003c/b\u003e In vivo experiment 1 (results shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003e): The experimental scheme for melittin effects on behavior amnesia induced by scopolamine. After sacrifice, analysis was carried out for parameters: neurogenesis level,, Nrf2 DNA binding activity and HO-1 expression, ROS and GSH index; BDNF, p-CREB, Bcl-2, Bax, iNOS, and mAchR 1 protein expressions; AchE and Ach levels.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Chemical analysis proved melittin passing through disrupted BBB and accumulated within hippocampus tissue:\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe hippocampus was specifically chosen for its importance in the formation and recalling of memory, this brain organ is also the focus of Alzheimer's studies [\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFrom the Total Ion chromatogram of commercial standard melittin (with a high purity of 98%), we detected a main peak and confirmed that to be the melittin. The peak tips\u0026rsquo; retention time proximity 7.04 min. The regression equation was y\u0026thinsp;=\u0026thinsp;130541x-60.074 (R2\u0026thinsp;=\u0026thinsp;0.9999) and was applied to calculate the level of melittin in samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Specific melittin mass pattern was based on signals broken down from this main peak: [M\u0026thinsp;+\u0026thinsp;3H]\u003csup\u003e3+\u003c/sup\u003e m/z\u0026thinsp;=\u0026thinsp;948.59 (Approximately 1/3 of melittin molecular weight), [M\u0026thinsp;+\u0026thinsp;4H]\u003csup\u003e4+\u003c/sup\u003e m/z\u0026thinsp;=\u0026thinsp;712.44 (Approximately 1/4 of melittin molecular weight), Melittin [M\u0026thinsp;+\u0026thinsp;5H]\u003csup\u003e5+\u003c/sup\u003e m/z\u0026thinsp;=\u0026thinsp;570.16 (Approximately 1/5 of melittin molecular weight), and Melittin [M\u0026thinsp;+\u0026thinsp;6H]\u003csup\u003e6+\u003c/sup\u003e m/z\u0026thinsp;=\u0026thinsp;475.30 (Approximately 1/6 of melittin molecular weight). Within the mass spectrometer chambers, each melittin molecules coupled with several H\u0026thinsp;+\u0026thinsp;resulted in the multiple m/z values detected.\u003c/p\u003e \u003cp\u003eWhen scanning through all sample\u0026rsquo;s chromatograms at the m/z\u0026thinsp;=\u0026thinsp;712.44 value, pinpoint retention time nearest to 7.04 min. This allows to detect and quantify melittin.\u003c/p\u003e \u003cp\u003eAs a result, from all mice groups, we detected only melittin in hippocampus of mice co treated with scopolamine and melittin. In the normal group as well as scopolamine only treated groups there was no amount of melittin near the suspected retention time of 7.04 min (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIn scopolamine and melittin co-treated group, there was a significant amount of melittin detected in hippocampus tissue. As previous research mentioned, the administration of scopolamine can induce stress in the brain and clearly disrupt the BBB [\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], this can facilitate the chance for large molecule such as melittin to enter the brain tissue such as hippocampus and produce direct effect on the hippocampal neurons. This change is BBB selectivity was reported before: when the BBB is weakened, even CD4 cells can travel into brain tissues, typically, the size of these cells restricts their entry through an intact blood-brain barrier (BBB)[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. This is the first study to present evidence that melittin can penetrate the brain hippocampal tissue. The matter of BBB disruption which create a chance to melittin to enter hippocampal tissue is further mentioned in the \u003cspan refid=\"Sec22\" class=\"InternalRef\"\u003ediscussion\u003c/span\u003e section (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eWe found weak melittin signals in the melittin only treated group samples. We explain this as: even though all mice were carefully perfused, there could still be a trace amount melittin in a very small blood volume left, despite after cleaning by perfusion (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Melittin exhibited cognitive protective effect against scopolamine induced amnesia and recover in hippocampus neurons neurogenesis:\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIn the water maze experiment assessing mice's long-term learning memory, notable findings emerged. Initially, scopolamine hindered cognitive function as training progressed, but on days 7\u0026ndash;9, the scopolamine-treated group showed minor improvement, reducing latency from above 60 to around 50 seconds. Adding melittin treatment to scopolamine-pretreated mice significantly reduced escape time, nearly matching those without scopolamine (20\u0026ndash;30 seconds). The normal and melittin-only groups showed little difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). In the probe test, scopolamine impaired mouse memory of the platform's location, while melittin treatment improved their interaction, seen in the heatmap, and increased platform crossing times. The normal and melittin-only groups had similar high crossing times (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eAs the result of observing spontaneous alternation (%) in Y maze test which indicate short term memory ability [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], it was confirmed that scopolamine significantly decreased this the spontaneous alternation index, whereas melittin treatment significantly enhanced this suppression. There was no significant difference between the normal and melittin only treated group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe brain's hippocampal physiology is closely tied to the neuroprocessing abilities of mice. One critical aspect of hippocampal function, the status of neuronal genesis in the dentate gyrus, is commonly studied due to its vital role in the development, recollection, and assessment of episodic memory. Brain sections were stained using the DCX antibody, a key marker for assessing neuronal neurogenesis state as it's expressed by developing neurons[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The results vividly illustrated the damage inflicted by scopolamine at an anatomical level. In the same region, the number of DCX-positive neurons decreased by approximately half compared to the normal group. However, the introduction of melittin significantly increased this count, confirming the neuroprotective effect of this drug against scopolamine-induced stress. Importantly, the group treated exclusively with melittin exhibited no significant difference from the normal group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). To further elucidate the effect of melittin on the hippocampus, we conducted more closely tests with the HT22 mouse hippocampal neurons in later parts.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.3. Melittin showed wide neuroprotection effects in the examined hippocampus tissue: upregulation of antioxidant defenses and recovery of neurotrophic, inflammatory, and cholinergic functions in hippocampus tissue\u003c/b\u003e:\u003c/p\u003e \u003cp\u003eIn prior renal-disorder-related studies, it was documented that melittin played a role in modulating the nuclear translocation of the nuclear factor erythroid 2-like 2 (Nrf2), a pivotal transcription factor responsible for upregulating the expression of important antioxidant genes such as heme oxygenase-1 (HO-1)[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. This intrinsic antioxidant barrier is important and is the cornerstone of combating oxidative stress and slowdown neurodegeneration[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThis study is the first report to demonstrate that melittin did indeed could up regulated Nrf2/HO-1 system within animal brain\u0026rsquo;s tissue: In the hippocampus samples of scopolamine only treated mice, we could observe a collapse of the Nrf2/HO-1 system, as the nucleus Nrf2 level, its\u0026rsquo; DNA binding activity and the HO-1 expression were only haft of that when compared to the normal group. When we administrated melittin to recuse this situation, this treatment induced Nrf2 nuclear translocation (figured by an increase in nucleus and reduction in cytoplasm Nrf2), which lead to the recovery of Nrf2 DNA binding activity and subsequently raising HO-1 production \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eAs a result of the increased production of antioxidative enzymes, oxidative stress (ROS) levels are suppressed in the melittin, and scopolamine co-treated group compared to the group treated with scopolamine alone. Glutathione (GSH) is crucial in the oxidative stress defense system as it acts as a primary antioxidant, neutralizing reactive oxygen species (ROS) and repairing oxidative damage in cells. By acting as a natural buffer against ROS, GSH helps maintain cellular integrity and function. Its levels serve as a key indicator of tissue recovery from oxidative stress, with higher GSH concentrations reflecting improved cellular health and restoration of normal function in damaged tissues[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eAfter proofs of cellular redox re-balancing, which it alone is not enough needed for enhanced neuronal regulations, we scanned a wide rage to see if other cellular regulations also improved by melittin: BDNF and p-CREB are crucial for neuronal survival and plasticity, and their reduced levels imply impaired neuronal health[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. mAChR1 is essential for cognitive function, and its decreased expression suggests compromised neurotransmission[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. iNOS was chosen as an inflammation marker due to its role in producing nitric oxide, leading to oxidative stress[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Bcl-2 promotes cell survival, and its reduction indicates increased cell death, while Bax promotes apoptosis, and its increase signifies heightened apoptotic activity[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eWith scopolamine-induced stress alone, we observed significantly decreased expression of key neuronal signaling proteins, including neurotrophic factors BDNF and p-CREB, and the neurotransmitter receptor mAChR1, indicating impaired neurotrophic support and cholinergic function. Scopolamine also increased inflammation, as evidenced by elevated iNOS protein levels, and promoted apoptosis by decreasing the anti-apoptotic protein Bcl-2 and increasing the pro-apoptotic protein Bax. When melittin was administered to these dysregulated mice, BDNF and p-CREB levels increased by approximately twofold, and mAChR1 levels nearly doubled, indicating recovery of neurotrophic support and cholinergic function. Melittin also reduced iNOS levels by about half, reflecting decreased inflammation, and normalized apoptotic signaling by increasing Bcl-2 levels by nearly 50% and decreasing Bax levels by about a third, suggesting an overall neuroprotective effect. Each protein marker was chosen for its critical role in neuronal survival: BDNF and p-CREB for neurotrophic support, Bcl-2 and Bax for apoptosis regulation, iNOS for inflammation, and mAChR1 for cholinergic function (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eFor the impact on the neurotransmitter system, an assessment of acetylcholinesterase activity and acetylcholine concentration in brain tissue revealed significant differences between the scopolamine group and the non-treatment group. Notably, the melittin.\u003c/p\u003e \u003cp\u003eThese findings suggest that melittin effectiveness is holistic across multiple aspects of neuro-recovery.\u003c/p\u003e \u003cp\u003eBesides this, the melittin only treated group exhibited little alternations from the normal group which is suggested due to the melittin did not infiltrate into brain tissue as explained above.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.4. Melittin enhance HO-1 gene expression as in the initially stage of action, prior to inflammation and neurotrophic factor response\u003c/b\u003e:\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFigure 6.\u003c/b\u003e In vivo experiment 2 (results shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e7\u003c/span\u003e): The experimental for the effect of melittin in a time dependent manner on Nrf2 DNA binding activity; HO-1 gene expression, ROS and GSH levels; iNOS, TNF-α, IL-1β, and IL-6 gene expression; Brain Ach and ATP levels, BDNF and Bcl-2 gene expression. S.C., subcutaneous injection; I.P., Intraperitoneal injection; Scopolamine I.P.: 1mg/kg; Melittin S.C.: 0.1mg/kg.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eIn this research, a second, more in depth, animal experiment was conducted (\u003cb\u003eFig.\u0026nbsp;6 \u0026amp;\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The positive effect of melittin treatment is holistic across a variety of aspects as presented above. There is a need to examine which direction might be the initial target of melittin. We performed a wide range of experiments periodically on mice after being treated with and/or melittin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e7\u003c/span\u003e). As gene transcriptions is highly sensitive and can reliably pinpoint which gene be being interacted by melittin in a prioritized manner[\u003cspan additionalcitationids=\"CR54 CR55\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Therefore, we based on gene expression observations, to indicate which pathway is the focus of action initially.\u003c/p\u003e\u003cp\u003eThe method of using Nrf2 DNA binding activity and HO-1 gene expression had been validated to align with Nrf2 nuclear translocation and HO-1 protein expression in previous section above, therefore these was applied to monitor in this experiment in huge quantity.\u003c/p\u003e\u003cp\u003eOur results were astonishing. After administering scopolamine, both control and treated groups exhibited a reduction in nucleus Nrf2 DNA binding activity (which were shown to go hand-in-hand with the rate of Nrf2 nuclear translocation in section 3.3 above), decreased HO-1 gene expression, elevated hippocampal ROS, and lower GSH levels. However, when treated with melittin, significant changes in these antioxidant markers were observed as early as the 2.5th to 5th hour (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). This was notably earlier than the improvements in inflammation parameters, which only became significant around the 10th hour: iNOS, TNF-α, IL-1β, and IL-6 gene expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Additionally, enhancements in cholinergic parameters like ACh levels, brain neurotrophic factor BDNF and anti-apoptosis Bcl-2 gene expressions, brain ATP levels were also significant, but again, not until the 10th hour (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e7\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003eFor the first time, our study has revealed that melittin not only upregulates the weakened Nrf2/HO-1 pathway in animals at a neurodegenerative stage but also provides compelling evidence that this pathway is the initial focus of melittin's action. This discovery opens up new avenues for targeting neurodegenerative diseases and highlights the profound potential of melittin in therapeutic interventions.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003e3.5 In vitro experiments provide evidence of melittin's initial and directly activation of the Nrf2/HO-1 pathway, and ignore multiple inflammation and apoptosis related ERK, JNK, p38, Akt signaling pathways\u003c/b\u003e:\u003c/p\u003e \u003cp\u003eAfter in vivo experiments on the mouse hippocampus demonstrated positive results, in this further in-depth in vitro study using the HT22 mouse hippocampal cell line, we aim to further investigate the mechanisms through which melittin exerts its effects. Glutamate negatively affects HT22 cells by causing oxidative stress, mitochondrial dysfunction, calcium overload, and apoptosis. This widely used in vitro model mimics brain stress and replicates mechanisms observed in psychiatric and neurodegenerative diseases, making it valuable for studying stress-induced neuronal damage and excitotoxicity [\u003cspan additionalcitationids=\"CR26 CR27 CR28\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this section, we delve into the intriguing mechanisms by which melittin, a component of bee venom, actively interacts with the Nrf2/HO-1 pathway to exert a profound neuroprotective effect. This neuroprotection is of great interest due to its potential implications for the treatment of neurological disorders and the understanding of cellular stress responses.\u003c/p\u003e \u003cp\u003eFirst, to identify the ideal concentration of melittin. The objective was to determine the highest melittin concentration that did not compromise the viability of HT22 cells, a crucial step to ensure the safety of this potent compound. It was found that 3 \u0026micro;M of melittin stood as the threshold concentration, effectively preserving the viability of HT22 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e8\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eBuilding upon this initial screening, we explored the neuroprotective potential of melittin in a dose-dependent manner. Concentrations ranging from 0.3 \u0026micro;M to 3 \u0026micro;M were tested against glutamate-induced stress. Our results revealed a dose-dependent neuroprotection, with higher melittin concentrations yielding more robust protective effects, the cell availability increased from about 50% up to 80% when treated with melittin (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e8\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eThe pivotal role of the Nrf2/HO-1 pathway in cellular defense against oxidative stress is well-established. When this system is activated Nrf2 is detached from Keap1 in cytosolic and move into the nucleus, attach to the ARE gene region to activate the transcription of antioxidant genes especially HO-1[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. To gain insights into the cellular processes involved, we conducted fluorescent staining experiments. These experiments illuminated the dynamic translocation of Nrf2 into the nucleus following melittin treatment. Significantly, Nrf2 translocation was observed at concentrations of 1 \u0026micro;M and 3 \u0026micro;M of melittin, highlighting the engagement of this pathway in melittin-induced: Groups treat with melittin (despite treatment with glutamate) show in the 6th hour after treatment, an increase in green florescent signal that overlap the nucleus (which is stained in blue DAPI), especially the groups with 3 \u0026micro;M melittin exhibited very Nrf2 nuclear translocation that most of Nrf2 in the cytoplasm disappeared and almost all concentrated into the oval-shaped nucleus neuroprotection (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e8\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eTo find out which pathway or protein a drug targets, it is common to use inhibitors that slow down specific cellular defense response. These inhibitors help identify the drug's target because when the right inhibitor is used with melittin, it has the same target as the drug candidate, the pathway that the drug activates would now be slowed down. As a result, the drug becomes less effective specifically when co-treated with the right inhibitor[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eMelittin can activate antioxidant defenses via directly upregulation of the Keap1/Nrf2/HO-1 pathway. Or, indirectly via anti-inflammatory and anti-apoptosis responses, which in terms are closely modulated by critical proteins like ERK, JNK, p38, and Akt. Following this direction, we applied inhibitors of ERK, JNK, p38, Akt, and HO-1 synthesis proteins with their respectively concentrations. These inhibitors were used in previous research to determine target of interaction for Nrf2/HO-1 activation [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eWe picked these concentrations, after screening with various dosages before, as they influenced similar cell availability of around 80% (statistically equivalent in comparison). This concentration selection is important, as we attempt to influence similar cell growth performance, as a baseline for later melittin intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e8\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eAfter introducing the above inhibitor with melittin, the treatment of all inhibitors reduces the drug\u0026rsquo;s protection. It is feasible since all the pathways are related in a broad sense to cellular recovery. However, the inhibitor that reduced the most this protection effect was HO-1 synthesis inhibitor. This implies that the most relevance to melittin direct activity is the Nrf2-HO-1 pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e8\u003c/span\u003eE).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Docking affinity and stability of melittin on Keap1: potential impacts on Keap1/Nrf2 complex formation:\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe above in vivo (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) and in vitro (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e8\u003c/span\u003eC) experiments all showed an increase translocation of Nrf2 from the cytoplasm into the nucleus. Typically, Nrf2 is held hostage within the cytoplasm by the Keap1/Nrf2 complex. Melittin action, can disguise as a natural defense stimulus to distort this complex\u0026rsquo;s stability via an attachment to the Keap1 molecule, which can liberate the intact Nrf2 from the complex and allow it to naturally move into the nucleus, where Nrf2 is the main promoter of important antioxidant gene expression such as HO-1[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan additionalcitationids=\"CR61\" citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the molecular docking analysis, we observed several configurations of intermolecular interactions between melittin and Keap1, each exhibiting the highest predicted affinity of -7.6 kcal/mol across five docking patterns at the Keap1/Nrf2 interaction site (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e9\u003c/span\u003e). The presence of diverse interaction types across these patterns suggests compensatory mechanisms that enhance stability and binding efficiency.\u003c/p\u003e \u003cp\u003eImportantly, the strong affinity and stability of the melittin-Keap1 complexes could disrupt or modulate the Keap1-Nrf2 interaction, a critical regulator of cellular responses to oxidative stress.\u003c/p\u003e \u003cp\u003eThe interaction density in patterns 2 and 5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e9\u003c/span\u003eB, E) shows a significantly high number of van der Waals interactions, suggesting extensive surface contacts with Keap1. This is significant, as van der Waals interactions are highly crucial for the stability of protein-ligand complexes. Patterns 1, 3, and 5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e9\u003c/span\u003eA, C, \u003cb\u003e\u0026amp; E\u003c/b\u003e) exhibit a greater number of conventional hydrogen bonds, which are essential for specificity and stability in ligand binding. This indicates that these patterns might form particularly stable complexes with Keap1. The unique pi-donor hydrogen bond in pattern 4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e9\u003c/span\u003eD) likely facilitates specific and robust binding to certain Keap1 residues.\u003c/p\u003e \u003cp\u003eAdditionally, the carbon-hydrogen bonds in patterns 1 and 5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e9\u003c/span\u003eA, E) and pi-alkyl interactions in these patterns may influence the orientation and stability of melittin within the binding site. While the unfavorable donor-donor interactions noted in patterns 3 and 4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e9\u003c/span\u003eC, D) might generally be less favorable, their impact is seemingly neutralized by other stabilizing interactions, as evidenced by the consistent docking energy across all patterns. All these properties further suggest a good physical interaction of melittin and Keap1 possible.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eFollowing the 3D docking analysis elucidating the potential interaction between melittin and Keap1, a pull-down assay was conducted to experimentally confirm this interaction. The Keap1 protein is detected approximately at the 60 kDa position. In this assay, melittin was employed as the bait, conjugated on the Epoxy-activated Sepharose 6B beads, to target proteins including Keap1. In the depicted result (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e10\u003c/span\u003e), the first lane shows the western blot analysis of the whole HT22 cell lysate, serving as a positive control. The second lane represents a negative control experiment, where the HT22 cell lysate was incubated with beads that were not conjugated with melittin. This lane showed no trace of Keap1, demonstrating that the beads alone do not cause any non-specific binding. This ensures that proteins shown in the third lane are those which specifically bound only to melittin, not bead\u0026rsquo;s bare surface. The HT22 cell lysate was then incubated with melittin-conjugated beads, which were subsequently collected, washed thoroughly to remove non-specifically bound proteins. SDS loading buffer, which typically contains sodium dodecyl sulfate (SDS), a strong anionic detergent, was employed to wash proteins like Keap1 from melittin-conjugated beads and analyzed by western blotting.\u003c/p\u003e \u003cp\u003eThe third lane shows the proteins released from the melittin-conjugated beads after washing, with the presence of Keap1 at the 60 kDa, similar to manufacturer description, then stained with Coomassie Brilliant Blue to visualize all proteins. The presence of Keap1 as the main protein bound to melittin beads demonstrates the selectivity of melittin for Keap1 and its potential to activate the downstream Nrf2/HO-1 pathway.\u003c/p\u003e \u003cp\u003eAdditionally, mass spectra analysis was conducted to compare the commercial standard Keap1 with the extracted protein sample. The spectra showed three significant peaks, specifically at m/z 1803.95, 2066.79, and 2135.1. These peaks were selected as the most dominant due to their high relative abundance and clear definition in both the commercial standard and the extracted sample spectra. The close match between the m/z values in the standard and extracted samples reinforces the conclusion that the extracted protein is indeed Keap1. Several peaks appear exclusively in the extracted sample and not in the standard Keap1 spectra. These peaks are likely attributable to other proteins western blot co-eluted during the extraction process. However, their significantly lower intensity indicates that these proteins are present in much smaller quantities compared to Keap1, and therefore do not represent major components in the sample. This congruence in m/z values supports the hypothesis of specific interaction and binding between melittin and Keap1.\u003c/p\u003e \u003cp\u003eThe results of the pull-down assay conclusively demonstrate the physical association between melittin and Keap1, directly supporting the findings from the docking simulations and providing robust evidence for the interaction at the molecular level. This comprehensive approach, combining western blot analysis, Coomassie staining, stripping and re-probing, and mass spectra comparison, ensures the specificity and accuracy of Keap1 extraction and identification.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIn the initial part of our research, we focused on the ability of melittin to penetrate the blood-brain barrier (BBB). The mouse scopolamine-induced neurodegeneration model was utilized in much research to discover new anti-neurodegeneration drug candidates[\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan additionalcitationids=\"CR64\" citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. The brain disorders shown in this study displayed a considerable amount of neuro stress: increase in oxidative stress levels; increase in inflammatory responses; decline in neurotrophic, cholinergic system, and neuronal neurogenesis. In this study, melittin was only found in the hippocampal tissue of those: which were jointly pretreated with scopolamine to induce a neurodegenerative stage; but not in the normal mice receiving only melittin treatment. When the BBB is disrupted by neurodegenerative disease, this wall fails to filter many of the external elements and let them to migrate into brain tissues[\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. For example, when the barrier is weakened, CD4 cells, which their size usually limits them to enter through the BBB but also can be observed in the brain tissue[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. We believe, normally, BBB filter out melittin cannot pass through BBB; but in this experiment, scopolamine induced BBB damage enough so that melittin could pass through as shown via the chemical analytical analysis, and this facilitate melittin to interact directly with neurons. While some studies have indicated that BBB disruption is an early event in neurodegenerative diseases[\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e], the recovery process appears to be slow and challenging. This hints that when melittin is administrative, there is certainly a window of time before BBB is fully healed that melittin can get through and go into the brain. Interestingly, this creates an interesting effect in this study that melittin only could past selectively through BBB of scopolamine induced neuro-degenerative animals, but not those in normal condition. This selective characteristic can be used as a useful hint for therapeutic strategies development.\u003c/p\u003e \u003cp\u003eIn previous cardiology and renal studies, which disease models that seem to lack the importance of BDNF/CREB signaling, melittin could help restore cellular redox balance via the Nrf2/HO-1 pathway[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In neurology, experiment carried out in HT22 cells revealed that melittin could upregulate Nrf2 presence in the nuclear and hence increase HO-1 production, thus reduce cellular oxidative stress parameters such as cellular ROS, MDA, LDH, and protein carbonyl levers[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. However, on \u003cem\u003ein vivo\u003c/em\u003e level, it remains elusive if melittin can upregulate the diminished Nrf2/HO-1 pathway in animals at a neuro-degenerative stage, also whether this pathway is the initial effect of melittin action or not.\u003c/p\u003e \u003cp\u003eFor the first time, this study revealed that melittin upregulates the diminished Nrf2/HO-1 pathway in the brain. The evidence demonstrated that melittin's initial action primarily involves enhancing HO-1 gene expression, occurring much earlier compared to the subsequent improvements in neurotrophic factors (BDNF and p-CREB), anti-apoptotic protein Bcl-2, inflammation markers (iNOS, TNF-α, IL-6, and IL-1β), and recovery of Ach and ATP levels. Additionally, our in vitro study using the HT22 cell line showed that melittin can liberate Nrf2 from the Keap1/Nrf2 complex, facilitating Nrf2's translocation into the nucleus and leading to increased HO-1 production, a novel finding.\u003c/p\u003e \u003cp\u003eIn details, there was indeed a positive change in the Nrf2/HO-1 pathway prior to inflammation parameters enhancements. This indicates the specific interaction mechanisms of melittin is rather up regulate intracellular antioxidant barrier rather than anti-inflammatory effect. Reduces neuroinflammation is a key strategy in to slow down aging brains[\u003cspan additionalcitationids=\"CR68 CR69\" citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]. Antioxidant and detoxification genes are believed to preserve cellular homeostasis and eliminate toxins before they can cause damage and activate inflammatory responses, also as cellar redox balance is restored cell regulation start to balance and over express inflammation cytokine tend to reduce[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. In the brain, Microglia cells have functions similar to macrophage-like cells and contribute to homeostasis, as well as host cell defense and repair. Also, astrocytes cells offer structural, metabolic, and trophic assistance to neurons, and are also capable of producing inflammatory mediators. The activation of both cell types leads to extreme secretion of crucial proinflammatory cytokines such as iNOS, TNF-α, IL-6 and IL-1β. This facilitates negative consequences for neuronal viability and is a signature of inflammation mediated neurodegeneration[\u003cspan additionalcitationids=\"CR74\" citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. Therefore, the expressions of TNF-α, iNOS, IL-6 and IL-1β inflammatory substances, were analyzed in this study.\u003c/p\u003e \u003cp\u003eA similar pattern was seen, as the improvement of the Nrf2/HO-1 pathway was recorded much earlier, than the improvement of brain neurotrophic system signature proteins BDNF and CREB gene expression. Normalization of brain neurotrophic indicates a normal working neural cell neuronal cell health and functions. Beside a strengthen neurotrophic system can also support a more prominent recovery of cellular redox balance[\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAll these improvements stabilize cellular signaling matrixes, reduce apoptosis reactions and recover neuronal functions.\u003c/p\u003e \u003cp\u003eFrom results seen above, the cholinergic and neurotransmitter system were also improved after melittin treatment. These are key targets of some well-known anti dementia drugs such as donepezil[\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. The muscarinic acetylcholine receptor M1 (mAchR1) is a subtype of M1-5[\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]. M1 receptors are confined to cognitive-related brain regions, such as the hippocampus and cortex[\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e], they mediate the metabolic action of acetylcholine[\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e], and increase intracellular calcium concentrations to activate enzymes related to intracellular signaling systems[\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe overall neuron\u0026rsquo;s health recovery by HO-1 enhancement also had positive effects on improving mice cholinergic system, as it had recovered the ATP level of mice brain, and therefore, improved inner-neuronal living and functions[82]. The revival cellular ATP represents that brain cells internal metabolisms functions were tilting back to normal. This cellular energy recovery significantly lags behind the cellular redox recovery in our experiment. Which reflects the truth that cellular ROS disrupts the function of mitochondria and disrupts ATP production as well as ignite apoptosis process, weaken all cellular survival attempt to retain stability [83,84]. The evidence adds strong ground to support the holistic value of the approach to upregulate cellular antioxidant mechanisms in curing neurodegenerative disorder. Additionally, melittin treatment decreased Bax and increased Bcl-2 levels, indicating a recovery of cell death mechanisms, which closely related to [85\u0026ndash;87] performance. Bax promotes apoptosis by permeabilizing the mitochondrial membrane, while Bcl-2 inhibits this process. This recovery is crucial for maintaining neuronal integrity and function, highlighting melittin's neuroprotective effects.\u003c/p\u003e \u003cp\u003eTo delve deeper into the precise internal cellular signaling pathway responsible for this effect, we performed in vitro experiments using HT22 mouse hippocampal neurons. This experiment utilized a range of inhibitors to block potential pathways associated with Nrf2/HO-1 activation. These inhibitors help identify the drug's target because when the correct inhibitor is used, it shares the same target as the drug candidate, thus slowing down the pathway that the drug activates. Consequently, the drug becomes less effective, indicating that it was acting on the pathway, which was indicated by the respective inhibitor[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eThe p38, ERK, JNK, and Akt pathways are intricately interconnected in various cellular defense mechanisms, encompassing processes such as inflammation, apoptosis, and cellular regeneration. Importantly, all these pathways can all upregulate the activity of the Nrf2/HO-1 system as stress-response reactions [29,87\u0026ndash;90]. Interestingly, despite their roles, inhibitors of these four pathways fail to replicate the inhibition effect of the HO-1 synthesis inhibitor in effectively blocking melittin's cellular protection which really emphasize melittin direct influent on the Nrf2/HO-1 activation.\u003c/p\u003e \u003cp\u003eTypically, Nrf2 is held hostage within the cytoplasm by the Keap1/Nrf2 complex. Melittin action, can disguise as a natural defense stimulus to distort this complex\u0026rsquo;s stability via physical attachments to the Keap1 molecule, which can liberate the intact Nrf2 from the complex and allow it to naturally move into the nucleus, where Nrf2 is the main promoter of important antioxidant gene expression such as HO-1[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan additionalcitationids=\"CR61\" citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe dry lab docking experiment revealed multiple interaction sites where melittin binds to Keap1 with a high affinity of -7.6 kcal/mol, as shown across the five analyzed docking patterns. These binding interactions likely disrupt the normal Keap1/Nrf2 interaction dynamics, thus releasing Nrf2.\u003c/p\u003e \u003cp\u003eThese docking simulations indicate a robust interaction profile, including a significant number of van der Waals forces and hydrogen bonds. These interactions are critical for the stability and specificity of melittin binding, which are essential factors in its ability to modulate the Keap1/Nrf2 complex effectively. The presence of unique interaction types such as pi-donor hydrogen bonds and pi-alkyl interactions in certain patterns further supports the hypothesis that melittin can induce conformational changes in Keap1, facilitating the release of Nrf2. Together with the results from the pulldown assay, these findings suggest that melittin's target is likely the direct interaction with Keap1, which promotes Nrf2 liberation and subsequently upregulates the cellular intraduct antioxidant system.\u003c/p\u003e \u003cp\u003eResearch has suggested that the disruption of the Keap1/Nrf2 interaction by small molecules can lead to enhanced expression of antioxidant response element (ARE)-driven genes like HO-1, which plays a pivotal role in cellular defense mechanisms against oxidative stress[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. This potential makes melittin a promising candidate for therapeutic applications aimed at diseases characterized by oxidative stress and inflammation.\u003c/p\u003e \u003cp\u003eThe administration route for melittin commonly involves subcutaneous injection, a method that can lead to adverse effects if excessive. While melittin has shown promise in restoring cognitive function in neurodegenerative models, addressing its potential irritative properties and establishing an optimal human dosage are imperative[91]. Recent developments in disease research involving melittin have harnessed recombinant technology and computational bioinformatics to engineer specialized variants with modified amino acid sequences. These innovations have facilitated more effective augmentation and enhanced drug delivery, allowing for intravenous injection and targeted action on specific groups of malaria-infected cells[92]. Such advancements hold the potential to mitigate melittin's side effects and bolster its acceptance as a treatment option.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIn conclusion, our investigation demonstrated for the first time as we know that melittin directly interacts with and reactivates the compromised Nrf2/HO-1 pathway, effectively restoring cellular redox balance. This reactivation establishes a foundation for the natural recovery of various downstream processes, including inflammation, apoptosis, neurotrophic factor regulation, cholinergic function, and mitochondrial performance. These findings highlight melittin's potential as a holistic therapeutic agent for conditions marked by oxidative stress and inflammation, supporting the need for further clinical research to explore its therapeutic applications in neurodegenerative diseases.\u003c/p\u003e "},{"header":"Abbreviations","content":"\u003cp\u003eNrf2: Nuclear factor erythroid 2\u0026ndash;related factor 2; HO-1: Heme oxygenase-1; BV: Bee venom; I.P.: Intraperitoneally; S.C.: Subcutaneously; PBS: Phosphate-buffered saline; ROS: Reactive oxygen species; MDA: Malondialdehyde; LDH: Lactate dehydrogenase; DCX: Doublecortin; GSH: Glutathione; BDNF: Brain-derived neurotrophic factor; CREB: cAMP response element-binding protein; mAchR1: Muscarinic acetylcholine receptor; M1 iNOS: Inducible nitric oxide synthase; TNF-α: Tumor necrosis factor-alpha; IL-1β: Interleukin-1 beta; IL-6: Interleukin-6; Ach: Acetylcholine; ATP: Adenosine triphosphate; Bcl-2: B-cell lymphoma 2; PCR: Polymerase chain reaction; DMEM: Dulbecco's Modified Eagle Medium; FBS: Fetal bovine serum; HRP: Horseradish peroxidase; TMB: 3,3',5,5'-Tetramethylbenzidine; ELISA: Enzyme-linked immunosorbent assay; HT22: Mouse hippocampal cell line; SDS-PAGE: Sodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis; PVDF: Polyvinylidene fluoride; SPSS: Statistical Package for the Social Sciences; NRC: National Research Council; NRF: National Research Foundation; 3D: Three-dimensional; UHPLC: Ultra-high-performance liquid chromatography; MS/MS: Tandem mass spectrometry; TIC: Total ion chromatography; AchE: Acetylcholinesterase; DCF: Dichlorofluorescein; DNA: Deoxyribonucleic acid.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval:\u0026nbsp;\u003c/strong\u003eThis study was conducted in accordance with the Guide for Care and Use of Laboratory Animals of the National Research Council (NRC, 1996) and was approved by the Committee of Animal Care and Experiment of Dongshin University, Korea (DSU2021-01-07).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT)\u0026mdash;No. NRF-2021R1A2C20070411341282058250103 and NRF-2022R1I1A30682551241282058250102.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u0026nbsp;\u003c/strong\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions: YHJ, CDN, and HAH\u003c/strong\u003e performed the experiment and wrote the manuscript. \u003cstrong\u003eSJJ\u003c/strong\u003e augmented the manuscript. \u003cstrong\u003eGL,\u003c/strong\u003e \u003cstrong\u003eYJH\u003c/strong\u003e, \u003cstrong\u003eJCS,\u003c/strong\u003e and \u003cstrong\u003eJHK\u003c/strong\u003e gave directional advice and managed the whole project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003eThe author gives our consent for the publication of identifiable details, which can include data and content to be published in the above Journal and Article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed Consent Statement:\u0026nbsp;\u003c/strong\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u003c/strong\u003e The data that support the findings of this study will be made available upon reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting of Interest:\u0026nbsp;\u003c/strong\u003eThe authors declare no conflicts of interest that are directly relevant to the content of this manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKorean Neuropsychiatry (2018) National College of Korean Medicine Neuropsychiatry Textbook Compilation Committee. Third Edition. Seoul: Jipmoon Publishing Co\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark DY, Kim H, Lee KJ (2019) Association between Thyroid-Related Hormones and Cognitive Function Patients with Alzheimer\u0026rsquo;s Disease and Mild Cognitive Impairment. Korean J Psychosom Med 27:60\u0026ndash;68\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHwang BR, Kim H, Lee KJ (2012) Neuropsychiatric Symptoms in Patients with Mild Cognitive Impairment and Dementia of Alzheimer\u0026rsquo;s Type. Korean J Psychosom Med 20:105\u0026ndash;111\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWinston Wong (2020) Economic Burden of Alzheimer Disease and Managed Care Considerations\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim HJ, Baek SY, Sok DE, Lee KJ, Kim YJ, Kim MR (2020) Neuroprotective activity of polyphenol-rich ribes diacanthum pall against oxidative stress in glutamate-stimulated ht-22 cells and a scopolamine-induced amnesia animal model. Antioxidants 9:1\u0026ndash;17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheignon C, Tomas M, Bonnefont-Rousselot D, Faller P, Hureau C, Collin F (2018) Oxidative stress and the amyloid beta peptide in Alzheimer\u0026rsquo;s disease. Redox Biol 14:450\u0026ndash;464\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArslan J, Jamshed H, Qureshi H (2020) Early Detection and Prevention of Alzheimer\u0026rsquo;s Disease: Role of Oxidative Markers and Natural Antioxidants. Front Aging Neurosci. ;12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL\u0026oacute;pez N, Tormo C, de Blas I, Llinares I, Alom J (2013) Oxidative stress in Alzheimer\u0026rsquo;s disease and mild cognitive impairment with high sensitivity and specificity. J Alzheimer\u0026rsquo;s Disease 33:823\u0026ndash;829\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng X, Ku C-H, Siow RCM (2013) Regulation of the Nrf2 antioxidant pathway by microRNAs: New players in micromanaging redox homeostasis. Free Radic Biol Med 64:4\u0026ndash;11\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshii T, Itoh K, Takahashi S, Sato H, Yanagawa T, Katoh Y et al (2000) Transcription Factor Nrf2 Coordinately Regulates a Group of Oxidative Stress-inducible Genes in Macrophages. J Biol Chem 275:16023\u0026ndash;16029\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCho H-Y, Jedlicka AE, Reddy SPM, Kensler TW, Yamamoto M, Zhang L-Y et al (2002) Role of NRF2 in Protection Against Hyperoxic Lung Injury in Mice. Am J Respir Cell Mol Biol 26:175\u0026ndash;182\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVargas MR, Johnson JA (2009) The Nrf2\u0026ndash;ARE cytoprotective pathway in astrocytes. Expert Rev Mol Med 11:e17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang DD (2006) Mechanistic Studies of the Nrf2-Keap1 Signaling Pathway. Drug Metab Rev 38:769\u0026ndash;789\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTu W, Wang H, Li S, Liu Q, Sha H (2019) The anti-inflammatory and anti-oxidant mechanisms of the keap1/Nrf2/ARE signaling pathway in chronic diseases. Aging Dis 10:637\u0026ndash;651\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJurcau A (2021) The role of natural antioxidants in the prevention of dementia\u0026mdash;where do we stand and future perspectives. Nutrients 13:1\u0026ndash;22\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSolleiro-Villavicencio H, Rivas-Arancibia S (2018) Effect of chronic oxidative stress on neuroinflammatory response mediated by CD4\u0026thinsp;+\u0026thinsp;T cells in neurodegenerative diseases. Front Cell Neurosci 12:1\u0026ndash;13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamsey CP, Glass CA, Montgomery MB, Lindl KA, Ritson GP, Chia LA et al (2007) Expression of Nrf2 in Neurodegenerative Diseases. NIH Public Access 66:75\u0026ndash;85\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOsama A, Zhang J, Yao J, Xiaojun Yao JF (2020) Nrf2: a dark horse in Alzheimer\u0026rsquo;s disease treatment. Ageing Res Rev. ;64\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakao A, Otterbein LE, Overhaus M, Sarady JK, Tsung A, Kimizuka K et al (2004) Biliverdin protects the functional integrity of a transplanted syngeneic small bowel. Gastroenterology 127:595\u0026ndash;606\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi L, Grenard P, van Nhieu JT, Julien B, Mallat A, Habib A et al (2003) Heme oxygenase-1 is an antifibrogenic protein in human hepatic myofibroblasts. Gastroenterology 125:460\u0026ndash;469\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang T, Zhang J, Xiao A, Liu W, Shang Y, An J (2016) Melittin ameliorates CVB3-induced myocarditis via activation of the HDAC2-mediated GSK-3β/Nrf2/ARE signaling pathway. Biochem Biophys Res Commun 480:126\u0026ndash;131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim JY, Leem J, Hong HL (2021) Melittin Ameliorates Endotoxin-Induced Acute Kidney Injury by Inhibiting Inflammation, Oxidative Stress, and Cell Death in Mice. Oxid Med Cell Longev. ;2021\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Yang NN, Shi GX, Wang LQ, Li QQ, Yang JW et al (2021) Acupuncture Attenuates Blood Pressure via Inducing the Expression of nNOS. Evidence-based Complementary and Alternative Medicine. ;2021\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNguyen T-T-L, Kim JW, Choi H-I, Maeng H-J, Koo T-S (2022) Development of an LC-MS/MS Method for ARV-110, a PROTAC Molecule, and Applications to Pharmacokinetic Studies. Molecules 27:1977\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHematyar M, Soleimani M, Es-haghi A, Rezaei Mokarram A (2018) Synergistic co-delivery of doxorubicin and melittin using functionalized magnetic nanoparticles for cancer treatment: loading and \u003cem\u003ein vitro\u003c/em\u003e release study by LC\u0026ndash;MS/MS. Artif Cells Nanomed Biotechnol 46:S1226\u0026ndash;S1235\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang S, Wang J, Guo Z, Wang Y, Liu C (2020) Quantitative measurement of melittin in Asian honeybee venom using a new method including UPLC-QqTOF-MS. Toxins (Basel). ;12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang R, Yang D, Zhou C, Cheng K, Liu Z, Chen L et al (2012) β-Actin as a loading control for plasma-based Western blot analysis of major depressive disorder patients. Anal Biochem 427:116\u0026ndash;120\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGilda JE, Gomes AV (2015) Western blotting using in-gel protein labeling as a normalization control: stain-free technology. Methods Mol Biol 1295:381\u0026ndash;391\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJankowska U, Latosinska A, Skupien-Rabian B, Swiderska B, Dziedzicka-Wasylewska M, Kedracka-Krok S (2016) Optimized procedure of extraction, purification and proteomic analysis of nuclear proteins from mouse brain. J Neurosci Methods 261:1\u0026ndash;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim KW, Quang TH, Ko W, Kim DC, Yoon CS, Oh H et al (2018) Anti-neuroinflammatory effects of cudraflavanone a isolated from the chloroform fraction of Cudrania Tricuspidata root bark. Pharm Biol 56:192\u0026ndash;200\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLewis KN, Wason E, Edrey YH, Kristan DM, Nevo E, Buffenstein R (2015) Regulation of Nrf2 signaling and longevity in naturally long-lived rodents. Proc Natl Acad Sci U S A 112:3722\u0026ndash;3727\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark G, Moon BC, Oh DS, Kim YU, Park MK (2021) Enhanced Nrf2 up-regulation by extracellular basic pH in a human skin equivalent system. J Cell Mol Med 25:3646\u0026ndash;3653\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao H, Wong RJ, Nguyen X, Kalish F, Mizobuchi M, Vreman HJ et al (2006) Expression and regulation of heme oxygenase isozymes in the developing mouse cortex. Pediatr Res 60:518\u0026ndash;523\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTom\u0026aacute;s FJB, Turko P, Heilmann H, Trimbuch T, Yanagawa Y, Vida I et al (2020) BDNF expression in cortical GABAergic interneurons. Int J Mol Sci. ;21\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGobert AP, Verriere T, Asim M, Barry DP, Piazuelo MB, de Sablet T et al (2014) Heme Oxygenase-1 Dysregulates Macrophage Polarization and the Immune Response to Helicobacter pylori. J Immunol 193:3013\u0026ndash;3022\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJamal F, Singh MK, Hansa J, Pushpanjali, Ahmad G, Dikhit MR et al (2020) Leishmania-Specific Promiscuous Membrane Protein Tubulin Folding Cofactor D Divulges Th1/Th2 Polarization in the Host via ERK-1/2 and p38 MAPK Signaling Cascade. Front Immunol. ;11\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKooreman NG, de Almeida PE, Stack JP, Nelakanti Rv, Diecke S, Shao NY et al (2017) Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics. Cell Rep 20:1978\u0026ndash;1990\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhasym A, Annarapu GK, Saha S, Shrimali N, Gupta S, Seth T et al (2019) Neutrophils develop rapid proinflammatory response after engulfing Hb-activated platelets under intravascular hemolysis. Clin Exp Immunol 197:131\u0026ndash;140\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSweeney MD, Sagare AP, Zlokovic B (2018) v. Blood-brain barrier breakdown in Alzheimer disease and other neurodegenerative disorders. Nat Reviews Neurol 14:133\u0026ndash;150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Z yong, Jiang M, Fang J, Yang M, feng, Zhang S, Yin Y, xin et al (2017) Enhanced Therapeutic Potential of Nano-Curcumin Against Subarachnoid Hemorrhage-Induced Blood\u0026ndash;Brain Barrier Disruption Through Inhibition of Inflammatory Response and Oxidative Stress. Mol Neurobiol. ;54:1\u0026ndash;14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong K, Li Y, Zhang H, An N, Wei Y, Wang L et al (2020) Oxidative Stress-Mediated Blood-Brain Barrier (BBB) Disruption in Neurological Diseases. Oxidative Medicine and Cellular Longevity. ;2020\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKraeuter AK, Guest PC, Sarnyai Z (2019) The Y-Maze for Assessment of Spatial Working and Reference Memory in Mice. Methods in Molecular Biology. Humana Press Inc., pp 105\u0026ndash;111\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNguyen CD, Lee G (2021) Neuroprotective activity of melittin\u0026mdash;the main component of bee venom\u0026mdash;Against oxidative stress induced by Aβ25\u0026ndash;35 in \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e models. Antioxidants. ;10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang R, Wallqvist A, Thanki N, Covell DG (2005) Linking pathway gene expressions to the growth inhibition response from the National Cancer Institute\u0026rsquo;s anticancer screen and drug mechanism of action. Pharmacogenom J 5:381\u0026ndash;399\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Nadal E, Ammerer G, Posas F (2011) Controlling gene expression in response to stress. Nat Rev Genet 12:833\u0026ndash;845\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpriggs KA, Bushell M, Willis AE (2010) Translational Regulation of Gene Expression during Conditions of Cell Stress. Mol Cell 40:228\u0026ndash;237\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarbosa C, Peixeiro I, Rom\u0026atilde;o L (2013) Gene Expression Regulation by Upstream Open Reading Frames and Human Disease. PLoS Genet. ;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChung ES, Lee G, Lee C, Ye M, Chung H, Kim H et al (2015) Bee Venom Phospholipase A 2, a Novel Foxp3\u0026thinsp;+\u0026thinsp;Regulatory T Cell Inducer, Protects Dopaminergic Neurons by Modulating Neuroinflammatory Responses in a Mouse Model of Parkinson\u0026rsquo;s Disease. J Immunol 195:4853\u0026ndash;4860\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Xue X, Xian L, Guo Z, Ito Y, Sun W (2016) Potential neuroprotection of protodioscin against cerebral ischemia-reperfusion injury in rats through intervening inflammation and apoptosis. Steroids 113:52\u0026ndash;63\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiaz A, Limon D, Ch\u0026aacute;vez R, Zenteno E, Guevara J (2012) Aβ25\u0026ndash;35 injection into the temporal cortex induces chronic inflammation that contributes to neurodegeneration and spatial memory impairment in rats. J Alzheimer\u0026rsquo;s Disease 30:505\u0026ndash;522\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIm EJ, Kim SJ, Hong SB, Park JK, Rhee MH (2016) Anti-Inflammatory Activity of Bee Venom in BV2 Microglial Cells: Mediation of MyD88-Dependent NF-B Signaling Pathway. Evidence-based Complementary and Alternative Medicine. ;2016\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwon HS, Koh SH (2020) Neuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes. Translational Neurodegeneration. ;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinogue AM, Barrett JP, Lynch MA (2012) LPS-induced release of IL-6 from glia modulates production of IL-1β in a JAK2-dependent manner\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePozniak PD, White MK, Khalili K (2014) TNF-α/NF-κB signaling in the CNS: Possible connection to EPHB2. J Neuroimmune Pharmacol 9:133\u0026ndash;141\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrankola KA, Greig NH, Luo W, Tweedie D Targeting TNF-alpha to elucidate and ameliorate neuroinflammation in neurodegenerative diseases\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTu W, Wang H, Li S, Liu Q, Sha H (2019) The anti-inflammatory and anti-oxidant mechanisms of the keap1/Nrf2/ARE signaling pathway in chronic diseases. Aging Disease 10:637\u0026ndash;651\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSatoh T, McKercher SR, Lipton SA (2013) Nrf2/ARE-mediated antioxidant actions of pro-electrophilic drugs. Free Radic Biol Med 65:645\u0026ndash;657\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuc Nguyen C, Yoo J, Kim M, Jang H, No KO, Hwang S et al (2022) Title: Bee venom activates the Nrf2/OH-1 and TrkB/CREB/BDNF pathways in neuronal cell responses against oxidative stress induced by Aβ 1\u0026ndash;42\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHannan MA, Dash R, Sohag AAM, Haque MN, Moon IS (2020) Neuroprotection Against Oxidative Stress: Phytochemicals Targeting TrkB Signaling and the Nrf2-ARE Antioxidant System. Front Mol Neurosci. ;13 July\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaek SY, Li FY, Kim DH, Kim SJ, Kim MR (2020) Enteromorpha prolifera Extract Improves Memory in Scopolamine-Treated Mice via Downregulating Amyloid-β Expression and Upregulating BDNF/TrkB Pathway. Antioxidants 9:620\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evon Bohlen O (2018) von Bohlen und Halbach V. BDNF effects on dendritic spine morphology and hippocampal function. Cell Tissue Res 373:729\u0026ndash;741\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColucci-D\u0026rsquo;Amato L, Speranza L, Volpicelli F, Neurotrophic Factor BDNF (2020) Physiological Functions and Therapeutic Potential in Depression, Neurodegeneration and Brain Cancer. Int J Mol Sci 21:7777\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu B, Nagappan G, Lu Y (2014) BDNF and Synaptic Plasticity, Cognitive Function, and Dysfunction. pp. 223\u0026ndash;50\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen AY, Sakamoto KM, Miller LS (2010) The Role of the Transcription Factor CREB in Immune Function. J Immunol 185:6413\u0026ndash;6419\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaura CA, Valero J (2011) The role of CREB signaling in Alzheimer\u0026rsquo;s disease and other cognitive disorders. Rev Neurosci. ;22\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParamanik V, Thakur MK (2013) Role of CREB signaling in aging brain. Arch Ital Biol 151:33\u0026ndash;42\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaek SY, Kim MR (2020) Neuroprotective effect of carotenoid-rich enteromorpha prolifera extract via TrkB/Akt pathway against oxidative stress in hippocampal neuronal cells. Mar Drugs. ;18\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoo JM, Lee BD, Sok DE, Ma JY, Kim MR (2017) Neuroprotective action of N-acetyl serotonin in oxidative stress-induced apoptosis through the activation of both TrkB/CREB/BDNF pathway and Akt/Nrf2/Antioxidant enzyme in neuronal cells. Redox Biol 11:592\u0026ndash;599\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCells N, Lee BD, Yoo J, Baek SY, Li FY, Sok D et al (2019) Antioxidant Enzyme Formation via TrkB / Akt Pathway Activation for Neuroprotection against Oxidative Stress-Induced Apoptosis in Hippocampal. Antioxidants. ;:1\u0026ndash;14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBartkowska K, Paquin A, Gauthier AS, Kaplan DR, Miller FD (2007) Trk signaling regulates neural precursor cell proliferation and differentiation during cortical development. Development 134:4369\u0026ndash;4380\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrancis PT (2005) The interplay of neurotransmitters in Alzheimer\u0026rsquo;s disease. CNS Spectr. ;10 11 SUPPL. 18:6\u0026ndash;9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBirks JS, Harvey RJ (2018) Donepezil for dementia due to Alzheimer\u0026rsquo;s disease. Cochrane Database of Systematic Reviews. ;2018\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNobili F, Vitali P, Canfora M, Girtler N, de Leo C, Mariani G et al Effects of long-term Donepezil therapy on rCBF of Alzheimer\u0026rsquo;s patients\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshii, Masaru (2006) Kurachi Yoshihisa. Muscarinic acetylcholine receptors. Curr Pharm Des 12:3573\u0026ndash;3581\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePorter AC, Bymaster FP, DeLapp NW, Yamada M, Wess J, Hamilton SE et al (2002) M1 muscarinic receptor signaling in mouse hippocampus and cortex. Brain Res 944:82\u0026ndash;89\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEglen RM (2006) Muscarinic receptor subtypes in neuronal and non-neuronal cholinergic function. Auton Autacoid Pharmacol 26:219\u0026ndash;233\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark DJ (2000) The Role and the Regulation of phospholipase C. The Role and the Regulation of phospholipase C. 15:333\u0026ndash;341\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee JS, Kim HG, Lee HW, Han JM, Lee SK, Kim DW et al (2015) Hippocampal memory enhancing activity of pine needle extract against scopolamine-induced amnesia in a mouse model. Sci Rep. ;5 May\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu H, Zhang R, Zhang Y, Xia Z, Hu Y (2010) Role of CREB in the regulatory action of sarsasapogenin on muscarinic M1 receptor density during cell aging. FEBS Lett 584:1549\u0026ndash;1552\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasasuke Yoshida EM, ATP TH, SYNTHASE \u0026mdash; A, MARVELLOUSROTARY ENGINE OF THE CELL. MOLECULAR CELLBIOLOGY (2001). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/35089509\u003c/span\u003e\u003cspan address=\"10.1038/35089509\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzeto HH, Liu S, Soong Y, Wu D, Darrah SF, Cheng FY et al Mitochondria-targeted peptide accelerates ATP recovery and reduces ischemic kidney injury. Journal of the America\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"melittin, bee venom, neurodegeneration, antioxidant, Keap1, Nrf2, HO-1","lastPublishedDoi":"10.21203/rs.3.rs-4626190/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4626190/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe Nrf2/HO-1 pathway, known for its significant role in regulating innate antioxidant defense mechanisms, is increasingly being recognized for its potential in neuroprotection studies. Derived from bee venom, melittin's neuroprotective effects are raising interest. This study confirms that melittin specificity upregulated the weaken Nrf2/HO-1 signaling in mice brain. Interestingly, we also revealed melittin\u0026rsquo;s efficient tactic, as the restored redox balance alone gradually stabilized other regulations of the mouse hippocampus. Using a scopolamine-induced, a common and effective neurodegeneration model in mice, chemical analysis revealed that melittin crosses the compromised blood-brain barrier, accumulates in the hippocampus, and significantly enhances neurogenesis and cognitive function in scopolamine-induced mice. Careful observation in mice showed: first signs of changes within 5 hours after melittin administration were the restoration of the Nrf2/HO-1 system and suppresses oxidative stress. After this event, from 7 to 12.5 hours after administration were the rebalancing of inflammation, apoptosis, neurotrophic factors, cholinergic function, and mitochondrial performance. This chain reaction underscores the redox balance's role in reviving multiple neuronal functions. Evidence of enhancement in mouse hippocampus led to further exploration with hippocampal cell line HT22. Immunofluorescence analysis showed melittin-induced Nrf2 translocation to the nucleus, which would initiating the translation of antioxidant genes like HO-1. Pathway inhibitors pinpointed melittin's direct influence on the Nrf2/HO-1 pathway. 3D docking models and pull-down assays suggested melittin's direct interaction with Keap1, Nrf2/HO-1\u0026rsquo;s activator. Overall, this study not only highlighted melittin specifically effect on Nrf2/HO-1, thus, rebalancing cellular redox, but also showed that this is a effective multi-effect therapeutic strategy against neurodegeneration.\u003c/p\u003e","manuscriptTitle":"Melittin - A Main Component of Bee Venom: A Promising Therapeutic Agent for Neuroprotection through Nrf2/HO-1 Pathway Activation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-15 14:43:00","doi":"10.21203/rs.3.rs-4626190/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3183d478-9d81-4ef5-9a6c-7351f90ab96c","owner":[],"postedDate":"July 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-11-02T05:23:29+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-15 14:43:00","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4626190","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4626190","identity":"rs-4626190","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}