CircRNA-0013747 induces mesangial cell proliferation in IgA nephropathy by targeting the Warburg effect via miR-330- 3p/PKM2 signaling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article CircRNA-0013747 induces mesangial cell proliferation in IgA nephropathy by targeting the Warburg effect via miR-330- 3p/PKM2 signaling Huimei Zou, Peilei Chen, Wenli Deng, Lu Liu, Miao Liu, Lifen Xu, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3996101/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Aberrant mesangial cell proliferation is a prevailing histopathological feature of immunoglobulin A nephropathy (IgAN) and is the primary driver of glomerular sclerosis and impaired renal function in IgAN patients. Prior research has revealed that PKM2-mediated aerobic glycolysis (the Warburg effect) frequently promotes mesangial cell growth and contributes to the development of various acute and chronic kidney diseases. However, the expression and functionality of PKM2 in IgA nephropathy, as well as the underlying molecular mechanisms governing its abnormal expression, remain elusive. Circular RNAs, a subset of noncoding RNAs, have garnered increasing attention due to mounting evidence of their pivotal roles in the initiation and progression of numerous disorders. The present study aimed to explore the effects of circRNA_0013747 on IgAN and the potential underlying mechanisms. The results indicated notable overexpression of circRNA_0013747 in lipopolysaccharide (LPS)-treated human mesangial cells (HMCs) and kidney biopsy samples from IgAN patients. CircRNA_0013747 was shown to facilitate mesangial cell proliferation and activate PKM2-mediated aerobic glycolysis, although these effects were mitigated by an increase in miR-330-3p. Mechanistically, circRNA_0013747 physically interacted with microRNA-330-3p (miR-330-3p) and hindered its function by directly binding to it. These findings imply that circRNA_0013747 can enhance glycolysis and proliferation in mesangial cells by modulating the miR-330-3p/PKM2 signaling pathway. In conclusion, the present results underscore the possibility of circRNA_0013747 serving as a promising therapeutic target for IgAN, suggesting new prospects for treating this disease. IgA nephropathy Mesangial cell Warburg effect PKM2 Circular RNA Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Immunoglobulin A nephropathy (IgAN) is a primary glomerular disease characterized by glomerular mesangial deposition of IgA or IgA-based immunoglobulin[ 1 ]. Since its identification by the French scholar Berger in 1968, it has become the most prevalent primary glomerular disease worldwide[ 2 ]. Patients with moderate clinical disease exhibit mesangial cell proliferation and extracellular matrix growth, but 30–40% of patients develop end-stage renal disease as a result of glomerular and interstitial sclerosis approximately 20 years after diagnosis[ 3 – 4 ]. Mesangial cells are activated via the deposition of the galactose-deficient IgA1 (Gd-IgA1) immune complex to mediate particular intracellular signal transduction pathways, and Gd-IgA1 immune complex deposition also promotes mesangial cell growth and initiates kidney injury[ 5 – 6 ]. Additionally, a number of proinflammatory and fibroblastic cytokines are released by mesangial cells to mediate oxidative stress and complement activation, which in turn causes damage to podocytes and proximal tubular epithelial cells, glomerular sclerosis, and interstitial fibrosis, all of which contribute to the progression of IgAN[ 7 – 8 ]. The early pathogenic changes in IgAN are thought to be largely mediated by mesangial cells, according to the following findings. Glucose is vital for cellular functions because it serves as the primary substrate for energy production. When glucose is fully oxidized within a cell in the presence of oxygen, 38 molecules of adenosine triphosphate (ATP) are generated, which serves as the cell's essential energy source[ 9 ]. However, when cells are under hypoxic conditions, pyruvic acid is not converted into acetyl-coenzyme A but rather into lactic acid, a process known as anaerobic cellular respiration[ 10 ]. In this scenario, the net energy balance is reduced to just two ATP molecules, making anaerobic glucose metabolism energetically inefficient[ 11 ]. In the early 1920s, Warburg, Posener, and Negelein made noteworthy discoveries regarding the behavior of tumor tissue in vitro. Their examination of respiration and glycolysis in different tissue sections revealed that tumors exhibit unusually high glycolytic activity and lactic acid production from glucose when compared to normal tissues. Surprisingly, glycolysis is "aerobic" and is not inhibited by oxygen in malignant cells, signifying that cancer cells lack the "Pasteur effect"[ 12 – 13 ]. This gave rise to the concept of aerobic glycolysis, which is the fermentation of glucose even in the presence of ample oxygen. Type M2 pyruvate kinase (PKM2) plays a key role in glycolysis by catalyzing the final and physiologically irreversible step of the process of converting phosphoenolpyruvate (PEP) to pyruvate through the transfer of a phosphate group to ADP[ 14 ]. The substantial upregulation of PKM2 expression in most human cancer types strongly suggests its importance in tumorigenesis. Transient transfection of tumor cell lines with PKM2 small interfering RNA (siRNA) resulted in reduced cell proliferation and increased apoptosis[ 15 – 17 ]. Metabolic changes have also been implicated in the development of several kidney diseases. Li et al. reported a shift toward aerobic glycolysis in the pathogenesis of chronic kidney disease (CKD)[ 18 ]. Furthermore, the inhibition of PKM2 by shikonin significantly ameliorated the histopathological symptoms of LPS-induced acute kidney injury (AKI)[ 19 ]. These findings underscore the potential role of PKM2-mediated aerobic glycolysis in various kidney diseases, although the precise regulatory mechanisms involved remain to be elucidated. Circular RNAs (circRNAs) represent a distinct class of noncoding RNAs highly prevalent in mammalian cells and are involved in the regulation of gene expression[ 20 ]. They have been found in various human organs and exhibit unique spatial and temporal expression patterns[ 21 ]. Due to their closed-loop structure, circRNAs exhibit greater stability than linear RNAs, rendering them promising candidates as biomarkers for disease diagnosis[ 22 ]. Research suggests that circRNAs can act as 'sponges' for miRNAs, selectively binding to miRNAs and consequently leading to the upregulation of miRNA target genes[ 23 ]. For example, Niu et al. demonstrated that Circ_0008529 contributes to renal tubular cell dysfunction under high glucose stress through the miR-185-5p/SMAD2 pathway in diabetic nephropathy[ 24 ]. Furthermore, circRNA_0017076 modulates epithelial-to- mesenchy -mal transition during renal interstitial fibrosis by acting as a sponge for miR-185-5p[ 25 ]. These discoveries underscore the crucial role of circRNAs in kidney diseases. In our investigation, we noted a considerable increase in the expression of hsa_circ_0013747 in human IgA nephropathy tissue compared to normal kidney tissue. Additionally, we found that circRNA_0013747 can enhance aerobic glycolysis and stimulate the proliferation of mesangial cells by modulating the miR-330-3p/PKM2 signaling axis. In an IgAN mouse model, the administration of adeno-associated virus with mmu_circ_0010297 knockdown led to a substantial reduction in kidney lactate levels, effectively ameliorating kidney damage. These findings indicate that the circRNA_0013747/miR-330-3p/PKM2 pathway could be a valuable target for the early diagnosis and treatment of IgA nephropathy. 2. Methods and materials 2.1 Ethics Approval: The research protocols involving human specimens were granted approval by the Institutional Ethics Committee of Guizhou Medical University, located in Guiyang, China (Approval Number: 2021-43). Patients who participated in the study were recruited from the Affiliated Hospital of Guizhou Medical University in Guiyang, China, and provided written informed consent. Animal experiments were conducted under the authorization of the Institutional Animal Ethics Committee of Guizhou Medical University (Approval Number: 2100031). These studies were carried out in strict adherence to the guidelines outlined in the "Guide for the Care and Use of Laboratory Animals" by the US National Institutes of Health. 2.2 Human tissue specimens We collected fresh kidney tissues from a total of 32 patients from the Nephrology and Urology Departments of the hospital. Sixteen of these patients were pathologically diagnosed with primary IgA nephropathy. The kidney tissues of these patients exhibited significant mesangial proliferation and glomerulosclerosis. These tissues were obtained through percutaneous biopsy under the guidance of ultrasound. The control group included kidney samples from 16 patients who had undergone nephrectomy due to traumatic kidney injury. Tissue samples were taken approximately 5 cm from the injury site and were pathologically confirmed to be normal kidney tissues. After brief flash freezing in liquid nitrogen for 30 seconds, the tissues were stored at a temperature of -80°C. 2.3 Animal model We obtained eighteen female BALB/c mice aged five weeks with weights ranging from 20 to 25 g. These mice were procured from the Laboratory Animal Center at Guizhou Medical University, located in Guiyang, China. They were kept in standard cages in a pathogen-free environment with controlled temperature and humidity conditions. Following a three-day acclimation period, the mice were randomly divided into three groups: "Blank control," "IgAN + AAV-shNC," and "IgAN + AAVsh-mmu_circ_0010297," with six mice in each group. Mice were intraperitoneally administered 2% pentobarbital at a dose of 4 ml/kg for anesthesia. Subsequently, under ultrasound guidance, a solution containing the RNAi adeno-associated virus (AAV) vector-9 was microinjected into the kidneys using a 31G needle. The AAV vector for silencing mmu_circ_0010297 and the negative control AAV vector were obtained from GeneChem in China. One week later, we induced IgAN through oral mucosal immunization. The mice were gavaged with acidified bovine serum albumin (BSA) every other day at a dose of 800 mg/kg. Additionally, they were administered a mixed solution of CCL4 and castor oil (at a 1:5 ratio) subcutaneously every week (0.1 ml) and intraperitoneally every two weeks (0.06–0.08 ml). At weeks 6 and 8, lipopolysaccharide (LPS, 50 µg) was injected into the tail vein. The successful establishment of the IgAN model was confirmed at the end of week 11 via glomerular IgA immunofluorescence. By week 17, the mice were humanely euthanized under anesthesia, and blood, urine, and kidney tissue samples were collected for further analysis. 2.4 Histological analyses Kidney tissues were dehydrated, embedded, and subsequently sectioned at a thickness of 4 mm. To evaluate collagen deposition in the renal sections, Sirius red staining was performed. Immunohistochemistry (IHC) was used to quantify and locate specific proteins within these sections. Images were captured using a microscope and analyzed using ImageJ software. Further information about the antibodies utilized can be found in Table 1 . Table 1 Antibodies Names Manufacturer Cat. No PKM2 Abcam, UK ab150377 collagen IV Abcam, UK ab6586 Fibronectin Abcam, UK ab2413 IgA Abcam, UK ab214003 Tubulin Abcam, UK ab8245 2.5 RNA fluorescence in situ hybridization (RNA FISH) Cells or kidney sections were subjected to a 12-hour incubation with RNA probes in hybridization buffer. The circRNA_0013747 probe was labeled with Cyanine 3 (Cy3), while the miR-330-3p probe was labeled with fluorescein isothiocyanate (FITC). Both probes were obtained from RiboBio, China. 2.6 Immunofluorescence staining Cells and tissues, which were subsequently grown on cover slips, were subjected to a series of steps. The cells were initially fixed using 4% formaldehyde, permeabilized using 0.25% Triton X-100, and blocked quickly with blocking solution. Subsequently, the sections were subjected to overnight incubation at 4°C with primary antibodies targeting IgA, PKM2, collagen IV, or fibronectin. The next day, the cells and tissues were thoroughly washed with PBS containing 0.05% Tween 20 before they were incubated with a fluorescent secondary antibody. DAPI staining was used to visualize the cell nuclei. The prepared samples were stored in a light-protected environment and subsequently examined using a laser confocal microscope at the earliest possible time points. 2.7 Cell culture Human mesangial cells (HMCs) were procured from the American Type Culture Collection (ATCC, USA). The cells were transfected using Lipofectamine RNAiMAX (Invitrogen, USA) with either a circRNA_0013747-specific siRNA obtained from GeneSeed (China) or a negative control. Following transfection, the HMC cells were exposed to LPS. Additionally, cells were transfected with a pLCDH-ciR plasmid containing circRNA_0013747 (GeneSeed, China), a miR-330-3p mimic sourced from RiboBio, China, or a PKM2 siRNA provided by GenePharma, China. After these transfection procedures, the cells were incubated for 24 hours under standard growth conditions before they were transitioned to the experimental media. The harvested cells were used in the subsequent experiments. The specific siRNA sequences used are detailed in Table 2 . Table 2 siRNA sequences siRNA targets circRNA_0013747 siRNA1# circRNA_0013747 siRNA2# GCTGAAACATTAAAGCTATAG AACATTAAAGCTATAGAAAAA PKM2 siRNA Sense Antisense AGT ACC ATG CGG AGA CCA TC GCG TTA TCC AGC GTG ATT TT 2.8 RNA extraction and quantitative real-time PCR (RT‒qPCR) analysis Total RNA was isolated from kidney tissues or cultured cells via the TRIzol method. Subsequently, the extracted RNA was subjected to reverse transcription into cDNA employing a kit sourced from Takara, Japan. RT‒qPCR was performed utilizing SYBR Green reagent (Takara, Japan). The relative gene expression was determined after normalization to the internal control, GAPDH, employing the 2 −ΔΔCt method. For the primer sequences used in the RT‒qPCR experiments, please refer to Supplementary Table 3. Table 3 PCR primer sequences Forward primer (5'-3') Reverse primer(5'-3') CircRNA_0013747 GTCAAAGATGTATATTCCTCT TGCTCTGGAACCATCTGCTCC MiR-330-3p GCGGCGGGCAAAGCACACGGCC ATCCAGTGCAGGGTCCGAGG PKM2 TCGCATGCAGCACCTGATT CCTCGAATAGCTGCAAGTGGTA GAPDH TGTGGGCATCAATGGATTTGG ACACCATGTATTCCGGGTCAAT 2.9 Western blot (WB) analysis Proteins were extracted from tissues and cells using lysis buffer, and the total protein concentration was determined with a BCA kit (Beyotime Biotechnology, China). In brief, after the proteins were transferred to PVDF membranes, the membranes were blocked with 5% nonfat milk for one hour. The membranes were then incubated with the diluted primary antibody overnight at 4°C. On the following day, the secondary antibody was applied, and the samples were incubated at room temperature for an hour. The protein bands were visualized using the ECL method, and their intensity was quantified using a gel imaging system. Specific information about the antibodies utilized can be found in Table 1 . 2.10 Cell viability assay HMCs were seeded in 96-well plates and subjected to treatment with 10 µL of Cell Counting Kit-8 (CCK-8) reagent (Dojindo, Japan) per well. After incubation at 37°C in a controlled atmosphere, the optical density (OD450) was determined using a microplate reader (Bio-Rad, USA) on Days 1, 2, 3, 4, 5, and 6 following treatment. To evaluate the number of apoptotic cells, 1×10 6 cells from each group were rinsed with PBS and subsequently stained with PE-conjugated Annexin V and 7AAD dyes. Flow cytometry was used to quantify apoptotic cells using a Becton Dickinson instrument located in Guiyang, China. 2.11 Lactate production, glucose uptake, and ATP levels The glucose level was measured using a glucose assay kit from Merck KGaA, Germany. The lactate level was determined using a Lactate Assay Kit (Merck KGaA, Germany). ATP levels were assessed using the Luminescent ATP Detection Assay from Abcam, UK. 2.12 RNA pull‑down assay Streptavidin-coated magnetic beads (Thermo Fisher Scientific, USA) were conjugated with biotin-labeled CircRNA_0013747 probes or control probes (RiboBio, China). Subsequently, these conjugates were mixed with cell lysates. After incubation, the bound RNAs were isolated and analyzed by RT–qPCR to determine the expression levels of circRNA_0013747 and miR-330-3p. 2.13 Dual‑luciferase reporter assay Following transfection with either the pmiRGLO-CircRNA_0013747-wt plasmid or the pmiRGLO-CircRNA_0013747-Mut plasmid (GeneSeed, China), the cells were cotransfected with either a control or a miR-330-3p mimic (GeneSeed, China). After 48 hours of transfection, luciferase activity was assessed using a Dual-Luciferase Reporter Assay Kit (Promega, USA). The reporter activity was determined based on both firefly and Renilla luciferase activities. 2.14 Statistical analysis Group differences were assessed via one-way ANOVA, followed by the least significant difference test for post hoc comparisons. The linear relationship between circRNA-0013747 and miR-330-3p expression in kidney tissues was analyzed using Spearman's correlation coefficient. The data are presented as the means ± SDs. All of the statistical analyses were performed using GraphPad Prism 7 software (GraphPad Software, USA), and the statistical significance was set at *P < 0.05. 3. Results 3.1 Circ_0013747 expression is markedly elevated in human IgA nephropathy tissues Dysregulated gene expression is a contributing factor in the pathogenesis of various diseases. In our research, we examined 16 pairs of human IgA nephropathy tissues and compared them to normal renal tissues to evaluate the expression of Circ_0013747. Our staining analysis revealed a substantial increase in Sirius red staining and IgA immunofluorescence in the IgA nephropathy group compared with the normal control group. This elevated staining indicated heightened deposition of IgA and collagen, suggesting more severe pathological damage (Fig. 1 A). CircRNA_0013747 is generated from the exon of MAN1A2 through a process known as backsplicing, forming a 509-nucleotide circular structure, as illustrated in Supplementary Fig. S1 . To specifically detect and quantify circRNA_0013747, we developed a tailored fluorescent probe. Notably, compared with that in control tissues, the fluorescence intensity in targeted IgA nephropathy tissues was significantly greater. Additionally, we designed specific PCR primers for circRNA_0013747 and applied RT‒qPCR to assess its expression levels in 16 paired IgAN and normal renal tissues. These results convincingly demonstrated elevated expression of circ_0013747 in IgAN tissues compared to normal tissues, as depicted in Fig. 1 B. The circular structure of circRNA is more stable than the structure of linear RNA. While RNase R can effectively degrade linear RNA, it is incapable of cleaving circRNA. Our use of RNase R unequivocally confirmed the circular nature of circRNA_0013747; this circRNA exhibited remarkable resistance to RNase R digestion, notably outperforming the linear MAN1A2 transcript, as depicted in Fig. 1 C. Furthermore, upon assessing RNA stability following treatment with the transcription inhibitor actinomycin D, it became evident that circRNA_0013747 displayed significantly enhanced stability when compared with the linear MAN1A2 mRNA transcript in human IgA nephropathy tissues, as illustrated in Fig. 1 D. These findings underscore the upregulation of circRNA_0013747 in IgA nephropathy tissues. 3.2 Silencing of CircRNA_0013747 mitigates the proliferation of mesangial cells induced by lipopolysaccharide (LPS). IgAN is fundamentally an inflammatory disorder in which persistent inflammation drives the proliferation of glomerular mesangial cells, ultimately leading to substantial collagen deposition and glomerular sclerosis. Lipopolysaccharide (LPS), a primary component of the outer membrane in gram-negative bacteria that is composed mainly of lipids and polysaccharides, is the gold standard for simulating acute inflammation due to its ease of control, reproducibility, and well-defined systemic effects. To determine the role of CircRNA_0013747 in inflammation-triggered mesangial cell proliferation, we downregulated its expression in LPS-stimulated human mesangial cells (HMCs). RT‒qPCR analysis revealed that LPS induced significant upregulation of circRNA_0017076 in HMCs, and this change was effectively reversed by siRNA treatment (Fig. 2 A). Concurrently, the CCK-8 assay results illustrated that LPS amplified the proliferation of HMCs, whereas the inhibition of CircRNA_0013747 significantly suppressed this effect (Fig. 2 B). Moreover, the flow cytometry results, which evaluated both apoptosis levels and cell cycle progression, were consistent with the CCK-8 assay results (Fig. 2 C and 2 D). Activated mesangial cells are known to produce notable quantities of collagen IV and fibronectin, both of which are major contributors to the development of glomerular sclerosis and the loss of renal function. Western blot and immunofluorescence analyses demonstrated a substantial increase in the levels of Collagen IV and fibronectin in LPS-exposed cells. However, the suppression of circRNA_0017076 effectively mitigated the LPS-induced upregulation of both proteins (Fig. 3 E, F). Collectively, these findings strongly suggest the pivotal role of circRNA_0013747 in regulating HMC proliferation. 3.3 CircRNA_0013747 silencing results in downregulated PKM expression and a decrease in LPS-induced aerobic glycolysis in mesangial cells Emerging evidence suggests that aerobic glycolysis may serve as a pivotal driver of pathological mesangial cell proliferation[ 26 ]. Many chronic kidney diseases characterized by mesangial hyperplasia commonly exhibit elevated glucose consumption and lactic acid accumulation. The results demonstrated a significant increase in glucose uptake and a concurrent increase in ATP and lactate production in HMCs when exposed to LPS. However, the effective silencing of circRNA_0013747 almost entirely reversed the stimulatory effect of LPS on HMCs (Fig. 3 A, B, C). These findings strongly suggest that the activation of aerobic glycolysis might be one of the key factors contributing to the promotion of mesangial cell proliferation by circRNA_0013747. Key glycolysis enzymes, including PKM2, HK2, and PFK1, are known to be strongly involved in a wide range of cellular physiological functions and pathological processes. In our study, stimulation with LPS led to a notable increase in the expression of these three pivotal enzymes in HMCs. However, upon transfection with siRNA specifically targeting circRNA_0013747, we observed a significant reduction in PKM2 expression, with minimal effects on HK2 and PFK1 (as depicted in Fig. 3 D). These findings strongly indicate that PKM2 is a crucial downstream regulatory signaling molecule influenced by circRNA_0013747. To further investigate the connection between PKM2 and circRNA_0013747, we assessed PKM2 mRNA levels in 16 paired kidney tissues. Intriguingly, compared with those in the normal tissue, PKM2 mRNA levels in the IgAN tissue were significantly greater (see Fig. 3 H). Subsequent Spearman correlation analyses revealed a robust positive correlation between circRNA_0013747 and PKM2 mRNA levels (P < 0.001, r = 0.833; as depicted in Fig. 3 I, J). Furthermore, the immunohistochemistry results provided additional support for these findings, as there was a conspicuous increase in PKM2 expression levels in IgA kidney biopsy samples compared to those in normal kidney tissue (refer to Fig. 3 G). These combined results strongly suggest that PKM2 plays a pivotal role in the circRNA_0013747-induced process of aerobic glycolysis. 3.4 Silencing PKM2 attenuates circRNA-0013747-induced glycolysis and proliferation in mesangial cells To investigate the influence of PKM2 on circRNA-0013747-induced glycolysis and proliferation, siRNA targeting PKM2 was cotransfected into HMC cells overexpressing circRNA-0013747. The mRNA and protein expression data revealed that the overexpression of circRNA-0013747 significantly upregulated PKM2, but this effect was subsequently suppressed by siRNA targeting PKM2 (as shown in Fig. 4 A, B, C). Cell viability, as assessed by the CCK-8 assay, indicated that the increase in cell activity resulting from the overexpression of circRNA-0013747 was counteracted by PKM2 knockdown (Fig. 4 D). The findings obtained from flow cytometry, which assessed both apoptosis levels and cell cycle progression, were in line with the outcomes of the CCK-8 assay (Fig. 4 E, F). Furthermore, the increase in circRNA_0013747 expression led to a significant increase in glucose uptake and a concurrent increase in ATP and lactate production in HMC cells, and these effects were partially offset by PKM2 silencing (Fig. 4 G, H, I). All of these findings collectively emphasize the critical importance of PKM2 in mediating the promotion of glycolysis and proliferation in mesangial cells via circRNA-0013747. 3.5 MiR-330-3p mediates the positive regulatory effect of circRNA-0013747 on PKM2 CircRNAs primarily act as miRNA sponges, exerting regulatory effects on genes. Therefore, we hypothesized that certain miRNAs might mediate the regulatory effect of circRNA-0013747 on PKM2. Using bioinformatics analysis via miRTarBase, we identified more than 100 miRNAs that potentially interact with PKM2 in HMC cells (Fig. 5 A). The CircInteractome database lists several miRNAs as potential targets of circRNA-0013747 (Fig. 5 B). Among these candidates, miR-184, miR-330, and miR-887 were found in both categories (Fig. 5 C). Importantly, the upregulation of circRNA-0013747 in HMC cells significantly inhibited miR-330-3p expression, while miR-184 and miR-887 expression remained unchanged (Fig. 5 D), indicating that miR-330-3p may be a crucial downstream target of circRNA-0013747. To investigate the direct RNA interactions in this study, we conducted additional experiments. The FISH assay confirmed the colocalization of circRNA_0013747 and miR-330-3p in both mesangial cells and human renal glomerular tissues (Fig. 6 A). Furthermore, a circRNA_0013747-specific probe showed enrichment of both circRNA_0013747 and miR-330-3p (Fig. 6 B), indicating that circRNA_0013747 targets miR-330-3p in HMC cells. To validate this interaction, we generated wild-type and mutant dual-luciferase reporter vectors for circRNA_0013747 based on the potential binding sites of miR-330-3p and circRNA_0013747. We cotransfected a miR-330-3p mimic or a negative control (NC) mimic with the luciferase reporter into human embryonic kidney 293 (HEK293) cells. The overexpression of miR-330-3p reduced the luciferase activity of the wild-type reporters but had no effect on the luciferase activity of the mutant reporters (Fig. 6 C). In a separate experiment using dual-luciferase reporter vectors for PKM2, miR-330-3p mimics decreased the luciferase activity of the reporter (Fig. 6 D). These results confirmed that circRNA_0013747 functions as a miR-330-3p sponge and that miR-330-3p directly binds to the 3' UTR of PKM2 mRNA. 3.6 Knockdown of Mmu_circ_0010297 alleviates renal damage caused by IgA nephropathy in mice Mmu_circ_0010297, which is the homologous circular RNA of hsa_circ_0013747, originates from the primary transcript of the MAN1A2 gene (gene symbol). In our study, we randomly assigned 18 BALB/c mice to three groups: "Blank Control", "IgAN + AAV-shNC", and "IgAN + AAVsh-mmu_circ_0010297". We utilized AAV9-sh-Mmu_circ_0010297 to suppress the expression of mmu_circ_0010297 in the kidneys of BALB/c mice. As a control, another group of mice received an injection of an empty AAV9 vector. Subsequently, both sets of mice were induced with IgA models and compared with untreated BALB/c mice. RT‒qPCR analysis revealed increased expression of Mmu_circ_0010297 in the kidneys of the IgAN + AAV-shNC group compared to that in the blank control group. This elevation was notably reduced following treatment with AAVsh-mmu_circ_0010297, as illustrated in Fig. 7 A. Concurrent with the decrease in Mmu_circ_0010297, there was a significant reduction in lactate levels within the kidneys of the AAVsh-mmu_circ_0010297 group, as shown in Fig. 7 B. Western blot analysis revealed that the increased expression of PKM2, fibronectin, and collagen IV in the IgAN model group was reversed in the IgAN + AAV-sh-mmu_circ_0010297 group, as depicted in Fig. 7 C. Sirius Red staining clearly revealed that, compared with the AAV-sh-NC mice, the mmu_circ_0010297 knockdown mice showed notably less glomerulosclerosis. Furthermore, the FISH results revealed a significant decrease in miR-330-3p levels in the kidneys of the AAV-shNC group compared to those in the control group. This decrease was effectively counteracted following treatment with AAVsh-mmu_circ_0010297. The results of immunohistochemistry assays for collagen IV in kidney tissues from all three groups were consistent with the Western blot findings, as shown in Fig. 7 D. IgA nephropathy typically presents with severe kidney dysfunction characterized by increasing levels of blood urea nitrogen (BUN), serum creatinine (Scr), and uric acid (UA) and 24-hour proteinuria (24 h-pro) as the disease progresses. Biochemical analysis demonstrated a reduction in the levels of these elevated markers in the IgAN + AAV-sh-mmu_circ_0010297 group compared to those in the IgAN model group. Additionally, positive correlations between mmu_circ_0010297 and BUN levels, Scr levels, UA levels, and 24 h-pro levels were detected using Spearman's correlation, as depicted in Fig. 7 E and F. In summary, these findings collectively suggest that inhibiting Mmu_circ_0010297 mitigates the renal damage caused by IgA nephropathy in mice. 4. Discussion In mature organisms, quiescent cells typically exhibit heightened replication rates during tumorigenesis or as part of the tissue repair process following injury [ 27 ]. Within the renal glomerulus, various forms of injury can incite localized inflammatory reactions involving resident glomerular cells. These injuries may arise from immune-mediated responses, infections, toxins, mechanical stress, or other causative factors [ 28 ]. A prominent histopathological feature of numerous human and experimental glomerular inflammatory conditions is an increase in cellular density within the mesangium. This increase is attributed to the proliferation of mesangial cells (MCs) and the influx of leukocytes [ 29 ]. Irrespective of the specific injury mechanism, an early and pivotal factor in the development of progressive glomerular injury and glomerulosclerosis seems to be an imbalance in regulating MC proliferation. In experimental models of nephritis, MC proliferation frequently precedes and correlates with an increase in the accumulation of extracellular matrix (ECM) within the mesangium and the subsequent development of glomerulosclerosis [ 30 – 31 ]. Moreover, interventions that reduce cell proliferation in glomerular disease models, such as treatment with heparin, a low-protein diet, or the use of neutralizing antibodies against platelet-derived growth factor, have been demonstrated to mitigate ECM expansion and sclerotic changes[ 32 ]. Notably, a reduction in MC replication is correlated with a marked decrease in mesangial ECM accumulation and diminished deposition of collagen type IV, laminin, and fibronectin [ 33 ]. However, the specific molecular mechanisms underlying the abnormal proliferation of mesangial cells in various types of nephritis, including IgA nephropathy, have yet to be fully elucidated. In the 1920s, Otto Warburg and his colleagues made an important observation that tumors exhibit an unusually high rate of glucose uptake in comparison to the surrounding tissue. Furthermore, they noted that glucose was metabolized to produce lactate even when oxygen was present, which led to the coining of the term "aerobic glycolysis."[ 34 ]. The Warburg effect has been postulated to be an adaptive mechanism aimed at fulfilling the biosynthetic demands associated with uncontrolled cell proliferation. In this context, increased glucose consumption serves as a carbon source for the anabolic processes required to facilitate cell proliferation. Excess carbon is allocated for the synthesis of new nucleotides, lipids, and proteins and can be channeled into various branching pathways that stem from glycolysis[ 35 – 36 ]. Furthermore, the Warburg effect may offer a growth advantage to cells within a multicellular environment[ 37 ]. However, the reason behind this relatively inefficient metabolic pathway in tumor cells remains unclear. However, current research points to mitochondrial dysfunction in cancer cells and changes in essential enzymes such as pyruvate kinase (PK), which are involved in glycolysis[ 38 ]. PK plays a crucial role in glycolysis by catalyzing the final and physiologically irreversible step, which involves converting phosphoenolpyruvate into pyruvate through the transfer of a phosphate group to adenosine diphosphate [ 39 ]. In mammals, there are four distinct PK isoforms encoded by two genes. The PKLR gene encodes PKL and PKR. The PKM gene encodes PKM1 and PKM2 through alternative splicing, utilizing mutually exclusive exons that are the same length but encode a 56-amino acid region differing at 22 residues[ 40 ]. PKM2 is universally expressed during embryogenesis, regeneration, and cancer development. This observation implies that the capacity to regulate pyruvate kinase enzymatic activity is a crucial factor in actively proliferating cells[ 41 ]. Numerous studies have indicated that elevated levels of PKM2 in circulation could serve as a diagnostic marker for various cancer types. Furthermore, the overexpression of PKM2 is positively correlated with tumor progression, primarily owing to its involvement in glycolysis, proliferation, and apoptosis[ 42 ]. A reduction in PKM2 expression has been demonstrated to lower the glycolytic rate and inhibit tumor growth in various types of cancer. Administering the PKM2 activator TEPP-46 to H1299 xenograft model mice resulted in a delay in tumor onset and the development of smaller tumors compared to those in control mice that received a vehicle[ 43 ]. Similarly, the deletion of PKM2 in a xenograft mouse model of NCI-N87 cells led to the formation of smaller tumors than those formed in the control counterparts[ 44 ]. Intriguingly, an expanding body of literature offers substantiating evidence regarding the potential of PKM2 as a biomarker for nephrotoxicity. This growing interest in revealing the possible involvement of PKM2 in renal diseases is well founded. In a recent study, the induction of nephrotoxicity in rats through cisplatin led to a notable increase in urinary PKM2 levels, which coincided with elevated lactate excretion and significant alterations in amino acids, glucose, and TCA intermediates within the urine. Correspondingly, renal tubular HK-2 cells exposed to cisplatin, as well as other nephrotoxic agents such as cyclosporine A, exhibited increased PKM2 secretion in conditioned media[ 45 ]. Furthermore, Chen et al. reported that PKM2 contributes to kidney fibrosis, particularly during the transition from acute kidney injury to chronic kidney disease[ 46 ]. These collective findings underscore PKM2 as a substantial contributor to renal function and a potential novel marker for nephrotoxicity. These discoveries suggest that targeting PKM2 could represent an innovative strategy for the prevention and treatment of renal diseases. In our study, we noted a significant increase in lactate and PKM2 expression in the kidneys of IgA model mice. Silencing PKM2 resulted in pronounced inhibition of LPS-induced aerobic glycolysis and proliferation in human mesangial cells. Notably, the expression of PKM2 gradually diminishes during the transition from embryonic development to mature tissue. However, PKM2 expression resurfaces during tissue repair and tumor growth, implying that its regulation in tissue cells is strictly controlled by molecular regulation. Research has demonstrated that miRNAs can bind to PKM2 mRNA, effectively suppressing its expression during gene translation. This suppression can decelerate cellular glycolysis and hinder tumor growth. Hence, there is a growing focus on the regulation of PKM2 by noncoding genes. Unlike the majority of linear messenger RNAs and long noncoding RNAs, which are characterized by 5′ N7-methylguanosine caps at the beginning and 3′ polyadenylated tails at the end, circular RNAs represent a distinct class of RNA molecules[ 47 ]. Circular RNAs are characterized by their unique feature of being covalently closed single-stranded RNAs. These circular RNAs have recently gained recognition as a prevalent category of RNA species[ 48 ]. The circular nature of single-stranded RNA was initially observed in plant viroids, and subsequently, circular transcripts were discovered in eukaryotes through electron microscopic evidence, revealing a circular morphology despite their unknown functions[ 49 ]. In the 1980s, other examples of circular RNA genomes were identified, as was the case for the hepatitis δ virus. Over the past decade, the emergence of RNA sequencing technologies, enriched for nonpolyadenylated and circular transcriptomes, along with computational tools for circular RNA annotation, has revealed the widespread expression of circRNAs across various metazoan cell types and tissues[ 50 ]." A groundbreaking discovery in 2013 highlighted the ability of circRNAs to act as "molecular sponges" that bind and inhibit corresponding miRNAs and consequently enhance the expression of the miRNA target genes[ 51 ]. Liao et al. reported that circRNA_45478, which functions as a miR-190a-5p sponge, exacerbates ischemic acute kidney injury[ 52 ]. Furthermore, circPlekha7 inhibits the epithelial-to-mesenchymal transition of renal tubular epithelial cells by targeting miR-493-3p to derepress KLF4 expression[ 53 ]. Recent comparisons of urinary circRNA profiles between IgAN patients and healthy controls highlighted the upregulation of circRNA_0013747 in IgAN patients, with an associated expression pattern with PKM2[ 54 ]. These findings suggested that circRNA_0013747 may play an important role in the onset and progression of IgA nephropathy. In our study, we demonstrated that circRNA_0013747 was significantly upregulated in the kidney tissue of IgA nephropathy patients and promoted mesangial cell proliferation through the induction of PKM2-mediated aerobic glycolysis. Our results confirm the central role of the circRNA_0013747/miR-330-3p/PKM2 axis in driving aerobic glycolysis and mesangial cell proliferation in IgAN. Nevertheless, our study has certain limitations. We did not investigate the relationship between circRNA_0013747 expression and clinicopathological parameters such as mesangial IgA deposition and renal interstitial lymphocyte infiltration. The exact distribution of circRNA_0013747 in the kidney has not been determined, and its specific impact on mesangial cells has yet to be determined. Finally, whether this molecular target can be applied in clinical diagnosis and treatment requires further investigation. To summarize, our research provides a novel perspective by suggesting that the Warburg effect may not only be central to tumor cell proliferation but also to the proliferation of mesangial cells. These findings indicated that circRNA_0013747 was elevated in IgAN tissues and induced mesangial cell proliferation and the Warburg effect by regulating the miR-330-3p/PKM2 signaling pathway. Therefore, our study suggested that circRNA_0013747 could serve as a promising new biological marker and therapeutic target for IgAN. Declarations Conflicts of Interest The authors declare that they have no conflicts of interest. Author Contribution Zou drafted the article, and Zhang revised the article. Acknowledgement The current work was supported by the National Natural Science Foundation of China (No. 82160137 and No. 82360147) and the Natural Science Foundation of Guizhou Province, China (QianKeHeJiChu-ZK[2022] General 409 and [2020] 1Y305). Availability of data and materials The datasets obtained and analyzed during the current study were made available from the corresponding authors through request. References Floege J, Amann K(2016)Primary glomerulonephritides. Lancet 387(1003 2) :2036–2048 Selvaskandan H, Gonzalez-Martin G, Barratt J, Cheung CK(2022)IgA nephropathy: an overview of drug treatments in clinical trials. Expert Opin Investig Drugs 31(12):1321–1338 Maixnerova D, Tesar V(2020)Emerging Modes of Treatment of IgA Nephropathy. Int J Mol Sci 21(23):9064 Rajasekaran A, Julian BA, Rizk DV(2021)IgA Nephropathy: An Interesting Autoimmune Kidney Disease. Am J Med Sci 361(2):176–194 Zhao L, Lan Z, Peng L et al(2022)Triptolide promotes autophagy to inhibit mesangial cell proliferation in IgA nephropathy via the CARD9/p38 MAPK pathway. Cell Prolif 55(9):e13278 Nihei Y, Suzuki H, Suzuki Y(2023)Current understanding of IgA antibodies in the pathogenesis of IgA nephropathy. Front Immunol 14:1165394 Luvizotto MJ, Menezes-Silva L, Woronik V, Monteiro RC, Câmara NOS (2022) Gut-kidney axis in IgA nephropathy: Role on mesangial cell metabolism and inflammation. Front Cell Dev Biol 10:993716 Selvaskandan H, Shi S, Twaij S, Cheung CK, Barratt J (2020) Monitoring Immune Responses in IgA Nephropathy: Biomarkers to Guide Management. Front Immunol 2020;11:572754 Shimizu K, Matsuoka Y(2019)Regulation of glycolytic flux and overflow metabolism depending on the source of energy generation for energy demand. Biotechnol Adv 37(2):284–305 Perry RJ, Wang Y, Cline GW et al (2018) Leptin Mediates a Glucose-Fatty Acid Cycle to Maintain Glucose Homeostasis in Starvation. Cell 172(1–2):234–248e17 Zhang HY, Fan ZL, Wang TY (2021) Advances of Glycometabolism Engineering in Chinese Hamster Ovary Cells. Front Bioeng Biotechnol 9:774175 WARBURG O (1956) On the origin of cancer cells. Science 123(3191):309–314 Liberti MV, Locasale JW (2016)The Warburg Effect: How Does it Benefit Cancer Cells? Trends Biochem Sci 41(3):211–218 Wang JZ, Zhu W, Han J et al (2021) The role of the HIF-1α/ALYREF/PKM2 axis in glycolysis and tumorigenesis of bladder cancer. Cancer Commun (Lond) 41(7):560–575 Li TE, Wang S, Shen XT et al (2020)PKM2 Drives Hepatocellular Carcinoma Progression by Inducing Immunosuppressive Microenvironment. Front Immunol 11:589997 Zhu S, Guo Y, Zhang X et al (2021) Pyruvate kinase M2 (PKM2) in cancer and cancer therapeutics. Cancer Lett 503:240–248 Dey P, Kundu A, Sachan R et al (2019) PKM2 Knockdown Induces Autophagic Cell Death via AKT/mTOR Pathway in Human Prostate Cancer Cells. Cell Physiol Biochem 52(6):1535–1552 Li M, Jia F, Zhou H, Di J, Yang M (2018) Elevated aerobic glycolysis in renal tubular epithelial cells influences the proliferation and differentiation of podocytes and promotes renal interstitial fibrosis. Eur Rev Med Pharmacol Sci 22(16):5082–5090 Wu J, Rong S, Zhou J, Yuan W (2021) The role and mechanism of PKM2 in the development of LPS-induced acute kidney injury. Histol Histopathol 36(8):845–852 Zhou WY, Cai ZR, Liu J et al (2020) Circular RNA: metabolism, functions and interactions with proteins. Mol Cancer 19(1):172 Zhang ZH, Wang Y, Zhang Y et al (2023) The function and mechanisms of action of circular RNAs in Urologic Cancer. Mol Cancer 22(1):61 Fontemaggi G, Turco C, Esposito G, Di Agostino S (2021) New Molecular Mechanisms and Clinical Impact of circRNAs in Human Cancer. Cancers (Basel) 13(13):3154 Memczak S, Jens M, Elefsinioti A et al (2013) Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 495(7441):333–338 Niu Z, Ren G, Huang L, Mu L (2023) Circ_0008529 Contributes to Renal Tubular Cell Dysfunction in High Glucose Stress via miR-185-5p/SMAD2 Pathway in Diabetic Nephropathy. Biochem Genet 61(3):963–978 Zhang F, Zou H, Li X et al (2023) CircRNA_0017076 acts as a sponge for miR-185-5p in the control of epithelial-to-mesenchymal transition of tubular epithelial cells during renal interstitial fibrosis. Hum Cell 36(3):1024–1040 Xu WL, Liu S, Li N et al (2021) Quercetin Antagonizes Glucose Fluctuation Induced Renal Injury by Inhibiting Aerobic Glycolysis via HIF-1α/miR-210/ISCU/FeS Pathway. Front Med (Lausanne) 8:656086 Ahmed MB, Alghamdi AAA, Islam SU, Ahsan H, Lee YS (2023) The Complex Roles of DNA Repair Pathways, Inhibitors, Hyperthermia, and Contact Inhibition in Cell Cycle Halts. Mini Rev Med Chem 23(5):514–529 Wada T, Matsushima K, Kaneko S (2008) The role of chemokines in glomerulonephritis. Front Biosci 13:3966–3974 Shimizu F, Kawachi H, Orikasa M (1999) Role of mesangial cell damage in progressive renal disease. Kidney Blood Press Res 22(1–2):5–12 Kurogi Y (2003) Mesangial cell proliferation inhibitors for the treatment of proliferative glomerular disease. Med Res Rev 23(1):15–31 Kusaba G, Ohsawa I, Ishii M et al (2012) Significance of broad distribution of electron-dense deposits in patients with IgA nephropathy. Med Mol Morphol 45(1):29–34 Johnson RJ, Raines EW, Floege J, Yoshimura A, Pritzl P, Alpers C, Ross R (1992) Inhibition of mesangial cell proliferation and matrix expansion in glomerulonephritis in the rat by antibody to platelet-derived growth factor. J Exp Med 175(5):1413–1416 Adeva-Andany MM, Carneiro-Freire N (2022) Biochemical composition of the glomerular extracellular matrix in patients with diabetic kidney disease. World J Diabetes 13(7):498–520 Vaupel P, Multhoff G (2021) Revisiting the Warburg effect: historical dogma versus current understanding. J Physiol 599(6):1745–1757 Koppenol WH, Bounds PL, Dang CV(2011)Otto Warburg's contributions to current concepts of cancer metabolism. Nat Rev Cancer 11(5):325–337 Fukushi A, Kim HD, Chang YC, Kim CH (2022) Revisited Metabolic Control and Reprogramming Cancers by Means of the Warburg Effect in Tumor Cells. Int J Mol Sci 23(17):10037 Schwartz L, Supuran CT, Alfarouk KO (2017) The Warburg Effect and the Hallmarks of Cancer. Anticancer Agents Med Chem 17(2):164–170 Li T, Han J, Jia L, Hu X, Chen L, Wang Y (2019) PKM2 coordinates glycolysis with mitochondrial fusion and oxidative phosphorylation. Protein Cell 10(8):583–594 Yang W, Lu Z(2015)Pyruvate kinase M2 at a glance. J Cell Sci 128(9):1655–1660 Lee YB, Min JK, Kim JG et al (2022) Multiple functions of pyruvate kinase M2 in various cell types. J Cell Physiol 237(1):128–148 Wang G, Yu Y, Wang YZ, Zhu ZM, Yin PH, Xu K (2020) Effects and mechanisms of fatty acid metabolism-mediated glycolysis regulated by betulinic acid-loaded nanoliposomes in colorectal cancer. Oncol Rep 44(6):2595–2609 Ji X, Lv C, Huang J, Dong W, Sun W, Zhang H (2023) )ALKBH5-induced circular RNA NRIP1 promotes glycolysis in thyroid cancer cells by targeting PKM2. Cancer Sci 114(6):2318–2334 Lin H, Han H, Yang M et al(2023)PKM2/PDK1 dual-targeted shikonin derivatives restore the sensitivity of EGFR-mutated NSCLC cells to gefitinib by remodeling glucose metabolism. Eur J Med Chem 249:115166 Wang C, Jiang J, Ji J et al (2017) )PKM2 promotes cell migration and inhibits autophagy by mediating PI3K/AKT activation and contributes to the malignant development of gastric cancer. Sci Rep 7(1):2886 Kim SY, Sohn SJ, Won AJ, Kim HS, Moon A(2014)Identification of noninvasive biomarkers for nephrotoxicity using HK-2 human kidney epithelial cells. Toxicol Sci 140(2):247–258 Chen Y, Bai X, Chen J et al (2024) Pyruvate kinase M2 regulates kidney fibrosis through pericyte glycolysis during the progression from acute kidney injury to chronic kidney disease. Cell Prolif 57(2):e13548 Li H (2023) )circRNA: a promising all-around star in the future. Epigenomics 15(12):677–685 Yu T, Wang Y, Fan Y et al(2019)CircRNAs in cancer metabolism: a review. J Hematol Oncol 12(1):90 Li Z, Huang C, Bao C et al (2015)Exon-intron circular RNAs regulate transcription in the nucleus. Nat Struct Mol Biol 22(3):256–264 Chen L, Wang C, Sun H et al (2021)The bioinformatics toolbox for circRNA discovery and analysis. Brief Bioinform 22(2):1706–1728 Hansen TB, Jensen TI, Clausen BH et al (2013)Natural RNA circles function as efficient microRNA sponges. Nature 495(7441):384–388 Liao Y, Peng X, Li X et al (2022)CircRNA_45478 promotes ischemic AKI by targeting the miR-190a-5p/PHLPP1 axis. FASEB J 36(12):e22633 Zhou W, Chen YX, Ke B et al (2022) )circPlekha7 suppresses renal fibrosis via targeting miR-493-3p/KLF4. Epigenomics 14(4):199–217 Luan R, Tian G, Ci X et al (2021)Differential expression analysis of urinary exosomal circular RNAs in patients with IgA nephropathy. Nephrol (Carlton) 26(5):432–441 Supplementary Figure and Table Supplementary Figure 1 and Supplementary Table 3 are not available with this version. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3996101","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":275352193,"identity":"3ae3e962-a68e-43ad-88b8-bdd307ac68ce","order_by":0,"name":"Huimei Zou","email":"","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Huimei","middleName":"","lastName":"Zou","suffix":""},{"id":275352194,"identity":"4486df26-424f-47d0-a2c1-79f73ce51e49","order_by":1,"name":"Peilei Chen","email":"","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Peilei","middleName":"","lastName":"Chen","suffix":""},{"id":275352195,"identity":"b3669042-f8c6-4de6-94a6-3fe9d2d67c2c","order_by":2,"name":"Wenli Deng","email":"","orcid":"","institution":"The First People’s Hospital of Guiyang","correspondingAuthor":false,"prefix":"","firstName":"Wenli","middleName":"","lastName":"Deng","suffix":""},{"id":275352196,"identity":"5c594886-d98a-4458-81ef-4c8bcc81ea6c","order_by":3,"name":"Lu Liu","email":"","orcid":"","institution":"Guizhou Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Liu","suffix":""},{"id":275352197,"identity":"ab08054e-e5bf-453c-abc9-a4ea8fd2dc95","order_by":4,"name":"Miao Liu","email":"","orcid":"","institution":"Affiliated Hospital of Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Miao","middleName":"","lastName":"Liu","suffix":""},{"id":275352198,"identity":"fd5c45d6-4fef-4cd3-a2d3-4f4b8be92ac0","order_by":5,"name":"Lifen Xu","email":"","orcid":"","institution":"Affiliated Hospital of Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lifen","middleName":"","lastName":"Xu","suffix":""},{"id":275352199,"identity":"db3d3336-bdbd-402d-af44-712b6565b295","order_by":6,"name":"Yin Xie","email":"","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yin","middleName":"","lastName":"Xie","suffix":""},{"id":275352200,"identity":"15a1a907-86da-436a-9098-cb96666841b6","order_by":7,"name":"Min Chen","email":"","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Chen","suffix":""},{"id":275352201,"identity":"61405194-c40e-46bf-879d-6052b8928074","order_by":8,"name":"Jie Yu","email":"","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Yu","suffix":""},{"id":275352202,"identity":"7793526a-7746-4c05-8cec-b55f7dd14141","order_by":9,"name":"Yingqin Luo","email":"","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yingqin","middleName":"","lastName":"Luo","suffix":""},{"id":275352203,"identity":"52f8085e-ca5a-4596-b9f2-6d8e2e3fe8e8","order_by":10,"name":"Xingmei Liu","email":"","orcid":"","institution":"Guizhou Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xingmei","middleName":"","lastName":"Liu","suffix":""},{"id":275352204,"identity":"d04fae3f-c54a-45cd-a7a2-4a3c418c9604","order_by":11,"name":"Jun Liu","email":"","orcid":"","institution":"Affiliated Hospital of Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Liu","suffix":""},{"id":275352205,"identity":"77f789b5-0e77-416f-af0d-4cf26c97970c","order_by":12,"name":"Fan Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4ElEQVRIiWNgGAWjYDAC5gMMDAkVNvX8IDZxWtgSGBgenElLkGyAauEhRgvjw7bDCQYHiNUi38b87EFiW1qe8Y3kg58LGO7I2RPSwtjGZm6QcM6m2OxGWrL0DIZnxgRtYZZvMJNIKEtj3HYjx0Cah+FwYg9Br7Cxf5NIYDvMuHlG/uffQC31BLXwsPEAbWk7nLhBIocNZEsCQYdJsPGUSSScSTOWOPPMzJrH4LBhzwECWuTb2LdJ/qiwkeNvT358m6fisDx7AyFr4EAgAUgYEK0cBPgJOWgUjIJRMApGLAAA+eU82pfEUkAAAAAASUVORK5CYII=","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"Fan","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-02-28 08:33:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3996101/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3996101/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52029299,"identity":"02bd8adc-20e0-41c4-ae6f-5b4a8aa91f33","added_by":"auto","created_at":"2024-03-05 16:17:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4246148,"visible":true,"origin":"","legend":"\u003cp\u003eEnhanced expression of circRNA_0013747 in kidney biopsy samples from IgA nephropathy patients\u003c/p\u003e\n\u003cp\u003eA: Kidney sections obtained from patients with kidney diseases (patients 1-6) were subjected to Sirius red staining and immunofluorescence staining for IgA. Additionally, in situ hybridization was employed to examine the expression and localization of circRNA_0013747. B: The levels of circRNA_0013747 were evaluated in 16 pairs of kidney tissues from individuals with IgAN and healthy controls through RT‒qPCR. C: After RNase R treatment, RT‒qPCR was conducted to assess the relative expression of circRNA_0013747 and MAN1A2 in human IgA nephropathy tissues. D: The stability of circRNA_0013747 in human IgA nephropathy tissues was confirmed posttreatment with actinomycin D.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3996101/v1/b6fa5aba704f3c862a4288b1.png"},{"id":52029300,"identity":"daf1515d-7255-44c0-b92f-ccad0c2dcc6a","added_by":"auto","created_at":"2024-03-05 16:17:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":878082,"visible":true,"origin":"","legend":"\u003cp\u003eInhibition of circ-0013747 reduces LPS-induced mesangial cell proliferation\u003c/p\u003e\n\u003cp\u003eA: Quantification of circRNA_0013747 expression in HMCs using RT‒qPCR. B: Assessment of cell viability at different time points through a CCK-8 assay. C: Measurement of apoptosis through Annexin V and propidium iodide staining. D: Analysis of the cell cycle distribution in HMCs using flow cytometry.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3996101/v1/83b293448cdb618160c2adbc.png"},{"id":52031474,"identity":"aff873aa-7e75-4af3-8162-6db0903b5e05","added_by":"auto","created_at":"2024-03-05 16:25:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3117326,"visible":true,"origin":"","legend":"\u003cp\u003ePKM2 is involved in circRNA_0013747-induced aerobic glycolysis\u003c/p\u003e\n\u003cp\u003eA, B, C: Evaluation of glucose, lactate, and ATP levels in HMC cells. D: Assessment of PKM2, HK2, and PFK1 expression in HMCs by RT‒qPCR. E: Western blot (WB) images displaying collagen IV, FN, and PKM2 protein levels in HMCs. F: Immunofluorescence analysis to detect collagen IV, FN, and PKM2 protein levels, with DAPI serving as the nuclear counterstain. G: Immunohistochemistry (IHC) staining of kidney tissue sections from patients to determine PKM2 expression (patient numbers 1-6). H: Measurement of PKM2 expression through RT‒qPCR in kidney tissue samples. I, J: Correlations between circ-0013747 and PKM2 expression assessed through Spearman's correlation analysis in kidney tissue samples.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3996101/v1/88549e0dd9479cc4aae579bb.png"},{"id":52029302,"identity":"86f8361d-6ec2-41f0-bf49-8cd4a51aa384","added_by":"auto","created_at":"2024-03-05 16:17:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1856919,"visible":true,"origin":"","legend":"\u003cp\u003eRole of Circ-0013747 in Enhancing Glycolysis and Mesangial Cell Proliferation through PKM2\u003c/p\u003e\n\u003cp\u003eA: Evaluation of circ-0013747 and PKM2 expression in HMCs via RT‒qPCR. B: Western blot images illustrating the protein levels of PKM2 in HMC cells. C: Immunofluorescence analysis to determine PKM2 protein levels. D: Assessment of cell viability for the specified cells using the CCK-8 assay. P\u0026lt;0.05. E: Quantification of apoptosis through Annexin V and propidium iodide staining. F: Flow cytometry analysis of the cell cycle in HMC cells. G, H, I: Measurement of glucose, lactate, and ATP concentrations in each cell group.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3996101/v1/b0909d3a51f5f145e59caad3.png"},{"id":52029304,"identity":"5d904efa-b98b-440d-94a7-5eeca5a6908f","added_by":"auto","created_at":"2024-03-05 16:17:47","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2047169,"visible":true,"origin":"","legend":"\u003cp\u003eMiR-330-3p mediates the regulatory effect of circRNA_0013747 on PKM2\u003c/p\u003e\n\u003cp\u003eA: Potential microRNAs that may bind to circRNA_0013747, as indicated by the Circlnteractome database. B: Predicted microRNAs that may interact with PKM2 according to miRTarBase. C: miRNAs capable of binding to both circRNA-0013747 and PKM2 are represented in the green area. D: RT‒qPCR analysis of the indicated genes in HMC cells. E: Comparison of MiR-330-3p expression between IgAN tissues and normal kidney tissues (n=16 per group). F: Correlation analysis between the expression of circ-0013747 and miR-330-3p using Spearman's correlation in kidney tissue samples. G: Measurement of circ-0013747, miR-330-3p, and PKM2 expression in HMCs via RT‒qPCR. H: Western blot images displaying PKM2 protein levels in HMCs. I: Immunofluorescence analysis of PKM2 protein levels.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3996101/v1/fc4c37436cd589de0271a678.png"},{"id":52029301,"identity":"b6107c44-7357-44ae-9ecf-8689ef52ffe1","added_by":"auto","created_at":"2024-03-05 16:17:47","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1274630,"visible":true,"origin":"","legend":"\u003cp\u003eInteraction between circRNA_0013747, miR-330-3p, and PKM2 in HMCs\u003c/p\u003e\n\u003cp\u003eA: FISH analysis demonstrating the colocalization of circRNA_0013747 (in red) and miR-330-3p (in green) in both human glomeruli and the cytoplasm of HMCs. DAPI was used to counterstain the nuclei. B: RT‒qPCR quantification of circRNA_0013747 and miR-330-3p levels in HMC cells enriched with a circRNA_0013747-specific probe.C: The results from the luciferase reporter assay indicate the binding of miR-330-3p to the circRNA_0013747 wild type. D: Dual-luciferase assays confirmed the interaction between PKM2 and miR-330-3p.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-3996101/v1/f3846fd43e52a17889ddf71a.png"},{"id":52029306,"identity":"9e8b491c-45c9-4b65-80a2-8ca3ae29511c","added_by":"auto","created_at":"2024-03-05 16:17:47","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":3155074,"visible":true,"origin":"","legend":"\u003cp\u003eSilencing mmu_circ_0010297 ameliorated the development of IgAN in vivo. A: The expression of mmu_circ_0010297 mRNA in mouse kidney tissues was measured using RT‒qPCR. B: The lactate concentration in mouse kidney tissues was measured using a lactate assay kit. C: The protein levels of collagen IV, fibronectin, and PKM2 in renal tissues from each group were examined via Western blotting. D: Pathological analysis of the degree of sclerosis in mouse glomeruli was performed using Sirius Red staining, the expression of MiR-330-3p was determined via fluorescence in situ hybridization (FISH), and the expression of PKM2 and Collagen IV was examined through immunohistochemistry. E, F: Relationships between the levels of circRNA_0010297 and the degree of kidney injury in 18 kidney tissue samples. All of the data are presented as the means ± SDs (standard deviations).\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-3996101/v1/7068324be5ed0d3439afca5b.png"},{"id":52029307,"identity":"b00179f0-ba58-4894-af9c-9eb9473f9458","added_by":"auto","created_at":"2024-03-05 16:17:48","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":645552,"visible":true,"origin":"","legend":"\u003cp\u003eElucidating the role of circRNA_0013747 in IgAN progression and the related molecular mechanisms.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-3996101/v1/0a005bc213be052e0d96eb3f.png"},{"id":52201581,"identity":"3a6100f6-8849-494e-a472-086e420e5113","added_by":"auto","created_at":"2024-03-07 21:27:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6102088,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3996101/v1/c9436102-e61e-4d09-bc8e-5dbeb015cfb8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"CircRNA-0013747 induces mesangial cell proliferation in IgA nephropathy by targeting the Warburg effect via miR-330- 3p/PKM2 signaling","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eImmunoglobulin A nephropathy (IgAN) is a primary glomerular disease characterized by glomerular mesangial deposition of IgA or IgA-based immunoglobulin[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Since its identification by the French scholar Berger in 1968, it has become the most prevalent primary glomerular disease worldwide[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Patients with moderate clinical disease exhibit mesangial cell proliferation and extracellular matrix growth, but 30\u0026ndash;40% of patients develop end-stage renal disease as a result of glomerular and interstitial sclerosis approximately 20 years after diagnosis[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Mesangial cells are activated via the deposition of the galactose-deficient IgA1 (Gd-IgA1) immune complex to mediate particular intracellular signal transduction pathways, and Gd-IgA1 immune complex deposition also promotes mesangial cell growth and initiates kidney injury[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Additionally, a number of proinflammatory and fibroblastic cytokines are released by mesangial cells to mediate oxidative stress and complement activation, which in turn causes damage to podocytes and proximal tubular epithelial cells, glomerular sclerosis, and interstitial fibrosis, all of which contribute to the progression of IgAN[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The early pathogenic changes in IgAN are thought to be largely mediated by mesangial cells, according to the following findings.\u003c/p\u003e \u003cp\u003eGlucose is vital for cellular functions because it serves as the primary substrate for energy production. When glucose is fully oxidized within a cell in the presence of oxygen, 38 molecules of adenosine triphosphate (ATP) are generated, which serves as the cell's essential energy source[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. However, when cells are under hypoxic conditions, pyruvic acid is not converted into acetyl-coenzyme A but rather into lactic acid, a process known as anaerobic cellular respiration[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In this scenario, the net energy balance is reduced to just two ATP molecules, making anaerobic glucose metabolism energetically inefficient[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In the early 1920s, Warburg, Posener, and Negelein made noteworthy discoveries regarding the behavior of tumor tissue in vitro. Their examination of respiration and glycolysis in different tissue sections revealed that tumors exhibit unusually high glycolytic activity and lactic acid production from glucose when compared to normal tissues. Surprisingly, glycolysis is \"aerobic\" and is not inhibited by oxygen in malignant cells, signifying that cancer cells lack the \"Pasteur effect\"[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. This gave rise to the concept of aerobic glycolysis, which is the fermentation of glucose even in the presence of ample oxygen. Type M2 pyruvate kinase (PKM2) plays a key role in glycolysis by catalyzing the final and physiologically irreversible step of the process of converting phosphoenolpyruvate (PEP) to pyruvate through the transfer of a phosphate group to ADP[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The substantial upregulation of PKM2 expression in most human cancer types strongly suggests its importance in tumorigenesis. Transient transfection of tumor cell lines with PKM2 small interfering RNA (siRNA) resulted in reduced cell proliferation and increased apoptosis[\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Metabolic changes have also been implicated in the development of several kidney diseases. Li et al. reported a shift toward aerobic glycolysis in the pathogenesis of chronic kidney disease (CKD)[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Furthermore, the inhibition of PKM2 by shikonin significantly ameliorated the histopathological symptoms of LPS-induced acute kidney injury (AKI)[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. These findings underscore the potential role of PKM2-mediated aerobic glycolysis in various kidney diseases, although the precise regulatory mechanisms involved remain to be elucidated.\u003c/p\u003e \u003cp\u003eCircular RNAs (circRNAs) represent a distinct class of noncoding RNAs highly prevalent in mammalian cells and are involved in the regulation of gene expression[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. They have been found in various human organs and exhibit unique spatial and temporal expression patterns[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Due to their closed-loop structure, circRNAs exhibit greater stability than linear RNAs, rendering them promising candidates as biomarkers for disease diagnosis[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Research suggests that circRNAs can act as 'sponges' for miRNAs, selectively binding to miRNAs and consequently leading to the upregulation of miRNA target genes[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. For example, Niu et al. demonstrated that Circ_0008529 contributes to renal tubular cell dysfunction under high glucose stress through the miR-185-5p/SMAD2 pathway in diabetic nephropathy[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Furthermore, circRNA_0017076 modulates epithelial-to- mesenchy -mal transition during renal interstitial fibrosis by acting as a sponge for miR-185-5p[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. These discoveries underscore the crucial role of circRNAs in kidney diseases.\u003c/p\u003e \u003cp\u003eIn our investigation, we noted a considerable increase in the expression of hsa_circ_0013747 in human IgA nephropathy tissue compared to normal kidney tissue. Additionally, we found that circRNA_0013747 can enhance aerobic glycolysis and stimulate the proliferation of mesangial cells by modulating the miR-330-3p/PKM2 signaling axis. In an IgAN mouse model, the administration of adeno-associated virus with mmu_circ_0010297 knockdown led to a substantial reduction in kidney lactate levels, effectively ameliorating kidney damage. These findings indicate that the circRNA_0013747/miR-330-3p/PKM2 pathway could be a valuable target for the early diagnosis and treatment of IgA nephropathy.\u003c/p\u003e"},{"header":"2. Methods and materials","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Ethics Approval:\u003c/h2\u003e \u003cp\u003eThe research protocols involving human specimens were granted approval by the Institutional Ethics Committee of Guizhou Medical University, located in Guiyang, China (Approval Number: 2021-43). Patients who participated in the study were recruited from the Affiliated Hospital of Guizhou Medical University in Guiyang, China, and provided written informed consent. Animal experiments were conducted under the authorization of the Institutional Animal Ethics Committee of Guizhou Medical University (Approval Number: 2100031). These studies were carried out in strict adherence to the guidelines outlined in the \"Guide for the Care and Use of Laboratory Animals\" by the US National Institutes of Health.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Human tissue specimens\u003c/h2\u003e \u003cp\u003eWe collected fresh kidney tissues from a total of 32 patients from the Nephrology and Urology Departments of the hospital. Sixteen of these patients were pathologically diagnosed with primary IgA nephropathy. The kidney tissues of these patients exhibited significant mesangial proliferation and glomerulosclerosis. These tissues were obtained through percutaneous biopsy under the guidance of ultrasound. The control group included kidney samples from 16 patients who had undergone nephrectomy due to traumatic kidney injury. Tissue samples were taken approximately 5 cm from the injury site and were pathologically confirmed to be normal kidney tissues. After brief flash freezing in liquid nitrogen for 30 seconds, the tissues were stored at a temperature of -80\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Animal model\u003c/h2\u003e \u003cp\u003eWe obtained eighteen female BALB/c mice aged five weeks with weights ranging from 20 to 25 g. These mice were procured from the Laboratory Animal Center at Guizhou Medical University, located in Guiyang, China. They were kept in standard cages in a pathogen-free environment with controlled temperature and humidity conditions. Following a three-day acclimation period, the mice were randomly divided into three groups: \"Blank control,\" \"IgAN\u0026thinsp;+\u0026thinsp;AAV-shNC,\" and \"IgAN\u0026thinsp;+\u0026thinsp;AAVsh-mmu_circ_0010297,\" with six mice in each group. Mice were intraperitoneally administered 2% pentobarbital at a dose of 4 ml/kg for anesthesia. Subsequently, under ultrasound guidance, a solution containing the RNAi adeno-associated virus (AAV) vector-9 was microinjected into the kidneys using a 31G needle. The AAV vector for silencing mmu_circ_0010297 and the negative control AAV vector were obtained from GeneChem in China. One week later, we induced IgAN through oral mucosal immunization. The mice were gavaged with acidified bovine serum albumin (BSA) every other day at a dose of 800 mg/kg. Additionally, they were administered a mixed solution of CCL4 and castor oil (at a 1:5 ratio) subcutaneously every week (0.1 ml) and intraperitoneally every two weeks (0.06\u0026ndash;0.08 ml). At weeks 6 and 8, lipopolysaccharide (LPS, 50 \u0026micro;g) was injected into the tail vein. The successful establishment of the IgAN model was confirmed at the end of week 11 via glomerular IgA immunofluorescence. By week 17, the mice were humanely euthanized under anesthesia, and blood, urine, and kidney tissue samples were collected for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Histological analyses\u003c/h2\u003e \u003cp\u003eKidney tissues were dehydrated, embedded, and subsequently sectioned at a thickness of 4 mm. To evaluate collagen deposition in the renal sections, Sirius red staining was performed. Immunohistochemistry (IHC) was used to quantify and locate specific proteins within these sections. Images were captured using a microscope and analyzed using ImageJ software. Further information about the antibodies utilized can be found in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntibodies\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNames\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eManufacturer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat. No\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePKM2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam, UK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eab150377\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecollagen IV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam, UK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eab6586\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFibronectin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam, UK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eab2413\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIgA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam, UK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eab214003\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTubulin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAbcam, UK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eab8245\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 RNA fluorescence in situ hybridization (RNA FISH)\u003c/h2\u003e \u003cp\u003eCells or kidney sections were subjected to a 12-hour incubation with RNA probes in hybridization buffer. The circRNA_0013747 probe was labeled with Cyanine 3 (Cy3), while the miR-330-3p probe was labeled with fluorescein isothiocyanate (FITC). Both probes were obtained from RiboBio, China.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Immunofluorescence staining\u003c/h2\u003e \u003cp\u003eCells and tissues, which were subsequently grown on cover slips, were subjected to a series of steps. The cells were initially fixed using 4% formaldehyde, permeabilized using 0.25% Triton X-100, and blocked quickly with blocking solution. Subsequently, the sections were subjected to overnight incubation at 4\u0026deg;C with primary antibodies targeting IgA, PKM2, collagen IV, or fibronectin. The next day, the cells and tissues were thoroughly washed with PBS containing 0.05% Tween 20 before they were incubated with a fluorescent secondary antibody. DAPI staining was used to visualize the cell nuclei. The prepared samples were stored in a light-protected environment and subsequently examined using a laser confocal microscope at the earliest possible time points.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Cell culture\u003c/h2\u003e \u003cp\u003eHuman mesangial cells (HMCs) were procured from the American Type Culture Collection (ATCC, USA). The cells were transfected using Lipofectamine RNAiMAX (Invitrogen, USA) with either a circRNA_0013747-specific siRNA obtained from GeneSeed (China) or a negative control. Following transfection, the HMC cells were exposed to LPS. Additionally, cells were transfected with a pLCDH-ciR plasmid containing circRNA_0013747 (GeneSeed, China), a miR-330-3p mimic sourced from RiboBio, China, or a PKM2 siRNA provided by GenePharma, China. After these transfection procedures, the cells were incubated for 24 hours under standard growth conditions before they were transitioned to the experimental media. The harvested cells were used in the subsequent experiments. The specific siRNA sequences used are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003esiRNA sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003esiRNA targets\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecircRNA_0013747 siRNA1#\u003c/p\u003e \u003cp\u003ecircRNA_0013747 siRNA2#\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGAAACATTAAAGCTATAG\u003c/p\u003e \u003cp\u003eAACATTAAAGCTATAGAAAAA\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePKM2 siRNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense\u003c/p\u003e \u003cp\u003eAntisense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGT ACC ATG CGG AGA CCA TC\u003c/p\u003e \u003cp\u003eGCG TTA TCC AGC GTG ATT TT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 RNA extraction and quantitative real-time PCR (RT‒qPCR) analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from kidney tissues or cultured cells via the TRIzol method. Subsequently, the extracted RNA was subjected to reverse transcription into cDNA employing a kit sourced from Takara, Japan. RT‒qPCR was performed utilizing SYBR Green reagent (Takara, Japan). The relative gene expression was determined after normalization to the internal control, GAPDH, employing the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. For the primer sequences used in the RT‒qPCR experiments, please refer to Supplementary Table\u0026nbsp;3.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCR primer sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer(5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCircRNA_0013747\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCAAAGATGTATATTCCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCTCTGGAACCATCTGCTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMiR-330-3p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGGCGGGCAAAGCACACGGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCCAGTGCAGGGTCCGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePKM2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGCATGCAGCACCTGATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTCGAATAGCTGCAAGTGGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTGGGCATCAATGGATTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACACCATGTATTCCGGGTCAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Western blot (WB) analysis\u003c/h2\u003e \u003cp\u003eProteins were extracted from tissues and cells using lysis buffer, and the total protein concentration was determined with a BCA kit (Beyotime Biotechnology, China). In brief, after the proteins were transferred to PVDF membranes, the membranes were blocked with 5% nonfat milk for one hour. The membranes were then incubated with the diluted primary antibody overnight at 4\u0026deg;C. On the following day, the secondary antibody was applied, and the samples were incubated at room temperature for an hour. The protein bands were visualized using the ECL method, and their intensity was quantified using a gel imaging system. Specific information about the antibodies utilized can be found in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Cell viability assay\u003c/h2\u003e \u003cp\u003eHMCs were seeded in 96-well plates and subjected to treatment with 10 \u0026micro;L of Cell Counting Kit-8 (CCK-8) reagent (Dojindo, Japan) per well. After incubation at 37\u0026deg;C in a controlled atmosphere, the optical density (OD450) was determined using a microplate reader (Bio-Rad, USA) on Days 1, 2, 3, 4, 5, and 6 following treatment. To evaluate the number of apoptotic cells, 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells from each group were rinsed with PBS and subsequently stained with PE-conjugated Annexin V and 7AAD dyes. Flow cytometry was used to quantify apoptotic cells using a Becton Dickinson instrument located in Guiyang, China.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Lactate production, glucose uptake, and ATP levels\u003c/h2\u003e \u003cp\u003eThe glucose level was measured using a glucose assay kit from Merck KGaA, Germany. The lactate level was determined using a Lactate Assay Kit (Merck KGaA, Germany). ATP levels were assessed using the Luminescent ATP Detection Assay from Abcam, UK.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 RNA pull‑down assay\u003c/h2\u003e \u003cp\u003eStreptavidin-coated magnetic beads (Thermo Fisher Scientific, USA) were conjugated with biotin-labeled CircRNA_0013747 probes or control probes (RiboBio, China). Subsequently, these conjugates were mixed with cell lysates. After incubation, the bound RNAs were isolated and analyzed by RT\u0026ndash;qPCR to determine the expression levels of circRNA_0013747 and miR-330-3p.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Dual‑luciferase reporter assay\u003c/h2\u003e \u003cp\u003eFollowing transfection with either the pmiRGLO-CircRNA_0013747-wt plasmid or the pmiRGLO-CircRNA_0013747-Mut plasmid (GeneSeed, China), the cells were cotransfected with either a control or a miR-330-3p mimic (GeneSeed, China). After 48 hours of transfection, luciferase activity was assessed using a Dual-Luciferase Reporter Assay Kit (Promega, USA). The reporter activity was determined based on both firefly and Renilla luciferase activities.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14 Statistical analysis\u003c/h2\u003e \u003cp\u003eGroup differences were assessed via one-way ANOVA, followed by the least significant difference test for post hoc comparisons. The linear relationship between circRNA-0013747 and miR-330-3p expression in kidney tissues was analyzed using Spearman's correlation coefficient. The data are presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;SDs. All of the statistical analyses were performed using GraphPad Prism 7 software (GraphPad Software, USA), and the statistical significance was set at *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Circ_0013747 expression is markedly elevated in human IgA nephropathy tissues\u003c/h2\u003e \u003cp\u003eDysregulated gene expression is a contributing factor in the pathogenesis of various diseases. In our research, we examined 16 pairs of human IgA nephropathy tissues and compared them to normal renal tissues to evaluate the expression of Circ_0013747. Our staining analysis revealed a substantial increase in Sirius red staining and IgA immunofluorescence in the IgA nephropathy group compared with the normal control group. This elevated staining indicated heightened deposition of IgA and collagen, suggesting more severe pathological damage (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). CircRNA_0013747 is generated from the exon of MAN1A2 through a process known as backsplicing, forming a 509-nucleotide circular structure, as illustrated in Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. To specifically detect and quantify circRNA_0013747, we developed a tailored fluorescent probe. Notably, compared with that in control tissues, the fluorescence intensity in targeted IgA nephropathy tissues was significantly greater. Additionally, we designed specific PCR primers for circRNA_0013747 and applied RT‒qPCR to assess its expression levels in 16 paired IgAN and normal renal tissues. These results convincingly demonstrated elevated expression of circ_0013747 in IgAN tissues compared to normal tissues, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB. The circular structure of circRNA is more stable than the structure of linear RNA. While RNase R can effectively degrade linear RNA, it is incapable of cleaving circRNA. Our use of RNase R unequivocally confirmed the circular nature of circRNA_0013747; this circRNA exhibited remarkable resistance to RNase R digestion, notably outperforming the linear MAN1A2 transcript, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC. Furthermore, upon assessing RNA stability following treatment with the transcription inhibitor actinomycin D, it became evident that circRNA_0013747 displayed significantly enhanced stability when compared with the linear MAN1A2 mRNA transcript in human IgA nephropathy tissues, as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD. These findings underscore the upregulation of circRNA_0013747 in IgA nephropathy tissues.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Silencing of CircRNA_0013747 mitigates the proliferation of mesangial cells induced by lipopolysaccharide (LPS).\u003c/h2\u003e \u003cp\u003eIgAN is fundamentally an inflammatory disorder in which persistent inflammation drives the proliferation of glomerular mesangial cells, ultimately leading to substantial collagen deposition and glomerular sclerosis. Lipopolysaccharide (LPS), a primary component of the outer membrane in gram-negative bacteria that is composed mainly of lipids and polysaccharides, is the gold standard for simulating acute inflammation due to its ease of control, reproducibility, and well-defined systemic effects. To determine the role of CircRNA_0013747 in inflammation-triggered mesangial cell proliferation, we downregulated its expression in LPS-stimulated human mesangial cells (HMCs). RT‒qPCR analysis revealed that LPS induced significant upregulation of circRNA_0017076 in HMCs, and this change was effectively reversed by siRNA treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Concurrently, the CCK-8 assay results illustrated that LPS amplified the proliferation of HMCs, whereas the inhibition of CircRNA_0013747 significantly suppressed this effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Moreover, the flow cytometry results, which evaluated both apoptosis levels and cell cycle progression, were consistent with the CCK-8 assay results (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Activated mesangial cells are known to produce notable quantities of collagen IV and fibronectin, both of which are major contributors to the development of glomerular sclerosis and the loss of renal function. Western blot and immunofluorescence analyses demonstrated a substantial increase in the levels of Collagen IV and fibronectin in LPS-exposed cells. However, the suppression of circRNA_0017076 effectively mitigated the LPS-induced upregulation of both proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, F). Collectively, these findings strongly suggest the pivotal role of circRNA_0013747 in regulating HMC proliferation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.3 CircRNA_0013747 silencing results in downregulated PKM expression and a decrease in LPS-induced aerobic glycolysis in mesangial cells\u003c/p\u003e \u003cp\u003eEmerging evidence suggests that aerobic glycolysis may serve as a pivotal driver of pathological mesangial cell proliferation[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Many chronic kidney diseases characterized by mesangial hyperplasia commonly exhibit elevated glucose consumption and lactic acid accumulation. The results demonstrated a significant increase in glucose uptake and a concurrent increase in ATP and lactate production in HMCs when exposed to LPS. However, the effective silencing of circRNA_0013747 almost entirely reversed the stimulatory effect of LPS on HMCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B, C). These findings strongly suggest that the activation of aerobic glycolysis might be one of the key factors contributing to the promotion of mesangial cell proliferation by circRNA_0013747. Key glycolysis enzymes, including PKM2, HK2, and PFK1, are known to be strongly involved in a wide range of cellular physiological functions and pathological processes. In our study, stimulation with LPS led to a notable increase in the expression of these three pivotal enzymes in HMCs. However, upon transfection with siRNA specifically targeting circRNA_0013747, we observed a significant reduction in PKM2 expression, with minimal effects on HK2 and PFK1 (as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). These findings strongly indicate that PKM2 is a crucial downstream regulatory signaling molecule influenced by circRNA_0013747. To further investigate the connection between PKM2 and circRNA_0013747, we assessed PKM2 mRNA levels in 16 paired kidney tissues. Intriguingly, compared with those in the normal tissue, PKM2 mRNA levels in the IgAN tissue were significantly greater (see Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). Subsequent Spearman correlation analyses revealed a robust positive correlation between circRNA_0013747 and PKM2 mRNA levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, r\u0026thinsp;=\u0026thinsp;0.833; as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI, J). Furthermore, the immunohistochemistry results provided additional support for these findings, as there was a conspicuous increase in PKM2 expression levels in IgA kidney biopsy samples compared to those in normal kidney tissue (refer to Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). These combined results strongly suggest that PKM2 plays a pivotal role in the circRNA_0013747-induced process of aerobic glycolysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Silencing PKM2 attenuates circRNA-0013747-induced glycolysis and proliferation in mesangial cells\u003c/h2\u003e \u003cp\u003eTo investigate the influence of PKM2 on circRNA-0013747-induced glycolysis and proliferation, siRNA targeting PKM2 was cotransfected into HMC cells overexpressing circRNA-0013747. The mRNA and protein expression data revealed that the overexpression of circRNA-0013747 significantly upregulated PKM2, but this effect was subsequently suppressed by siRNA targeting PKM2 (as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B, C). Cell viability, as assessed by the CCK-8 assay, indicated that the increase in cell activity resulting from the overexpression of circRNA-0013747 was counteracted by PKM2 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). The findings obtained from flow cytometry, which assessed both apoptosis levels and cell cycle progression, were in line with the outcomes of the CCK-8 assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, F). Furthermore, the increase in circRNA_0013747 expression led to a significant increase in glucose uptake and a concurrent increase in ATP and lactate production in HMC cells, and these effects were partially offset by PKM2 silencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG, H, I). All of these findings collectively emphasize the critical importance of PKM2 in mediating the promotion of glycolysis and proliferation in mesangial cells via circRNA-0013747.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.5 MiR-330-3p mediates the positive regulatory effect of circRNA-0013747 on PKM2\u003c/h2\u003e \u003cp\u003eCircRNAs primarily act as miRNA sponges, exerting regulatory effects on genes. Therefore, we hypothesized that certain miRNAs might mediate the regulatory effect of circRNA-0013747 on PKM2. Using bioinformatics analysis via miRTarBase, we identified more than 100 miRNAs that potentially interact with PKM2 in HMC cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The CircInteractome database lists several miRNAs as potential targets of circRNA-0013747 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Among these candidates, miR-184, miR-330, and miR-887 were found in both categories (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Importantly, the upregulation of circRNA-0013747 in HMC cells significantly inhibited miR-330-3p expression, while miR-184 and miR-887 expression remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD), indicating that miR-330-3p may be a crucial downstream target of circRNA-0013747.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate the direct RNA interactions in this study, we conducted additional experiments. The FISH assay confirmed the colocalization of circRNA_0013747 and miR-330-3p in both mesangial cells and human renal glomerular tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Furthermore, a circRNA_0013747-specific probe showed enrichment of both circRNA_0013747 and miR-330-3p (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), indicating that circRNA_0013747 targets miR-330-3p in HMC cells. To validate this interaction, we generated wild-type and mutant dual-luciferase reporter vectors for circRNA_0013747 based on the potential binding sites of miR-330-3p and circRNA_0013747. We cotransfected a miR-330-3p mimic or a negative control (NC) mimic with the luciferase reporter into human embryonic kidney 293 (HEK293) cells. The overexpression of miR-330-3p reduced the luciferase activity of the wild-type reporters but had no effect on the luciferase activity of the mutant reporters (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). In a separate experiment using dual-luciferase reporter vectors for PKM2, miR-330-3p mimics decreased the luciferase activity of the reporter (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). These results confirmed that circRNA_0013747 functions as a miR-330-3p sponge and that miR-330-3p directly binds to the 3' UTR of PKM2 mRNA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Knockdown of Mmu_circ_0010297 alleviates renal damage caused by IgA nephropathy in mice\u003c/h2\u003e \u003cp\u003eMmu_circ_0010297, which is the homologous circular RNA of hsa_circ_0013747, originates from the primary transcript of the MAN1A2 gene (gene symbol). In our study, we randomly assigned 18 BALB/c mice to three groups: \"Blank Control\", \"IgAN\u0026thinsp;+\u0026thinsp;AAV-shNC\", and \"IgAN\u0026thinsp;+\u0026thinsp;AAVsh-mmu_circ_0010297\". We utilized AAV9-sh-Mmu_circ_0010297 to suppress the expression of mmu_circ_0010297 in the kidneys of BALB/c mice. As a control, another group of mice received an injection of an empty AAV9 vector. Subsequently, both sets of mice were induced with IgA models and compared with untreated BALB/c mice. RT‒qPCR analysis revealed increased expression of Mmu_circ_0010297 in the kidneys of the IgAN\u0026thinsp;+\u0026thinsp;AAV-shNC group compared to that in the blank control group. This elevation was notably reduced following treatment with AAVsh-mmu_circ_0010297, as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA. Concurrent with the decrease in Mmu_circ_0010297, there was a significant reduction in lactate levels within the kidneys of the AAVsh-mmu_circ_0010297 group, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB. Western blot analysis revealed that the increased expression of PKM2, fibronectin, and collagen IV in the IgAN model group was reversed in the IgAN\u0026thinsp;+\u0026thinsp;AAV-sh-mmu_circ_0010297 group, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC. Sirius Red staining clearly revealed that, compared with the AAV-sh-NC mice, the mmu_circ_0010297 knockdown mice showed notably less glomerulosclerosis. Furthermore, the FISH results revealed a significant decrease in miR-330-3p levels in the kidneys of the AAV-shNC group compared to those in the control group. This decrease was effectively counteracted following treatment with AAVsh-mmu_circ_0010297. The results of immunohistochemistry assays for collagen IV in kidney tissues from all three groups were consistent with the Western blot findings, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD. IgA nephropathy typically presents with severe kidney dysfunction characterized by increasing levels of blood urea nitrogen (BUN), serum creatinine (Scr), and uric acid (UA) and 24-hour proteinuria (24 h-pro) as the disease progresses. Biochemical analysis demonstrated a reduction in the levels of these elevated markers in the IgAN\u0026thinsp;+\u0026thinsp;AAV-sh-mmu_circ_0010297 group compared to those in the IgAN model group. Additionally, positive correlations between mmu_circ_0010297 and BUN levels, Scr levels, UA levels, and 24 h-pro levels were detected using Spearman's correlation, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE and F. In summary, these findings collectively suggest that inhibiting Mmu_circ_0010297 mitigates the renal damage caused by IgA nephropathy in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn mature organisms, quiescent cells typically exhibit heightened replication rates during tumorigenesis or as part of the tissue repair process following injury [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Within the renal glomerulus, various forms of injury can incite localized inflammatory reactions involving resident glomerular cells. These injuries may arise from immune-mediated responses, infections, toxins, mechanical stress, or other causative factors [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. A prominent histopathological feature of numerous human and experimental glomerular inflammatory conditions is an increase in cellular density within the mesangium. This increase is attributed to the proliferation of mesangial cells (MCs) and the influx of leukocytes [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Irrespective of the specific injury mechanism, an early and pivotal factor in the development of progressive glomerular injury and glomerulosclerosis seems to be an imbalance in regulating MC proliferation. In experimental models of nephritis, MC proliferation frequently precedes and correlates with an increase in the accumulation of extracellular matrix (ECM) within the mesangium and the subsequent development of glomerulosclerosis [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Moreover, interventions that reduce cell proliferation in glomerular disease models, such as treatment with heparin, a low-protein diet, or the use of neutralizing antibodies against platelet-derived growth factor, have been demonstrated to mitigate ECM expansion and sclerotic changes[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Notably, a reduction in MC replication is correlated with a marked decrease in mesangial ECM accumulation and diminished deposition of collagen type IV, laminin, and fibronectin [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. However, the specific molecular mechanisms underlying the abnormal proliferation of mesangial cells in various types of nephritis, including IgA nephropathy, have yet to be fully elucidated.\u003c/p\u003e \u003cp\u003eIn the 1920s, Otto Warburg and his colleagues made an important observation that tumors exhibit an unusually high rate of glucose uptake in comparison to the surrounding tissue. Furthermore, they noted that glucose was metabolized to produce lactate even when oxygen was present, which led to the coining of the term \"aerobic glycolysis.\"[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The Warburg effect has been postulated to be an adaptive mechanism aimed at fulfilling the biosynthetic demands associated with uncontrolled cell proliferation. In this context, increased glucose consumption serves as a carbon source for the anabolic processes required to facilitate cell proliferation. Excess carbon is allocated for the synthesis of new nucleotides, lipids, and proteins and can be channeled into various branching pathways that stem from glycolysis[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Furthermore, the Warburg effect may offer a growth advantage to cells within a multicellular environment[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. However, the reason behind this relatively inefficient metabolic pathway in tumor cells remains unclear. However, current research points to mitochondrial dysfunction in cancer cells and changes in essential enzymes such as pyruvate kinase (PK), which are involved in glycolysis[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. PK plays a crucial role in glycolysis by catalyzing the final and physiologically irreversible step, which involves converting phosphoenolpyruvate into pyruvate through the transfer of a phosphate group to adenosine diphosphate [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. In mammals, there are four distinct PK isoforms encoded by two genes. The PKLR gene encodes PKL and PKR. The PKM gene encodes PKM1 and PKM2 through alternative splicing, utilizing mutually exclusive exons that are the same length but encode a 56-amino acid region differing at 22 residues[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. PKM2 is universally expressed during embryogenesis, regeneration, and cancer development. This observation implies that the capacity to regulate pyruvate kinase enzymatic activity is a crucial factor in actively proliferating cells[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Numerous studies have indicated that elevated levels of PKM2 in circulation could serve as a diagnostic marker for various cancer types. Furthermore, the overexpression of PKM2 is positively correlated with tumor progression, primarily owing to its involvement in glycolysis, proliferation, and apoptosis[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. A reduction in PKM2 expression has been demonstrated to lower the glycolytic rate and inhibit tumor growth in various types of cancer. Administering the PKM2 activator TEPP-46 to H1299 xenograft model mice resulted in a delay in tumor onset and the development of smaller tumors compared to those in control mice that received a vehicle[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Similarly, the deletion of PKM2 in a xenograft mouse model of NCI-N87 cells led to the formation of smaller tumors than those formed in the control counterparts[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Intriguingly, an expanding body of literature offers substantiating evidence regarding the potential of PKM2 as a biomarker for nephrotoxicity. This growing interest in revealing the possible involvement of PKM2 in renal diseases is well founded. In a recent study, the induction of nephrotoxicity in rats through cisplatin led to a notable increase in urinary PKM2 levels, which coincided with elevated lactate excretion and significant alterations in amino acids, glucose, and TCA intermediates within the urine. Correspondingly, renal tubular HK-2 cells exposed to cisplatin, as well as other nephrotoxic agents such as cyclosporine A, exhibited increased PKM2 secretion in conditioned media[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Furthermore, Chen et al. reported that PKM2 contributes to kidney fibrosis, particularly during the transition from acute kidney injury to chronic kidney disease[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. These collective findings underscore PKM2 as a substantial contributor to renal function and a potential novel marker for nephrotoxicity. These discoveries suggest that targeting PKM2 could represent an innovative strategy for the prevention and treatment of renal diseases. In our study, we noted a significant increase in lactate and PKM2 expression in the kidneys of IgA model mice. Silencing PKM2 resulted in pronounced inhibition of LPS-induced aerobic glycolysis and proliferation in human mesangial cells. Notably, the expression of PKM2 gradually diminishes during the transition from embryonic development to mature tissue. However, PKM2 expression resurfaces during tissue repair and tumor growth, implying that its regulation in tissue cells is strictly controlled by molecular regulation. Research has demonstrated that miRNAs can bind to PKM2 mRNA, effectively suppressing its expression during gene translation. This suppression can decelerate cellular glycolysis and hinder tumor growth. Hence, there is a growing focus on the regulation of PKM2 by noncoding genes.\u003c/p\u003e \u003cp\u003eUnlike the majority of linear messenger RNAs and long noncoding RNAs, which are characterized by 5\u0026prime; N7-methylguanosine caps at the beginning and 3\u0026prime; polyadenylated tails at the end, circular RNAs represent a distinct class of RNA molecules[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Circular RNAs are characterized by their unique feature of being covalently closed single-stranded RNAs. These circular RNAs have recently gained recognition as a prevalent category of RNA species[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. The circular nature of single-stranded RNA was initially observed in plant viroids, and subsequently, circular transcripts were discovered in eukaryotes through electron microscopic evidence, revealing a circular morphology despite their unknown functions[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. In the 1980s, other examples of circular RNA genomes were identified, as was the case for the hepatitis δ virus. Over the past decade, the emergence of RNA sequencing technologies, enriched for nonpolyadenylated and circular transcriptomes, along with computational tools for circular RNA annotation, has revealed the widespread expression of circRNAs across various metazoan cell types and tissues[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].\" A groundbreaking discovery in 2013 highlighted the ability of circRNAs to act as \"molecular sponges\" that bind and inhibit corresponding miRNAs and consequently enhance the expression of the miRNA target genes[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Liao et al. reported that circRNA_45478, which functions as a miR-190a-5p sponge, exacerbates ischemic acute kidney injury[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Furthermore, circPlekha7 inhibits the epithelial-to-mesenchymal transition of renal tubular epithelial cells by targeting miR-493-3p to derepress KLF4 expression[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Recent comparisons of urinary circRNA profiles between IgAN patients and healthy controls highlighted the upregulation of circRNA_0013747 in IgAN patients, with an associated expression pattern with PKM2[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. These findings suggested that circRNA_0013747 may play an important role in the onset and progression of IgA nephropathy. In our study, we demonstrated that circRNA_0013747 was significantly upregulated in the kidney tissue of IgA nephropathy patients and promoted mesangial cell proliferation through the induction of PKM2-mediated aerobic glycolysis. Our results confirm the central role of the circRNA_0013747/miR-330-3p/PKM2 axis in driving aerobic glycolysis and mesangial cell proliferation in IgAN. Nevertheless, our study has certain limitations. We did not investigate the relationship between circRNA_0013747 expression and clinicopathological parameters such as mesangial IgA deposition and renal interstitial lymphocyte infiltration. The exact distribution of circRNA_0013747 in the kidney has not been determined, and its specific impact on mesangial cells has yet to be determined. Finally, whether this molecular target can be applied in clinical diagnosis and treatment requires further investigation.\u003c/p\u003e \u003cp\u003eTo summarize, our research provides a novel perspective by suggesting that the Warburg effect may not only be central to tumor cell proliferation but also to the proliferation of mesangial cells. These findings indicated that circRNA_0013747 was elevated in IgAN tissues and induced mesangial cell proliferation and the Warburg effect by regulating the miR-330-3p/PKM2 signaling pathway. Therefore, our study suggested that circRNA_0013747 could serve as a promising new biological marker and therapeutic target for IgAN.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflicts of Interest\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no conflicts of interest.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eZou drafted the article, and Zhang revised the article.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e \u003cp\u003eThe current work was supported by the National Natural Science Foundation of China (No. 82160137 and No. 82360147) and the Natural Science Foundation of Guizhou Province, China (QianKeHeJiChu-ZK[2022] General 409 and [2020] 1Y305).\u003c/p\u003e\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e \u003cp\u003eThe datasets obtained and analyzed during the current study were made available from the corresponding authors through request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFloege J, Amann K(2016)Primary glomerulonephritides. Lancet 387(1003 2) :2036\u0026ndash;2048\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelvaskandan H, Gonzalez-Martin G, Barratt J, Cheung CK(2022)IgA nephropathy: an overview of drug treatments in clinical trials. Expert Opin Investig Drugs 31(12):1321\u0026ndash;1338\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaixnerova D, Tesar V(2020)Emerging Modes of Treatment of IgA Nephropathy. Int J Mol Sci 21(23):9064\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRajasekaran A, Julian BA, Rizk DV(2021)IgA Nephropathy: An Interesting Autoimmune Kidney Disease. Am J Med Sci 361(2):176\u0026ndash;194\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao L, Lan Z, Peng L et al(2022)Triptolide promotes autophagy to inhibit mesangial cell proliferation in IgA nephropathy via the CARD9/p38 MAPK pathway. Cell Prolif 55(9):e13278\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNihei Y, Suzuki H, Suzuki Y(2023)Current understanding of IgA antibodies in the pathogenesis of IgA nephropathy. Front Immunol 14:1165394\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuvizotto MJ, Menezes-Silva L, Woronik V, Monteiro RC, C\u0026acirc;mara NOS (2022) Gut-kidney axis in IgA nephropathy: Role on mesangial cell metabolism and inflammation. Front Cell Dev Biol 10:993716\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelvaskandan H, Shi S, Twaij S, Cheung CK, Barratt J (2020) Monitoring Immune Responses in IgA Nephropathy: Biomarkers to Guide Management. Front Immunol 2020;11:572754\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShimizu K, Matsuoka Y(2019)Regulation of glycolytic flux and overflow metabolism depending on the source of energy generation for energy demand. Biotechnol Adv 37(2):284\u0026ndash;305\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerry RJ, Wang Y, Cline GW et al (2018) Leptin Mediates a Glucose-Fatty Acid Cycle to Maintain Glucose Homeostasis in Starvation. Cell 172(1\u0026ndash;2):234\u0026ndash;248e17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang HY, Fan ZL, Wang TY (2021) Advances of Glycometabolism Engineering in Chinese Hamster Ovary Cells. Front Bioeng Biotechnol 9:774175\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWARBURG O (1956) On the origin of cancer cells. Science 123(3191):309\u0026ndash;314\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiberti MV, Locasale JW (2016)The Warburg Effect: How Does it Benefit Cancer Cells? Trends Biochem Sci 41(3):211\u0026ndash;218\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang JZ, Zhu W, Han J et al (2021) The role of the HIF-1α/ALYREF/PKM2 axis in glycolysis and tumorigenesis of bladder cancer. Cancer Commun (Lond) 41(7):560\u0026ndash;575\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi TE, Wang S, Shen XT et al (2020)PKM2 Drives Hepatocellular Carcinoma Progression by Inducing Immunosuppressive Microenvironment. Front Immunol 11:589997\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu S, Guo Y, Zhang X et al (2021) Pyruvate kinase M2 (PKM2) in cancer and cancer therapeutics. Cancer Lett 503:240\u0026ndash;248\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDey P, Kundu A, Sachan R et al (2019) PKM2 Knockdown Induces Autophagic Cell Death via AKT/mTOR Pathway in Human Prostate Cancer Cells. Cell Physiol Biochem 52(6):1535\u0026ndash;1552\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi M, Jia F, Zhou H, Di J, Yang M (2018) Elevated aerobic glycolysis in renal tubular epithelial cells influences the proliferation and differentiation of podocytes and promotes renal interstitial fibrosis. Eur Rev Med Pharmacol Sci 22(16):5082\u0026ndash;5090\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu J, Rong S, Zhou J, Yuan W (2021) The role and mechanism of PKM2 in the development of LPS-induced acute kidney injury. Histol Histopathol 36(8):845\u0026ndash;852\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou WY, Cai ZR, Liu J et al (2020) Circular RNA: metabolism, functions and interactions with proteins. Mol Cancer 19(1):172\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang ZH, Wang Y, Zhang Y et al (2023) The function and mechanisms of action of circular RNAs in Urologic Cancer. Mol Cancer 22(1):61\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFontemaggi G, Turco C, Esposito G, Di Agostino S (2021) New Molecular Mechanisms and Clinical Impact of circRNAs in Human Cancer. Cancers (Basel) 13(13):3154\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMemczak S, Jens M, Elefsinioti A et al (2013) Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 495(7441):333\u0026ndash;338\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiu Z, Ren G, Huang L, Mu L (2023) Circ_0008529 Contributes to Renal Tubular Cell Dysfunction in High Glucose Stress via miR-185-5p/SMAD2 Pathway in Diabetic Nephropathy. Biochem Genet 61(3):963\u0026ndash;978\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang F, Zou H, Li X et al (2023) CircRNA_0017076 acts as a sponge for miR-185-5p in the control of epithelial-to-mesenchymal transition of tubular epithelial cells during renal interstitial fibrosis. Hum Cell 36(3):1024\u0026ndash;1040\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu WL, Liu S, Li N et al (2021) Quercetin Antagonizes Glucose Fluctuation Induced Renal Injury by Inhibiting Aerobic Glycolysis via HIF-1α/miR-210/ISCU/FeS Pathway. Front Med (Lausanne) 8:656086\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmed MB, Alghamdi AAA, Islam SU, Ahsan H, Lee YS (2023) The Complex Roles of DNA Repair Pathways, Inhibitors, Hyperthermia, and Contact Inhibition in Cell Cycle Halts. Mini Rev Med Chem 23(5):514\u0026ndash;529\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWada T, Matsushima K, Kaneko S (2008) The role of chemokines in glomerulonephritis. Front Biosci 13:3966\u0026ndash;3974\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShimizu F, Kawachi H, Orikasa M (1999) Role of mesangial cell damage in progressive renal disease. Kidney Blood Press Res 22(1\u0026ndash;2):5\u0026ndash;12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurogi Y (2003) Mesangial cell proliferation inhibitors for the treatment of proliferative glomerular disease. Med Res Rev 23(1):15\u0026ndash;31\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKusaba G, Ohsawa I, Ishii M et al (2012) Significance of broad distribution of electron-dense deposits in patients with IgA nephropathy. Med Mol Morphol 45(1):29\u0026ndash;34\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson RJ, Raines EW, Floege J, Yoshimura A, Pritzl P, Alpers C, Ross R (1992) Inhibition of mesangial cell proliferation and matrix expansion in glomerulonephritis in the rat by antibody to platelet-derived growth factor. J Exp Med 175(5):1413\u0026ndash;1416\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdeva-Andany MM, Carneiro-Freire N (2022) Biochemical composition of the glomerular extracellular matrix in patients with diabetic kidney disease. World J Diabetes 13(7):498\u0026ndash;520\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVaupel P, Multhoff G (2021) Revisiting the Warburg effect: historical dogma versus current understanding. J Physiol 599(6):1745\u0026ndash;1757\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoppenol WH, Bounds PL, Dang CV(2011)Otto Warburg's contributions to current concepts of cancer metabolism. Nat Rev Cancer 11(5):325\u0026ndash;337\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFukushi A, Kim HD, Chang YC, Kim CH (2022) Revisited Metabolic Control and Reprogramming Cancers by Means of the Warburg Effect in Tumor Cells. Int J Mol Sci 23(17):10037\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchwartz L, Supuran CT, Alfarouk KO (2017) The Warburg Effect and the Hallmarks of Cancer. Anticancer Agents Med Chem 17(2):164\u0026ndash;170\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi T, Han J, Jia L, Hu X, Chen L, Wang Y (2019) PKM2 coordinates glycolysis with mitochondrial fusion and oxidative phosphorylation. Protein Cell 10(8):583\u0026ndash;594\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang W, Lu Z(2015)Pyruvate kinase M2 at a glance. J Cell Sci 128(9):1655\u0026ndash;1660\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee YB, Min JK, Kim JG et al (2022) Multiple functions of pyruvate kinase M2 in various cell types. J Cell Physiol 237(1):128\u0026ndash;148\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang G, Yu Y, Wang YZ, Zhu ZM, Yin PH, Xu K (2020) Effects and mechanisms of fatty acid metabolism-mediated glycolysis regulated by betulinic acid-loaded nanoliposomes in colorectal cancer. Oncol Rep 44(6):2595\u0026ndash;2609\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJi X, Lv C, Huang J, Dong W, Sun W, Zhang H (2023) )ALKBH5-induced circular RNA NRIP1 promotes glycolysis in thyroid cancer cells by targeting PKM2. Cancer Sci 114(6):2318\u0026ndash;2334\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin H, Han H, Yang M et al(2023)PKM2/PDK1 dual-targeted shikonin derivatives restore the sensitivity of EGFR-mutated NSCLC cells to gefitinib by remodeling glucose metabolism. Eur J Med Chem 249:115166\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Jiang J, Ji J et al (2017) )PKM2 promotes cell migration and inhibits autophagy by mediating PI3K/AKT activation and contributes to the malignant development of gastric cancer. Sci Rep 7(1):2886\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim SY, Sohn SJ, Won AJ, Kim HS, Moon A(2014)Identification of noninvasive biomarkers for nephrotoxicity using HK-2 human kidney epithelial cells. Toxicol Sci 140(2):247\u0026ndash;258\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Bai X, Chen J et al (2024) Pyruvate kinase M2 regulates kidney fibrosis through pericyte glycolysis during the progression from acute kidney injury to chronic kidney disease. Cell Prolif 57(2):e13548\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H (2023) )circRNA: a promising all-around star in the future. Epigenomics 15(12):677\u0026ndash;685\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu T, Wang Y, Fan Y et al(2019)CircRNAs in cancer metabolism: a review. J Hematol Oncol 12(1):90\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Z, Huang C, Bao C et al (2015)Exon-intron circular RNAs regulate transcription in the nucleus. Nat Struct Mol Biol 22(3):256\u0026ndash;264\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen L, Wang C, Sun H et al (2021)The bioinformatics toolbox for circRNA discovery and analysis. Brief Bioinform 22(2):1706\u0026ndash;1728\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHansen TB, Jensen TI, Clausen BH et al (2013)Natural RNA circles function as efficient microRNA sponges. Nature 495(7441):384\u0026ndash;388\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao Y, Peng X, Li X et al (2022)CircRNA_45478 promotes ischemic AKI by targeting the miR-190a-5p/PHLPP1 axis. FASEB J 36(12):e22633\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou W, Chen YX, Ke B et al (2022) )circPlekha7 suppresses renal fibrosis via targeting miR-493-3p/KLF4. Epigenomics 14(4):199\u0026ndash;217\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuan R, Tian G, Ci X et al (2021)Differential expression analysis of urinary exosomal circular RNAs in patients with IgA nephropathy. Nephrol (Carlton) 26(5):432\u0026ndash;441\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Supplementary Figure and Table","content":"\u003cp\u003eSupplementary Figure 1 and Supplementary Table 3 are not available with this version.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"IgA nephropathy, Mesangial cell, Warburg effect, PKM2, Circular RNA","lastPublishedDoi":"10.21203/rs.3.rs-3996101/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3996101/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAberrant mesangial cell proliferation is a prevailing histopathological feature of immunoglobulin A nephropathy (IgAN) and is the primary driver of glomerular sclerosis and impaired renal function in IgAN patients. Prior research has revealed that PKM2-mediated aerobic glycolysis (the Warburg effect) frequently promotes mesangial cell growth and contributes to the development of various acute and chronic kidney diseases. However, the expression and functionality of PKM2 in IgA nephropathy, as well as the underlying molecular mechanisms governing its abnormal expression, remain elusive. Circular RNAs, a subset of noncoding RNAs, have garnered increasing attention due to mounting evidence of their pivotal roles in the initiation and progression of numerous disorders. The present study aimed to explore the effects of circRNA_0013747 on IgAN and the potential underlying mechanisms. The results indicated notable overexpression of circRNA_0013747 in lipopolysaccharide (LPS)-treated human mesangial cells (HMCs) and kidney biopsy samples from IgAN patients. CircRNA_0013747 was shown to facilitate mesangial cell proliferation and activate PKM2-mediated aerobic glycolysis, although these effects were mitigated by an increase in miR-330-3p. Mechanistically, circRNA_0013747 physically interacted with microRNA-330-3p (miR-330-3p) and hindered its function by directly binding to it. These findings imply that circRNA_0013747 can enhance glycolysis and proliferation in mesangial cells by modulating the miR-330-3p/PKM2 signaling pathway. In conclusion, the present results underscore the possibility of circRNA_0013747 serving as a promising therapeutic target for IgAN, suggesting new prospects for treating this disease.\u003c/p\u003e","manuscriptTitle":"CircRNA-0013747 induces mesangial cell proliferation in IgA nephropathy by targeting the Warburg effect via miR-330- 3p/PKM2 signaling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-05 16:17:42","doi":"10.21203/rs.3.rs-3996101/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c45171de-6179-4eaf-b407-058d904b6500","owner":[],"postedDate":"March 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-30T04:49:26+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-05 16:17:42","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3996101","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3996101","identity":"rs-3996101","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.