Sequence characteristics and expression analysis of CYP17A1 and CYP17A2 genes in Chlamys farreri

Sequence characteristics and expression analysis of CYP17A1 and CYP17A2 genes in Chlamys farreri | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Sequence characteristics and expression analysis of CYP17A1 and CYP17A2 genes in Chlamys farreri Xiaoling Liu, Han Yun, Xuejiao Mu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3089889/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract CYP17A1 and CYP17A2 genes are members of the CYP17 subfamily and belong to the P450 superfamily. This study analyzed the sequences of Chlamys farreri ( C. farreri ) CYP17A1 and CYP17A2 , found that the CYP17A1 coding sequence (CDS) is 1287 bp, encoding 428 amino acids, and the CYP17A2 coding sequence is 1512 bp, encoding 503 amino acids. The two genes both contain three conserved regions: the Ozols' tripeptide region, the heme binding region, and the Ono sequence which is unique to CYP17 subfamily, and these regions are conserved in different species by the homology analysis of multiple amino sequence. Semi-quantitative RT-PCR (SqRT-PCR) showed that CYP17A1 was strongly expressed in the kidney and hepatopancreas of females, strongly expressed in the hepatopancreas of males, and weakly expressed in other tissues. CYP17A2 was strongly expressed in the kidney and gill of females, in the adductor muscle, kidney, gill and testis of males, weakly expressed in other tissues. The wide expression of CYP17A1 and CYP17A2 in C. farreri suggest that they may play multiple roles in different tissues.Using real-time fluorescent quantitative PCR (qPCR), the expression during gametogenesis was detected , CYP17A1 was expressed highest at the ovarian growth stage., it was considered the gene may play a role in oocytes growth, furthermore, we speculated that the gene may affect oocyte growth by participating in production of estradiol. CYP17A1 expression increased with the testis development, which implied this gene may be involved in the testosterone’ production. CYP17A2 expressed highest in testis at mature stage, it was believed that this gene may affect sperm excretion and motility by participating in pregnancy hormones production. CYP17A2 expressed higher in the ovary at mature stage than other stages, it is speculated that this gene may play a role in oocytes maturation by participating in 17α, 20β-DP (17α, 20β-dihydroxy-4-pregnen-3-one, DHP, a kind of progesterone) production. Chlamys farreri CYP17A1 CYP17A2 sequence characteristics expression Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Introduction Cytochrome P450c17 ( CYP17 ) was first identified in humans ( Homo sapiens ) (Chung er al. 1987). Subsequently, CYP17 genes of other species such as pig ( Sus scrofa ) (Tremblay et al. 1994), horse ( Equus caballus ) (Choi et al. 1996) , chicken ( Gallus gallus ) (Ono et al. 1988) and so on were cloned. With the development of research, the previous idea that only one kind P450c17 existed in mammals and fish had been replaced, Zhou et al. (2007b) discovered a new clone of P450c17 in Nile tilapia ( Oreochromis niloticus ) and medaka ( Oryzias latipes ), named it P450c17-II ( CYP17A2 ). Afterwards, two different encoded CYP17A1 and CYP17A2 were detected in some bony fishes such as zebrafish ( Danio rerio ), Nile tilapia, and flounder ( Paralichthysolivaceus ) (Jin et al. 2012; Meng et al. 2019). Some researchers thought that the two CYP17A genes formed in fish because genomes had undergone two whole-genome duplications in their evolutionary history, called the 2-round hypothesis, but this speculation still needs to be supported by further experimental evidence. (Ohno. 1970; Amores et al. 1998; Hoegg et al. 2004; Wang and Ge. 2004; Meyer and Peer. 2005; Zhou et al. 2007) CYP17 is one of the most critical enzymes in steroid hormones production of vertebrate (Chen and Wen. 2012). Many studies have shown that CYP17 gene is expressed in both female and male gonads, indicating that this gene is not specific to male or female development, but has functions in development of both female and male gonads, and the function may be different (Yu et al. 2003). In the testis of humans, if the CYP17 enzyme activity is absent, androgen content will be insufficient, which further leads to cessation of testicular development and the absence of the penis and scrotum (Cao. 2016). Iwade et al . (2008) detected the CYP17 expression in rough-skinned frog ( Ranarugosa ), found that the expression in male individuals gradually increases with individual development, and the androgen content increases significantly during sex differentiation, indicating that CYP17 may participate in androgen production, and indirectly participate in sex differentiation process. Sex hormones also play an important role in ovary. In mammals, CYP17 gene mutations may lead to a variety of sex hormone-related disorders, such as polycystic ovary syndrome (PCOS) and endometriosis (EMS) (Cadagan et al. 2016). Rangel et al . (2007）have found that in the laying hen ovary ( Gallus domesticus ), androgens can affect the early growth and development of follicles, as well as the normal ovulation process by affecting the production of progesterone in granulosa cells. In addition, the CYP17 gene is also involved in glucocorticoids production, and when the gene is impaired, glucocorticoid levels will decrease, leading to diseases such as 17α hydroxylase/17, 20-carbon chain lyase deficiency (17OHD) (Xiao and Li. 2019). The deletion of the CYP17 gene will lead to a decrease in human corticosteroids and sex steroid hormones, sexual maturity is eventually delayed (Kater and Biglieri. 1994; Yanase. 1995). In fish, CYP17A1 has 17α hydroxylase and 17, 20 lyase activities, while CYP17A2 only has 17α hydroxylase activity (Wang. 2016). Zhou et al . (2007b) found that CYP17A2 gene was responsible for the production of C-21 steroids such as 17α-20β-DP (17α, 20β-dihydroxy-4-pregnene-3-one) and cortisol in a related study on Nile tilapia. Later, some researchers have analyzed gene expression profiling of medaka oocytes 48 hours before spawning by in situ hybridization, and the result showed that the CYP17A2 is responsible for the production of 17α-2 0β-DP and Cortisol in head and kidney during the maturation of medaka oocytes (Ozols et al. 1981; Sakai et al. 1992). These studies preliminary revealed the possible function of the CYP17A2 gene in fish, and provided an experimental basis for the study of this gene in fish. In invertebrates, the relevant studies on CYP17A1 were few. Guo et al. (2013) detected the CYP17A1 expression in the gonads developmental cycle of sea urchin ( Strongylocentrotus intermedius ), and found that CYP17A1 was widely expressed, and was expressed significantly higher in male gonads than in females, the researchers speculated that CYP17A1 may play an important role in male gonads, but the mechanism is unknown and needs to be further explored. Thitiphuree et al . (2018) detected the expression of CYP17A1 in gonadal tissues at the early stage of cell differentiation in the Yesso scallop ( Mizuhopecten yessoensis ), and found that CYP17A1 is widely expressed in different tissues. Four members of CYP17s are found in the common hydra ( Hydra vulgaris ) (Nelson. 2009), and six members are found in sea urchin ( Strongylocentrotus purpuratus ) (Goldstone et al. 2006), multiple members were found in the Pacific oyster ( Crassostrea gigas ). But the above studies are all derived from data analysis only after omics sequencing, no specific investigations are on expression patterns and functions of related genes. The C. farreri is sex-stable, and the distinction between male and female individuals is obvious, these characteristics make it possible to study the genes related to gonadal development in C. farreri. C. farreri is an economically shellfish with high nutritional value, the research on genes related to gonadal development can provide a theoretical basis for practice, and lay a theoretical foundation for the reproduction efficiency improving to a certain extent (Qin. 2011). 1 Materials and methods 1.1 Tissue identification of different gonad development stage in C. farreri Healthy scallops C. farreri were purchased from the seafood market near Yantai University, and tissue samples were dissected after 24 h rearing in the filtered seawater, the gonads were first fixed with Bouin’s solution and then identified by tissue sectioning (Fig. 1), were grouped into three development stages (proliferative stage, growing stage and mature stage) (Liu et al. 2018). 5 males and 5 females at the same developmental stages were selected, and different tissues (including gonads, gills, liver and pancreas, kidneys, mantles, and adductor muscle) were snap-frozen in liquid nitrogen and stored at －80℃ in the refrigerator for RNA extraction. 1.2 Total RNA extraction and cDNA synthesis Total RNA was extracted from various tissues using guanidine isothiocyanate method (reagent, Sangon Biotech, Shanghai, China) (Takase et al. 2000). The extracted RNA was tested by NanoDrop ND-2000 ultra-micro spectrophotometer, and the integrity of the extracted RNA was tested by agarose gel electrophoresis. The reverse transcription reaction used mRNA as the template which separated from total RNA, and RT Primer Mix were used to reverse transcribe into cDNA by reverse transcriptase. cDNA was synthesized using Evo M-MLV kit (Invitrogen, TakaRa, Beijing, China) and stored in the refrigerator at －20°C for later use. 1.3 Sequence characteristics of CYP17A1 and CYP17A2 The gene sequences were obtained from early transcriptome sequencing in our laboratory (unpublished), and some researchers also directly used sequence obtained by omics sequencing to analyze the sequence and expression pattern, for example, Li et al . (2020) used the omics sequence to directly analyze the Dmrt1 gene sequence and expression pattern of C. farreri . Homologous sequence comparison was performed using Clustal X and DNAman. Phylogenetic analysis was conducted based on Neighbor-Joining (NJ) method using MEGA4. The protein 3D structures of the two genes were predicted using Swiss-Model homology modeling server. 1.4 Semiquantitative RT-PCR In this experiment, 3 different individual samplesfor each tissue were extracted., and the corresponding RNA samples were mixed proportionally for the subsequent experiments. Primer designed in the non-conserved region. Tissue distributions of CYP17A1 and CYP17A2 in C. farreri tissues were analyzed using SqRT-PCR with specific primers P1 and P2, P3 and P4 (shown in Table 1). The PCRs were standardized using β-actin (GenBank accession no. AY335441) primers as A3, A4 (shown in Table 1), PCR amplifications in 20 μl aliquots were performed by denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 30 s; 33 cycles for CYP17A1 and 23 cycles for β-actin , PCR amplifications in 20 μl aliquots were performed by denaturation at 94°C for 30 s, annealing at 58.2°C for 30 s, extension at 72°C for 30 s; 33 cycles for CYP17A2 and 23 cycles for β-actin , The PCR was repeated twice. The PCR products were detected by gel electrophoresis and photographed. Tab. 1 Primer sequences used in this experiment Primer Sequence（5′→3′） Usage P1 CCAAGTAGCCGATTCAAAAAAGTGT Semi-quantitative and quantitative fluorescence PCR of CYP17A1 gene P2 TCCAGCAAAGAAAATGTCAGCA Semi-quantitative and quantitative fluorescence PCR of CYP17A1 gene P3 GATGTGGACGATGCTTTTCTC Semi-quantitative and quantitative fluorescence PCR of CYP17A2 gene P4 TGTTTTGCCTGTTGCTGTTC Semi-quantitative and quantitative fluorescence PCR of CYP17A2 gene A3 TTCTTGGGAATGGAATCTGC β-actin reference gene A4 GCCAGACTCGTCGTATTCCT β-actin reference gene 1.5 Quantitative real-time PCR Expression of CYP17A1 and CYP17A2 mRNA in gonads during the reproductive cycle was detected using qRT-PCR with the specific primers P1 and P2, P3 and P4, β-actin primers A3 and A4 (shown in Table 1). The reactions were carried out using a SYBR Green Real-Time PCR Master Mix ((Invitrogen, TakaRa, Beijing, China) and the ABI 7500Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Data from triplicate analyses for each gonad sample were analyzed using the ABI 7500 system SDS software version 1.4 (Applied Biosystems) with automati-cally set baseline and cycle threshold values. The 2 –ΔΔCt method was used to analyze the mRNA expression level of CYP17A1 and CYP17A2 . All data are presented as the mean±SEM from five samples. Differences were tested using one-way analysis of variance followed by least significant difference tests (SPSS software version 12.0; SPSS Inc., Chicago, IL, USA) with a significance level set at p <0.05 (Liu et al. 2012). 2 Results 2.1 Tissue identification of different gonad development stage in C. farreri According to the morphologic characteristics described by Liao et al . (1983), the development of the gonads (ovaries and testes) can be classified into 3 stages based on histological structure (Fig. 1). In Figures 1.1 and 1.4, only one or two layers of germ cells are formed on the follicular walls in the testes and ovaries, indicating that the scallop gonads had entered the proliferative stage; Obvious follicular cavities can be observed in Figure 1.2 and Figure 1.5, and multiple layers of germ cells have been formed on the follicular wall, indicating that the gonads of scallops have entered the growing stage; in Figure 1.3 and Figure 1.6, the follicular cavities of the testes and ovaries were full of germ cells, and a large number of sperms appeared in the testis, and the mature eggs in the ovary are squeezed into an irregular shape, indicating that the scallop gonads had entered the mature stage (Liao et al. 1983). 2.2 Classification of CYP17A1 and CYP17A2 genes of C. farreri The conserved region of Ono sequence was the characteristic sequence of CYP17 family, the Ono conserved region multiple alignment of CYP17A1 and CYP17A2 proteins from different species showed that there were different sites. As shown in the black box in Figure 2, the second site within the conserved region of the Ono sequence was D (aspartate) for CYP17A1 and E (glutamate) for CYP17A2 , and the sixteenth amino acid site in this conserved region was all L (leucine) for CYP17A2 in different species. According to these different sites features, the two similar genes of C. farreri were distinguished and classified as CYP17A1 and CYP17A2 . 2. 3 Sequence analysis and alignment of CYP17A1 and CYP17A2 in C. farreri The CYP17A1 CDS was 1287 bp long and encodes 428 amino acids, and the CYP17A2 CDS was 1512 bp and encodes 503 amino acids, both the two genes contained obvious characteristics of the cytochrome P450 gene family. There were three conserved regions, named the Ono sequence, the Ozols' tripeptide region and the heme binding region, and the 3 conserved regions were marked in the box in figure 3 and figure 4. The multiple sequence alignment results showed that the CYP17A1 protein and CYP17A2 protein of C. farreri is consistent with the conserved regions of mammals, amphibians, fish and mollusks, and there were also 3 conserved regions (marked in Figure 5 and Figure 6). As shown in the red box marked in Figure 5, the sixth and eighth positions in the CYP17A1 and CYP17A2 heme conserved region contained the conserved arginine (Arg, R) and cysteine (Cys, C), two sites were necessary for the P450 family to exert heme activity. 2. 4 Phylogenetic analysis of CYP17A1 protein in C. farreri The phylogenetic analysis results showed that the CYP17A1 protein of C. farreri first clustered with the scallop, and then clustered with the Pacific oyster ( Crassostrea gigas) and sea snail ( Aplysia californica) , finally clustered with CYP17A1 proteins of other species (Figure 7). The phylogenetic relationship was basically consistent with the taxonomic status of the species. CYP17A2 had only been studied in some fish and was absent in other animals up to now, therefore it was not meaningful to perform phylogenetic analysis of CYP17A2 proteins from different species. 2. 5 Three-dimensional structure prediction of CYP17A1 and CYP17A2 proteins in C. farreri The three-dimensional structure of Chlamys farreri CYP17A1 and CYP17A2 protein prediction results showed that the proteins all contains the conserved region Ono sequence, the Ozols' tripeptide region and the heme region (Figure 8 and Figure 9). 2. 6 Tissue expression characteristics of CYP17A1 and CYP17A2 in C. farreri CYP17A1 and CYP17A2 were all widely expressed in different tissues of C. farreri. CYP17A1 was strongly expressed in the kidney and hepatopancreas in female individuals, weakly expressed in the adductor muscle, mantle, gill and ovary (Figure 10B); it was strongly expressed in the hepatopancreas of male individuals, and weakly expressed in the adductor muscle, mantle, kidney, gill and testis (Figure 10A). In female, CYP17A2 was strongly expressed in kidney and gill tissues, but weakly expressed in the adductor muscle, mantle, hepatopancreas and ovary tissues (Figure 10D). In male individuals, CYP17A2 was strongly expressed in the adductor muscle, kidney, gill, and testis, while the expression level in the mantle and hepatopancreas was slightly lower (Figure 10C). 2. 7 Expression of CYP17A1 and CYP17A2 during gonad developmental cycles in C. farreri During ovarian development, the CYP17A1 expressed highest at growth stage, about seven times higher than that at proliferative and mature stage. In the testis, the expression level exists in the whole development cycle, and increased non-significantly with the testis development. 3 Discussion 3.1 Sequence analysis and alignment of CYP17A1 and CYP17A2 in C. farreri CYP17 belongs to the P450 gene family, CYP17 protein conserved regions include the Ono sequence, the Ozols' tripeptide region and the heme binding region. The Ozols' tripeptide region and heme binding region belong to the common conserved region of the P450 family members (Jin et al. 2012), while the Ono sequence conserved region is a characteristic sequence of the CYP17 subfamily. In this study, we compared CYP17A1 and CYP17A2 of different species, and found the site-specific differences in the Ono conserved region between this two genes for the first time, we concluded that at the second amino acid position in the Ono sequence, all amino acids corresponding to CYP17A1 were D (aspartic acid), and all amino acids corresponding to CYP17A2 were E (glutamic acid); at the sixteenth position in the Ono sequence, all amino acids corresponding to CYP17A2 are L (leucine). The CYP17A1 and CYP17A2 of C. farreri have the three conserved regions above-mentioned, which were confirmed by the three-dimensional structure prediction. The Ono sequence is the characteristic sequence of CYP17A, the Ozols' tripeptide region is responsible for binding to steroids, and the heme binding region is the binding site for heme iron. In the heme binding region, CYP17A1 and CYP17A2 of different species contain both the conserved arginine (Arg, R) and cysteine (Cys, C) in the sixth and eighth positions of the conserved region of ferrous heme, and some researchers have shown that these two sites are necessary for the P450 family to play an active of heme (Li et al. 2017). The CYP17A1 and CYP17A2 of C. farreri are consistent with the conserved regions of other species. 3.2 Expression of CYP17A1 and CYP17A2 Researchers have found that CYP17 was expressed in steroid-producing tissues such as gonads, head and kidney in cartilaginous fish and bony fish (Sakai et al. 1992; Trant. 1995; Kazeto et al. 2000; Halm et al. 2003; Wang et al. 2004), in addition, CYP17 had also been found in other non-classical steroid-producing tissues of fish, such as brain (Halm et al. 2003; Yu et al. 2003) gastrointestinal tract, liver and gill (Wang et al. 2004); Chen et al . (2010) detected the CYP17A1 expression in female half smooth tongue sole ( Cynoglossus semilaevis ) and found that the gene was expressed in ovary, brain, head kidney, stomach, intestine, gill, spleen, and kidney tissues to different degrees (Meng et al. 2019). Wang et al . (2004) also detected CYP17A1 be expressed in the gill, kidney, brain, intestine, and liver of zebrafish. The above studies show that CYP17A1 was widely expressed in fish and plays a role in different tissues. Our semiquantitative PCR results showed that CYP17A1 and CYP17A2 was widely expressed in different tissues of C. farreri , especially in the kidney and hepatopancreas in female, hepatopancreas in male. Thitiphuree et al . (2018) also found the CYP17A1 was expressed widely and variously in Yesso scallop, its expression level was relatively high in the kidney and low in the mantle, gill and gonad (Thitiphuree et al. 2018), is the expression pattern was generally consistent with our results, also similar to mammals and fish, it indicated that CYP17A1 may be not only involved in steroid hormones production, but also affect other physiological processes such as lipid metabolism or detoxification. Zhang et al . (2018) detected the expression of CYP17A2 gene in female Naked Carps ( Gymnocypris przewalskii ) brane, found the gene was expressed in ovary, ovarian membrane, brain, muscle and hepatopancreas, the researcher suggested that CYP17A2 gene plays different physiological functions in different tissues of Naked Carps. In addition, the CYP17A2 gene was found also widely expressed in zebrafish, Wang and Ge (2004) found that CYP17A2 was all expressed in gonad, kidney, brain, gill, intestine, and hepatopancreas tissues of zebrafish. Some researchers suggested that the expression of CYP17A2 gene in the head kidney tissue of medaka is caused by the involvement of CYP17A2 gene in the production of cortisol (Zhou et al. 2007b). The widespread expression of CYP17A2 gene in C. farreri was similar to that of Naked Carps and zebrafish, indicating that CYP17A2 gene plays physiological functions in different tissues of C. farreri . However, there were few rasearch on the tissue expression of CYP17A2 gene, which needs to be further studied. The expression patterns of CYP17A1 and CYP17A2 during the ovarian development cycle of C. farreri showed that CYP17A1 was highest expressed at growth stage, significantly higher than that at the other two stages, while CYP17A2 was highest expressed at maturation stage. Nagahama et al . (1985, 1997) concluded that in the ovaries of bony fish, estrogen (E2) is necessary for oocyte growth (mainly the process of yolk production), and 17α, 20β-DP (DHP) is necessary for the final maturation of oocytes, DHP is the progesterone in most fishes, and researchers thought that DHP is also called gamete maturation inducing hormone (MIH). Zhou et al. (2007a) detected that the CYP17A1 expression during the development cycle tilapia ( Oreochromis mossambicus ) by immune system analysis and quantitative analysis, the result showed that the gene was mainly expressed at the early and middle stages of vitellogenesis, indicating that CYP17A1 is mainly required for oocyte growth, presumably caused by the involvement of the CYP17A1 gene in estrogen production (Zhou et al. 2007a). The CYP17A1 expression decreased during oocyte maturation, while the CYP17A2 expression peaked at maturation (Zhou et al. 2007a). The researcher believed that this phenomenon at maturation stage indicated a shift in steroid hormone production from estrogen to 17α, 20β-DP (Zhou et al. 2007a). So the CYP17A1 expression which mentioned by Zhou (Zhou et al. 2007a) is expressed mainly in the early and middle stages of vitellogenesis in tilapia may be considered that the CYP17A1 is expressed mainly in the growth stage. The above expression characteristics are consistent with the expression pattern of CYP17A1 gene in C. farreri , besides the changes of oocytes during the growth period of C. farreri are mainly the formation and accumulation of yolk (Liao et al. 1983). This suggests that the regulation of CYP17A1 activity may be a major factor at ovarian development stage, and CYP17A2 may be important to the final mature stage, and that CYP17A1 and CYP17A2 work together in the transition from estradiol to 17α, 20β-DP. It is speculated that CYP17A1 and CYP17A2 genes may also participate in the growth and maturation process of C. farreri oocytes. A few papers have speculated sex steroid biosynthesis exist in mollusks and these sex steroids play roles in reproduction (Lafont et al. 2007; Fernandes et al. 2011). Thitiphuree et al . (2018) hypothesized that CYP17A1 may be an important gene involved in sex steroid biosynthesis in Yesso scallop. The expression patterns of CYP17A1 and CYP17A2 during the testis development cycle of C. farreri showed that CYP17A1 was continuously expressed and expressed nonsignificantly increase during the development, while CYP17A2 was expressed significantly increase at maturation stage than other stage. Guo et al . (2013) detected the CYP17A1 expression in the gonadal development of sea urchins ( strongylocentrotus intermedius ) using semiquantitative PCR, found that the gene was expressed in both gender, and the expression increased with the testis development, which was positively correlated with the male gonadal development, suggesting that the CYP17A1 gene plays a role in the male gonad. This is consistent with the expression of CYP17A1 during testis development in C. farreri , it is speculated that this gene is also involved in the development of testis in C. farreri . Liu et al . (2014) found that testosterone levels during the gonadal development cycle in C. farreri gradually increased with gametogenesis and peaked at maturity, this study speculated that the reason for the non-significant elevation of the CYP17A1 gene with spermatophore development may be due to the involvement of this gene in steroid hormone production, and the specific mechanism of action needs to be supported by more experimental data. The CYP17A2 was highest expressed at mature stage and significantly higher than that at proliferative and growing stages, Chen et al . (2014) found that CYP17A2 gene was highest expressed at the late mature stage during the development of zebrafish testis, which is consistent with the our CYP17A2 expression in C. farreri . Yang et al . (2019) found CYP17A2 was most expressed in mature testis during the gonadal developmental cycle of Nile tilapia by semi-quantitative PCR analysis. The quality of the sperm with homozygous mutation of CYP17A2 was evaluated by sperm quality analyzer, the results showed the motility of mutagenic sperm was affected, the amount of forward-moving sperm decreased and the amount of inactive sperm increased, progesterone is important in male fish for sperm production and excretion as well as sperm viability, and the CYP17A2 is involved in progesterone production in fish, therefore, the gene probably affects sperm development by affecting progesterone production in the maturation stage of Nile tilapia. Our study believes that the CYP17A2 gene may play a similar role in testis of C. farreri , perhaps both CYP17A1 and CYP17A2 can play a role in sex hormone production in C. farreri , but the specific mechanism needs to be further explored. In conclusion, CYP17A1 and CYP17A2 genes are involved in the gonadal development of C. farreri, in ovary, they respectively play a role in oocyte growth and maturation, in testis, CYP17A1 gene may be involved in the testosterone production, and CYP17A2 gene may have an impact on the vitality and excretion of mature sperm by participating in the formation of progesterone DHP. Compared with vertebrates, the mechanism of CYP17A1 and CYP17A2 genes in mollusks is not clearly studied, there is still much explore space especially on the functions of CYP17A1 and CYP17A2 in mollusks to study. Declarations Acknowledgments This work was supported by Shandong Natural Science Foundation (ZR2022MC126). Data availability The authors declare that the data supporting the findings of this study are availability within the article in the form of tables and figures. Competing interests The authors declare no competing interests. Ethical Approval This text does not require ethical consent. Contributions Xiaoling Liu designed the experiments and wrote and revised the article. Han Yun analyzed the data and wrote the article. Xuejiao Mu performed the experiments and wrote the article. References Amores, A., Force, A., Yan, Y., Joly, L., Ekker, M., 1999. Postlethwait jh: zebra sh hox clusters and vertebrate genome evolution. Am Zoo, 39 (5), 15A-15A. Bonnet, X., Naulleau, G., Mauget, R., Shine, R., 1994. The influence of body condition on 17-betaestradiol levels inrelation to vitellogenesis in female vipera aspis ( Reptilia, Viperidae ). Gen Comp Endocr, 93 (3), 424-437. Chung, B. C., Picado-Leonard, J., Haniu, M., Bienkowski, M., Hall, P. F., Shively, J.E., Miller, W.L., 1987. Cytochrome P450c17 (steroid 17 alpha-hydroxylase/17, 20lyase): cloning of human adrenal and testis cDNAs indicates the same gene is expressed in both tissues. P Nat Acad Sci USA, 84 (2), 407-411. Choi, I., Simmen, R. C., Simmen, F. A., 1996. Molecular cloning of cytochrome P450 aromatase complementary deoxyribonucleic acid from periimplantation porcine and equine blastocysts identifies multiple novel 5'-untranslated exons expressed inembryos endometrium and placenta. Endocrinology, 137 (4), 1457-1467. Custodia-Lora, N., Novillo, A., Callard, I. P., 2004. Regulation of hepatic progesterone andestrogen receptors in the female turtle, Chrysemys Picta: Relationship to vitellogenesis. Gen Comp Endocr, 136 (2), 232-240. Chen, C. F., Wen, H. S., Wang, Z. P., He, F., Zhang, J. R., Chen, X. Y., Jin, G. X., Shi, b., Shi, D., Yang, Y. P., 2010. Cloning and expression of P450c17-I (17α-hydroxylase/17,20-lyase) in brain and ovary during gonad development in Cynoglossus semilaevis . Fish Physiol Biochem, 36 (4), 1001-1012. Chen, C. F., Wen, H. S., 2012. The characteristic analysis of P450c17s mRNA expression during the reproductive cycle in male Cynoglossus semilaevis Günther. Journal of Fisheries of China, 36 (07), 1019-1025 (in Chinese). Chen, X. H., 2014. Studies on the expression of a few kinds of CYP genes in the different phases of gonad development in Zebrafish. Dissertation, Dalian Ocean University (in Chinese). Cao, H. M., 2016. The association study between CYP17A1 , CYP19 gene polymorphisms and male infertility in Henan Han Chinese population. Dissertation, Zhengzhou University (in Chinese). Cadagan, D., Khan, R., Amer, S., 2016. Thecal cell sensitivity to luteinizing hormone andinsulin in polycystic ovarian syndrome. Reprod Biol, 16 (1), 53-60. Fernandes, D., Loi, B., Porte C., 2011. Biosynthesis and metabolism of steroids in molluscs [J]. J Steroid Biochem Mol Biol, 127, 189-195. Gavaud, J., 1986. Vitellogenesis in the lizard lacerta vivipara jacquin. II. Vitellogenin synthesis during the reproductive cycle and its control by ovarian steroids. Gen Comp Endocr, 63 (1), 11-23. Goldstone, J. V., Hamdoun, A., Cole, B. J., Howard-Ashby, M., Nebert, D. W., Scally, M., Dean, M., Epel, D., Hahn, M. E., Stegeman, J.J., 2006. The chemical defensome: Environmental sensing and response genes in the Strongy locentrotus purpuratus genome. Dev Bio, 300 (1), 366-384. Guo, X. L., Qiu, X. M., Chang, Y. Q., Zhang, W. J., Cui, J., Cong, Y. T., Wu, L. Z., Liu, Y., Wang, X. L., 2013. Cloning and differential expression of CYP17 gene in sea urchin Strongylocentrotus intermedius. J Dalian Fish Univ, 28 (01), 1-6 (in Chinese). Hoegg, S., Brinkmann, H., Taylor, J. S., Meyer, A., 2004. Phylogenetic timing of the fish specific genome duplication correlates with the diversification of teleost fish. J Mol Evol, 59 (2), 190-203. Halm, S., Kwon, J. Y., Rand-Weaver, M., Sumpter, J. P., Tyler, C. R., 2003. Cloning and gene expression of P450 17α-hydroxylase, 17, 20-lyase cDNA in the gonads and brain of the fathead minnow Pimephales promelas . Gen Comp Endocr, 130 (3), 256-266. Iwade, R., Maruo, K., Okada, G., Nakamura, M., 2008. Elevated expression of P450c 17 ( CYP 17 ) during testicular formation in the frog. Gen Comp Endocr, 155 (1), 79-87. Jin, G. X., Wen, H. S., He, F., Li, J. F., & Cai, F. C., 2012. Molecular cloning, characterization expression of P450c17-I and P450c17-II and their functions analysis during the reproductive cycle in males of barfin flounder ( Verasper moseri ). Fish Physiol Biochem, 38 (3), 807-817. Kater, C.E., Biglieri, E.G., 1994. Disorders of steroid 17-alpha-hydroxylase deficiency. Endcrin Metab Clin, 23 (2), 341-357. Kazeto, Y., Ijiri, S., Todo, T., Adachi, S., Yamauchi, K., 2000. Molecular cloning and characterization of Japanese eel ovarian P450c17 ( CYP17 ) cDNA. Gen Comp Endocrinol, 118 (1), 123-133. Kobayashi, D., Tanaka, M., Fukada, S., & Nagahama, Y. (1996). Steroidogenesis and ovarian follicles of the medaka ( Oryzias latipes ) during vitellogenesis and oocyte maturatIon. Zoolog Sci, 13 (6): 921–927. Liu, M., 2009. Relationship between endometriosis and polymorphisms of CYP17, CYP1A2 , CYP3A4 and COMT gene. Dissertation, Hebei Medical University (in Chinese). Liu, X. L., Liu, J., Wang, Z. D., Wang, Z. H., Li, Y. S., Cui, L. B., 2018. Necessity of foxl2 in the oogenesis of the scallop Chlamys farreri. Marine Sciences, 42 (04), 127-131 (in Chinese). Li, Q. Q., Qin, Z. K., Wei, M. K., Zhang, Z. F., 2020. Molecular identification and expression pattern analysis of Dmrt 1 in the scallop Chlamys farreri . Journal of Fishery Sciences of China, 27 (11), 1277-1284 (in Chinese). Liao, C. Y., Xu, Y. F., Wang, Y. L., 1983. Reproductive cycle of the scallop Chlamys farreri . Journal of Fisheries China, 7 (1), 1-13 (in Chinese). Li, Y., Sun, X., Hu, X., Xun, X., Zhang, J., Guo, X., Jiao, W., Zhang, L., Liu, W., Wang, J., 2017. Scallop genome reveals molecular adaptations to semi-sessile life and neurotoxins. Nat Commun, 8 (1), 1721. Liu, J., Zhang, Z., Zhang, L., Liu, X., Yang, D., Ma, X., 2014. Variations of estradiol-17β and testosterone levels correlated with gametogenesis in the gonad of Zhikong scallop ( Chlamys farreri ) during annual reproductive cycle. Canadian journal of zoology, 92 (3), 195-204. Liu, X. L., Zhang, Z. F., Shao, M. Y., Liu, J. G., Muhammad, F., 2012. Sexually dimorphic expression of foxl2 during gametogenesis in scallop chlamys farreri , conserved with vertebrates. Dev Genes Evol, 222 (5), 279-286. Lafont, R., Mathieu, M., 2007. Steroids in aquatic invertebrates. Ecotoxicology, 16, 109-130. Meng, L. H., Yu, H. Y., Qu, J. B., Niu, J. J., Ni, F. F., Han, P., Yu, H. Y., Wang, X. B., 2019. Two CYP17 genes perform different functions in the sex hormone biosynthesis and gonadal differentiation in Japanese flounder ( Paralichthys olivaceus ). Gene, 702, 17-26. Meyer, A., Peer, Y. V. D., 2005. From 2R to 3R: evidence for a fish specific genome duplication (FSGD). Bioessays, 27 (9), 937-945. Nelson, D. R., 2009. The cytochrome P450 homepage. Hum Genomics. 4, 59-65. Nagahama, Y., 1997. 17alpha, 20beta-dihydroxy-4-pregnen-3-one, a maturaTioninducing hormone in fish oocytes: Mechanisms of synthesis and action. Steroids, 62 (1), 190-196. Nagahama, Y., Adachi, S., 1985. Identification of maturation-inducing steroid in a teleost, the amago salmon (Oncorhynchus rhodurus) . Dev Biol, 109 (2), 428-435. Ono, H., Iwasaki, M., Sakamoto, N., Mizuno, S., 1988. cDNA cloning and sequence analysis of a chicken gene expressed during the gonadal development and homologous to mammalian cytochrome P-450c17. Gene, 66 (1), 77-85. Ohno, S., 1970. Evolution by gene duplication. Springer-Verlag, Berlin. Ozols, J., Heinemann, F. S., Johnson, E. F., 1981. Amino acid sequence of an analogous peptide from two forms of cytochrome P-450. Biol Chem, 256 (22), 11405-11408. Qin, Z., Li, Y., Sun, D., Shao, M., Zhang, Z., 2012. Cloning and expression analysis of the vitellogenin gene in the scallop Chlamys farreri and the effects of estradiol‐17β on its synthesis. Invertebrate Biology, 131 (4), 312-321. Rangel, P. L., Rodríguez, A., Gutierrez, C. G., 2007. Testosterone directly induces progesterone production and interacts with physiological concentrations of LH to increase granulosa cell progesterone production in laying hens ( Gallus domesticus ). Anim Reprod Sci, 102 (1), 56-65. Sakai, N., Tanaka, M., Adachi, S., Miller, W. L., Nagahama, Y., 1992. Rainbow trout cytochrome P-450c17 (17alpha-hydroxylase/17,20-lyase) cDNA cloning, enzymatic properties and temporal pattern of ovarian P-450c17 mRNA expression during oogenesis. Febs Lett, 301 (1), 60-64. Tremblay, Y., Fleury, A., Beaudoin, C., Vallée, M., Bélanger, A., 1994. Molecular cloning and expression of guinea pig cytochrome P450c17 cDNA (steroid 17alpha-hydroxylase/17,20lyase): tissue distribution, regulation, and substrate specificity of the expressed enzyme. DNA Cell Biol, 13 (12), 1199-1212. Tao, H., Lu, Z. L., 2003. Gene symbol: CYP17A1 . Disease: 17-alpha-hydroxylase/17, 20-lyase deficiency. Hum Genet, 113 (4), 369-369. Takase, M., Noguchi, S., Nakamura, M., 2000. Two Sox9 messenger RNA isoforms: isolation of cDNAs and their expression during gonadal development in the frog Rana rugosa. Febs Lett, 466 (2-3), 249-254. Trant, J. M., 1995. Isolation and characterization of the cDNA encoding the spiny dogfish shark ( Squalus acanthias ) form of cytochrome P450c17. Exp Zool, 272, 25-33. Thitiphuree, T., Nagasawa, K., Osada, M., 2018. Molecular identification of steroidogenesis related genes in scallops and their potential roles in gametogenesis. J Steroid Biochem Mol Biol, 186, 35-72. Vogeler, S., Galloway, T. S., Lyons, B. P., Bean, T. P., 2014. The nuclear receptor gene family in the Pacific oyster, Crassostrea gigas , contains a novel subfamily group. Bmc Genomics, 15 (1), 369. Wang, Y. J., Ge, W., 2004. Cloning of zebrafish ovarian p450c17 (cyp17,17alphahydroxylase/17, 20-lyase) and characterization of its expression in gonadal and extra-gonadal tissues. Gen Comp Endocr, 135 (2), 241-249. Wang, W. W., 2016. Bioinformatics analysis of CYP17A2 in Nile tilapia and differences of expression in gonads. J Anhui Agric Sci, 44 (07), 103-106 (in Chinese). Xiao, S.Y., Li, R., 2019. Advances in the study of 17α hydroxylase/17, 20 carbon chain cleavage enzyme deficiency. J Mod Med Health, 35 (16), 2504-2507. Yu, H., Cheng, H. H., Guo, Y. Q., Xia, L. X., Zhou, R. J., 2003. Alternative splicing and differential expression of P450c17 ( CYP17 ) in gonads during sex transformation in the rice field eel. Biochem Biophys Res Commun, 307 (1), 165-171. Yanase, T., 1995. 17 alpha-Hydroxylase/17, 20-lyase defects. J Steroid Biochem Mol Biol, 53(1-6), 153-157. Yang, L.Y., 2019. Study on the Roles of CYP17A2 in steroidgenesis and gametogenesis in Nile tilapia. Dissertation, Southwest University (in Chinese). Zhou, L. Y., Wang, D. S., Shibata, Y., Paul-Prasanth, B., Suzuki, A., 2007a. Characterization, expression and transcriptional regulation of P450c17-I and P450c17-II in the medaka, Oryzias latipes . Biochem Biophys Res Commun, 362 (3), 619-625. Zhou, L. Y., Wang, D. S., Kobayashi, T., Yano, A., Paul-Prasanth, B., Suzuki, A., Sakai, F., Nagahama, Y., 2007b. A novel type of P450c17 lacking the lyase activity is responsible for C21-steroid biosynthesis in the fish ovary and head kidney. Endocrinology, 148 (9), 4282-4291. Zhang, X., Wei, F. L., Zhang, Y., Wei, W., Zhu, F. X., Wang, Y. Q., Li R. H., Han, B. Y., Liu, X. H., Qian, K. K., Wu, J., Zhu, S. H., Li, C. Z., 2018. Cloning and expression analysis of CYP17A2 gene in Naked Carp( Gymnocypris przewalskii ) from Qinghai Lake. Genom Appl Biol, 37 (05), 1859-1867 (in Chinese). Zheng, B. H., An, L. H., Chang, H., Liu, Y., Jiang, Z. Q., 2014. Evidence for the presence of sex steroidhormones in Zhikong scallop, Chlamys farreri . J Steroid Biochem Mol Biol, 143, 199-206. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3089889","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":211924615,"identity":"271858ea-a219-4b7b-992f-c9b54c7e47a2","order_by":0,"name":"Xiaoling Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAv0lEQVRIie3RsQrCMBCA4SuBdrm0a4oOPkKg4FTwQVwihWzuDh0SCnF09XEsB7oIvkIeoaOjcXSQxs0h33w/4S4ASfKHSmDWK9lixRj5qCSHbJDTQWN9zLWMTVx9vhPIB65EXCJ2ZsGdXjaEIKFvt/MJjqbhrsU18YuHq96b2aSwpguvhKRUMjMUkbAwxh1hM6AUcUlhrQ3ro2TRCY4DvI8sKBxZxexSie72DF+5qU5Efurb+eST+m08SZIk+eYFw686h/aDtKQAAAAASUVORK5CYII=","orcid":"","institution":"Yantai University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xiaoling","middleName":"","lastName":"Liu","suffix":""},{"id":211924616,"identity":"d41353b4-617f-44bb-84c1-3e89e46f5267","order_by":1,"name":"Han Yun","email":"","orcid":"","institution":"Yantai University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Han","middleName":"","lastName":"Yun","suffix":""},{"id":211924617,"identity":"187ca6e8-16c1-4b73-bb3a-6f21eff532e7","order_by":2,"name":"Xuejiao Mu","email":"","orcid":"","institution":"Yantai University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xuejiao","middleName":"","lastName":"Mu","suffix":""}],"badges":[],"createdAt":"2023-06-21 04:14:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3089889/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3089889/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":39129873,"identity":"9ebd273f-4dca-4f81-bbe5-0b852583a3de","added_by":"auto","created_at":"2023-06-26 23:01:18","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":660714,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistological observation on gonads of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. farreri i\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003en different developmental phases\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1.ovary (Proliferative stage); 2.testis (Proliferative stage); 3.ovary (Growing stage); 4. testis (Growing stage); 5.ovary (Mature stage); 6.testis (Mature stage); Gc, germ cell;\u003c/p\u003e\n\u003cp\u003eFc, follicular cavity; Mo, mature oocyte; Sz, spermatozoon; Scale bar=50 μm．\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/3b5d9b1f77591a475a025c46.png"},{"id":39129872,"identity":"5e3a904a-d68a-4ed6-8ff5-ee24705e1f77","added_by":"auto","created_at":"2023-06-26 23:01:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":253612,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequence comparison of\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eCYP17A1 and CYP17A2 proteins from different species\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCrassostrea gigas\u003c/em\u003e CYP17A1\u003cem\u003e \u003c/em\u003e(XP_011454186.1); \u003cem\u003eMizuhopecten yessoensis\u003c/em\u003e CYP17A1\u003cem\u003e \u003c/em\u003e(AXY92158.1); \u003cem\u003eHomo sapiens \u003c/em\u003eCYP17A1\u003cem\u003e \u003c/em\u003e(AAA52151.1); \u003cem\u003eMus musculus\u003c/em\u003e CYP17A1 \u003cem\u003e(\u003c/em\u003eEDL42014.1); \u003cem\u003eGallus gallus \u003c/em\u003eCYP17A1\u003cem\u003e (\u003c/em\u003eNP_001001901.1\u003cem\u003e)\u003c/em\u003e; \u003cem\u003eBos taurus\u003c/em\u003e CYP17A1 (AAI10170.1); \u003cem\u003eDanio rerio\u003c/em\u003e CYP17A1\u003cem\u003e \u003c/em\u003e(AAI62669.1); \u003cem\u003eXenopus laevis \u003c/em\u003eCYP17A1\u003cem\u003e \u003c/em\u003e(AAG42003.1); \u003cem\u003eOryzias latipes\u003c/em\u003e CYP17A1\u003cem\u003e \u003c/em\u003e(NP_001098564.1); \u003cem\u003eOreochromis niloticus\u003c/em\u003e CYP17A1\u003cem\u003e \u003c/em\u003e(BAF75924.1); \u003cem\u003eStrongylocentrotus intermedius \u003c/em\u003eCYP17A1\u003cem\u003e \u003c/em\u003e(ADL70858.1); \u003cem\u003eDanio rerio\u003c/em\u003e CYP17A2 (NP_001099140.1); \u003cem\u003eOreochromis niloticu\u003c/em\u003e CYP17A2\u003cem\u003e \u003c/em\u003e(ABQ96160.1); \u003cem\u003eTakifugu rubripes\u003c/em\u003e CYP17A2 (NP_001098691.1); \u003cem\u003eOryzias latipes\u003c/em\u003e CYP17A2\u003cem\u003e \u003c/em\u003e(NP_001265805.1); \u003cem\u003eParalichthys olivaceus\u003c/em\u003e CYP17A2 (ACM47730.2); \u003cem\u003eVerasper moseri\u003c/em\u003e CYP17A2\u003cem\u003e \u003c/em\u003e(ACI95233.2); \u003cem\u003eSebastes schlegeli\u003c/em\u003e CYP17A2\u003cem\u003e \u003c/em\u003e(AEJ33653.2)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/1fcac84c416ee828cc58d00b.png"},{"id":39129869,"identity":"fa6ce56f-0e2a-4778-8a18-6b9412ef0a0f","added_by":"auto","created_at":"2023-06-26 23:01:18","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":50080,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequence of the CYP17A1 in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. farreri\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe start codon and the stop codon were underlined; the three conservative regions were shown as the Ono sequence, the Ozols' tripeptide region and the heme binding region.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/073389ea5d5a98a0300a408c.png"},{"id":39129482,"identity":"bee7c5a7-3b9d-4f2d-b2e7-fa03c3908f22","added_by":"auto","created_at":"2023-06-26 22:53:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":48079,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequence of the CYP17A2 in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. farreri\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe start codon and the stop codon were underlined; the three conserved regions were shown as the Ono sequence, the Ozols' tripeptide region and the heme binding region.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/411306e0dacd76d94d488bd4.png"},{"id":39130165,"identity":"aa36679f-a39d-4274-b6f9-2a4ffc161edb","added_by":"auto","created_at":"2023-06-26 23:09:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":145217,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequence comparison of CYP17A1 homologous proteins from different species\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe three conserved regions were marked with boxes in the figure, box I was the Ono sequence, box II was the Ozols' tripeptide region, box III was the heme binding region; the heme conserved region sites were marked with a red box.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCrassostrea gigas\u003c/em\u003e CYP17A1 (XP_011454186.1); \u003cem\u003eMizuhopecten yessoensis\u003c/em\u003e CYP17A1 (AXY92158.1); Aplysia californica CYP17A1 (XP_012941324.1); \u003cem\u003eHomo sapiens\u003c/em\u003e CYP17A1\u003cem\u003e \u003c/em\u003e(AAA52151.1); \u003cem\u003eMus musculus\u003c/em\u003e CYP17A1 (EDL42014.1); \u003cem\u003eGallus gallus\u003c/em\u003e CYP17A1 (NP_001001901.1); \u003cem\u003eBos taurus\u003c/em\u003e CYP17A1 (AAI10170.1); \u003cem\u003eDanio rerio\u003c/em\u003e CYP17A1\u003cem\u003e \u003c/em\u003e(AAI62669.1); \u003cem\u003eXenopus laevis\u003c/em\u003e CYP17A1 (AAG42003.1); \u003cem\u003eOryzias latipes\u003c/em\u003e CYP17A1 (NP_001098564.1); \u003cem\u003eOreochromis niloticus\u003c/em\u003e CYP17A1 (BAF75924.1); \u003cem\u003eStrongylocentrotus intermedius\u003c/em\u003e CYP17A1 (ADL70 858.1)\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/71701814a9f39aeac722a6ec.png"},{"id":39129488,"identity":"9bebb7b0-5ea6-4602-bb63-089cf1fb2693","added_by":"auto","created_at":"2023-06-26 22:53:18","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":98985,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSequence comparison of CYP17A2 homologous proteins from different species\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe three conserved regions were marked with boxes in the figure, box I was the Ono sequence, box II was the Ozols' tripeptide region, box III was the heme binding region; the heme conserved region sites were marked with a red box.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDanio rerio\u003c/em\u003e CYP17A2 (NP_001099140.1); \u003cem\u003eOreochromis niloticus\u003c/em\u003e CYP17A2 (ABQ96160.1); \u003cem\u003eTakifugu rubripes\u003c/em\u003e CYP17A2 (NP_001098691.1); \u003cem\u003eOryzias latipes\u003c/em\u003e CYP17A2 (NP_001265805.1); \u003cem\u003eParalichthys olivaceus\u003c/em\u003e CYP17A2 (ACM47730.2); \u003cem\u003eVerasper moseri\u003c/em\u003e CYP17A2 (ACI95233.2); \u003cem\u003eSebastes schlegeli\u003c/em\u003e CYP17A2 (AEJ33653.2)\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/2bd28ec7f42aabdf69cb3e52.png"},{"id":39129483,"identity":"7739b574-fe9d-4e32-8b05-4fb3ea46b03b","added_by":"auto","created_at":"2023-06-26 22:53:18","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":27515,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCYP17A1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ebased on the homologous of the amino acids in different species\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/40b22ab141159f1c6eab8766.png"},{"id":39129485,"identity":"9d1a0859-b979-46ae-bbec-627ddc4c2d81","added_by":"auto","created_at":"2023-06-26 22:53:18","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":57819,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePredicted 3D structure of CYP17A1 protein\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConserved regions are shown by the arrows in the figure\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/8f2351cd93e98b7d0275f152.png"},{"id":39129487,"identity":"1fee2063-758e-4a00-ba60-5a38e3a7ee2d","added_by":"auto","created_at":"2023-06-26 22:53:18","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":68506,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePredicted 3D structure of CYP17A2 protein\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConserved regions are shown by the arrows in the figure\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/e39184f9ad8ac4fc6c1c007a.png"},{"id":39129489,"identity":"3c89bb06-1b1b-4155-b47e-4ef5e8f10757","added_by":"auto","created_at":"2023-06-26 22:53:18","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":259968,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCYP17A1 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCYP17A2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in male and female \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. farreri \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003etissues by qRT-PCR\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/7f2a53c75f60b894338c23d9.png"},{"id":39129870,"identity":"f7551257-7159-46b8-a9e4-54f929b58def","added_by":"auto","created_at":"2023-06-26 23:01:18","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":12476,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCYP17A1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e during different gonadal developmental cycles in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. farreri\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNote: The expression of testis during the proliferative period was set to 1.0, and different letters (a, b) indicate significant differences (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e\n\u003cp\u003eIn the ovary, the \u003cem\u003eCYP17A2\u003c/em\u003e expression had no significant difference at proliferative and growing stages, and the expression in mature stage had a significant increased compared with growing stage and proliferative stage. In male, the \u003cem\u003eCYP17A2\u003c/em\u003eexpression level at proliferative and growth phases did not change significantly, while the expression level at mature stage increased significantly, and significantly higher than that in other stage gonads.\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/ffc57369dfba4087b92254c9.png"},{"id":39129492,"identity":"aa466210-d436-41d9-8284-b7d473fbfc55","added_by":"auto","created_at":"2023-06-26 22:53:18","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":11487,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCYP17A2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e during different gonadal developmental cycles in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. farreri\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNote: The expression of testis during the growth period was set to 1.0, and different letters (a, b) indicate significant differences (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05)\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/c3ba94e83eb27d0d7e47c4d3.png"},{"id":40419403,"identity":"2a8c8048-08c1-4f5f-a650-90eab052f691","added_by":"auto","created_at":"2023-07-22 16:14:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1982313,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3089889/v1/08f64fbf-9254-4b83-a7bd-06f9d43de832.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Sequence characteristics and expression analysis of CYP17A1 and CYP17A2 genes in Chlamys farreri","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCytochrome P450c17 (\u003cem\u003eCYP17\u003c/em\u003e) was first identified in humans\u0026nbsp;(\u003cem\u003eHomo sapiens\u003c/em\u003e)\u0026nbsp;(Chung er al.\u0026nbsp;1987). Subsequently, \u003cem\u003eCYP17\u0026nbsp;\u003c/em\u003egenes of other species such as pig (\u003cem\u003eSus scrofa\u003c/em\u003e)\u0026nbsp;(Tremblay et al. 1994), horse (\u003cem\u003eEquus caballus\u003c/em\u003e)\u0026nbsp;(Choi et al. 1996)\u0026nbsp;, chicken\u0026nbsp;(\u003cem\u003eGallus gallus\u003c/em\u003e)\u0026nbsp;(Ono et al.\u0026nbsp;1988)\u003csup\u003e\u0026nbsp;\u003c/sup\u003eand so on were cloned.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWith the development of research, the previous idea that only one kind P450c17 existed in mammals and fish had been replaced, Zhou et al. (2007b) discovered a new clone of P450c17 in Nile tilapia\u0026nbsp;(\u003cem\u003eOreochromis niloticus\u003c/em\u003e)\u0026nbsp;and medaka\u0026nbsp;(\u003cem\u003eOryzias latipes\u003c/em\u003e), named it P450c17-II (\u003cem\u003eCYP17A2\u003c/em\u003e).\u0026nbsp;Afterwards,\u0026nbsp;two different encoded \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eCYP17A2\u003c/em\u003e were detected in some bony fishes such as zebrafish\u0026nbsp;(\u003cem\u003eDanio rerio\u003c/em\u003e), Nile tilapia, and flounder\u0026nbsp;(\u003cem\u003eParalichthysolivaceus\u003c/em\u003e)\u0026nbsp;(Jin et al. 2012; Meng\u0026nbsp;et al.\u0026nbsp;2019). Some researchers thought that the two\u003cem\u003e\u0026nbsp;CYP17A\u003c/em\u003e genes formed in fish because genomes had undergone two whole-genome duplications in their evolutionary history, called the 2-round hypothesis,\u003csup\u003e\u0026nbsp;\u003c/sup\u003ebut this speculation still needs to be supported by further experimental evidence.\u0026nbsp;(Ohno. 1970;\u0026nbsp;Amores et al.\u0026nbsp;1998;\u0026nbsp;Hoegg et al.\u0026nbsp;2004; Wang and\u0026nbsp;Ge.\u0026nbsp;2004; Meyer and\u0026nbsp;Peer.\u0026nbsp;2005; Zhou et al. 2007)\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cem\u003eCYP17\u003c/em\u003e is one of the most critical enzymes in steroid hormones production of vertebrate\u0026nbsp;(Chen and\u0026nbsp;Wen.\u0026nbsp;2012). Many studies have shown that \u003cem\u003eCYP17\u003c/em\u003e gene is expressed in both female and male\u0026nbsp;gonads, indicating that this gene is not specific to male or female development, but has functions\u0026nbsp;in\u0026nbsp;development of\u0026nbsp;both\u0026nbsp;female and male\u0026nbsp;gonads,\u0026nbsp;and the function may be different\u0026nbsp;(Yu et al.\u0026nbsp;2003). In the testis of humans,\u0026nbsp;if\u0026nbsp;the \u003cem\u003eCYP17\u0026nbsp;\u003c/em\u003eenzyme activity is\u0026nbsp;absent, androgen content will be insufficient, which further leads to cessation of testicular development\u0026nbsp;and the\u0026nbsp;absence\u0026nbsp;of the penis and scrotum (Cao.\u0026nbsp;2016).\u0026nbsp;Iwade \u003cem\u003eet al\u003c/em\u003e. (2008)\u0026nbsp;detected the \u003cem\u003eCYP17\u003c/em\u003e expression in\u0026nbsp;rough-skinned frog (\u003cem\u003eRanarugosa\u003c/em\u003e), found that the expression in male individuals gradually increases with individual development, and the androgen content increases significantly during sex differentiation, indicating that \u003cem\u003eCYP17\u0026nbsp;\u003c/em\u003emay participate in androgen production, and indirectly participate in sex differentiation process.\u0026nbsp;Sex hormones also play an important role\u0026nbsp;in ovary. In mammals, \u003cem\u003eCYP17\u003c/em\u003e gene\u0026nbsp;mutations may lead to a variety of sex hormone-related disorders, such as polycystic ovary syndrome (PCOS) and endometriosis (EMS)\u0026nbsp;(Cadagan et al. 2016).\u0026nbsp;Rangel\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e. (2007）have found\u0026nbsp;that in the laying hen ovary (\u003cem\u003eGallus domesticus\u003c/em\u003e), androgens can affect the early growth and development of follicles, as well as the normal ovulation process by affecting the production of progesterone in granulosa cells.\u0026nbsp;In addition, the \u003cem\u003eCYP17\u0026nbsp;\u003c/em\u003egene is also involved in glucocorticoids\u0026nbsp;production,\u0026nbsp;and when the gene is impaired,\u0026nbsp;glucocorticoid levels will decrease, leading to diseases such as 17\u0026alpha; hydroxylase/17,\u0026nbsp;20-carbon chain lyase deficiency (17OHD)\u0026nbsp;(Xiao and Li. 2019). The deletion of the \u003cem\u003eCYP17\u003c/em\u003e gene will lead to a decrease in human corticosteroids and sex steroid hormones, sexual maturity is eventually delayed\u0026nbsp;(Kater and\u0026nbsp;Biglieri.\u0026nbsp;1994; Yanase. 1995).\u003c/p\u003e\n\u003cp\u003eIn fish, \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003ehas 17\u0026alpha; hydroxylase and 17,\u0026nbsp;20 lyase\u0026nbsp;activities, while \u003cem\u003eCYP17A2\u003c/em\u003e only has 17\u0026alpha; hydroxylase activity\u0026nbsp;(Wang. 2016). Zhou \u003cem\u003eet al\u003c/em\u003e. (2007b)\u0026nbsp;found that \u003cem\u003eCYP17A2\u003c/em\u003e gene\u0026nbsp;was\u0026nbsp;responsible for\u0026nbsp;the production of\u0026nbsp;C-21 steroids such as 17\u0026alpha;-20\u0026beta;-DP\u0026nbsp;(17\u0026alpha;, 20\u0026beta;-dihydroxy-4-pregnene-3-one)\u0026nbsp;and cortisol\u0026nbsp;in a related study on Nile tilapia.\u0026nbsp;Later, some researchers\u0026nbsp;have analyzed gene expression profiling of medaka oocytes 48 hours before spawning by in situ hybridization, and the result showed that\u0026nbsp;the \u003cem\u003eCYP17A2\u003c/em\u003e is responsible for the production of 17\u0026alpha;-2 0\u0026beta;-DP and Cortisol in head and kidney during the maturation of medaka oocytes\u0026nbsp;(Ozols et al. 1981; Sakai et al. 1992). These studies\u0026nbsp;preliminary revealed the possible function of the \u003cem\u003eCYP17A2\u0026nbsp;\u003c/em\u003egene in fish, and provided an experimental basis for the study of this gene in fish.\u003c/p\u003e\n\u003cp\u003eIn invertebrates, the relevant studies on \u003cem\u003eCYP17A1\u003c/em\u003e were few. Guo\u003cem\u003e\u0026nbsp;et al.\u0026nbsp;\u003c/em\u003e(2013) detected the \u003cem\u003eCYP17A1\u003c/em\u003e expression in the gonads developmental cycle of sea urchin (\u003cem\u003eStrongylocentrotus intermedius\u003c/em\u003e), and found that \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003ewas widely expressed, and was expressed significantly higher in male gonads than in females, the researchers speculated that \u003cem\u003eCYP17A1\u003c/em\u003e may play an important role in male gonads, but the mechanism is unknown and needs to be further explored.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThitiphuree \u003cem\u003eet al\u003c/em\u003e. (2018) detected the expression of \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003ein gonadal tissues at the early stage of cell differentiation in\u0026nbsp;the\u0026nbsp;Yesso\u0026nbsp;scallop (\u003cem\u003eMizuhopecten yessoensis\u003c/em\u003e), and found that \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003eis widely expressed in different tissues.\u003cem\u003e\u0026nbsp;\u003c/em\u003eFour members of \u003cem\u003eCYP17s\u0026nbsp;\u003c/em\u003eare found in the common hydra (\u003cem\u003eHydra vulgaris\u003c/em\u003e) (Nelson. 2009), and six members are found in sea urchin (\u003cem\u003eStrongylocentrotus purpuratus\u003c/em\u003e) (Goldstone et al.\u0026nbsp;2006), multiple members were found in the Pacific oyster (\u003cem\u003eCrassostrea gigas\u003c/em\u003e). But the above studies are all derived from data analysis only after omics sequencing, no specific investigations are on expression patterns and functions of related genes.\u003c/p\u003e\n\u003cp\u003eThe\u0026nbsp;\u003cem\u003eC. farreri\u003c/em\u003e\u003cem\u003e\u0026nbsp;is\u0026nbsp;\u003c/em\u003esex-stable, and the distinction between male and female individuals is obvious, these characteristics make it possible to study the genes related to gonadal development in\u0026nbsp;\u003cem\u003eC. farreri.\u003c/em\u003e \u003cem\u003eC. farreri\u0026nbsp;\u003c/em\u003eis an economically shellfish with high nutritional value, the research on genes related to gonadal development can provide a theoretical basis for practice, and lay a theoretical foundation for the reproduction efficiency improving to a certain extent (Qin. 2011).\u003c/p\u003e"},{"header":"1 Materials and methods","content":"\u003cp\u003e\u003cstrong\u003e1.1\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTissue identification of different gonad development stage in\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eC. farreri\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHealthy\u003cem\u003e\u0026nbsp;\u003c/em\u003escallops\u003cem\u003e\u0026nbsp;C. farreri\u003c/em\u003e were purchased from the seafood market near Yantai University, and\u0026nbsp;tissue samples were dissected after 24 h\u0026nbsp;rearing in the filtered seawater,\u0026nbsp;the gonads were first fixed with\u0026nbsp;Bouin\u0026rsquo;s solution and\u0026nbsp;then identified by tissue sectioning (Fig. 1), were grouped into three development stages\u0026nbsp;(proliferative stage, growing stage and mature stage) (Liu et al. 2018). \u0026nbsp;5\u0026nbsp;males and 5 females\u0026nbsp;at the same developmental\u0026nbsp;stages\u0026nbsp;were selected, and different tissues (including gonads, gills, liver and pancreas, kidneys, mantles, and adductor muscle)\u0026nbsp;were snap-frozen in liquid nitrogen and stored at\u0026nbsp;－80℃\u0026nbsp;in the refrigerator for RNA extraction.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.2 Total\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eRNA extraction and cDNA synthesis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from various tissues using guanidine isothiocyanate method (reagent, Sangon Biotech, Shanghai, China) (Takase et al. 2000). The extracted RNA was tested by NanoDrop ND-2000 ultra-micro spectrophotometer, and the integrity of the extracted RNA was tested by agarose gel electrophoresis. The reverse transcription reaction used mRNA as the template which separated from total RNA, and RT Primer Mix were used to reverse transcribe into cDNA by reverse transcriptase. cDNA was synthesized using Evo M-MLV kit (Invitrogen, TakaRa, Beijing, China) and stored in the refrigerator at\u0026nbsp;－20\u0026deg;C for later use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.3 Sequence characteristics of \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The gene sequences were obtained from early transcriptome sequencing in our laboratory (unpublished), and some researchers also directly used sequence obtained by omics sequencing \u0026nbsp; to analyze the sequence and expression pattern, for example, Li \u003cem\u003eet al\u003c/em\u003e. (2020) used the omics sequence to directly analyze the \u003cem\u003eDmrt1\u003c/em\u003e gene sequence and expression pattern\u003csup\u003e\u0026nbsp;\u003c/sup\u003eof\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003eC. farreri\u003c/em\u003e.\u0026nbsp;Homologous sequence comparison was performed using Clustal X and DNAman. Phylogenetic analysis was conducted based on Neighbor-Joining (NJ) method using MEGA4. The protein 3D structures of the two genes were predicted using Swiss-Model homology modeling server.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.4 Semiquantitative RT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this experiment, 3 different individual samplesfor each tissue were extracted., and the corresponding RNA samples were mixed proportionally for the subsequent experiments.\u0026nbsp;Primer designed in the non-conserved region.\u0026nbsp;Tissue distributions of\u0026nbsp;\u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e in\u003cem\u003e\u0026nbsp;C. farreri\u003c/em\u003e tissues were analyzed using SqRT-PCR with specific primers P1 and P2, P3 and P4 (shown in Table 1). The PCRs were standardized using\u003cem\u003e\u0026nbsp;\u0026beta;-actin\u003c/em\u003e (GenBank accession no. AY335441) primers as A3, A4 (shown in Table 1), PCR amplifications\u0026nbsp;in 20 \u0026mu;l aliquots were performed by denaturation at 94\u0026deg;C for 30 s, annealing at 59\u0026deg;C for 30 s, extension at 72\u0026deg;C for 30 s; 33 cycles for\u0026nbsp;\u003cem\u003eCYP17A1\u003c/em\u003e and 23 cycles for\u003cem\u003e\u0026nbsp;\u0026beta;-actin\u003c/em\u003e, PCR amplifications\u0026nbsp;in 20 \u0026mu;l aliquots were performed by denaturation at 94\u0026deg;C for 30 s, annealing at 58.2\u0026deg;C for 30 s, extension at 72\u0026deg;C for 30 s; 33 cycles for\u0026nbsp;\u003cem\u003eCYP17A2\u003c/em\u003e and 23 cycles for \u003cem\u003e\u0026beta;-actin\u003c/em\u003e, The PCR was repeated twice.\u0026nbsp;The PCR\u0026nbsp;products were\u0026nbsp;detected by gel electrophoresis and\u0026nbsp;photographed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTab. 1 Primer sequences used in this experiment\u003c/strong\u003e \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" valign=\"top\"\u003e\n \u003cp\u003ePrimer Sequence（5\u0026prime;\u0026rarr;3\u0026prime;） \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Usage\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" valign=\"top\"\u003e\n \u003cp\u003eP1 \u0026nbsp; CCAAGTAGCCGATTCAAAAAAGTGT \u0026nbsp; \u0026nbsp; Semi-quantitative and quantitative\u003c/p\u003e\n \u003cp\u003efluorescence PCR of \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003egene\u003c/p\u003e\n \u003cp\u003eP2 \u0026nbsp; \u0026nbsp;TCCAGCAAAGAAAATGTCAGCA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Semi-quantitative and quantitative\u003c/p\u003e\n \u003cp\u003efluorescence PCR of \u003cem\u003eCYP17A1\u003c/em\u003e gene\u003c/p\u003e\n \u003cp\u003eP3 \u0026nbsp; \u0026nbsp;GATGTGGACGATGCTTTTCTC \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Semi-quantitative and quantitative\u003c/p\u003e\n \u003cp\u003efluorescence PCR of \u003cem\u003eCYP17A2\u0026nbsp;\u003c/em\u003egene\u003c/p\u003e\n \u003cp\u003eP4 \u0026nbsp; \u0026nbsp;TGTTTTGCCTGTTGCTGTTC \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Semi-quantitative and quantitative\u003c/p\u003e\n \u003cp\u003efluorescence PCR of \u003cem\u003eCYP17A2\u003c/em\u003e gene\u003c/p\u003e\n \u003cp\u003eA3 \u0026nbsp; \u0026nbsp;TTCTTGGGAATGGAATCTGC \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003e\u0026beta;-actin\u003c/em\u003e reference gene\u003c/p\u003e\n \u003cp\u003eA4 \u0026nbsp; \u0026nbsp;GCCAGACTCGTCGTATTCCT \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003cem\u003e\u0026beta;-actin\u003c/em\u003e reference gene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e1.5\u003c/strong\u003e \u003cstrong\u003eQuantitative real-time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExpression of \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;CYP17A2\u003c/em\u003e mRNA in gonads during the reproductive cycle was detected using qRT-PCR with the specific primers P1 and P2, P3 and P4, \u003cem\u003e\u0026beta;-actin\u003c/em\u003e primers A3 and A4 (shown in Table 1). The reactions were carried out using a SYBR Green Real-Time PCR Master Mix ((Invitrogen, TakaRa, Beijing, China) and the ABI 7500Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Data from triplicate analyses for each gonad sample were analyzed using the ABI 7500 system SDS software version 1.4 (Applied Biosystems) with automati-cally set baseline and cycle threshold values. The 2 \u003csup\u003e\u0026ndash;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method was used to analyze the mRNA expression level of\u003cem\u003e\u0026nbsp;CYP17A1\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;CYP17A2\u003c/em\u003e. All data are presented as the mean\u0026plusmn;SEM from five samples. Differences were tested using one-way analysis of variance followed by least significant difference tests (SPSS software version 12.0; SPSS Inc., Chicago, IL, USA) with a significance level set at \u003cem\u003ep\u003c/em\u003e\u0026lt;0.05 (Liu et al. 2012).\u003c/p\u003e"},{"header":"2 Results","content":"\u003cp\u003e\u003cstrong\u003e2.1\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTissue identification of different gonad development stage in\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eC. farreri\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to the morphologic characteristics described by Liao \u003cem\u003eet al\u003c/em\u003e. (1983), the development of the gonads (ovaries and testes) can be classified into 3 stages based on histological structure (Fig. 1). In Figures 1.1 and 1.4, only one or two layers of germ cells are formed on the follicular walls in the testes and ovaries, indicating that the scallop gonads had entered the proliferative stage; Obvious follicular cavities can be observed in Figure 1.2 and Figure 1.5, and multiple layers of germ cells have been formed on the follicular wall, indicating that the gonads of scallops have entered the growing stage; in Figure 1.3 and Figure 1.6, the follicular cavities of the testes and ovaries were full of germ cells, and a large number of sperms appeared in the testis, and the mature eggs in the ovary are squeezed into an irregular shape, indicating that the scallop gonads had entered the mature stage (Liao et al. 1983).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eClassification of \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eCYP17A2\u003c/em\u003e genes\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eC. farreri\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003eThe conserved region of Ono sequence was the characteristic sequence of \u003cem\u003eCYP17\u003c/em\u003e family, the Ono conserved region multiple alignment of CYP17A1 and CYP17A2 proteins from different species showed that there were different sites. As shown in the black box in Figure 2, the second site within the conserved region of the Ono sequence was D (aspartate) for CYP17A1 and E (glutamate) for \u003cem\u003eCYP17A2\u003c/em\u003e, and the sixteenth amino acid site in this conserved region was all L (leucine) for \u003cem\u003eCYP17A2\u0026nbsp;\u003c/em\u003ein different species. According to these different sites features, the two similar genes of \u003cem\u003eC. farreri\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003ewere distinguished and classified as \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eCYP17A2\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.\u003c/strong\u003e\u003cstrong\u003e3\u003c/strong\u003e \u003cstrong\u003eSequence analysis and alignment of \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e in\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eC. farreri\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eCYP17A1\u003c/em\u003e CDS was 1287 bp long and encodes 428 amino acids, and the \u003cem\u003eCYP17A2\u0026nbsp;\u003c/em\u003eCDS\u0026nbsp;was\u0026nbsp;1512 bp and encodes 503 amino acids, both\u0026nbsp;the two genes contained obvious characteristics of the cytochrome P450 gene family. There were three conserved regions, named the Ono sequence, the Ozols\u0026apos; tripeptide\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eregion and the heme binding region, and the 3 conserved regions \u0026nbsp;were marked in the box in figure 3 and figure 4.\u003c/p\u003e\n\u003cp\u003eThe multiple sequence alignment results showed that the \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003eprotein and\u003cem\u003e\u0026nbsp;CYP17A2\u003c/em\u003e protein of \u003cem\u003eC. farreri\u003c/em\u003e is consistent with the conserved regions of mammals, amphibians, fish and mollusks, and there were also 3 conserved regions (marked in Figure 5 and Figure 6). As shown in the red box marked in Figure 5, the sixth and eighth positions in the \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003eand \u003cem\u003eCYP17A2\u003c/em\u003e heme conserved region contained the conserved arginine (Arg, R) and cysteine (Cys, C), two sites were necessary for the P450 family to exert heme activity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.\u003c/strong\u003e\u003cstrong\u003e4\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ePhylogenetic analysis of CYP17A1\u003c/strong\u003e \u003cstrong\u003eprotein\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;in \u003cem\u003eC. farreri\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe phylogenetic analysis\u0026nbsp;results showed that\u0026nbsp;the\u003cem\u003e\u0026nbsp;\u003c/em\u003eCYP17A1 protein of \u003cem\u003eC. farreri\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003efirst clustered with\u003cem\u003e\u0026nbsp;\u003c/em\u003ethe scallop,\u0026nbsp;and then clustered with\u0026nbsp;the Pacific oyster (\u003cem\u003eCrassostrea gigas)\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003eand sea snail\u0026nbsp;(\u003cem\u003eAplysia californica)\u003c/em\u003e, finally clustered with CYP17A1 proteins of other species (Figure 7). The phylogenetic relationship was basically consistent with the taxonomic status of the species. \u003cem\u003eCYP17A2\u003c/em\u003e had only been studied in some fish and was absent in other animals up to now, therefore it was not meaningful to perform phylogenetic analysis of CYP17A2 proteins from different species.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.\u003c/strong\u003e\u003cstrong\u003e5\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eThree-dimensional structure prediction of CYP17A1 and\u003cem\u003e\u0026nbsp;\u003c/em\u003eCYP17A2 proteins in \u003cem\u003eC. farreri\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe three-dimensional structure of \u003cem\u003eChlamys farreri\u0026nbsp;\u003c/em\u003eCYP17A1 and CYP17A2 protein prediction results showed that the proteins all contains the conserved region Ono sequence, the Ozols\u0026apos; tripeptide region and the heme region (Figure 8 and Figure 9).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.\u003c/strong\u003e\u003cstrong\u003e6 Tissue expression characteristics of \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e in \u003cem\u003eC. farreri\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCYP17A1\u003c/em\u003e and\u003cem\u003e\u0026nbsp;CYP17A2\u003c/em\u003e were all widely expressed in different tissues of \u003cem\u003eC. farreri. CYP17A1\u0026nbsp;\u003c/em\u003ewas\u003cem\u003e\u0026nbsp;\u003c/em\u003estrongly expressed in the kidney and hepatopancreas in female individuals, weakly expressed in the adductor muscle, mantle, gill and ovary (Figure 10B); it was strongly expressed in the hepatopancreas of male individuals, and weakly expressed in the adductor muscle, mantle, kidney, gill and testis (Figure 10A). In female, \u003cem\u003eCYP17A2\u0026nbsp;\u003c/em\u003ewas strongly expressed in kidney and gill tissues, but weakly expressed in the adductor muscle, mantle, hepatopancreas and ovary tissues (Figure 10D). In male individuals, \u003cem\u003eCYP17A2\u003c/em\u003e was strongly expressed in the adductor muscle, kidney, gill, and testis, while the expression level in the mantle and hepatopancreas was slightly lower (Figure 10C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.\u003c/strong\u003e\u003cstrong\u003e7\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eExpression of \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e during gonad developmental cycles in \u003cem\u003eC. farreri\u003c/em\u003e \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring ovarian development, the \u003cem\u003eCYP17A1\u003c/em\u003e expressed highest at growth stage, about seven times higher than that at proliferative and mature stage. In the testis, the expression level exists in the whole development cycle, and increased non-significantly with the testis development.\u003c/p\u003e"},{"header":"3 Discussion ","content":"\u003cp\u003e\u003cstrong\u003e3.1\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eSequence analysis and alignment of \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e in\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eC. farreri\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCYP17\u003c/em\u003e belongs to the P450\u0026nbsp;gene family, CYP17 protein conserved regions include the Ono sequence, the Ozols\u0026apos; tripeptide region and the heme binding region. The Ozols\u0026apos; tripeptide region and heme binding region belong to the common conserved region of the P450 family members\u0026nbsp;(Jin\u0026nbsp;et al. 2012), while the Ono sequence conserved region is a characteristic sequence of the \u003cem\u003eCYP17\u003c/em\u003e subfamily. In this study, we compared CYP17A1 and CYP17A2\u003cem\u003e\u0026nbsp;\u003c/em\u003eof\u003cem\u003e\u0026nbsp;\u003c/em\u003edifferent species, and found the site-specific differences in the Ono conserved region between this two genes for the first time, we concluded that at the second amino acid position in the Ono sequence, all amino acids corresponding to CYP17A1\u0026nbsp;were D (aspartic acid), and all amino acids corresponding to\u003cem\u003e\u0026nbsp;\u003c/em\u003eCYP17A2 were E (glutamic acid); at the sixteenth position in the Ono sequence, all amino acids corresponding to\u003cem\u003e\u0026nbsp;\u003c/em\u003eCYP17A2 are L (leucine). The \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e of\u0026nbsp;\u003cem\u003eC. farreri\u0026nbsp;\u003c/em\u003ehave the three conserved regions above-mentioned, which were confirmed by the three-dimensional structure prediction. The Ono sequence is the characteristic sequence of CYP17A, the Ozols\u0026apos; tripeptide region is responsible for binding to steroids, and the heme binding region is the binding site for heme iron. In the heme binding region, CYP17A1\u003cem\u003e\u0026nbsp;\u003c/em\u003eand CYP17A2 of different species contain both the conserved arginine (Arg, R) and cysteine (Cys, C) in the sixth and eighth positions of the conserved region of ferrous heme, and some researchers have shown that these two sites are necessary for the P450 family to play an active of heme\u0026nbsp;(Li et al.\u0026nbsp;2017). The CYP17A1 and CYP17A2 of\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003eC. farreri\u003c/em\u003e are consistent with the conserved regions of other species.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Expression of \u003cem\u003eCYP17A1\u003c/em\u003e and\u003cem\u003e\u0026nbsp;CYP17A2\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eResearchers have found that \u003cem\u003eCYP17\u003c/em\u003e was expressed in steroid-producing tissues such as gonads, head and kidney in cartilaginous fish and bony fish\u0026nbsp;(Sakai et al. 1992; Trant. 1995; Kazeto et al. 2000; Halm et al. 2003; Wang et al. 2004), in addition, \u003cem\u003eCYP17\u003c/em\u003e had also been found in other non-classical steroid-producing tissues of fish, such as brain\u0026nbsp;(Halm et al. 2003; Yu et al. 2003)\u0026nbsp;gastrointestinal tract, liver and gill\u0026nbsp;(Wang et al. 2004); Chen \u003cem\u003eet al\u003c/em\u003e. (2010) detected the \u003cem\u003eCYP17A1\u003c/em\u003e expression in female half smooth tongue sole (\u003cem\u003eCynoglossus semilaevis\u003c/em\u003e) and found that the gene was expressed in ovary, brain, head kidney, stomach, intestine, gill, spleen, and kidney tissues to different degrees\u0026nbsp;(Meng et al. 2019).\u0026nbsp;Wang\u0026nbsp;\u003cem\u003eet al\u003c/em\u003e. (2004) also detected \u003cem\u003eCYP17A1\u003c/em\u003e be expressed in the gill, kidney, brain, intestine, and liver of zebrafish.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe above studies show that \u003cem\u003eCYP17A1\u003c/em\u003e was widely expressed in fish and plays a role in different tissues. Our semiquantitative PCR results showed that \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e was widely expressed in different tissues of\u0026nbsp;\u003cem\u003eC. farreri\u003c/em\u003e, especially in the kidney and hepatopancreas in female, hepatopancreas in male. Thitiphuree\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e. (2018) also found the \u003cem\u003eCYP17A1\u003c/em\u003e was expressed\u0026nbsp;widely and variously\u0026nbsp;in Yesso scallop,\u0026nbsp;its expression level was relatively high in the kidney and low in the mantle, gill and gonad (Thitiphuree\u003cem\u003e\u0026nbsp;\u003c/em\u003eet al. 2018),\u0026nbsp;is the expression pattern was generally consistent with our results, also similar to mammals and fish,\u0026nbsp;it indicated that \u003cem\u003eCYP17A1\u003c/em\u003e may be not only involved in steroid hormones production, but also affect other physiological processes such as lipid metabolism or detoxification. Zhang \u003cem\u003eet al\u003c/em\u003e. (2018) detected the expression of \u003cem\u003eCYP17A2\u003c/em\u003e gene in female\u0026nbsp;Naked Carps (\u003cem\u003eGymnocypris przewalskii\u003c/em\u003e)\u0026nbsp;brane, found the gene was expressed in ovary, ovarian membrane, brain, muscle and hepatopancreas, the researcher suggested that \u003cem\u003eCYP17A2\u003c/em\u003e gene plays different physiological functions in different tissues of\u0026nbsp;Naked Carps. In addition, the \u003cem\u003eCYP17A2\u003c/em\u003e gene was found also widely expressed in zebrafish, Wang and Ge (2004) found that \u003cem\u003eCYP17A2\u003c/em\u003e was\u0026nbsp;all expressed in gonad, kidney, brain, gill, intestine, and hepatopancreas tissues of zebrafish. Some researchers suggested that the expression of \u003cem\u003eCYP17A2\u003c/em\u003e gene in the head kidney tissue of medaka is caused by the involvement of \u003cem\u003eCYP17A2\u003c/em\u003e gene in the production of cortisol\u0026nbsp;(Zhou et al. 2007b). The widespread expression of \u003cem\u003eCYP17A2\u0026nbsp;\u003c/em\u003egene in \u003cem\u003eC. farreri\u0026nbsp;\u003c/em\u003ewas similar to that of\u0026nbsp;Naked Carps\u0026nbsp;and zebrafish, indicating that\u003cem\u003e\u0026nbsp;CYP17A2\u003c/em\u003e gene plays physiological functions in different tissues of\u0026nbsp;\u003cem\u003eC. farreri\u003c/em\u003e. However, there were few rasearch on the tissue expression of \u003cem\u003eCYP17A2\u003c/em\u003e gene, which needs to be further studied.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The expression patterns of \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e during the ovarian development cycle of\u0026nbsp;\u003cem\u003eC. farreri\u003c/em\u003e showed that \u003cem\u003eCYP17A1\u003c/em\u003e was highest expressed at growth stage, significantly higher than that at the other two stages, while \u003cem\u003eCYP17A2\u003c/em\u003e was highest expressed at maturation stage.\u0026nbsp;Nagahama \u003cem\u003eet al\u003c/em\u003e.\u0026nbsp;(1985, 1997)\u0026nbsp;concluded\u0026nbsp;that in the ovaries of bony fish, estrogen (E2) is necessary for oocyte growth (mainly the process of yolk production), and 17\u0026alpha;, 20\u0026beta;-DP (DHP) is necessary for the final maturation of oocytes,\u0026nbsp;DHP is the progesterone\u0026nbsp;in most fishes, and researchers thought that DHP is also called gamete maturation inducing hormone (MIH).\u0026nbsp;Zhou \u003cem\u003eet al.\u003c/em\u003e (2007a) detected that\u003cem\u003e\u0026nbsp;\u003c/em\u003ethe\u0026nbsp;\u003cem\u003eCYP17A1\u003c/em\u003e expression during the development cycle tilapia (\u003cem\u003eOreochromis mossambicus\u003c/em\u003e) by immune system analysis and quantitative analysis, the result showed that the gene was mainly expressed at the early and middle stages of vitellogenesis,\u0026nbsp;indicating that \u003cem\u003eCYP17A1\u003c/em\u003e is mainly required for oocyte growth, presumably caused by the involvement of the \u003cem\u003eCYP17A1\u003c/em\u003e gene in estrogen production\u0026nbsp;(Zhou et al. 2007a).\u0026nbsp;The \u003cem\u003eCYP17A1\u003c/em\u003e expression decreased during oocyte maturation, while the \u003cem\u003eCYP17A2\u003c/em\u003e expression peaked at maturation\u0026nbsp;(Zhou et al. 2007a). The researcher believed that this phenomenon at maturation stage indicated a shift in steroid hormone production from estrogen to 17\u0026alpha;, 20\u0026beta;-DP\u0026nbsp;(Zhou et al. 2007a). So the \u003cem\u003eCYP17A1\u003c/em\u003e expression which mentioned by Zhou (Zhou et al. 2007a) is expressed mainly in the early and middle stages of vitellogenesis in tilapia may be considered that the \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003eis expressed mainly in the growth stage. The above expression characteristics are consistent with the expression pattern of \u003cem\u003eCYP17A1\u003c/em\u003e gene in\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003eC. farreri\u003c/em\u003e,\u0026nbsp;besides\u0026nbsp;the changes of oocytes during the growth period of\u0026nbsp;\u003cem\u003eC. farreri\u003c/em\u003e are mainly the formation and accumulation of yolk (Liao et al. 1983). This suggests that the regulation of\u003cem\u003e\u0026nbsp;CYP17A1\u003c/em\u003e activity may be a major factor at ovarian development stage, and\u003cem\u003e\u0026nbsp;CYP17A2\u003c/em\u003e may be important to the final mature stage, and that\u0026nbsp;\u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e work together\u0026nbsp;in the transition from\u0026nbsp;estradiol to 17\u0026alpha;, 20\u0026beta;-DP. It is speculated that \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e genes may also participate in the growth and maturation process of \u003cem\u003eC. farreri\u0026nbsp;\u003c/em\u003eoocytes.\u003c/p\u003e\n\u003cp\u003eA few papers have speculated sex steroid biosynthesis exist in mollusks and these sex steroids play roles in reproduction (Lafont et al. 2007; Fernandes et al. 2011).\u0026nbsp;Thitiphuree \u003cem\u003eet al\u003c/em\u003e. (2018) hypothesized that \u003cem\u003eCYP17A1\u003c/em\u003e may be an important gene involved in sex steroid biosynthesis in Yesso scallop.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe expression patterns of \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e during the testis development cycle of\u0026nbsp;\u003cem\u003eC. farreri\u003c/em\u003e showed that \u003cem\u003eCYP17A1\u003c/em\u003e was continuously expressed and expressed nonsignificantly increase during the development, while \u003cem\u003eCYP17A2\u003c/em\u003e was expressed significantly increase at maturation stage than other stage. Guo \u003cem\u003eet al\u003c/em\u003e. (2013) detected the \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003eexpression in the gonadal development of sea urchins (\u003cem\u003estrongylocentrotus intermedius\u003c/em\u003e) using semiquantitative PCR, found that the gene was expressed in both gender, and the expression increased with the testis development, which was positively correlated with the male gonadal development, suggesting that the\u003cem\u003e\u0026nbsp;CYP17A1\u003c/em\u003e gene plays a role in the male gonad. This is consistent with the expression of \u003cem\u003eCYP17A1\u003c/em\u003e during testis development in\u0026nbsp;\u003cem\u003eC. farreri\u003c/em\u003e, it is speculated that this gene is also involved in the development of testis in\u003cem\u003e\u0026nbsp;C. farreri\u003c/em\u003e. Liu \u003cem\u003eet al\u003c/em\u003e. (2014) found that testosterone levels during the gonadal development cycle in\u0026nbsp;\u003cem\u003eC. farreri\u003c/em\u003e gradually increased with gametogenesis and peaked at maturity, this study speculated that the reason for the non-significant elevation of the \u003cem\u003eCYP17A1\u003c/em\u003e gene with spermatophore development may be due to the involvement of this gene in steroid hormone production, and the specific mechanism of action needs to be supported by more experimental data. The \u003cem\u003eCYP17A2\u003c/em\u003e was highest expressed at mature stage and significantly higher than that at proliferative and growing stages,\u0026nbsp;Chen \u003cem\u003eet al\u003c/em\u003e. (2014)\u003csup\u003e\u0026nbsp;\u003c/sup\u003efound that\u003cem\u003e\u0026nbsp;CYP17A2\u0026nbsp;\u003c/em\u003egene was\u0026nbsp;highest expressed at the late mature stage during the development of zebrafish testis, which is consistent with the our \u003cem\u003eCYP17A2\u0026nbsp;\u003c/em\u003eexpression in\u0026nbsp;\u003cem\u003eC. farreri\u003c/em\u003e.\u0026nbsp;Yang \u003cem\u003eet al\u003c/em\u003e. (2019) found \u003cem\u003eCYP17A2\u003c/em\u003e was most expressed in mature testis during the gonadal developmental cycle of Nile tilapia by semi-quantitative PCR analysis. The quality of the sperm with homozygous mutation of\u003cem\u003e\u0026nbsp;CYP17A2\u003c/em\u003e was evaluated by sperm quality analyzer,\u0026nbsp;the results showed the motility of mutagenic sperm was affected, the amount of forward-moving sperm decreased and the amount of inactive sperm increased, progesterone is important in male fish for sperm production and excretion as well as sperm viability, and the \u003cem\u003eCYP17A2\u003c/em\u003e is involved in progesterone production in fish,\u0026nbsp;therefore, the gene probably affects sperm development by affecting progesterone production in the maturation stage of Nile tilapia.\u0026nbsp;Our study believes that the \u003cem\u003eCYP17A2\u003c/em\u003e gene may play a similar role in\u003cem\u003e\u0026nbsp;\u003c/em\u003etestis\u0026nbsp;of\u003cem\u003e\u0026nbsp;C. farreri\u003c/em\u003e,\u0026nbsp;perhaps both \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e can play a role in sex hormone production\u0026nbsp;in\u003cem\u003e\u0026nbsp;C. farreri\u003c/em\u003e, but the specific mechanism needs to be further explored.\u003c/p\u003e\n\u003cp\u003eIn conclusion, \u003cem\u003eCYP17A1\u003c/em\u003e and\u003cem\u003e\u0026nbsp;CYP17A2\u003c/em\u003e genes are involved in the gonadal development of \u003cem\u003eC. farreri,\u003c/em\u003e in ovary, they respectively play a role in oocyte growth and maturation, in testis, \u003cem\u003eCYP17A1\u0026nbsp;\u003c/em\u003egene may be involved in the testosterone production, and \u003cem\u003eCYP17A2\u003c/em\u003e gene may have an impact on the vitality and excretion of mature sperm by participating in the formation of progesterone DHP. Compared with vertebrates, the mechanism of \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e genes in mollusks is not clearly studied, there is still much explore space especially on the functions of \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e in mollusks to study.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Shandong Natural Science Foundation (ZR2022MC126).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003c/strong\u003eThe authors declare that the data supporting the findings of this study are availability within the article in the form of tables and figures.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis text does not require ethical consent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXiaoling Liu designed the experiments and wrote and revised the article. Han Yun analyzed the data and wrote the article. Xuejiao Mu performed the experiments and wrote the article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAmores, A., Force, A., Yan, Y., Joly, L., Ekker, M., 1999. Postlethwait jh: zebra sh hox clusters and vertebrate genome evolution. Am Zoo, 39 (5), 15A-15A.\u003c/li\u003e\n\u003cli\u003eBonnet, X., Naulleau, G., Mauget, R., Shine, R., 1994. The influence of body condition on 17-betaestradiol levels inrelation to vitellogenesis in female vipera aspis (\u003cem\u003eReptilia, Viperidae\u003c/em\u003e). Gen Comp Endocr, 93 (3), 424-437.\u003c/li\u003e\n\u003cli\u003eChung, B. C., Picado-Leonard, J., Haniu, M., Bienkowski, M., Hall, P. F., Shively, J.E., Miller, W.L., 1987. Cytochrome P450c17\u003cem\u003e \u003c/em\u003e(steroid 17 alpha-hydroxylase/17, 20lyase): cloning of human adrenal and testis cDNAs indicates the same gene is expressed in both tissues. P Nat Acad Sci USA, 84 (2), 407-411.\u003c/li\u003e\n\u003cli\u003eChoi, I., Simmen, R. C., Simmen, F. A., 1996. Molecular cloning of cytochrome P450 aromatase complementary deoxyribonucleic acid from periimplantation porcine and equine blastocysts identifies multiple novel 5\u0026apos;-untranslated exons expressed inembryos endometrium and placenta. Endocrinology, 137 (4), 1457-1467.\u003c/li\u003e\n\u003cli\u003eCustodia-Lora, N., Novillo, A., Callard, I. P., 2004. Regulation of hepatic progesterone andestrogen receptors in the female turtle, Chrysemys Picta: Relationship to vitellogenesis. Gen Comp Endocr, 136 (2), 232-240.\u003c/li\u003e\n\u003cli\u003eChen, C. F., Wen, H. S., Wang, Z. P., He, F., Zhang, J. R., Chen, X. Y., Jin, G. X., Shi, b., Shi, D., Yang, Y. P., 2010. Cloning and expression of P450c17-I\u003cem\u003e \u003c/em\u003e(17\u0026alpha;-hydroxylase/17,20-lyase) in brain and ovary during gonad development in\u003cem\u003e Cynoglossus semilaevis\u003c/em\u003e. Fish Physiol Biochem, 36 (4), 1001-1012.\u003c/li\u003e\n\u003cli\u003eChen, C. F., Wen, H. S., 2012. The characteristic analysis of P450c17s mRNA expression during the reproductive cycle in male Cynoglossus semilaevis G\u0026uuml;nther. Journal of Fisheries of China, 36 (07), 1019-1025 (in Chinese).\u003c/li\u003e\n\u003cli\u003eChen, X. H., 2014. Studies on the expression of a few kinds of \u003cem\u003eCYP\u003c/em\u003e genes in the different phases of gonad development in Zebrafish. Dissertation, Dalian Ocean University (in Chinese).\u003c/li\u003e\n\u003cli\u003eCao, H. M., 2016. The association study between\u003cem\u003e CYP17A1\u003c/em\u003e, \u003cem\u003eCYP19\u003c/em\u003e gene polymorphisms and male infertility in Henan Han Chinese population. Dissertation, Zhengzhou University (in Chinese).\u003c/li\u003e\n\u003cli\u003eCadagan, D., Khan, R., Amer, S., 2016. Thecal cell sensitivity to luteinizing hormone andinsulin in polycystic ovarian syndrome. Reprod Biol, 16 (1), 53-60.\u003c/li\u003e\n\u003cli\u003eFernandes, D., Loi, B., Porte C., 2011. Biosynthesis and metabolism of steroids in molluscs [J]. J Steroid Biochem Mol Biol, 127, 189-195.\u003c/li\u003e\n\u003cli\u003eGavaud, J., 1986. Vitellogenesis in the lizard lacerta vivipara jacquin. II. Vitellogenin synthesis during the reproductive cycle and its control by ovarian steroids. Gen Comp Endocr, 63 (1), 11-23.\u003c/li\u003e\n\u003cli\u003eGoldstone, J. V., Hamdoun, A., Cole, B. J., Howard-Ashby, M., Nebert, D. W., Scally, M., Dean, M., Epel, D., Hahn, M. E., Stegeman, J.J., 2006. The chemical defensome: Environmental sensing and response genes in the Strongy locentrotus purpuratus genome. Dev Bio, 300 (1), 366-384.\u003c/li\u003e\n\u003cli\u003eGuo, X. L., Qiu, X. M., Chang, Y. Q., Zhang, W. J., Cui, J., Cong, Y. T., Wu, L. Z., Liu, Y., Wang, X. L., 2013. Cloning and differential expression of CYP17 gene in sea urchin Strongylocentrotus intermedius. J Dalian Fish Univ, 28 (01), 1-6 (in Chinese).\u003c/li\u003e\n\u003cli\u003eHoegg, S., Brinkmann, H., Taylor, J. S.,\u003cem\u003e \u003c/em\u003eMeyer, A., 2004. Phylogenetic timing of the fish specific genome duplication correlates with the diversification of teleost fish. J Mol Evol, 59 (2), 190-203.\u003c/li\u003e\n\u003cli\u003eHalm, S., Kwon, J. Y., Rand-Weaver, M., Sumpter, J. P., Tyler, C. R., 2003. Cloning and gene expression of P450 17\u0026alpha;-hydroxylase, 17, 20-lyase cDNA in the gonads and brain of the fathead minnow \u003cem\u003ePimephales promelas\u003c/em\u003e. Gen Comp Endocr, 130 (3), 256-266.\u003c/li\u003e\n\u003cli\u003eIwade, R., Maruo, K., Okada, G., Nakamura, M., 2008. Elevated expression of P450c 17 (\u003cem\u003eCYP 17\u003c/em\u003e) during testicular formation in the frog. Gen Comp Endocr, 155 (1), 79-87.\u003c/li\u003e\n\u003cli\u003eJin, G. X., Wen, H. S., He, F., Li, J. F., \u0026amp; Cai, F. C., 2012. Molecular cloning, characterization expression of P450c17-I and P450c17-II and their functions analysis during the reproductive cycle in males of barfin flounder ( \u003cem\u003eVerasper moseri\u003c/em\u003e ). Fish Physiol Biochem, 38 (3), 807-817.\u003c/li\u003e\n\u003cli\u003eKater, C.E., Biglieri, E.G., 1994. Disorders of steroid 17-alpha-hydroxylase deficiency. Endcrin Metab Clin, 23 (2), 341-357.\u003c/li\u003e\n\u003cli\u003eKazeto, Y., Ijiri, S., Todo, T., Adachi, S., Yamauchi, K., 2000. Molecular cloning and characterization of Japanese eel ovarian P450c17 (\u003cem\u003eCYP17\u003c/em\u003e) cDNA. Gen Comp Endocrinol, 118 (1), 123-133.\u003c/li\u003e\n\u003cli\u003eKobayashi, D., Tanaka, M., Fukada, S., \u0026amp; Nagahama, Y. (1996). Steroidogenesis and ovarian follicles of the medaka (\u003cem\u003eOryzias latipes\u003c/em\u003e) during vitellogenesis and oocyte maturatIon. Zoolog Sci, 13 (6): 921\u0026ndash;927.\u003c/li\u003e\n\u003cli\u003eLiu, M., 2009. Relationship between endometriosis and polymorphisms of \u003cem\u003eCYP17, CYP1A2\u003c/em\u003e, \u003cem\u003eCYP3A4 \u003c/em\u003eand \u003cem\u003eCOMT\u003c/em\u003e gene. Dissertation, Hebei Medical University (in Chinese).\u003c/li\u003e\n\u003cli\u003eLiu, X. L., Liu, J., Wang, Z. D., Wang, Z. H., Li, Y. S., Cui, L. B., 2018. Necessity of foxl2 in the oogenesis of the scallop Chlamys farreri. Marine Sciences, 42 (04), 127-131 (in Chinese).\u003c/li\u003e\n\u003cli\u003eLi, Q. Q., Qin, Z. K., Wei, M. K., Zhang, Z. F., 2020. Molecular identification and expression pattern analysis of Dmrt 1 in the scallop \u003cem\u003eChlamys farreri\u003c/em\u003e. Journal of Fishery Sciences of China, 27 (11), 1277-1284 (in Chinese).\u003c/li\u003e\n\u003cli\u003eLiao, C. Y., Xu, Y. F., Wang, Y. L., 1983. Reproductive cycle of the scallop \u003cem\u003eChlamys farreri\u003c/em\u003e. Journal of Fisheries China, 7 (1), 1-13 (in Chinese).\u003c/li\u003e\n\u003cli\u003eLi, Y., Sun, X., Hu, X., Xun, X., Zhang, J., Guo, X., Jiao, W., Zhang, L., Liu, W., Wang, J., 2017. Scallop genome reveals molecular adaptations to semi-sessile life and neurotoxins. Nat Commun, 8 (1), 1721.\u003c/li\u003e\n\u003cli\u003eLiu, J., Zhang, Z., Zhang, L., Liu, X., Yang, D., Ma, X., 2014. Variations of estradiol-17\u0026beta; and testosterone levels correlated with gametogenesis in the gonad of Zhikong scallop (\u003cem\u003eChlamys farreri\u003c/em\u003e) during annual reproductive cycle. Canadian journal of zoology, 92 (3), 195-204.\u003c/li\u003e\n\u003cli\u003eLiu, X. L., Zhang, Z. F., Shao, M. Y., Liu, J. G., Muhammad, F., 2012. Sexually dimorphic expression of foxl2 during gametogenesis in scallop \u003cem\u003echlamys farreri\u003c/em\u003e, conserved with vertebrates. Dev Genes Evol, 222 (5), 279-286.\u003c/li\u003e\n\u003cli\u003eLafont, R., Mathieu, M., 2007. Steroids in aquatic invertebrates. Ecotoxicology, 16, 109-130.\u003c/li\u003e\n\u003cli\u003eMeng, L. H., Yu, H. Y., Qu, J. B., Niu, J. J., Ni, F. F., Han, P., Yu, H. Y., Wang, X. B., 2019. Two \u003cem\u003eCYP17\u003c/em\u003e genes perform different functions in the sex hormone biosynthesis and gonadal differentiation in Japanese flounder (\u003cem\u003eParalichthys olivaceus\u003c/em\u003e). Gene, 702, 17-26.\u003c/li\u003e\n\u003cli\u003eMeyer, A., Peer, Y. V. D., 2005. From 2R to 3R: evidence for a fish specific genome duplication (FSGD). Bioessays, 27 (9), 937-945.\u003c/li\u003e\n\u003cli\u003eNelson, D. R., 2009. The cytochrome P450 homepage. Hum Genomics. 4, 59-65.\u003c/li\u003e\n\u003cli\u003eNagahama, Y., 1997. 17alpha, 20beta-dihydroxy-4-pregnen-3-one, a maturaTioninducing hormone in fish oocytes: Mechanisms of synthesis and action. Steroids, 62 (1), 190-196.\u003c/li\u003e\n\u003cli\u003eNagahama, Y., Adachi, S., 1985. Identification of maturation-inducing steroid in a teleost, the amago salmon \u003cem\u003e(Oncorhynchus rhodurus)\u003c/em\u003e. Dev Biol, 109 (2), 428-435.\u003c/li\u003e\n\u003cli\u003eOno, H., Iwasaki, M., Sakamoto, N., Mizuno, S., 1988. cDNA cloning and sequence analysis of a chicken gene expressed during the gonadal development and homologous to mammalian cytochrome P-450c17. Gene, 66 (1), 77-85.\u003c/li\u003e\n\u003cli\u003eOhno, S., 1970. Evolution by gene duplication. Springer-Verlag, Berlin.\u003c/li\u003e\n\u003cli\u003eOzols, J., Heinemann, F. S., Johnson, E. F., 1981. Amino acid sequence of an analogous peptide from two forms of cytochrome\u003cem\u003e \u003c/em\u003eP-450. Biol Chem, 256 (22), 11405-11408.\u003c/li\u003e\n\u003cli\u003eQin, Z., Li, Y., Sun, D., Shao, M., Zhang, Z., 2012. Cloning and expression analysis of the vitellogenin gene in the scallop \u003cem\u003eChlamys farreri\u003c/em\u003e and the effects of estradiol‐17\u0026beta; on its synthesis. Invertebrate Biology, 131 (4), 312-321.\u003c/li\u003e\n\u003cli\u003eRangel, P. L., Rodr\u0026iacute;guez, A., Gutierrez, C. G., 2007. Testosterone directly induces progesterone production and interacts with physiological concentrations of LH to increase granulosa cell progesterone production in laying hens (\u003cem\u003eGallus domesticus\u003c/em\u003e). Anim Reprod Sci, 102 (1), 56-65.\u003c/li\u003e\n\u003cli\u003eSakai, N., Tanaka, M., Adachi, S., Miller, W. L., Nagahama, Y., 1992. Rainbow trout cytochrome P-450c17\u003cem\u003e \u003c/em\u003e(17alpha-hydroxylase/17,20-lyase) cDNA cloning, enzymatic properties and temporal pattern of ovarian P-450c17 mRNA expression during oogenesis. Febs Lett, 301 (1), 60-64.\u003c/li\u003e\n\u003cli\u003eTremblay, Y., Fleury, A., Beaudoin, C., Vall\u0026eacute;e, M., B\u0026eacute;langer, A., 1994. Molecular cloning and expression of guinea pig cytochrome P450c17 cDNA (steroid 17alpha-hydroxylase/17,20lyase): tissue distribution, regulation, and substrate specificity of the expressed enzyme. DNA Cell Biol, 13 (12), 1199-1212.\u003c/li\u003e\n\u003cli\u003eTao, H., Lu, Z. L., 2003. Gene symbol: \u003cem\u003eCYP17A1\u003c/em\u003e. Disease: 17-alpha-hydroxylase/17, 20-lyase deficiency. Hum Genet, 113 (4), 369-369.\u003c/li\u003e\n\u003cli\u003eTakase, M., Noguchi, S., Nakamura, M., 2000. Two\u003cem\u003e Sox9 \u003c/em\u003emessenger RNA isoforms: isolation of cDNAs and their expression during gonadal development in the frog Rana rugosa. Febs Lett, 466 (2-3), 249-254.\u003c/li\u003e\n\u003cli\u003eTrant, J. M., 1995. Isolation and characterization of the cDNA encoding the spiny dogfish shark (\u003cem\u003eSqualus acanthias\u003c/em\u003e) form of cytochrome P450c17. Exp Zool, 272, 25-33.\u003c/li\u003e\n\u003cli\u003eThitiphuree, T., Nagasawa, K., Osada, M., 2018. Molecular identification of steroidogenesis\u003c/li\u003e\n\u003cli\u003erelated genes in scallops and their potential roles in gametogenesis. J Steroid Biochem Mol Biol, 186, 35-72.\u003c/li\u003e\n\u003cli\u003eVogeler, S., Galloway, T. S., Lyons, B. P., Bean, T. P., 2014. The nuclear receptor gene family in the Pacific oyster, \u003cem\u003eCrassostrea gigas\u003c/em\u003e, contains a novel subfamily group. Bmc Genomics, 15 (1), 369.\u003c/li\u003e\n\u003cli\u003eWang, Y. J., Ge, W., 2004. Cloning of zebrafish ovarian p450c17 (cyp17,17alphahydroxylase/17, 20-lyase) and characterization of its expression in gonadal and extra-gonadal tissues. Gen Comp Endocr, 135 (2), 241-249.\u003c/li\u003e\n\u003cli\u003eWang, W. W., 2016. Bioinformatics analysis of \u003cem\u003eCYP17A2\u003c/em\u003e in Nile tilapia and differences of expression in gonads. J Anhui Agric Sci, 44 (07), 103-106 (in Chinese).\u003c/li\u003e\n\u003cli\u003eXiao, S.Y., Li, R., 2019. Advances in the study of 17\u0026alpha; hydroxylase/17, 20 carbon chain cleavage enzyme deficiency. J Mod Med Health, 35 (16), 2504-2507.\u003c/li\u003e\n\u003cli\u003eYu, H., Cheng, H. H., Guo, Y. Q., Xia, L. X., Zhou, R. J., 2003. Alternative splicing and differential expression of P450c17 (\u003cem\u003eCYP17\u003c/em\u003e) in gonads during sex transformation in the rice field eel. Biochem Biophys Res Commun, 307 (1), 165-171.\u003c/li\u003e\n\u003cli\u003eYanase, T., 1995. 17 alpha-Hydroxylase/17, 20-lyase defects. J Steroid Biochem Mol Biol, 53(1-6), 153-157.\u003c/li\u003e\n\u003cli\u003eYang, L.Y., 2019. Study on the Roles of \u003cem\u003eCYP17A2\u003c/em\u003e in steroidgenesis and gametogenesis in Nile tilapia. Dissertation, Southwest University (in Chinese).\u003c/li\u003e\n\u003cli\u003eZhou, L. Y., Wang, D. S., Shibata, Y., Paul-Prasanth, B., Suzuki, A., 2007a. Characterization, expression and transcriptional regulation of P450c17-I and P450c17-II in the medaka, \u003cem\u003eOryzias latipes\u003c/em\u003e. Biochem Biophys Res Commun, 362 (3), 619-625.\u003c/li\u003e\n\u003cli\u003eZhou, L. Y., Wang, D. S., Kobayashi, T., Yano, A., Paul-Prasanth, B., Suzuki, A., Sakai, F., Nagahama, Y., 2007b. A novel type of P450c17 lacking the lyase activity is responsible for C21-steroid biosynthesis in the fish ovary and head kidney. Endocrinology, 148 (9), 4282-4291.\u003c/li\u003e\n\u003cli\u003eZhang, X., Wei, F. L., Zhang, Y., Wei, W., Zhu, F. X., Wang, Y. Q., Li R. H., Han, B. Y., Liu, X. H., Qian, K. K., Wu, J., Zhu, S. H., Li, C. Z., 2018. Cloning and expression analysis of\u003cem\u003e CYP17A2\u003c/em\u003e gene in Naked Carp(\u003cem\u003eGymnocypris przewalskii\u003c/em\u003e) from Qinghai Lake. Genom Appl Biol, 37 (05), 1859-1867 (in Chinese).\u003c/li\u003e\n\u003cli\u003eZheng, B. H., An, L. H., Chang, H., Liu, Y., Jiang, Z. Q., 2014. Evidence for the presence of sex steroidhormones in Zhikong scallop, \u003cem\u003eChlamys farreri\u003c/em\u003e. J Steroid Biochem Mol Biol, 143, 199-206.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Chlamys farreri, CYP17A1, CYP17A2, sequence characteristics, expression","lastPublishedDoi":"10.21203/rs.3.rs-3089889/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3089889/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e genes are members of the \u003cem\u003eCYP17\u003c/em\u003e subfamily and belong to the P450 superfamily. This study analyzed the sequences of \u003cem\u003eChlamys farreri\u003c/em\u003e (\u003cem\u003eC. farreri\u003c/em\u003e) \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e, found that the \u003cem\u003eCYP17A1\u003c/em\u003e coding sequence (CDS) is 1287 bp, encoding 428 amino acids, and the \u003cem\u003eCYP17A2\u003c/em\u003e coding sequence is 1512 bp, encoding 503 amino acids. The two genes both contain three conserved regions: the Ozols' tripeptide region, the heme binding region, and the Ono sequence which is unique to \u003cem\u003eCYP17\u003c/em\u003e subfamily, and these regions are conserved in different species by the homology analysis of multiple amino sequence. Semi-quantitative RT-PCR (SqRT-PCR) showed that \u003cem\u003eCYP17A1\u003c/em\u003e was strongly expressed in the kidney and hepatopancreas of females, strongly expressed in the hepatopancreas of males, and weakly expressed in other tissues. \u003cem\u003eCYP17A2\u003c/em\u003e was strongly expressed in the kidney and gill of females, in the adductor muscle, kidney, gill and testis of males, weakly expressed in other tissues. The wide expression of \u003cem\u003eCYP17A1\u003c/em\u003e and \u003cem\u003eCYP17A2\u003c/em\u003e in \u003cem\u003eC. farreri\u003c/em\u003e suggest that they may play multiple roles in different tissues.Using real-time fluorescent quantitative PCR (qPCR), \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ethe expression during gametogenesis was detected\u003c/span\u003e, \u003cem\u003eCYP17A1\u003c/em\u003e was expressed highest at the ovarian growth stage., it was considered the gene may play a role in oocytes growth, furthermore, we speculated that the gene may affect oocyte growth by participating in production of estradiol. \u003cem\u003eCYP17A1\u003c/em\u003e expression increased with the testis development, which implied this gene may be involved in the testosterone\u0026rsquo; production. \u003cem\u003eCYP17A2\u003c/em\u003e expressed highest in testis at mature stage, it was believed that this gene may affect sperm excretion and motility by participating in pregnancy hormones production. \u003cem\u003eCYP17A2\u003c/em\u003e expressed higher in the ovary at mature stage than other stages, it is speculated that this gene may play a role in oocytes maturation by participating in 17α, 20β-DP (17α, 20β-dihydroxy-4-pregnen-3-one, DHP, a kind of progesterone) production.\u003c/p\u003e","manuscriptTitle":"Sequence characteristics and expression analysis of CYP17A1 and CYP17A2 genes in Chlamys farreri","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-06-26 22:53:13","doi":"10.21203/rs.3.rs-3089889/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"32faea9c-88fb-4b31-986e-f6694a3f00fc","owner":[],"postedDate":"June 26th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-07-22T16:14:21+00:00","versionOfRecord":[],"versionCreatedAt":"2023-06-26 22:53:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3089889","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3089889","identity":"rs-3089889","version":["v1"]},"buildId":"ehx78VzkSd0WSzXnipQa-","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}