Clone-based sequencing and NGS of plant growth-promoting genes from metagenomic DNA of rice rhizosphere show marked diversity

Clone-based sequencing and NGS of plant growth-promoting genes from metagenomic DNA of rice rhizosphere show marked diversity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Clone-based sequencing and NGS of plant growth-promoting genes from metagenomic DNA of rice rhizosphere show marked diversity Vivek Kumar, Ashok Kumar This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3110729/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Backgrounds and Aims An attempt has been made to assess the distribution and diversity of important plant growth-promoting genes from the metagenomic DNA of rice rhizosphere soil. Methods A novel multiplex polymerase chain reaction was developed for the amplification of three important genes namely nifH , pqqC and accd-DR simultaneously from the metagenomic DNA. Next generation sequencing was employed for the sequencing of above genes for the assessment of diversity. Results Ninety six nifH clones from the metagenomic DNA of rice rhizosphere were selected which belonged to 15 groups on the basis of RFLP. Sequencing of the representative 15 clones showed higher level of similarity with the uncultured bacteria. Similarly, 12 clones of pqqC were selected, majority of the clones showed similarity with both uncultured and cultured bacteria. NGS of nifH showed fourteen types of genera with varying number of OTUs, the dominant genus identified as Halorhodospira (7.38%). pqqC and accd-DR showed seven types of genera with varying number of OTUs. The highest abundance of Pseudomonas sp. (48.73%) was noted in pqqC and accd-DR showed the abundance of Acidovorax sp. (58.28%). Conclusions Altogether, findings of this study suggest marked diversity in nifH, pqqC and accd-DR genes in rice rhizosphere. It would be desirable to apply both clone-based sequencing and NGS for the analysis of total bacterial community and plant growth promoting genes from the metagenome of any habitat. Rhizosphere Plant growth-promoting genes Multiplex PCR Next generation DNA sequencing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Plant roots are associated with a vast array of microorganisms including both prokaryotes and eukaryotes. In general, marked diversity in their population and profile exist due to the fluctuating abiotic and biotic factors including plant metabolites (de Weger et al. 1995 ). Several researchers have made extensive studies to unravel the bacterial profile surrounding the rhizosphere but this ecological niche has still remained a black box (da Rocha et al. 2009 ). This is mainly due to the fact that several bacteria growing in the rhizosphere of plants are unculturable (da Rocha et al. 2009 ). However, during the last few decades several bacteria belonging to different genera have been isolated from rhizosphere of various crop plants with proven beneficial effects on plant growth (Backer et al. 2018 ; Compant et al. 2010 ; Kloepper et al. 1989 ; Rosier et al. 2018 ; Wang et al. 2020 ). These bacteria referred as plant growth-promoting rhizobacteria (PGPR) promote plant growth directly or indirectly by their potential to fix N 2 , production of plant growth hormones, siderophores and 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and roles in mineral phosphate solubilization and disease control and/or systemic plant defenses (Bruto et al. 2014 ; Lugtenberg and Kamilova 2009 ; Maksimov et al. 2011 ; Singh et al. 2015 ). Among the most important beneficial attributes, N 2 fixation by bacteria plays key role in enriching fixed nitrogen in natural ecosystem and increasing the fertility of soil especially the rice fields (Rosenblueth et al. 2018 ; Wang et al. 2023 ). The process of N 2 fixation is mediated by one of the oldest and existing enzymes nitrogenase which is made up of two components, namely component I (MoFe-protein or dinitrogenase) encoded by nifD and nifK and component II (Fe-protein or dinitrogenase reductase) encoded by nifH structural genes. Several reports have documented high degree of sequence conservation in nifH (Burgmann et al. 2004 ; Gaby and Buckley 2014 ). nifH has been widely used as a marker for studying the diversity of diazotrophs in different habitats including the rhizosphere of various plants (Bittleston et al. 2023 ; Engelhard et al. 2000 ; Franco-Dias et al. 2012 ; Knauth et al. 2005 ; Lovell et al. 2000 ; Ueda et al. 1995 ). Occurrence of P solubilising potential and the mechanisms of solubilisation in several bacteria have been documented by several researchers (Alori et al. 2017 ). P solubilisation in bacteria is carried out mainly by acid production such as gluconic acid (GA) and 2-ketogluconic acid (2-KGA). Gluconic acid synthesized in cytoplasm is released in soil, and chelates the cations associated with phosphate complex and make soluble phosphors easily accessible to plants (de Werra et al. 2009 ). The acid production is dependent on the oxidation of glucose catalyzed by glucose dehydrogenase (GDH) using pyrroloquinoline quinine (PQQ) as a cofactor (Shen et al. 2012 ). The genes involved in PQQ production have been cloned and sequenced from several bacteria (Long et al. 2018 ; Meyer et al. 2011 ). The most widely studied PQQ operon in P. fluorescens B16 constitute 11 genes of which the pqqC encodes pyrroloquinoline quinone synthase C (PqqC) and catalyzes the final step of the PQQ biosynthesis (Magnusson et al. 2004 ; Shen et al. 2012 ). Several researchers have reported the presence of PQQ in different bacteria but the genetic diversity of this important cofactor is poorly understood (Bruto et al. 2014 ). Equally important is the synthesis of an enzyme 1-aminocyclopropane-1-carboxylate deaminase (ACCD) by bacteria which helps growth of plants exposed to abiotic and/or biotic stresses (Bouffaud et al. 2018 ; Singh et al. 2015 ). ACCD-possessing bacteria catalyze the degradation of 1-aminocyclopropane-1-carboxylate (ACC) to α-ketobutyrate and ammonia leading to decreased ACC levels in plants. The decrease in ACC level by the action of ACCD of bacteria lowers the level of ethylene and offers protection against destructive effects of environmental stressors to the plants (Glick et al. 2007 , 2014; Singh et al. 2015 ). ACCD is a multimeric enzyme of approximately 35–42 kDa with a pyridoxal 5’-phosphate (PLP) as an active site (Yao et al. 2000 ). The structural genes encoding ACCD from several bacteria have been identified as acdS genes (Nascimento et al. 2014 ; Singh et al. 2015 ). acdS are GC rich and highly polymorphic, genetic diversity analysis is problematic (Bouffaud et al. 2018 ; Manter et al. 2023 ; Nascimento et al. 2014 ). However, a degenerate primer pair has been synthesized to amplify a 113 bp region designated as the ACCD domain region (ACCD-DR) which has well conserved region suitable for genetic analysis (Jin et al. 2016 ). Till date, functional genetic diversity analysis of important genes namely nifH, pqq, ipdc, acdS etc has been made by selecting one gene at a time that too mostly from the culturable bacteria (Jin et al. 2016 ; Meyer et al. 2011 ; Soni et al. 2016 ). Undoubtedly, findings have greatly advanced knowledge but there is a need to reveal diversity of these genes both in culturable and unculturable bacteria inhabiting the rhizospheric region of any plants. Accordingly, we became interested to address a few questions; a) can important plant growth promoting genes of bacteria namely nifH, pqq , and accd-DR and 16S rRNA (as a reference gene) be amplified simultaneously employing multiplex PCR, and b) rhizosphere metagenomic DNA is indeed a suitable source for genetic diversity analysis of above genes? Materials and methods Rhizospheric soil sampling The rhizosphere soil was collected in the month of November 2017, from a rice field of the Agricultural farm of Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh (25 0 21'N, 83 0 1'E and ~ 76m above mean sea level). For the collection of soil sample, five rice plants from different corners of the field were uprooted and the adhering soil was placed in a sterile plastic bag and mixed properly. The plastic bag was kept in an ice box and transported to the laboratory. Unless otherwise stated, soil sample was immediately processed for the isolation of DNA. Metagenomic DNA extraction The metagenomic DNA from soil was extracted employing PowerSoil DNA isolation kit (MOBio Laboratories, Inc., USA) following the instructions of the manufacturer. For obtaining sufficient amount of DNA, extraction was done in batches (in 10 tubes) and DNA of all the tubes was pooled together. Integrity and quality of the extracted DNA were checked by running 0.8% (w/v) agarose gel electrophoresis followed by visualization in UV light. Multiplex PCR for the amplification of selected genes Three bacterial genes namely pqqC , nifH and accd-DR were selected for the amplification from the soil metagenomc DNA. 16S rRNA was included as a reference gene for ensuring the presence of bacterial community in soil sample. Prior to performing multiplex PCR, amplification of all four genes was tested individually using routine PCR and standard primers (Table 1 ). This step was essential to select a suitable annealing temperature in running multiplex PCR. PCR was done in a final volume of 100 µL which contained 1.5 U of Taq DNA polymerase (Bangalore Genei, India), 1X PCR assay buffer with 1.5 mM MgCl 2 , 50 pmol each of the forward and reverse primers of all the four genes (Integrated DNA Technology, USA), 125 µM each of the dNTPs, and 100 ng of template DNA. Thermal cycles for the amplification were set as described in Fig. 1 a. To verify the amplification of desired genes, 5 µL of the amplified PCR product was electrophoresed on a 2% agarose gel in Tris-acetate-EDTA buffer (TAE) containing ethidium bromide (0.5 µg mL − 1 ) and monitored in gel documentation unit (Bio-Rad Laboratories, USA). Table 1 Primers used for amplification of different genes (F/f, forward; R/r, reverse) Genes Primer sequences (5’→ 3’) Annealing temperature (Tm) Amplicon size (bp) References ACCD-DR a2F: GSAACAAGACGCGCAAG a2R: CACSAGCACGCACTTCATG 52°C 113 Jin et al. 2016 16S rRNA 8f: AGAGTTTGATYMTGGCTCAG 1495r: CTACGGCTACCTTGTTACGA 52°C 1500 Shahi and Kumar 2016 pqqC f1: CATGGCATCGAGCATGCTCC r1: CAGGGCTGGGTCGCCAACC 60°C 546 Meyer et al. 2011 nifH 19F: GCIWTYTAYGGIAARGGIGG 407R: AAICCRCCRCAIACIACRTC 56°C 390 Ueda et al. 1995 Cloning of genes 16S rRNA , pqqC , nifH and accd-DR amplified by multiplex PCR were purified by Wizard SV Gel and PCR Clean-Up System following the instructions of manufacturer (Promega, USA). The purified 16S rRNA , pqqC , nifH and accd-DR were cloned in pGEM-T easy cloning vector (Promega, USA) following the manufacturer’s instructions. The recombinants were transformed into E. coli JM 109 high efficiency competent cells (Promega, USA). 96 clones for each gene were randomly selected for further study. The confirmation of insert in each clone was done by colony PCR. Restriction fragment length polymorphism (RFLP) analysis of pqqC and nifH Amplified PCR products of pqqC and nifH of all the clones were double digested separately using Alu I and Rsa I restriction endonucleases (New England Biolabs Inc., UK). Digestion of PCR products was done in 25 µL reaction mixture which contained 2.5 µL 1X CutSmart buffer, 0.20 µL (3.0 U) of each enzyme and 15 µL of PCR product, the remaining volume was maintained by nuclease-free MilliQ water. The reaction mixture was incubated at 37 0 C for 4 h and terminated by heat inactivation of restriction enzymes at 70 0 C for 20 min. To check the RFLP pattern, 15 µL of the digested product was electrophoresed in a 3% low melting agarose gel at 50 V in TAE buffer (Macro-drive, LKB Sweden). Cluster analysis of RFLP was made by unweighted pair-group method with arithmetic means using Quantity One 1-D Analysis Software, version 4.4 (Bio-Rad Laboratories, USA). One representative clone from each RFLP group was selected and grown overnight in LB medium supplemented with ampicillin (100 µg mL − 1 ). Plasmid from each representative clone was isolated employing HiPurA Plasmid DNA Miniprep Purification Kit (HiMedia Laboratories, Mumbai). Insert from the recombinant cl o ne was recovered by digestion of the plasmid with Eco RI restriction enzyme followed by agarose gel electrophoresis. Sequencing of insert was done commercially from SciGenome Labs. Pvt. Ltd., India. nifH and pqqC sequences from representative clone were compared with the GenBank database by using the algorithm BLASTN program to identify the most similar sequences of unculturable and cultured bacteria. Owing to the very small size of accd-DR (113 bp), its RFLP analysis could not be performed. Next generation sequencing (NGS) of nifH, pqqC and accd-DR NGS of multiplex-PCR generated amplicon was performed on commercial basis (SciGenome Labs. Pvt. Ltd, India) in Illumina HiSeq 2500 using paired end (250 bp × 2) library type. To ensure the quality of sequencing, the raw reads were checked with the FastQC tool (version. 0.11.8) with default parameters. Unless otherwise stated, pre-processed consensus sequences of the genes ( nifH, pqqC and accd-DR ) were used for operational taxonomic units (OTUs) selection and taxonomy classification. For taxonomical classification, representative sequences from each OTU were picked and classification was performed using RPD classifier by mapping each selected sequence against nifH data base ( http://www.css.cornell.edu/faculty/buckley/hifh.htm ). Taxonomical classification of selected pqqC and accd-DR from each cluster was done using DIAMOND BLASTX program against UniProt pqqC and ACCD-DR OTUs database respectively. Multiple sequence alignment and phylogenetic analysis The nucleotide sequences obtained after sequencing were trimmed and resultant sequences were translated into protein coding amino acids with the help of ExPASy translational tool. Multiple sequence alignment of the deduced amino acids was carried out with ClustalW2 software (version 2.0.10) and visualized in sequence viewer. Phylogenetic tree of nifH, pqqC and accd-DR was constructed in MEGA 7 (Kumar et al. 2016 ) using bootstrapping at 1000 bootstrap trials with the two-parameter model of Kimura. Results Amplification of genes by multiplex PCR Three genes namely nifH, pqqC and accd-DR and the reference gene 16S rRNA were successfully amplified employing multiplex PCR from the metagenomic DNA extracted from the rhizospheric soil of rice plant (Fig. 1 b). Four DNA bands of approx. 1500, 546, 390 and 113 bp corresponding to 16S rRNA, pqqC, nifH and accd-DR were repeatedly observed suggesting the efficacy of multiplex PCR in amplification of all the genes (Fig. 1 b). That the amplified amplicons are indeed from bacteria is evident from the fact that the template DNA used also resulted in the amplification of 16S rRNA . Aanlysis of nifH and pqqC diversity in rhizosphere of rice A 390 bp amplicon of nifH amplified by multiplex PCR using metagenomic DNA was cloned in pGEM-T easy cloning vector to obtain large number of nifH clones. 96 clones were selected and insert was double digested with Alu I and Rsa I which generated 15 RFLP groups. One representative from each RFLP group of clones was sequenced and subjected to BLAST for nifH sequence diversity. It is evident from the results of Table 2 that the highest number of identical clones are present in SBT AK C3 (27) followed by SBT AK C1 (14). Furthermore, results of BLAST analysis showed that the sequences belonging to five clones (SBT AK C1, AK C3, AK C6, AK C45 and AK C52) are represented by different species of Bradyrhizobium/Mesorhizobium (out of 15 clones). The remaining ten clones contain sequences of different genera/order/classes (Table 2 ). It is also evident from the data that majority of the clones exhibit maximum similarity (91–100%) with unculturable bacteria. In fact, three clones showed 100% similarity with the uncultured bacterial sequences. Further analysis of sequences revealed the presence of highest percentage of sequences belonging to the phylum proteobacteria (10/15, 66.66%) comprising alpha (5/15), beta (2/15), gamma (1/15) and delta classes (2/15). Sequences of four clones with very low percentage (ranging from 6.66 to 13.33%) belonged to other group of bacteria. Sequence of the clone-SBT AK C2 did not show affiliation with nifH sequences of any cultured bacteria. Table 2 Similarity of nifH sequences of various clones with uncultured and cultured bacterial sequences available in the database nifH clones Accession number of this study Closest uncultured bacteria (accession number) % Identity Closest match (cultured bacteria) Accession number % Identity Group affiliation SBT AK C1 (14) MF680849 AHN51144.1 100 Bradyrhizobium japonicum ACT67989.1 99 α SBT AK C2 (3) MF680850 ACN23728.1 94 - - - Other SBT AK C3 (27) MF680851 CAG30111.1 100 Bradyrhizobium sp. BAF95631.1 98 α SBT AK C6 (8) MF680852 AHN50517.1 96 Bradyrhizobium japonicum ACT67982.1 96 α SBT AK C10 (6) MF680853 APA22235.1 95 Methanocella conradii WP014404752.1 94 Archaea SBT AK C14 (4) MF680854 ADZ48369.1 100 Azoarcus communis Rhodocyclales bacterium AAB63033.2 OHC65356.1 98 98 β SBT AK C24 (4) MF680855 ADX43226.1 93 Methanoregula boonei WP012106688.1 92 Archaea SBT AK C26 (4) MF680856 APD29463.1 95 Syntrophus gentianae WP093883931.1 96 α SBT AK C28 (3) MF680857 ADZ48348.1 98 Desulfuromonadales sp. OGR29997.1 99 α SBT AK C45 (4) MF680858 AHN51275.1 99 Bradyrhizobium sp. ACT67983.1 99 α SBT AK C50 (5) MF680859 AHN50775.1 98 Opitutaceae bacterium WP009512762.1 95 Verrucomicrobia SBT AK C52 (6) MF680860 AHN51303.1 99 Bradyrhizobium sp. Mesorhizobium loti AML61104.1 BAF95636.1 99 98 α SBT AK C53 (4) MF680861 BAP16836.1 91 Gallionellales sp. OGS90295.1 94 β SBT AK C73 (2) MF680862 APA22124.1 97 Nitrospirae bacteria OGW27708.1 96 Nitrospirae SBT AK C85 (2) MF680863 AJF14338.1 94 Vibrio natriegens AAD55588.1 93 γ Query coverage- 100% for both uncultured and cultured bacteria. Number in bracket shows total number of clones present in each representative clone based on RFLP similarity. In the case of pqqC , 96 clones were selected following the protocol adopted for the nifH analysis. All the 96 clones clustered to twelve groups on the basis of RFLP pattern. Of the 12 representative clones, the highest number of identical clones were present in the SBT AK8 (28) followed by SBT AK1 (12) (Table 3 ). The remaining ten clones contained three to eight clones. Further analysis of representative sequences of six clones (SBT AK1, AK8, AK13, AK19, AK78 and AK96) revealed identical level of similarity with both the cultured and uncultured bacteria. However, sequences of the remaining six clones showed higher level of similarity with the cultured bacteria. Interestingly, of the 12 group of clones, 10 clones consisted members of cultured pseudomonads namely Pseudomonas putida, Pseudomonas sp. GM50, Pseudomonas lini , Pseudomonas sp. FSL W5-0299, Pseudomonas mandelii , Pseudomonas sp., Pseudomonas oryzae , Pseudomonas sp. PICF141, and Pseudomonas sihuiensis all belonging to γ- proteobacteria . Sequence of the clone SBT AK96 also belonged to a member of gamma class, Marinobacterium jannaschii (with 75% percent identity). Clone SBT AK40 did not show affiliation with any bacteria present in the NCBI database, nevertheless shared homology with the sequence of cultured bacterium, Candidatus Entotheonella with 100% query coverage and 74% identity (Table 3 ). Table 3 Similarity of pqqC sequence of various clones with uncultured and cultured bacterial sequences available in the database pqqC clones Accession number of this study Closest uncultured bacteria (accession number) % Identity Closest match (cultured bacteria) Accession number % Identity Group affiliation SBT AK1(12) MH453460 ATI09183.1 99 Pseudomonas putida WP079226301.1 99 γ SBT AK8 (28) MH453461 ATP13615.1 97 Pseudomonas sp. GM50 WP008008220.1 97 γ SBT AK13 (6) MH453462 ATP13615.1 99 Pseudomonas lini WP048396408.1 99 γ SBT AK19 (5) MH453463 ATI09183.1 100 Pseudomonas putida WP014755118.1 100 γ SBT AK25(5) MH453464 ATP13613.1 97 Pseudomonas sp. FSL W5-0299 WP077749285.1 99 γ SBT AK33 (6) MH453465 ATP13613.1 98 Pseudomonas mandelii WP083376520 99 γ SBT AK36 (7) MH453466 ATP13613.1 97 Pseudomonas sp. WP018929700.1 99 γ SBT AK40 (5) MH453467 - - Candidatus Entotheonella gemina ETX06873.1 74 Other SBT AK54 (7) MH453468 ATP13506.1 91 Pseudomonas oryzae WP090351895.1 94 γ SBT AK78 (8) MH453469 ATP13615.1 99 Pseudomonas sp. PICF141 WP095630850.1 99 γ SBT AK91 (4) MH453470 ATP13489.1 92 Pseudomonas sihuiensis WP092375741.1 96 γ SBT AK96 (3) MH453471 ATP13506.1 75 Marinobacterium jannaschii WP027857990.1 75 γ Query coverage- 100% for both uncultured and cultured bacteria. Number in bracket shows total number of clones present in each representative clone based on RFLP pattern similarity. NGS for nifH, pqqC and accd-DR diversity and bacterial community composition With a view to gain better understanding of nifH sequence diversity, NGS approach was applied. Altogether, 90236 consensus sequences of nifH were retrieved and after removing 12324 (13.66%) chimeric sequences, 77912 (86.34%) pre-processed consensus sequences were obtained. With 77912 pre-processed consensus sequences, 21532 OTUs were obtained after clustering based on sequence similarity (similarity cut off = 0.97). Subsequently, 19487 OTUs having less than five reads were filtered and the remaining 2045 OTUs finally selected for the taxonomical abundance study. Altogether, fourteen types of genera containing varying number of OTUs were found. Halorhodospira was the dominant genus with 151 OTUs (7.38%) followed by Frankia (6.74%) and Bradyrhizobium (6.55%). Percent distribution of OTUs in other genera are presented in Fig. 2 a. Sequences showing no alignment against taxonomic database comprised 65.86% (unknown) and those less than five in numbers included 1.22% (Fig. 2 a). Similarly, NGS of pqqC was done following the steps used for nifH analysis. Altogether, 15,805 OTUs were obtained after clustering based on the sequence similarity of total reads. Pseudomonas sp. was the dominant genus with 7,703 OTUs (48.73%) followed by Acinetobacter sp. (6.78%) and Azotobacter sp. (6.01%). Percent distribution of OTUs in other genera were; Klebsiella sp. (2.73%), Xanthomonas sp. (1.46%), Erwinia sp. (0.87%), Stenotrophomonas sp. (0.77%) and others (32.6%) (Fig. 2 b). NGS of accd-DR (113 bp) was done as per the steps used for nifH and pqqC analysis. Accordingly, of the 367529 paired-end reads, 361570 pre-processed consensuses sequences were obtained. Out of 361570 reads, a total of 69841 OTUs were identified and after removing OTUs with less than 5 reads, 28872 OTUs were finally selected for further analysis. Altogether, seven genera containing varying number of OTUs (above 1%) were found. Data showed the highest abundance of Acidovorax sp. (58.28%) followed by Paraburkholderia sp. (14.75%), Variovorax sp. (8.53%), Desmospora active (5.61%), Pseudomonas syringae (2.17%), Streptomyces sp. (1.80%), Kibdelosporangium aridum (1.01%) and others (7.85%) with less than 1% of OUTs (Fig. 2 c) Phylogenetic analysis of nifH, pqqC and accd-DR Open reading frame (ORF) for amino acid sequence was checked and similar orientation for sequences of all the clones was made for multiple sequence alignment (MSA) (Fig. 3 a, b, c). Phylogenetic tree of NifH sequences based on the deduced amino acid sequences was constructed by using sequences of fifteen clones of this study and twenty one similar sequences of NifH protein of cultured bacteria retrieved from NCBI database. It is evident from the tree that all the 15 clones could be placed in two clusters comprising NifH sequences of alpha-, beta-, gamma-, delta- proteobacteria and other bacterial nitrogenases (Fig. 4 ). Clone SBT C1 showed close relationship (98% amino acid similarity) to Geobacter sp.-OR 1 and Geobacter sp. M21 (94%). Clone SBT AK 45 is most closely related (99% amino acid similarity) to Geobacter pickeringii . Clone SBT AK28 shares 99% similarity with the sequence of Desulfuromonas sp. Clone SBT AK C14 shares 99% similarity with the nitrogenase amino acid sequence of the beta- proteobacteria Azoarcus sp. CC-YHH848 and Thauera sp. D20. Clone SBT AK85 is related to the sequence of Methylomonas (96%) and Vibrio natriegens NBRC (83%). Similarly, clone SBT AK73 shares 97% similarity with the amino acid sequence of the alpha-class bacterium Bradyrhizobium japonicum . Clone SBT AK53 shows similarity (93%) with the sequence of Gallionellales bacterium GWA2. Nitrogenase amino acid sequence of the clone SBT AK C52 shows close relationship with the sequence of Bradyrhizobium sp. (99%) followed by Mesorhizobium loti (98%). Clone SBT AK C3 shares 98% similarity (amino acid sequence) with the sequence of Xanthobacter tagetidis. NifH protein sequences of the clones SBT AK C50, C6 and C26 show 97, 95 and 96% similarity with the sequences of Bradyrhizobium japonicum , B. japonicum and Syntrophus gentianae respectively (Fig. 4 ). Clones SBT AK C2, C10 and C24 show relatedness (89 to 93% amino acid similarity) with the sequence of nitrogenase of bacteria namely Spirochaeta perfilievii , Methanocella conradii and Kiritimatiellales . Similar to NifH, phylogenetic tree of PqqC was constructed using the deduced amino acid sequences of one representative from all the twelve clones and ten similar sequences of PqqC of cultured bacteria retrieved from NCBI data base. Evidently, all the twelve clones fall into two clusters with five groups in cluster I (10 clones) and one in cluster II (2 clones). Representative sequences from clones of cluster I show close relationship (99 to 100% amino acid similarity) with different species of Pseudomonas (Fig. 5 ). Of these, sequences of clones SBT AK33, AK36 and AK19 shared 100% similarity with the sequences of Pseudomonas species. Sequences of two clones (SBT AK8 and AK91) shared 96–97% similarity with different species of Pseudomonas but clone SBT AK54 had only 93% similarity with the sequence of P. oryzae . On the other hand, clones SBT AK40 and AK96 from cluster II grouped together and showed 100% homology between each other but did not show significant similarity (maximum 76% similarity) with the sequences of any species available in the database (Fig. 5 ). It is also evident from the phylogenetic analysis that there is a high degree of relatedness between majority of the Pseudomonas sp. Construction of pylogenetic tree of accd-DR was possible by using top six OTUs nucleotide sequences assigned in NGS for bacterial species namely OTU1- Acidovorax sp., OUT13- Par a burkholderia sp., OTU26- Pseudomonas sp., OTU44- Streptomyces sp., OTU65- Kibdelosporangium phytohabitans and OTU78- Variovorax sp. accd-DR nucleotide sequences of above OTUs were converted into amino acid sequences with the help of translational tool. Resultant amino acid sequences of each OTU were queried for similarity (above 97%) search against NCBI database and phylogenetic tree was constructed. Among the six OTUs, sequences of OTU1, OTU13, OTU44 and OTU65 shared 100% similarity with Acidovorax citrulli , Paraburkholderia , Streptomyces sp. and Kibdelosporangium phytohabitans respectively. Sequences of OTUs78 and 26 showed 92 and 99% similarity with the sequences of Variovorax sp. and Pseudomonas sp. respectively (Fig. 6 ). Discussion A number of PGPR with multiple beneficial characteristics have been isolated and genes involved in plant growth-promoting (PGP) activities have been identified and characterized but mostly from cultured bacteria (Bruto et al. 2014 ; Lugtenberg and Kamilova 2009 ; Rosier et al. 2018 ). Henceforth, culture-independent molecular approaches are essential for community analysis and diversity of important genes namely nifH , pqqC , ipdC/ppdC , acdS/acdR and others from uncultured (Daniel 2004 ; Gaby and Buckley 2014 ; Omotayo et al. 2022 ). To date, majority of the studies have used PCR-based assay for the detection of one gene using single set of primers at a time (Dang et al. 2013 ; Lovell et al. 2000 ; Nikolic et al. 2011 ; Sarita et al. 2008 ; Ueda et al. 1995 ; Wu et al. 2009 ). In the present study, an multiplex PCR has been employed which can detect four genes including three PGP genes namely nifH , pqqC , accd-DR and one reference gene 16S rRNA simultaneously in one reaction mixture using soil metagenomic DNA. Altogether, multiplex PCR seems cost effective and rapid compared to detection of gene by running PCR separately for each gene. To our knowledge, our study is the first of its kind which demonstrates amplification of four genes by using multiplex PCR assay from the metagenomic DNA. Similar to our approach, PCR has been developed for the simultaneous detection of several pathogens in clinical samples and genes involved in conferring resistance to β-lactam and other antibiotics (Mata et al. 2004 ; Shahi et al. 2016). Among the PGP genes, diversity of nifH has been widely studied from the rhizospheric soil of different plants, forest soils, sediments, ocean water etc employing metagenomic approaches (Bahulikar et al. 2014 ; Bittleston et al. 2023 ; Dang et al. 2013 ; Delmont et al. 2018 ; Mehta et al. 2003 ; Meng et al. 2019 ; Ueda et al. 1995 ; Zilius et al. 2020 ). Diversity of nifH distribution is expected considering the occurrence of nitrogen-fixing microorganisms (diazotrophs) in majority of Earth’s ecosystem, although their distribution changes from habitat to habitat. In this study, of the 96 nifH clones derived from the rhizospheric soil of rice, 15 groups were formed on the basis of RFLP pattern. Majority of the clones (5 out of 15 clones) belonged to different species of Bradyrhizobium/Mesorhizobium and the highest percentage of sequences belonged to the phylum proteobacteria (10 out of 15 clones, 66.66%). Validity of the nifH sequences cannot be doubted considering the fact that all the species of Bradyrhizobium/Mesorhizobium are known to fix N 2 (Lugtenberg and Kamilova 2009 ; Rosenblueth et al. 2018 ). Similar to our findings, Bahulikar et al. ( 2014 ) have also reported 58% of nifH sequences belonging to the order Rhizobiales (comprising Bradyrhizobium , Mesorhizobium , Methylobacterium , Rhizobium , and Sinorhizobium ) derived from the metagenomic DNA of rhizospheric soil of Switchgrass. Meng et al. ( 2019 ) also reported the dominance of Bradyrhizobium (up to 45%) based on the high-throughput sequencing of nifH from the acidic sub-tropical forest soil. Several genera reported in the present study have been also reported from the sugarcane rhizosphere through high-throughput sequencing of nifH (Gaby et al. 2018 ). Ueda et al. ( 1995 ) obtained as many as 23 nifH sequences of phylogenetically diverse types of diazotrophic bacteria from rice roots without culturing the organism. Interestingly, we detected two clones that showed similarity with archaeal nifH sequences, reports on evolutionary history of nifH suggest high frequency of horizontal gene transfer of this gene, even at the inter domain level including bacteria and archaea (Raymond et al. 2004 ). Similar to the data of clone-based sequencing, bacterial diversity analysis based on NGS data also showed dominance of the phylum proteobacteria comprising the classes α-, β-, γ- and δ- proteobacteria . This was expected as the members of proteobacteria are reported to occur in all types of ecosystems (Jing et al. 2015 ; Meng et al. 2019 ). However, unlike the data of direct sequencing of nifH amplicon where dominance of Bradyrhizobium/Mesorhizobium was observed, NGS data showed the dominance of Halorhodospira with 151 OTUs (7.38%) followed by Frankia (6.74%) and Bradyrhizobium (6.55%). Role of PQQ as a co-factor in the biosynthesis of gluconic acid has been well documented in several bacteria (de Werra et al. 2009 ). However, little, if any, attempt has been made to investigate its occurrence and diversity in unculturable bacteria (Meyer et al. 2011 ). Herein, by cloning and sequencing of one of the important genes of PQQ operon namely pqqC from metagenomic DNA, we report its occurrence in uncultured bacteria. The presence of pqqC was noted mostly in different species of Pseudomonas , a finding similar to those reported by Meyer et al. ( 2011 ). This was expected owing to the fact that the novel PCR primer pair developed specifically for Pseudomonas species by Meyer et al. ( 2011 ) was used in this study. Nevertheless, findings of this study clearly suggest wide occurrence of pqqC from the rice rhizosphere metagenomic DNA and point to the role of PQQ as cofactor in GDH-mediated P solubilization using glucose as a carbon source by bacteria (An and Moe 2016 ). Amino acids sequence of ACCD-DR translated from Accd-DR DNA suggest that rice rhizosphere metagenome contains a significant pool of ACC deaminase protein of different bacteria. This was evident from the presence of ACCD-DR in bacterial genera including Acidovorax sp., Variovorax sp., Pseudomonas sp, Paraburkholderia sp., Kibdelosporangium aridum , and Streptomyces sp. This finding is in agreement with the data of phylogenetic tree constructed on the basis of clustering of amino acid sequences. It is also interesting to note that the majority of the genera belonged to the phylum proteobacteria followed by actinobacteria. Occurrence of ACCD gene has been reported in diverse taxa but predominatnce in the phyla proteobacteria , actinobacteria and firmicutes has been reported (Manter et al. 2023 ; Nascimento et al. 2014 ). Our findings are consistent with the above reports and suggest the wide prevalence of ACCD protein in the rice rhizosphere. However, a better understanding of functional genetic diversity of ACCD gene may emerge only, if, universal primer capable of amplifying the full length of the gene from different genera of bacteria is developed. In conclusion, findings of this study show that multiplex PCR can be routinely used to amplify important PGP genes simultaneously in one reaction mixture thereby making the process cheaper and rapid. Assessment of genetic diversity of three PGP genes revealed vast diversity of nifH in clone-based sequencing and NGS of metagenomic DNA isolated from the rice rhizosphere soil. However, pqqC gene was represented mainly by different species of Pseudomonas in clone-based sequencing and NGS. Presence of ACCD-DR was evident in different genera but predominantly in the members belonging to the phyla proteobacteria and actinobacteria. Findings of this study suggest that rhizospheric metagenomic DNA may serve as a suitable source for studying genetic diversity of PGP genes. Declarations Acknowledgements VK is thankful to Indian Council of Medical Research (ICMR), New Delhi, for providing financial support in the form of Senior Research Fellowship (No. 45/20/2018-PHA/BMS/OL). AK is grateful to University Grants Commission, New Delhi, for the award of BSR fellowship (F-18-1/2011-BSR). Thanks are also due to the Coordinators, Biotechnology, UGC-SAP and Centre for Bioinformatics, School of Biotechnology, Banaras Hindu University, Varanasi, India, for providing required facilities as and when required. Author Contributions VK performed the experiments. AK planned the experiments and helped in writing the manuscript . Funding This study was partly supported by a research grant sanctioned to AK by the Indian Council of Agricultural Research (ICAR), Government of India, New Delhi (NBAIM/AMAAS/2014-17/PF/4). Data Availability The nucleotide sequences of fifteen nifH and twelve pqqC have been submitted to the National Center for Biotechnology Information (NCBI) GenBank database under the accession numbers MF680849-MF680863 and MH453460-MH453471 respectively. The next generation sequencing (NGS) data is available in the NCBI database under the BioProject numbers PRJNA578577. Confict of interests The authors declare that they have no known competing fnancial interests or personal relationships that could have appeared to infuence the work reported in this paper. References Alori ET, Glick BR, Babalola OO (2017) Microbial phosphorus solubilization and its potential for use in sustainable agriculture. Front Microbiol 8:971. doi: 10.3389/fmicb.2017.00971 An R, Moe LA (2016) Regulation of pyrroloquinoline quinone-dependent glucose dehydrogenase activity in the model rhizosphere-dwelling bacterium Pseudomonas putida KT2440. Appl Environ Microbiol 82:4955-4964. doi: 10.1128/AEM.00813-16 Backer R, Rokem JS, Ilangumaran G, Lamont J, Praslickova D, Ricci E, Subramanian S, Smith DL (2018) Plant growth-promoting rhizobacteria: context, mechanisms of action, and roadmap to commercialization of biostimulants for sustainable agriculture. Front Plant Sci 9:1473. doi: 10.3389/fpls.2018.01473 Bahulikar RA, Torres-Jerez I, Worley E, Craven K, Udvardi MK (2014) Diversity of nitrogen-fixing bacteria associated with Switchgrass in the native tall grass prairie of Northern Oklahoma. Appl Environ Microbiol 80:5636-5643. doi: 10.1007/s13205-023-03640-w Bittleston LS, Wolock CJ, Maeda J, Infante V, Ané JM, Pierce NE, Pringle A (2023) Carnivorous Nepenthes pitchers with less acidic fluid house nitrogen-fixing bacteria. Appl Environ Microbiol 20:e0081223. doi: 10.1128/aem.00812-23 Bouffaud ML, Renoud S, Dubost A, Moënne-Loccoz Y, Muller D (2018) 1-Aminocyclopropane-1-carboxylate deaminase producers associated to maize and other Poaceae species. Microbiome 6:114. doi: 10.1186/s40168-018-0503-7 Bruto M, Prigent-Combaret C, Muller D, Moënne-Loccoz Y (2014) Analysis of genes contributing to plant-beneficial functions in plant growth-promoting rhizobacteria and related Proteobacteria . Sci Rep 4:6261. doi: 10.1038/srep06261 Burgmann H, Widmer F, Von Sigler W, Zeyer J (2004) New molecular screening tools for analysis of free-living diazotrophs in soil. Appl Environ Microbiol 70:240-247. doi: 10.1128/AEM.70.1.240-247.2004 Compant S, Clément C, Sessitsch A (2010) Plant growth-promoting bacteria in the rhizo- and endosphere of plants: Their role, colonization, mechanisms involved and prospects for utilization. Soil Biol Biochem 42:669-678. doi:10.1016/j.soilbio.2009.11.024 da Rocha UN, van Overbeek L, van Elsas JD (2009) Exploration of hitherto-uncultured bacteria from the rhizosphere. FEMS Microbiol Ecol 69: 313-328. doi: 10.1111/j.1574-6941.2009.00702.x Dang H, Yang J, Li J, Luan X, Zhang Y, Gu G, Xue R, Zong M, Klotz MG (2013) Environment dependent distribution of the sediment nifH -harboring microbiota in the northern South China Sea. Appl Environ Microbiol . 79:121-132. doi: 10.1128/AEM.01889-12 Daniel R (2004) The soil metagenome - a rich resource for the discovery of novel natural products . Curr Opin Biotechnol 15:199-204. doi: 10.1016/j.copbio.2004.04.005 de Weger LA, van der Bij AJ, Dekkers LC, Simons M, Wijffelman CA, Lugtenberg BJ (1995) Colonization of the rhizosphere of crop plants by plant-beneficial pseudomonads. FEMS Microbial Ecol 17:221-277. doi: 10.1016/0168-6496 (95)00031-5 de Werra P, Péchy-Tarr M, Keel C, Maurhofer M (2009) Role of gluconic acid production in the regulation of biocontrol traits of Pseudomonas fluorescens CHA0. Appl Environ Microbiol 75:4162-4174. doi: 10.1128/AEM.00295-09 Delmont TO, Quince C, Shaiber A, Esen ÖC, Lee ST, Rappé MS, McLellan SL, Lücker S, Eren AM (2018) Nitrogen-fixing populations of Planctomycetes and Proteobacteria are abundant in surface ocean metagenomes. Nat Microbiol 3:804-813. doi: 10.1038/s41564-018-0176-9 Engelhard M, Hurek T, Reinhold‐Hurek B (2000) Preferential occurrence of diazotrophic endophytes, Azoarcus spp., in wild rice species and land races of Oryza sativa in comparison with modern races. Environ Microbiol 2:131-141. doi: 10.1046/j.1462-2920.2000.00078.x Franco-Dias AC, Silva MD, Cotta SR, Dini-Andreote F, Soares FL, Salles JF, Azevedo JL, Van Elsas JD, Andreote FD (2012) Abundance and genetic diversity of nifH gene sequences in anthropogenically affected Brazilian mangrove sediments. Appl Environ Microbiol 78:7960-7967. doi: 10.1128/AEM.02273-12 Gaby JC, Buckley DH (2014) A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen-fixing bacteria. Database 2014:bau001. doi: 10.1093/database/bau001 Gaby JC, Rishishwar L, Valderrama-Aguirre LC, Green SJ, Valderrama-Aguirre A, Jordan IK (2018) Diazotroph community characterization via a high-throughput nifH amplicon sequencing and analysis pipeline. Appl Environ Microbiol 84:e01512. doi: 10.1128/AEM.00713-19 Glick BR (2014) Bacteria with ACC deaminase can promote plant growth and help to feed the world. Microbiol Res 169:30-39. doi: 10.1016/j.micres.2013.09.009 Glick BR, Todorovic B, Czarny J, Cheng Z, Duan J, McConkey B (2007) Promotion of plant growth by bacterial ACC deaminase. Crit Rev Plant Sci 26:227-242. doi: 10.1080/07352680701572966 Jin Z, Di Rienzi SC, Janzon A, Werner JJ, Angenent LT, Dangl JL, Fowler DM, Ley RE (2016) Novel rhizosphere soil alleles for the enzyme 1-aminocyclopropane-1-carboxylate deaminase queried for function with an in vivo competition assay. Appl Environ Microbiol 82:1050-1059. doi: 10.1128/AEM.03074-15 Jing HM, Xia XM, Liu HB, Zhou Z, Wu C, Nagarajan S (2015) Anthropogenic impact on diazotrophic diversity in the mangrove rhizosphere revealed by nifH pyrosequencing. Front Microbiol 6: 1172. doi: 10.3389/fmicb.2015.01172 Kloepper JW, Lifshitz R, Zablotowicz RM (1989) Free-living bacterial inocula for enhancing crop productivity. Trends Biotechnol 7: 39-44. doi: 10.1016/0167-7799(89)90057-7 Knauth S, Hurek T, Brar D, Reinhold‐Hurek B (2005) Influence of different Oryza cultivars on expression of nifH gene pools in roots of rice. Environ Microbiol 7:1725-1733. doi: 10.1111/j.1462-2920.2005.00841.x Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol 33:1870-1874. doi: 10.1093/molbev/msw054 Long XE, Yao H, Huang Y, Wei W, Zhu YG (2018) Phosphate levels influence the utilisation of rice rhizodeposition carbon and the phosphate-solubilising microbial community in a paddy soil. Soil Biol Biochem 118:103-114. doi: 10.1016/j.soilbio.2017.12.014 Lovell CR, Piceno YM, Quattro JM, Bagwell CE (2000) Molecular analysis of diazotroph diversity in the rhizosphere of the smooth cord grass, Spartina alterniflora . Appl Environ Microbiol 66:3814-3822. doi: 10.1128/AEM.66.9.3814-3822.2000 Lugtenberg B, Kamilova F (2009) Plant-growth-promoting rhizobacteria. Annu Rev 63:541-55 doi: 10.1146/annurev.micro.62.081307.162918 Magnusson OT, Toyama H, Saeki M, Rojas A, Reed JC, Liddington RC, Klinman JP, Schwarzenbacher R (2004) Quinone biogenesis: structure and mechanism of PqqC, the final catalyst in the production of pyrroloquinoline quinone. Proc Natl Acad Sci USA 101:7913-7918. doi: 10.1073/pnas.0402640101 Maksimov IV, Abizgil-Dina RR, Pusenkova LI (2011) Plant growth-promoting rhizobacteria as alternative to chemical crop protectors from pathogens. Appl Biochem Microbiol 47:333-345. doi: 10.1134/S0003683811040090 Manter DK, Hamm AK, Deel HL (2023) Community structure and abundance of ACC deaminase containing bacteria in soils with 16S-PICRUSt2 inference or direct acdS gene sequencing. J Microbiol Methods 9:106740. doi: 10.1016/j.mimet.2023.106740 Mata AI, Gibello A, Casamayor A, Blanco MM, Domínguez L, Fernandez-Garayzabal, JF (2004) Multiplex PCR assay for detection of bacterial pathogens associated with warm-water streptococcosis in fish. Appl Environ Microbiol 70:3183-3187. doi: 10.1128/AEM.70.5.3183-3187.2004 Mehta MP, Butterfield DA, Baross JA (2003) Phylogenetic diversity of nitrogenase ( nifH ) genes in deep-sea and hydrothermal vent environments of the Juan de Fuca Ridge. Appl Environ Microbiol 69:960-970. doi: 10.1128/AEM.69.2.960-970.2003 Meng H, Zhou Z, Wu R, Wang Y, Gu JD (2019) Diazotrophic microbial community and abundance in acidic subtropical natural and re-vegetated forest soils revealed by high-throughput sequencing of nifH gene. Appl Microbiol Biotechnol 103:995-1005. doi: 10.1007/s00253-018-9466-7 Meyer JB, Frapolli M, Keel C, Maurhofer M (2011) Pyrroloquinoline quinone biosynthesis gene pqqC , a novel molecular marker for studying the phylogeny and diversity of phosphate-solubilizing pseudomonads. Appl Environ Microbiol 77:7345-7354. doi: 10.1128/AEM.05434-11 Nascimento FX, Rossi MJ, Soares CR, McConkey BJ, Glick BR (2014) New insights into 1-aminocyclopropane-1-carboxylate (ACC) deaminase phylogeny, evolution and ecological significance. PLoS One 9:e99168. doi: 10.1371/journal.pone.0099168 Nikolic B, Schwab H, Sessitsch A (2011) Metagenomic analysis of the 1-aminocyclopropane-1-carboxylate deaminase gene ( acdS ) operon of an uncultured bacterial endophyte colonizing Solanum tuberosum L. Arch Microbiol 193:665-676. doi: 10.1007/s00203-011-0703-z Omotayo OP, Igiehon ON, Babalola OO (2022) Microbial genes of agricultural importance in maize rhizosphere unveiled through shotgun metagenomics. Spanish J Soil Sci 12:10427. doi: 10.3389/sjss.2022.10427 Raymond J, Siefert JL, Staples CR, Blankenship RE (2004) The natural history of nitrogen fixation. Mol Biol Evol 21:541-554. doi: 10.1093/molbev/msh047 Rosenblueth M, Ormeño-Orrillo E, López-López A, Rogel MA, Reyes-Hernández BJ, Martínez-Romero JC, Reddy PM, Martínez-Romero E (2018) Nitrogen fixation in cereals. Front Microbiol 9:1794. doi: 10.3389/fmicb.2018.01794 Rosier A, Medeiros FH, Bais HP (2018) Defining plant growth-promoting rhizobacteria molecular and biochemical networks in beneficial plant-microbe interactions. Plant Soil 428: 35-55. doi:10.1007/s11104-018-3679-5 Sarita S, Priefer UB, Prell J, Sharma PK (2008) Diversity of nifH gene amplified from rhizosphere soil DNA. Curr Sci 10:109-115. doi: 10.1007/s13213-011-0339-x Shahi SK, Kumar A (2016) Isolation and genetic analysis of multidrug resistant bacteria from diabetic foot ulcers. Front Microbiol 6:1464. doi: 10.3389/fmicb.2015.01464 Shen YQ, Bonnot F, Imsand EM, RoseFigura JM, Sjölander K, Klinman JP (2012) Distribution and properties of the genes encoding the biosynthesis of the bacterial cofactor, pyrroloquinoline quinone. Biochemistry 51:2265-2275. doi: 10.1021/bi201763d Singh RP, Shelke GM, Kumar A, Jha PN (2015) Biochemistry and genetics of ACC deaminase: a weapon to “stress ethylene” produced in plants. Front Microbiol 6:937. doi: 10.3389/fmicb.2015.00937 Soni R, Suyal DC, Sai S, Goel R (2016) Exploration of nifH gene through soil metagenomes of the western Indian Himalayas. 3 Biotech 6:25. doi: 10.1007/s13205-015-0324-3 Ueda T, Suga Y, Yahiro N, Matsuguchi T (1995) Remarkable N 2 -fixing bacterial diversity detected in rice roots by molecular evolutionary analysis of nifH gene sequences. J Bacteriol 177:1414-1417. doi: 10.1128/jb.177.5.1414-1417.1995 Wang Q, Wang D, Agathokleous E, Cheng C, Shang B, Feng Z (2023) Soil microbial community involved in nitrogen cycling in rice fields treated with antiozonant under ambient ozone. Appl Environ Microbiol 89:e00180. doi: 10.1128/aem.00180-23 Wang C, Zheng MM, Shen RF (2020) Diazotrophic communities are more responsive to maize cultivation than phosphorus fertilization in an acidic soil. Plant Soil 452:499-512. doi: 10.1007/s11104-020-04596-z Wu L, Ma K, Lu Y (2009) Prevalence of betaproteobacterial sequences in nifH gene pools associated with roots of modern rice cultivars. Microb Ecol 57:58-68. doi: 10.1007/s00248-008-9403-x Yao M, Ose T, Sugimoto H, Horiuchi A, Nakagawa A, Wakatsuki S, Yokoi D, Murakami T, Honma M, Tanaka I (2000) Crystal structure of 1-aminocyclopropane-1-carboxylate deaminase from Hansenula saturnus . J Biol Chem 275:34557-34565. doi: 10.1074/jbc.M004681200 Zilius M, Samuiloviene A, Stanislauskienė R, Broman E, Bonaglia S, Meškys R, Zaiko A (2020) Depicting temporal, functional, and phylogenetic patterns in estuarine diazotrophic communities from environmental DNA and RNA. Microb Ecol 81:36-51. doi: 10.1007/s00248-020-01562-1 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3110729","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":216790831,"identity":"e5799455-a2c6-47a0-88ac-517d92cb979e","order_by":0,"name":"Vivek Kumar","email":"","orcid":"","institution":"","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Vivek","middleName":"","lastName":"Kumar","suffix":""},{"id":216790832,"identity":"d2b92b2e-fa11-4930-892e-4afd8340bc36","order_by":1,"name":"Ashok Kumar","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYBACCSBmbGxgkAPSBgcqbBgY2NiJ02JgDNZyJg2ohZlILYkNQC0MIC0MhLRIth9/+HDmjj/p29ubNx44kLBNno+ZgfHDxxzcWqR5cowNN54xyJ1z5lgBUMttwzZmBmbJmdtwa5FjyGGTfNhmkDtDIsfg8McftxmBWtiYefFp4X/+DKQlXUL+jQHIFnuCWqQlEswkN7YZJEhI8IC1JBLUIjnjjbHhzDPGhjN40sB+SW5jZmzG6xeJ8+kPH/bukJOXYD+8+QNQi+389uaDHz7i0YINMDaQpn4UjIJRMApGAQYAAInHVcu6C2LLAAAAAElFTkSuQmCC","orcid":"","institution":"Banaras Hindu University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Ashok","middleName":"","lastName":"Kumar","suffix":""}],"badges":[],"createdAt":"2023-06-26 12:25:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3110729/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3110729/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":39922767,"identity":"de42492b-ddc8-4a94-8dce-915f7aba7fcb","added_by":"auto","created_at":"2023-07-12 14:38:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":102098,"visible":true,"origin":"","legend":"\u003cp\u003eMultiplex PCR showing amplification of three genes in one reaction mixture\u003cstrong\u003e. \u003c/strong\u003ea\u003cstrong\u003e-\u003c/strong\u003eoptimization of thermal cycles for the amplification of \u003cem\u003enifH, pqqC, accd-DR\u003c/em\u003e and \u003cem\u003e16S rDNA\u003c/em\u003e. Temperature set up is indicated at each step. b\u003cstrong\u003e-\u003c/strong\u003eagarose gel photograph showing amplification of desired genes; lane-1; DNA bands of 1500, 546, 390 and 113 bp of \u003cem\u003e16S rDNA, pqqC, nifH, \u003c/em\u003eand \u003cem\u003eaccd-DR\u003c/em\u003erespectively, and lane-M; molecular weight marker (100 bp ladder, NEB).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3110729/v1/fe2b6659038cb1e47cc668f0.png"},{"id":39921146,"identity":"3526aca0-3aad-4557-b945-742ac203c843","added_by":"auto","created_at":"2023-07-12 14:30:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":184446,"visible":true,"origin":"","legend":"\u003cp\u003eBacterial community diversity at genus level based on the OTUs data obtained from NGS of \u003cem\u003enifH\u003c/em\u003e, \u003cem\u003epqqC\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e.\u003cstrong\u003e \u003c/strong\u003ea\u003cstrong\u003e-\u003c/strong\u003ecomposition of diazotrophic genus (14) in percent, b-percent distribution of different pqqC bearing bacterial genus (7), and c\u003cstrong\u003e-\u003c/strong\u003epercent distribution of different \u003cem\u003eaccd-DR\u003c/em\u003e bearing bacterial genus. Number represents percentage of individual genus.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3110729/v1/3fc17a2204d4b55c9c4d9ab0.png"},{"id":39921145,"identity":"eaa3a321-65c8-466b-a58c-78710bd817e7","added_by":"auto","created_at":"2023-07-12 14:30:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":972147,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple sequence alignment of NifH, PqqC, and Accd-DR from different clones derived from the rice rhizospheric soil metagenome library. The alignment was established by loading the sequences to ClustalW2 software a-amino acid alignment for NifH, b- PqqC, and c-Accd-DR proteins. The box in figures represent conserved region of amino acids in all the representative clones.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3110729/v1/75a8a42335bd04a7b2d430a1.png"},{"id":39922768,"identity":"1d92bb8d-e11b-4354-aaca-6723582a9b72","added_by":"auto","created_at":"2023-07-12 14:38:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":77523,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree based on the deduced amino acid sequences from different \u003cem\u003enifH \u003c/em\u003eclones.\u003cstrong\u003e \u003c/strong\u003eThe tree was constructed using ClustalW2\u003cstrong\u003e \u003c/strong\u003eand\u003cstrong\u003e \u003c/strong\u003eMEGA 7 (version 7.0) using bootstrapping at 1000 bootstrap trials.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3110729/v1/09a95f79ff498fef5ec534e2.png"},{"id":39921144,"identity":"12babff6-9276-442f-9fdc-64d10f702d27","added_by":"auto","created_at":"2023-07-12 14:30:01","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":68528,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree showing relatedness of \u003cem\u003epqqC\u003c/em\u003esequences of different clones with \u003cem\u003ePseudomonas\u003c/em\u003especies.\u003cstrong\u003e \u003c/strong\u003eTree was constructed on the basis of deduced amino acid sequences of different \u003cem\u003epqqC \u003c/em\u003eclones.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3110729/v1/0f62866e564db3ed05a568a0.png"},{"id":39921142,"identity":"9ef55e62-f7e0-4fc0-83d7-7ecfa60cba93","added_by":"auto","created_at":"2023-07-12 14:30:00","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":44568,"visible":true,"origin":"","legend":"\u003cp\u003ePhyologenetic tree of \u003cem\u003eaccd-DR\u003c/em\u003e showing relationship with different genera of bacteria. Tree was constructed by using nucleotide sequences of selected OTUs obtained in NGS.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3110729/v1/13b56a8a55909b1475b7cfac.png"},{"id":40455525,"identity":"a214f844-de5e-44f8-98d9-6cbb24d575f3","added_by":"auto","created_at":"2023-07-24 08:28:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1732833,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3110729/v1/fadfa1b6-dcdc-4943-bf8d-1049f1d33ed8.pdf"}],"financialInterests":"","formattedTitle":"Clone-based sequencing and NGS of plant growth-promoting genes from metagenomic DNA of rice rhizosphere show marked diversity","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePlant roots are associated with a vast array of microorganisms including both prokaryotes and eukaryotes. In general, marked diversity in their population and profile exist due to the fluctuating abiotic and biotic factors including plant metabolites (de Weger et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). Several researchers have made extensive studies to unravel the bacterial profile surrounding the rhizosphere but this ecological niche has still remained a black box (da Rocha et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). This is mainly due to the fact that several bacteria growing in the rhizosphere of plants are unculturable (da Rocha et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). However, during the last few decades several bacteria belonging to different genera have been isolated from rhizosphere of various crop plants with proven beneficial effects on plant growth (Backer et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Compant et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Kloepper et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Rosier et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). These bacteria referred as plant growth-promoting rhizobacteria (PGPR) promote plant growth directly or indirectly by their potential to fix N\u003csub\u003e2\u003c/sub\u003e, production of plant growth hormones, siderophores and 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, and roles in mineral phosphate solubilization and disease control and/or systemic plant defenses (Bruto et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Lugtenberg and Kamilova \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Maksimov et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAmong the most important beneficial attributes, N\u003csub\u003e2\u003c/sub\u003e fixation by bacteria plays key role in enriching fixed nitrogen in natural ecosystem and increasing the fertility of soil especially the rice fields (Rosenblueth et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The process of N\u003csub\u003e2\u003c/sub\u003e fixation is mediated by one of the oldest and existing enzymes nitrogenase which is made up of two components, namely component I (MoFe-protein or dinitrogenase) encoded by \u003cem\u003enifD\u003c/em\u003e and \u003cem\u003enifK\u003c/em\u003e and component II (Fe-protein or dinitrogenase reductase) encoded by \u003cem\u003enifH\u003c/em\u003e structural genes. Several reports have documented high degree of sequence conservation in \u003cem\u003enifH\u003c/em\u003e (Burgmann et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Gaby and Buckley \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). \u003cem\u003enifH\u003c/em\u003e has been widely used as a marker for studying the diversity of diazotrophs in different habitats including the rhizosphere of various plants (Bittleston et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Engelhard et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Franco-Dias et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Knauth et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Lovell et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Ueda et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1995\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOccurrence of P solubilising potential and the mechanisms of solubilisation in several bacteria have been documented by several researchers (Alori et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). P solubilisation in bacteria is carried out mainly by acid production such as gluconic acid (GA) and 2-ketogluconic acid (2-KGA). Gluconic acid synthesized in cytoplasm is released in soil, and chelates the cations associated with phosphate complex and make soluble phosphors easily accessible to plants (de Werra et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The acid production is dependent on the oxidation of glucose catalyzed by glucose dehydrogenase (GDH) using pyrroloquinoline quinine (PQQ) as a cofactor (Shen et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The genes involved in PQQ production have been cloned and sequenced from several bacteria (Long et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Meyer et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The most widely studied PQQ operon in \u003cem\u003eP. fluorescens\u003c/em\u003e B16 constitute 11 genes of which the \u003cem\u003epqqC\u003c/em\u003e encodes pyrroloquinoline quinone synthase C (PqqC) and catalyzes the final step of the PQQ biosynthesis (Magnusson et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Shen et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Several researchers have reported the presence of PQQ in different bacteria but the genetic diversity of this important cofactor is poorly understood (Bruto et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eEqually important is the synthesis of an enzyme 1-aminocyclopropane-1-carboxylate deaminase (ACCD) by bacteria which helps growth of plants exposed to abiotic and/or biotic stresses (Bouffaud et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). ACCD-possessing bacteria catalyze the degradation of 1-aminocyclopropane-1-carboxylate (ACC) to α-ketobutyrate and ammonia leading to decreased ACC levels in plants. The decrease in ACC level by the action of ACCD of bacteria lowers the level of ethylene and offers protection against destructive effects of environmental stressors to the plants (Glick et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2007\u003c/span\u003e, 2014; Singh et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). ACCD is a multimeric enzyme of approximately 35\u0026ndash;42 kDa with a pyridoxal 5\u0026rsquo;-phosphate (PLP) as an active site (Yao et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). The structural genes encoding ACCD from several bacteria have been identified as \u003cem\u003eacdS\u003c/em\u003e genes (Nascimento et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). \u003cem\u003eacdS\u003c/em\u003e are GC rich and highly polymorphic, genetic diversity analysis is problematic (Bouffaud et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Manter et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Nascimento et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). However, a degenerate primer pair has been synthesized to amplify a 113 bp region designated as the ACCD domain region (ACCD-DR) which has well conserved region suitable for genetic analysis (Jin et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTill date, functional genetic diversity analysis of important genes namely \u003cem\u003enifH, pqq, ipdc, acdS\u003c/em\u003e etc has been made by selecting one gene at a time that too mostly from the culturable bacteria (Jin et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Meyer et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Soni et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Undoubtedly, findings have greatly advanced knowledge but there is a need to reveal diversity of these genes both in culturable and unculturable bacteria inhabiting the rhizospheric region of any plants. Accordingly, we became interested to address a few questions; a) can important plant growth promoting genes of bacteria namely \u003cem\u003enifH, pqq\u003c/em\u003e, and \u003cem\u003eaccd-DR\u003c/em\u003e and \u003cem\u003e16S rRNA\u003c/em\u003e (as a reference gene) be amplified simultaneously employing multiplex PCR, and b) rhizosphere metagenomic DNA is indeed a suitable source for genetic diversity analysis of above genes?\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eRhizospheric soil sampling\u003c/h2\u003e \u003cp\u003eThe rhizosphere soil was collected in the month of November 2017, from a rice field of the Agricultural farm of Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh (25\u003csup\u003e0\u003c/sup\u003e 21'N, 83\u003csup\u003e0\u003c/sup\u003e 1'E and ~\u0026thinsp;76m above mean sea level). For the collection of soil sample, five rice plants from different corners of the field were uprooted and the adhering soil was placed in a sterile plastic bag and mixed properly. The plastic bag was kept in an ice box and transported to the laboratory. Unless otherwise stated, soil sample was immediately processed for the isolation of DNA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eMetagenomic DNA extraction\u003c/h2\u003e \u003cp\u003eThe metagenomic DNA from soil was extracted employing PowerSoil DNA isolation kit (MOBio Laboratories, Inc., USA) following the instructions of the manufacturer. For obtaining sufficient amount of DNA, extraction was done in batches (in 10 tubes) and DNA of all the tubes was pooled together. Integrity and quality of the extracted DNA were checked by running 0.8% (w/v) agarose gel electrophoresis followed by visualization in UV light.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMultiplex PCR for the amplification of selected genes\u003c/h2\u003e \u003cp\u003eThree bacterial genes namely \u003cem\u003epqqC\u003c/em\u003e, \u003cem\u003enifH\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e were selected for the amplification from the soil metagenomc DNA. \u003cem\u003e16S rRNA\u003c/em\u003e was included as a reference gene for ensuring the presence of bacterial community in soil sample. Prior to performing multiplex PCR, amplification of all four genes was tested individually using routine PCR and standard primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This step was essential to select a suitable annealing temperature in running multiplex PCR. PCR was done in a final volume of 100 \u0026micro;L which contained 1.5 U of \u003cem\u003eTaq\u003c/em\u003e DNA polymerase (Bangalore Genei, India), 1X PCR assay buffer with 1.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 50 pmol each of the forward and reverse primers of all the four genes (Integrated DNA Technology, USA), 125 \u0026micro;M each of the dNTPs, and 100 ng of template DNA. Thermal cycles for the amplification were set as described in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea. To verify the amplification of desired genes, 5 \u0026micro;L of the amplified PCR product was electrophoresed on a 2% agarose gel in Tris-acetate-EDTA buffer (TAE) containing ethidium bromide (0.5 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) and monitored in gel documentation unit (Bio-Rad Laboratories, USA).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for amplification of different genes (F/f, forward; R/r, reverse)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences (5\u0026rsquo;\u0026rarr; 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAnnealing temperature (Tm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAmplicon size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eACCD-DR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ea2F: GSAACAAGACGCGCAAG\u003c/p\u003e \u003cp\u003ea2R: CACSAGCACGCACTTCATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e113\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eJin et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003e16S rRNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8f: AGAGTTTGATYMTGGCTCAG\u003c/p\u003e \u003cp\u003e1495r: CTACGGCTACCTTGTTACGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eShahi and Kumar \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2016\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003epqqC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ef1: CATGGCATCGAGCATGCTCC\u003c/p\u003e \u003cp\u003er1: CAGGGCTGGGTCGCCAACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e60\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e546\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMeyer et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003enifH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e19F: GCIWTYTAYGGIAARGGIGG\u003c/p\u003e \u003cp\u003e407R: AAICCRCCRCAIACIACRTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e56\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e390\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eUeda et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1995\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCloning of genes\u003c/h2\u003e \u003cp\u003e \u003cem\u003e16S rRNA\u003c/em\u003e, \u003cem\u003epqqC\u003c/em\u003e, \u003cem\u003enifH\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e amplified by multiplex PCR were purified by Wizard SV Gel and PCR Clean-Up System following the instructions of manufacturer (Promega, USA). The purified \u003cem\u003e16S rRNA\u003c/em\u003e, \u003cem\u003epqqC\u003c/em\u003e, \u003cem\u003enifH\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e were cloned in pGEM-T easy cloning vector (Promega, USA) following the manufacturer\u0026rsquo;s instructions. The recombinants were transformed into \u003cem\u003eE. coli\u003c/em\u003e JM 109 high efficiency competent cells (Promega, USA). 96 clones for each gene were randomly selected for further study. The confirmation of insert in each clone was done by colony PCR.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRestriction fragment length polymorphism (RFLP) analysis of\u003c/b\u003e \u003cb\u003epqqC\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003enifH\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAmplified PCR products of \u003cem\u003epqqC\u003c/em\u003e and \u003cem\u003enifH\u003c/em\u003e of all the clones were double digested separately using \u003cem\u003eAlu\u003c/em\u003eI and \u003cem\u003eRsa\u003c/em\u003eI restriction endonucleases (New England Biolabs Inc., UK). Digestion of PCR products was done in 25 \u0026micro;L reaction mixture which contained 2.5 \u0026micro;L 1X CutSmart buffer, 0.20 \u0026micro;L (3.0 U) of each enzyme and 15 \u0026micro;L of PCR product, the remaining volume was maintained by nuclease-free MilliQ water. The reaction mixture was incubated at 37 \u003csup\u003e0\u003c/sup\u003eC for 4 h and terminated by heat inactivation of restriction enzymes at 70 \u003csup\u003e0\u003c/sup\u003eC for 20 min. To check the RFLP pattern, 15 \u0026micro;L of the digested product was electrophoresed in a 3% low melting agarose gel at 50 V in TAE buffer (Macro-drive, LKB Sweden). Cluster analysis of RFLP was made by unweighted pair-group method with arithmetic means using Quantity One 1-D Analysis Software, version 4.4 (Bio-Rad Laboratories, USA). One representative clone from each RFLP group was selected and grown overnight in LB medium supplemented with ampicillin (100 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). Plasmid from each representative clone was isolated employing HiPurA Plasmid DNA Miniprep Purification Kit (HiMedia Laboratories, Mumbai). Insert from the recombinant cl\u003cb\u003eo\u003c/b\u003ene was recovered by digestion of the plasmid with \u003cem\u003eEco\u003c/em\u003eRI restriction enzyme followed by agarose gel electrophoresis. Sequencing of insert was done commercially from SciGenome Labs. Pvt. Ltd., India. \u003cem\u003enifH\u003c/em\u003e and \u003cem\u003epqqC\u003c/em\u003e sequences from representative clone were compared with the GenBank database by using the algorithm BLASTN program to identify the most similar sequences of unculturable and cultured bacteria. Owing to the very small size of \u003cem\u003eaccd-DR\u003c/em\u003e (113 bp), its RFLP analysis could not be performed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eNext generation sequencing (NGS) of \u003cem\u003enifH, pqqC\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eNGS of multiplex-PCR generated amplicon was performed on commercial basis (SciGenome Labs. Pvt. Ltd, India) in Illumina HiSeq 2500 using paired end (250 bp \u0026times; 2) library type. To ensure the quality of sequencing, the raw reads were checked with the FastQC tool (version. 0.11.8) with default parameters. Unless otherwise stated, pre-processed consensus sequences of the genes (\u003cem\u003enifH, pqqC\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e) were used for operational taxonomic units (OTUs) selection and taxonomy classification. For taxonomical classification, representative sequences from each OTU were picked and classification was performed using RPD classifier by mapping each selected sequence against \u003cem\u003enifH\u003c/em\u003e data base (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.css.cornell.edu/faculty/buckley/hifh.htm\u003c/span\u003e\u003cspan address=\"http://www.css.cornell.edu/faculty/buckley/hifh.htm\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Taxonomical classification of selected \u003cem\u003epqqC\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e from each cluster was done using DIAMOND BLASTX program against UniProt \u003cem\u003epqqC\u003c/em\u003e and ACCD-DR OTUs database respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMultiple sequence alignment and phylogenetic analysis\u003c/h2\u003e \u003cp\u003eThe nucleotide sequences obtained after sequencing were trimmed and resultant sequences were translated into protein coding amino acids with the help of ExPASy translational tool. Multiple sequence alignment of the deduced amino acids was carried out with ClustalW2 software (version 2.0.10) and visualized in sequence viewer. Phylogenetic tree of \u003cem\u003enifH, pqqC\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e was constructed in MEGA 7 (Kumar et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) using bootstrapping at 1000 bootstrap trials with the two-parameter model of Kimura.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eAmplification of genes by multiplex PCR\u003c/h2\u003e \u003cp\u003eThree genes namely \u003cem\u003enifH, pqqC\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e and the reference gene \u003cem\u003e16S rRNA\u003c/em\u003e were successfully amplified employing multiplex PCR from the metagenomic DNA extracted from the rhizospheric soil of rice plant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Four DNA bands of approx. 1500, 546, 390 and 113 bp corresponding to \u003cem\u003e16S rRNA, pqqC, nifH\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e were repeatedly observed suggesting the efficacy of multiplex PCR in amplification of all the genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). That the amplified amplicons are indeed from bacteria is evident from the fact that the template DNA used also resulted in the amplification of \u003cem\u003e16S rRNA\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAanlysis of\u003c/b\u003e \u003cb\u003enifH\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003epqqC\u003c/b\u003e \u003cb\u003ediversity in rhizosphere of rice\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA 390 bp amplicon of \u003cem\u003enifH\u003c/em\u003e amplified by multiplex PCR using metagenomic DNA was cloned in pGEM-T easy cloning vector to obtain large number of \u003cem\u003enifH\u003c/em\u003e clones. 96 clones were selected and insert was double digested with \u003cem\u003eAlu\u003c/em\u003eI and \u003cem\u003eRsa\u003c/em\u003eI which generated 15 RFLP groups. One representative from each RFLP group of clones was sequenced and subjected to BLAST for \u003cem\u003enifH\u003c/em\u003e sequence diversity. It is evident from the results of Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e that the highest number of identical clones are present in SBT AK C3 (27) followed by SBT AK C1 (14). Furthermore, results of BLAST analysis showed that the sequences belonging to five clones (SBT AK C1, AK C3, AK C6, AK C45 and AK C52) are represented by different species of \u003cem\u003eBradyrhizobium/Mesorhizobium\u003c/em\u003e (out of 15 clones). The remaining ten clones contain sequences of different genera/order/classes (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). It is also evident from the data that majority of the clones exhibit maximum similarity (91\u0026ndash;100%) with unculturable bacteria. In fact, three clones showed 100% similarity with the uncultured bacterial sequences. Further analysis of sequences revealed the presence of highest percentage of sequences belonging to the phylum \u003cem\u003eproteobacteria\u003c/em\u003e (10/15, 66.66%) comprising alpha (5/15), beta (2/15), gamma (1/15) and delta classes (2/15). Sequences of four clones with very low percentage (ranging from 6.66 to 13.33%) belonged to other group of bacteria. Sequence of the clone-SBT AK C2 did not show affiliation with \u003cem\u003enifH\u003c/em\u003e sequences of any cultured bacteria.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSimilarity of \u003cem\u003enifH\u003c/em\u003e sequences of various clones with uncultured and cultured bacterial sequences available in the database\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003enifH\u003c/em\u003e clones\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession number of this study\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eClosest uncultured bacteria (accession number)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e% Identity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClosest match (cultured bacteria)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e% Identity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003cp\u003eaffiliation\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C1 (14)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680849\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAHN51144.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eBradyrhizobium japonicum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eACT67989.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eα\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C2 (3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680850\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACN23728.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eOther\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C3 (27)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680851\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAG30111.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eBradyrhizobium\u003c/em\u003e sp.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eBAF95631.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eα\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C6 (8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680852\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAHN50517.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eBradyrhizobium japonicum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eACT67982.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eα\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C10 (6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680853\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAPA22235.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eMethanocella conradii\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP014404752.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eArchaea\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C14 (4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680854\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eADZ48369.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eAzoarcus communis\u003c/em\u003e\u003c/p\u003e \u003cp\u003eRhodocyclales bacterium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAAB63033.2\u003c/p\u003e \u003cp\u003eOHC65356.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e98\u003c/p\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eβ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C24 (4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680855\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eADX43226.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eMethanoregula boonei\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP012106688.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eArchaea\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C26 (4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680856\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAPD29463.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eSyntrophus gentianae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP093883931.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eα\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C28 (3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680857\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eADZ48348.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDesulfuromonadales sp.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eOGR29997.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eα\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C45 (4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680858\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAHN51275.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eBradyrhizobium\u003c/em\u003e sp.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eACT67983.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eα\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C50 (5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680859\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAHN50775.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eOpitutaceae\u003c/em\u003e bacterium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP009512762.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eVerrucomicrobia\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C52 (6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680860\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAHN51303.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eBradyrhizobium\u003c/em\u003e sp.\u003c/p\u003e \u003cp\u003e\u003cem\u003eMesorhizobium loti\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAML61104.1\u003c/p\u003e \u003cp\u003eBAF95636.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e99\u003c/p\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eα\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C53 (4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680861\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBAP16836.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGallionellales sp.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eOGS90295.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eβ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C73 (2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680862\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAPA22124.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eNitrospirae\u003c/em\u003e bacteria\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eOGW27708.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNitrospirae\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK C85 (2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMF680863\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAJF14338.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eVibrio natriegens\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAAD55588.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003eQuery coverage- 100% for both uncultured and cultured bacteria. Number in bracket shows total number of clones present in each representative clone based on RFLP similarity.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eIn the case of \u003cem\u003epqqC\u003c/em\u003e, 96 clones were selected following the protocol adopted for the \u003cem\u003enifH\u003c/em\u003e analysis. All the 96 clones clustered to twelve groups on the basis of RFLP pattern. Of the 12 representative clones, the highest number of identical clones were present in the SBT AK8 (28) followed by SBT AK1 (12) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The remaining ten clones contained three to eight clones. Further analysis of representative sequences of six clones (SBT AK1, AK8, AK13, AK19, AK78 and AK96) revealed identical level of similarity with both the cultured and uncultured bacteria. However, sequences of the remaining six clones showed higher level of similarity with the cultured bacteria. Interestingly, of the 12 group of clones, 10 clones consisted members of cultured pseudomonads namely \u003cem\u003ePseudomonas putida, Pseudomonas\u003c/em\u003e sp. GM50, \u003cem\u003ePseudomonas lini\u003c/em\u003e, \u003cem\u003ePseudomonas\u003c/em\u003e sp. FSL W5-0299, \u003cem\u003ePseudomonas mandelii\u003c/em\u003e, \u003cem\u003ePseudomonas\u003c/em\u003e sp., \u003cem\u003ePseudomonas oryzae\u003c/em\u003e, \u003cem\u003ePseudomonas\u003c/em\u003e sp. PICF141, and \u003cem\u003ePseudomonas sihuiensis\u003c/em\u003e all belonging to γ-\u003cem\u003eproteobacteria\u003c/em\u003e. Sequence of the clone SBT AK96 also belonged to a member of gamma class, \u003cem\u003eMarinobacterium jannaschii\u003c/em\u003e (with 75% percent identity). Clone SBT AK40 did not show affiliation with any bacteria present in the NCBI database, nevertheless shared homology with the sequence of cultured bacterium, \u003cem\u003eCandidatus Entotheonella\u003c/em\u003e with 100% query coverage and 74% identity (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSimilarity of \u003cem\u003epqqC\u003c/em\u003e sequence of various clones with uncultured and cultured bacterial sequences available in the database\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003epqqC\u003c/em\u003e clones\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession number of this study\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eClosest uncultured bacteria (accession number)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e% Identity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClosest match (cultured bacteria)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e% Identity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003cp\u003eaffiliation\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK1(12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453460\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATI09183.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas putida\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP079226301.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK8 (28)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453461\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATP13615.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. GM50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP008008220.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK13 (6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453462\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATP13615.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas lini\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP048396408.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK19 (5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453463\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATI09183.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas putida\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP014755118.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK25(5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453464\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATP13613.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. FSL W5-0299\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP077749285.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK33 (6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453465\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATP13613.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas mandelii\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP083376520\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK36 (7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453466\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATP13613.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP018929700.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK40 (5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453467\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eCandidatus Entotheonella\u003c/em\u003e gemina\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eETX06873.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eOther\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK54 (7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453468\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATP13506.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas oryzae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP090351895.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK78 (8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453469\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATP13615.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas\u003c/em\u003e sp. PICF141\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP095630850.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK91 (4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453470\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATP13489.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas sihuiensis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP092375741.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSBT AK96 (3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMH453471\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATP13506.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eMarinobacterium jannaschii\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eWP027857990.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eγ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003eQuery coverage- 100% for both uncultured and cultured bacteria. Number in bracket shows total number of clones present in each representative clone based on RFLP pattern similarity.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eNGS for\u003c/b\u003e \u003cb\u003enifH, pqqC\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eaccd-DR\u003c/b\u003e \u003cb\u003ediversity and bacterial community composition\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWith a view to gain better understanding of \u003cem\u003enifH\u003c/em\u003e sequence diversity, NGS approach was applied. Altogether, 90236 consensus sequences of \u003cem\u003enifH\u003c/em\u003e were retrieved and after removing 12324 (13.66%) chimeric sequences, 77912 (86.34%) pre-processed consensus sequences were obtained. With 77912 pre-processed consensus sequences, 21532 OTUs were obtained after clustering based on sequence similarity (similarity cut off =\u0026thinsp;0.97). Subsequently, 19487 OTUs having less than five reads were filtered and the remaining 2045 OTUs finally selected for the taxonomical abundance study. Altogether, fourteen types of genera containing varying number of OTUs were found. \u003cem\u003eHalorhodospira\u003c/em\u003e was the dominant genus with 151 OTUs (7.38%) followed by \u003cem\u003eFrankia\u003c/em\u003e (6.74%) and \u003cem\u003eBradyrhizobium\u003c/em\u003e (6.55%). Percent distribution of OTUs in other genera are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea. Sequences showing no alignment against taxonomic database comprised 65.86% (unknown) and those less than five in numbers included 1.22% (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSimilarly, NGS of \u003cem\u003epqqC\u003c/em\u003e was done following the steps used for \u003cem\u003enifH\u003c/em\u003e analysis. Altogether, 15,805 OTUs were obtained after clustering based on the sequence similarity of total reads. \u003cem\u003ePseudomonas\u003c/em\u003e sp. was the dominant genus with 7,703 OTUs (48.73%) followed by \u003cem\u003eAcinetobacter\u003c/em\u003e sp. (6.78%) and \u003cem\u003eAzotobacter\u003c/em\u003e sp. (6.01%). Percent distribution of OTUs in other genera were; \u003cem\u003eKlebsiella\u003c/em\u003e sp. (2.73%), \u003cem\u003eXanthomonas\u003c/em\u003e sp. (1.46%), \u003cem\u003eErwinia\u003c/em\u003e sp. (0.87%), \u003cem\u003eStenotrophomonas\u003c/em\u003e sp. (0.77%) and others (32.6%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003eNGS of \u003cem\u003eaccd-DR\u003c/em\u003e (113 bp) was done as per the steps used for \u003cem\u003enifH\u003c/em\u003e and \u003cem\u003epqqC\u003c/em\u003e analysis. Accordingly, of the 367529 paired-end reads, 361570 pre-processed consensuses sequences were obtained. Out of 361570 reads, a total of 69841 OTUs were identified and after removing OTUs with less than 5 reads, 28872 OTUs were finally selected for further analysis. Altogether, seven genera containing varying number of OTUs (above 1%) were found. Data showed the highest abundance of \u003cem\u003eAcidovorax\u003c/em\u003e sp. (58.28%) followed by \u003cem\u003eParaburkholderia\u003c/em\u003e sp. (14.75%), \u003cem\u003eVariovorax\u003c/em\u003e sp. (8.53%), \u003cem\u003eDesmospora active\u003c/em\u003e (5.61%), \u003cem\u003ePseudomonas syringae\u003c/em\u003e (2.17%), \u003cem\u003eStreptomyces\u003c/em\u003e sp. (1.80%), \u003cem\u003eKibdelosporangium aridum\u003c/em\u003e (1.01%) and others (7.85%) with less than 1% of OUTs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec)\u003c/p\u003e \u003cp\u003e \u003cb\u003ePhylogenetic analysis of\u003c/b\u003e \u003cb\u003enifH, pqqC\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eaccd-DR\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOpen reading frame (ORF) for amino acid sequence was checked and similar orientation for sequences of all the clones was made for multiple sequence alignment (MSA) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b, c). Phylogenetic tree of NifH sequences based on the deduced amino acid sequences was constructed by using sequences of fifteen clones of this study and twenty one similar sequences of NifH protein of cultured bacteria retrieved from NCBI database. It is evident from the tree that all the 15 clones could be placed in two clusters comprising NifH sequences of alpha-, beta-, gamma-, delta-\u003cem\u003eproteobacteria\u003c/em\u003e and other bacterial nitrogenases (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Clone SBT C1 showed close relationship (98% amino acid similarity) to \u003cem\u003eGeobacter\u003c/em\u003e sp.-OR 1 and \u003cem\u003eGeobacter\u003c/em\u003e sp. M21 (94%). Clone SBT AK 45 is most closely related (99% amino acid similarity) to \u003cem\u003eGeobacter pickeringii\u003c/em\u003e. Clone SBT AK28 shares 99% similarity with the sequence of \u003cem\u003eDesulfuromonas\u003c/em\u003e sp. Clone SBT AK C14 shares 99% similarity with the nitrogenase amino acid sequence of the beta-\u003cem\u003eproteobacteria Azoarcus\u003c/em\u003e sp. CC-YHH848 and \u003cem\u003eThauera\u003c/em\u003e sp. D20. Clone SBT AK85 is related to the sequence of \u003cem\u003eMethylomonas\u003c/em\u003e (96%) and \u003cem\u003eVibrio natriegens\u003c/em\u003e NBRC (83%). Similarly, clone SBT AK73 shares 97% similarity with the amino acid sequence of the alpha-class bacterium \u003cem\u003eBradyrhizobium japonicum\u003c/em\u003e. Clone SBT AK53 shows similarity (93%) with the sequence of \u003cem\u003eGallionellales\u003c/em\u003e bacterium GWA2. Nitrogenase amino acid sequence of the clone SBT AK C52 shows close relationship with the sequence of \u003cem\u003eBradyrhizobium\u003c/em\u003e sp. (99%) followed by \u003cem\u003eMesorhizobium loti\u003c/em\u003e (98%). Clone SBT AK C3 shares 98% similarity (amino acid sequence) with the sequence of \u003cem\u003eXanthobacter tagetidis.\u003c/em\u003e NifH protein sequences of the clones SBT AK C50, C6 and C26 show 97, 95 and 96% similarity with the sequences of \u003cem\u003eBradyrhizobium japonicum\u003c/em\u003e, \u003cem\u003eB. japonicum\u003c/em\u003e and \u003cem\u003eSyntrophus gentianae\u003c/em\u003e respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Clones SBT AK C2, C10 and C24 show relatedness (89 to 93% amino acid similarity) with the sequence of nitrogenase of bacteria namely \u003cem\u003eSpirochaeta perfilievii\u003c/em\u003e, \u003cem\u003eMethanocella conradii\u003c/em\u003e and \u003cem\u003eKiritimatiellales\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSimilar to NifH, phylogenetic tree of PqqC was constructed using the deduced amino acid sequences of one representative from all the twelve clones and ten similar sequences of PqqC of cultured bacteria retrieved from NCBI data base. Evidently, all the twelve clones fall into two clusters with five groups in cluster I (10 clones) and one in cluster II (2 clones). Representative sequences from clones of cluster I show close relationship (99 to 100% amino acid similarity) with different species of \u003cem\u003ePseudomonas\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Of these, sequences of clones SBT AK33, AK36 and AK19 shared 100% similarity with the sequences of \u003cem\u003ePseudomonas\u003c/em\u003e species. Sequences of two clones (SBT AK8 and AK91) shared 96\u0026ndash;97% similarity with different species of \u003cem\u003ePseudomonas\u003c/em\u003e but clone SBT AK54 had only 93% similarity with the sequence of \u003cem\u003eP. oryzae\u003c/em\u003e. On the other hand, clones SBT AK40 and AK96 from cluster II grouped together and showed 100% homology between each other but did not show significant similarity (maximum 76% similarity) with the sequences of any species available in the database (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). It is also evident from the phylogenetic analysis that there is a high degree of relatedness between majority of the \u003cem\u003ePseudomonas\u003c/em\u003e sp.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eConstruction of pylogenetic tree of \u003cem\u003eaccd-DR\u003c/em\u003e was possible by using top six OTUs nucleotide sequences assigned in NGS for bacterial species namely OTU1-\u003cem\u003eAcidovorax\u003c/em\u003e sp., OUT13-\u003cem\u003ePar\u003c/em\u003ea\u003cem\u003eburkholderia\u003c/em\u003e sp., OTU26-\u003cem\u003ePseudomonas\u003c/em\u003e sp., OTU44-\u003cem\u003eStreptomyces\u003c/em\u003e sp., OTU65- \u003cem\u003eKibdelosporangium phytohabitans\u003c/em\u003e and OTU78-\u003cem\u003eVariovorax\u003c/em\u003e sp. \u003cem\u003eaccd-DR\u003c/em\u003e nucleotide sequences of above OTUs were converted into amino acid sequences with the help of translational tool. Resultant amino acid sequences of each OTU were queried for similarity (above 97%) search against NCBI database and phylogenetic tree was constructed. Among the six OTUs, sequences of OTU1, OTU13, OTU44 and OTU65 shared 100% similarity with \u003cem\u003eAcidovorax citrulli\u003c/em\u003e, \u003cem\u003eParaburkholderia\u003c/em\u003e, \u003cem\u003eStreptomyces\u003c/em\u003e sp. and \u003cem\u003eKibdelosporangium phytohabitans\u003c/em\u003e respectively. Sequences of OTUs78 and 26 showed 92 and 99% similarity with the sequences of \u003cem\u003eVariovorax\u003c/em\u003e sp. and \u003cem\u003ePseudomonas\u003c/em\u003e sp. respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eA number of PGPR with multiple beneficial characteristics have been isolated and genes involved in plant growth-promoting (PGP) activities have been identified and characterized but mostly from cultured bacteria (Bruto et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Lugtenberg and Kamilova \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Rosier et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Henceforth, culture-independent molecular approaches are essential for community analysis and diversity of important genes namely \u003cem\u003enifH\u003c/em\u003e, \u003cem\u003epqqC\u003c/em\u003e, \u003cem\u003eipdC/ppdC\u003c/em\u003e, \u003cem\u003eacdS/acdR\u003c/em\u003e and others from uncultured (Daniel \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Gaby and Buckley \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Omotayo et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). To date, majority of the studies have used PCR-based assay for the detection of one gene using single set of primers at a time (Dang et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Lovell et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Nikolic et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Sarita et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Ueda et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Wu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). In the present study, an multiplex PCR has been employed which can detect four genes including three PGP genes namely \u003cem\u003enifH\u003c/em\u003e, \u003cem\u003epqqC\u003c/em\u003e, \u003cem\u003eaccd-DR\u003c/em\u003e and one reference gene \u003cem\u003e16S rRNA\u003c/em\u003e simultaneously in one reaction mixture using soil metagenomic DNA. Altogether, multiplex PCR seems cost effective and rapid compared to detection of gene by running PCR separately for each gene. To our knowledge, our study is the first of its kind which demonstrates amplification of four genes by using multiplex PCR assay from the metagenomic DNA. Similar to our approach, PCR has been developed for the simultaneous detection of several pathogens in clinical samples and genes involved in conferring resistance to β-lactam and other antibiotics (Mata et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Shahi et al. 2016).\u003c/p\u003e \u003cp\u003eAmong the PGP genes, diversity of \u003cem\u003enifH\u003c/em\u003e has been widely studied from the rhizospheric soil of different plants, forest soils, sediments, ocean water etc employing metagenomic approaches (Bahulikar et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Bittleston et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Dang et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Delmont et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Mehta et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Meng et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ueda et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Zilius et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Diversity of \u003cem\u003enifH\u003c/em\u003e distribution is expected considering the occurrence of nitrogen-fixing microorganisms (diazotrophs) in majority of Earth\u0026rsquo;s ecosystem, although their distribution changes from habitat to habitat. In this study, of the 96 \u003cem\u003enifH\u003c/em\u003e clones derived from the rhizospheric soil of rice, 15 groups were formed on the basis of RFLP pattern. Majority of the clones (5 out of 15 clones) belonged to different species of \u003cem\u003eBradyrhizobium/Mesorhizobium\u003c/em\u003e and the highest percentage of sequences belonged to the phylum \u003cem\u003eproteobacteria\u003c/em\u003e (10 out of 15 clones, 66.66%). Validity of the \u003cem\u003enifH\u003c/em\u003e sequences cannot be doubted considering the fact that all the species of \u003cem\u003eBradyrhizobium/Mesorhizobium\u003c/em\u003e are known to fix N\u003csub\u003e2\u003c/sub\u003e (Lugtenberg and Kamilova \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Rosenblueth et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Similar to our findings, Bahulikar et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) have also reported 58% of \u003cem\u003enifH\u003c/em\u003e sequences belonging to the order \u003cem\u003eRhizobiales\u003c/em\u003e (comprising \u003cem\u003eBradyrhizobium\u003c/em\u003e, \u003cem\u003eMesorhizobium\u003c/em\u003e, \u003cem\u003eMethylobacterium\u003c/em\u003e, \u003cem\u003eRhizobium\u003c/em\u003e, and \u003cem\u003eSinorhizobium\u003c/em\u003e) derived from the metagenomic DNA of rhizospheric soil of Switchgrass. Meng et al. (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) also reported the dominance of \u003cem\u003eBradyrhizobium\u003c/em\u003e (up to 45%) based on the high-throughput sequencing of \u003cem\u003enifH\u003c/em\u003e from the acidic sub-tropical forest soil. Several genera reported in the present study have been also reported from the sugarcane rhizosphere through high-throughput sequencing of \u003cem\u003enifH\u003c/em\u003e (Gaby et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Ueda et al. (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1995\u003c/span\u003e) obtained as many as 23 \u003cem\u003enifH\u003c/em\u003e sequences of phylogenetically diverse types of diazotrophic bacteria from rice roots without culturing the organism. Interestingly, we detected two clones that showed similarity with archaeal \u003cem\u003enifH\u003c/em\u003e sequences, reports on evolutionary history of \u003cem\u003enifH\u003c/em\u003e suggest high frequency of horizontal gene transfer of this gene, even at the inter domain level including bacteria and archaea (Raymond et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSimilar to the data of clone-based sequencing, bacterial diversity analysis based on NGS data also showed dominance of the phylum \u003cem\u003eproteobacteria\u003c/em\u003e comprising the classes α-, β-, γ- and δ-\u003cem\u003eproteobacteria\u003c/em\u003e. This was expected as the members of \u003cem\u003eproteobacteria\u003c/em\u003e are reported to occur in all types of ecosystems (Jing et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Meng et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, unlike the data of direct sequencing of \u003cem\u003enifH\u003c/em\u003e amplicon where dominance of \u003cem\u003eBradyrhizobium/Mesorhizobium\u003c/em\u003e was observed, NGS data showed the dominance of \u003cem\u003eHalorhodospira\u003c/em\u003e with 151 OTUs (7.38%) followed by \u003cem\u003eFrankia\u003c/em\u003e (6.74%) and \u003cem\u003eBradyrhizobium\u003c/em\u003e (6.55%).\u003c/p\u003e \u003cp\u003eRole of PQQ as a co-factor in the biosynthesis of gluconic acid has been well documented in several bacteria (de Werra et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). However, little, if any, attempt has been made to investigate its occurrence and diversity in unculturable bacteria (Meyer et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Herein, by cloning and sequencing of one of the important genes of PQQ operon namely \u003cem\u003epqqC\u003c/em\u003e from metagenomic DNA, we report its occurrence in uncultured bacteria. The presence of \u003cem\u003epqqC\u003c/em\u003e was noted mostly in different species of \u003cem\u003ePseudomonas\u003c/em\u003e, a finding similar to those reported by Meyer et al. (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). This was expected owing to the fact that the novel PCR primer pair developed specifically for \u003cem\u003ePseudomonas\u003c/em\u003e species by Meyer et al. (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) was used in this study. Nevertheless, findings of this study clearly suggest wide occurrence of \u003cem\u003epqqC\u003c/em\u003e from the rice rhizosphere metagenomic DNA and point to the role of PQQ as cofactor in GDH-mediated P solubilization using glucose as a carbon source by bacteria (An and Moe \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAmino acids sequence of ACCD-DR translated from \u003cem\u003eAccd-DR\u003c/em\u003e DNA suggest that rice rhizosphere metagenome contains a significant pool of ACC deaminase protein of different bacteria. This was evident from the presence of ACCD-DR in bacterial genera including \u003cem\u003eAcidovorax\u003c/em\u003e sp., \u003cem\u003eVariovorax\u003c/em\u003e sp., \u003cem\u003ePseudomonas\u003c/em\u003e sp, \u003cem\u003eParaburkholderia\u003c/em\u003e sp., \u003cem\u003eKibdelosporangium aridum\u003c/em\u003e, and \u003cem\u003eStreptomyces\u003c/em\u003e sp. This finding is in agreement with the data of phylogenetic tree constructed on the basis of clustering of amino acid sequences. It is also interesting to note that the majority of the genera belonged to the phylum \u003cem\u003eproteobacteria\u003c/em\u003e followed by \u003cem\u003eactinobacteria.\u003c/em\u003e Occurrence of ACCD gene has been reported in diverse taxa but predominatnce in the phyla \u003cem\u003eproteobacteria\u003c/em\u003e, \u003cem\u003eactinobacteria\u003c/em\u003e and \u003cem\u003efirmicutes\u003c/em\u003e has been reported (Manter et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Nascimento et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Our findings are consistent with the above reports and suggest the wide prevalence of ACCD protein in the rice rhizosphere. However, a better understanding of functional genetic diversity of ACCD gene may emerge only, if, universal primer capable of amplifying the full length of the gene from different genera of bacteria is developed.\u003c/p\u003e \u003cp\u003eIn conclusion, findings of this study show that multiplex PCR can be routinely used to amplify important PGP genes simultaneously in one reaction mixture thereby making the process cheaper and rapid. Assessment of genetic diversity of three PGP genes revealed vast diversity of \u003cem\u003enifH\u003c/em\u003e in clone-based sequencing and NGS of metagenomic DNA isolated from the rice rhizosphere soil. However, \u003cem\u003epqqC\u003c/em\u003e gene was represented mainly by different species of \u003cem\u003ePseudomonas\u003c/em\u003e in clone-based sequencing and NGS. Presence of ACCD-DR was evident in different genera but predominantly in the members belonging to the phyla \u003cem\u003eproteobacteria\u003c/em\u003e and \u003cem\u003eactinobacteria.\u003c/em\u003e Findings of this study suggest that rhizospheric metagenomic DNA may serve as a suitable source for studying genetic diversity of PGP genes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e VK is thankful to Indian Council of Medical Research (ICMR), New Delhi, for providing financial support in the form of Senior Research Fellowship (No. 45/20/2018-PHA/BMS/OL). AK is grateful to University Grants Commission, New Delhi, for the award of BSR fellowship (F-18-1/2011-BSR). Thanks are also due to the Coordinators, Biotechnology, UGC-SAP and Centre for Bioinformatics, School of Biotechnology, Banaras Hindu University, Varanasi, India, for providing required facilities as and when required.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e VK performed the experiments. AK planned the experiments and helped in writing the manuscript\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Funding This study was partly supported by a research grant sanctioned to AK by the Indian Council of Agricultural Research (ICAR), Government of India, New Delhi (NBAIM/AMAAS/2014-17/PF/4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe nucleotide sequences of fifteen \u003cem\u003enifH\u003c/em\u003e and twelve \u003cem\u003epqqC\u003c/em\u003e have been submitted to the National Center for Biotechnology Information (NCBI) GenBank database under the accession numbers MF680849-MF680863 and MH453460-MH453471 respectively. The next generation sequencing (NGS) data is available in the NCBI database under the BioProject numbers PRJNA578577.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConfict of interests\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no known competing fnancial interests or personal relationships that could have appeared to infuence the work reported in this paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAlori ET, Glick BR, Babalola OO (2017) Microbial phosphorus solubilization and its potential for use in sustainable agriculture. Front Microbiol 8:971. doi: 10.3389/fmicb.2017.00971 \u003c/li\u003e\n\u003cli\u003eAn R, Moe LA (2016) Regulation of pyrroloquinoline quinone-dependent glucose dehydrogenase activity in the model rhizosphere-dwelling bacterium \u003cem\u003ePseudomonas putida\u003c/em\u003e KT2440. Appl Environ Microbiol 82:4955-4964. doi: 10.1128/AEM.00813-16\u003c/li\u003e\n\u003cli\u003eBacker R, Rokem JS, Ilangumaran G, Lamont J, Praslickova D, Ricci E, Subramanian S, Smith DL (2018) Plant growth-promoting rhizobacteria: context, mechanisms of action, and roadmap to commercialization of biostimulants for sustainable agriculture. Front Plant Sci 9:1473. doi: 10.3389/fpls.2018.01473\u003c/li\u003e\n\u003cli\u003eBahulikar RA, Torres-Jerez I, Worley E, Craven K, Udvardi MK (2014) Diversity of nitrogen-fixing bacteria associated with Switchgrass in the native tall grass prairie of Northern Oklahoma. Appl Environ Microbiol 80:5636-5643. doi: 10.1007/s13205-023-03640-w\u003c/li\u003e\n\u003cli\u003eBittleston LS, Wolock CJ, Maeda J, Infante V, An\u0026eacute; JM, Pierce NE, Pringle A (2023) Carnivorous \u003cem\u003eNepenthes\u003c/em\u003e pitchers with less acidic fluid house nitrogen-fixing bacteria. Appl Environ Microbiol 20:e0081223. doi: 10.1128/aem.00812-23\u003c/li\u003e\n\u003cli\u003eBouffaud ML, Renoud S, Dubost A, Mo\u0026euml;nne-Loccoz Y, Muller D (2018) 1-Aminocyclopropane-1-carboxylate deaminase producers associated to maize and other Poaceae species. Microbiome 6:114. doi: 10.1186/s40168-018-0503-7\u003c/li\u003e\n\u003cli\u003eBruto M, Prigent-Combaret C, Muller D, Mo\u0026euml;nne-Loccoz Y (2014) Analysis of genes contributing to plant-beneficial functions in plant growth-promoting rhizobacteria and related \u003cem\u003eProteobacteria\u003c/em\u003e. Sci Rep 4:6261. doi: 10.1038/srep06261\u003c/li\u003e\n\u003cli\u003eBurgmann H, Widmer F, Von Sigler W, Zeyer J (2004) New molecular screening tools for analysis of free-living diazotrophs in soil. Appl Environ Microbiol 70:240-247. doi: 10.1128/AEM.70.1.240-247.2004\u003c/li\u003e\n\u003cli\u003eCompant S, Cl\u0026eacute;ment C, Sessitsch A (2010) Plant growth-promoting bacteria in the rhizo- and endosphere of plants: Their role, colonization, mechanisms involved and prospects for utilization. Soil Biol \u003cem\u003eBiochem\u003c/em\u003e 42:669-678. doi:10.1016/j.soilbio.2009.11.024\u003c/li\u003e\n\u003cli\u003eda Rocha UN, van Overbeek L, van Elsas JD (2009) Exploration of hitherto-uncultured bacteria from the rhizosphere. FEMS Microbiol Ecol 69: 313-328. doi: 10.1111/j.1574-6941.2009.00702.x\u003c/li\u003e\n\u003cli\u003eDang H, Yang J, Li J, Luan X, Zhang Y, Gu G, Xue R, Zong M, Klotz MG (2013) Environment dependent distribution of the sediment \u003cem\u003enifH\u003c/em\u003e-harboring microbiota in the northern South China Sea. Appl Environ Microbiol\u003cem\u003e.\u003c/em\u003e 79:121-132. doi: 10.1128/AEM.01889-12\u003c/li\u003e\n\u003cli\u003eDaniel R (2004) The soil metagenome - a rich resource for the discovery of novel natural products\u003cem\u003e. \u003c/em\u003eCurr Opin Biotechnol\u003cem\u003e \u003c/em\u003e15:199-204. doi: 10.1016/j.copbio.2004.04.005\u003c/li\u003e\n\u003cli\u003ede Weger LA, van der Bij AJ, Dekkers LC, Simons M, Wijffelman CA, Lugtenberg BJ (1995) Colonization of the rhizosphere of crop plants by plant-beneficial pseudomonads. FEMS Microbial Ecol 17:221-277. doi: 10.1016/0168-6496 (95)00031-5\u003c/li\u003e\n\u003cli\u003ede Werra P, P\u0026eacute;chy-Tarr M, Keel C, Maurhofer M (2009) Role of gluconic acid production in the regulation of biocontrol traits of \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e CHA0. Appl\u003cem\u003e \u003c/em\u003eEnviron Microbiol 75:4162-4174. doi: 10.1128/AEM.00295-09\u003c/li\u003e\n\u003cli\u003eDelmont TO, Quince C, Shaiber A, Esen \u0026Ouml;C, Lee ST, Rapp\u0026eacute; MS, McLellan SL, L\u0026uuml;cker S, Eren AM (2018) Nitrogen-fixing populations of \u003cem\u003ePlanctomycetes \u003c/em\u003eand \u003cem\u003eProteobacteria \u003c/em\u003eare abundant in surface ocean metagenomes. Nat Microbiol 3:804-813. doi: 10.1038/s41564-018-0176-9 \u003c/li\u003e\n\u003cli\u003eEngelhard M, Hurek T, Reinhold‐Hurek B (2000) Preferential occurrence of diazotrophic endophytes, \u003cem\u003eAzoarcus\u003c/em\u003e spp., in wild rice species and land races of \u003cem\u003eOryza sativa\u003c/em\u003e in comparison with modern races. Environ Microbiol 2:131-141. doi: 10.1046/j.1462-2920.2000.00078.x\u003c/li\u003e\n\u003cli\u003eFranco-Dias AC, Silva MD, Cotta SR, Dini-Andreote F, Soares FL, Salles JF, Azevedo JL, Van Elsas JD, Andreote FD (2012) Abundance and genetic diversity of \u003cem\u003enifH\u003c/em\u003e gene sequences in anthropogenically affected Brazilian mangrove sediments. Appl Environ Microbiol 78:7960-7967. doi: 10.1128/AEM.02273-12\u003c/li\u003e\n\u003cli\u003eGaby JC, Buckley DH (2014) A comprehensive aligned \u003cem\u003enifH\u003c/em\u003e gene database: a multipurpose tool for studies of nitrogen-fixing bacteria. Database 2014:bau001. doi: 10.1093/database/bau001\u003c/li\u003e\n\u003cli\u003eGaby JC, Rishishwar L, Valderrama-Aguirre LC, Green SJ, Valderrama-Aguirre A, Jordan IK (2018) Diazotroph community characterization via a high-throughput \u003cem\u003enifH \u003c/em\u003eamplicon sequencing and analysis pipeline. Appl Environ Microbiol 84:e01512. doi: 10.1128/AEM.00713-19 \u003c/li\u003e\n\u003cli\u003eGlick BR (2014) Bacteria with ACC deaminase can promote plant growth and help to feed the world. Microbiol Res 169:30-39. doi: 10.1016/j.micres.2013.09.009\u003c/li\u003e\n\u003cli\u003eGlick BR, Todorovic B, Czarny J, Cheng Z, Duan J, McConkey B (2007) Promotion of plant growth by bacterial ACC deaminase. Crit Rev Plant Sci 26:227-242. doi: 10.1080/07352680701572966\u003c/li\u003e\n\u003cli\u003eJin Z, Di Rienzi SC, Janzon A, Werner JJ, Angenent LT, Dangl JL, Fowler DM, Ley RE (2016) Novel rhizosphere soil alleles for the enzyme 1-aminocyclopropane-1-carboxylate deaminase queried for function with an \u003cem\u003ein vivo\u003c/em\u003e competition assay. Appl Environ Microbiol 82:1050-1059. doi: 10.1128/AEM.03074-15\u003c/li\u003e\n\u003cli\u003eJing HM, Xia XM, Liu HB, Zhou Z, Wu C, Nagarajan S (2015) Anthropogenic impact on diazotrophic diversity in the mangrove rhizosphere revealed by \u003cem\u003enifH\u003c/em\u003e pyrosequencing. Front Microbiol 6: 1172. doi: 10.3389/fmicb.2015.01172\u003c/li\u003e\n\u003cli\u003eKloepper JW, Lifshitz R, Zablotowicz RM (1989) Free-living bacterial inocula for enhancing crop productivity. Trends Biotechnol 7: 39-44. doi: 10.1016/0167-7799(89)90057-7\u003c/li\u003e\n\u003cli\u003eKnauth S, Hurek T, Brar D, Reinhold‐Hurek B (2005) Influence of different \u003cem\u003eOryza \u003c/em\u003ecultivars on expression of \u003cem\u003enifH\u003c/em\u003e gene pools in roots of rice. Environ Microbiol 7:1725-1733. doi: 10.1111/j.1462-2920.2005.00841.x\u003c/li\u003e\n\u003cli\u003eKumar S, Stecher G, Tamura K (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol 33:1870-1874. doi: 10.1093/molbev/msw054\u003c/li\u003e\n\u003cli\u003eLong XE, Yao H, Huang Y, Wei W, Zhu YG (2018) Phosphate levels influence the utilisation of rice rhizodeposition carbon and the phosphate-solubilising microbial community in a paddy soil. Soil Biol Biochem 118:103-114. doi: 10.1016/j.soilbio.2017.12.014\u003c/li\u003e\n\u003cli\u003eLovell CR, Piceno YM, Quattro JM, Bagwell CE (2000) Molecular analysis of diazotroph diversity in the rhizosphere of the smooth cord grass, \u003cem\u003eSpartina alterniflora\u003c/em\u003e. Appl Environ Microbiol 66:3814-3822. doi: 10.1128/AEM.66.9.3814-3822.2000\u003c/li\u003e\n\u003cli\u003eLugtenberg B, Kamilova F (2009) Plant-growth-promoting rhizobacteria. Annu Rev 63:541-55 doi: 10.1146/annurev.micro.62.081307.162918\u003c/li\u003e\n\u003cli\u003eMagnusson OT, Toyama H, Saeki M, Rojas A, Reed JC, Liddington RC, Klinman JP, Schwarzenbacher R (2004) Quinone biogenesis: structure and mechanism of PqqC, the final catalyst in the production of pyrroloquinoline quinone. Proc Natl Acad Sci USA 101:7913-7918. doi: 10.1073/pnas.0402640101\u003c/li\u003e\n\u003cli\u003eMaksimov IV, Abizgil-Dina RR, Pusenkova LI (2011) Plant growth-promoting rhizobacteria as alternative to chemical crop protectors from pathogens. Appl Biochem Microbiol 47:333-345. doi: 10.1134/S0003683811040090\u003c/li\u003e\n\u003cli\u003eManter DK, Hamm AK, Deel HL (2023) Community structure and abundance of ACC deaminase containing bacteria in soils with 16S-PICRUSt2 inference or direct \u003cem\u003eacdS\u003c/em\u003e gene sequencing. \u003cem\u003eJ Microbiol Methods\u003c/em\u003e 9:106740. doi: 10.1016/j.mimet.2023.106740\u003c/li\u003e\n\u003cli\u003eMata AI, Gibello A, Casamayor A, Blanco MM, Dom\u0026iacute;nguez L, Fernandez-Garayzabal, JF (2004) Multiplex PCR assay for detection of bacterial pathogens associated with warm-water streptococcosis in fish. Appl Environ Microbiol 70:3183-3187. doi: 10.1128/AEM.70.5.3183-3187.2004\u003c/li\u003e\n\u003cli\u003eMehta MP, Butterfield DA, Baross JA (2003) Phylogenetic diversity of nitrogenase (\u003cem\u003enifH\u003c/em\u003e) genes in deep-sea and hydrothermal vent environments of the Juan de Fuca Ridge. Appl Environ Microbiol 69:960-970. doi: 10.1128/AEM.69.2.960-970.2003\u003c/li\u003e\n\u003cli\u003eMeng H, Zhou Z, Wu R, Wang Y, Gu JD (2019) Diazotrophic microbial community and abundance in acidic subtropical natural and re-vegetated forest soils revealed by high-throughput sequencing of \u003cem\u003enifH\u003c/em\u003e gene. Appl Microbiol Biotechnol 103:995-1005. doi: 10.1007/s00253-018-9466-7\u003c/li\u003e\n\u003cli\u003eMeyer JB, Frapolli M, Keel C, Maurhofer M (2011) Pyrroloquinoline quinone biosynthesis gene \u003cem\u003epqqC\u003c/em\u003e, a novel molecular marker for studying the phylogeny and diversity of phosphate-solubilizing pseudomonads. Appl Environ Microbiol 77:7345-7354. doi: 10.1128/AEM.05434-11\u003c/li\u003e\n\u003cli\u003eNascimento FX, Rossi MJ, Soares CR, McConkey BJ, Glick BR (2014) New insights into 1-aminocyclopropane-1-carboxylate (ACC) deaminase phylogeny, evolution and ecological significance. PLoS One 9:e99168. doi: 10.1371/journal.pone.0099168\u003c/li\u003e\n\u003cli\u003eNikolic B, Schwab H, Sessitsch A (2011) Metagenomic analysis of the 1-aminocyclopropane-1-carboxylate deaminase gene (\u003cem\u003eacdS\u003c/em\u003e) operon of an uncultured bacterial endophyte colonizing \u003cem\u003eSolanum tuberosum\u003c/em\u003e L. Arch Microbiol 193:665-676. doi: 10.1007/s00203-011-0703-z\u003c/li\u003e\n\u003cli\u003eOmotayo OP, Igiehon ON, Babalola OO (2022) Microbial genes of agricultural importance in maize rhizosphere unveiled through shotgun metagenomics. Spanish J Soil Sci 12:10427. doi: 10.3389/sjss.2022.10427\u003c/li\u003e\n\u003cli\u003eRaymond J, Siefert JL, Staples CR, Blankenship RE (2004) The natural history of nitrogen fixation. Mol Biol Evol 21:541-554. doi: 10.1093/molbev/msh047\u003c/li\u003e\n\u003cli\u003eRosenblueth M, Orme\u0026ntilde;o-Orrillo E, L\u0026oacute;pez-L\u0026oacute;pez A, Rogel MA, Reyes-Hern\u0026aacute;ndez BJ, Mart\u0026iacute;nez-Romero JC, Reddy PM, Mart\u0026iacute;nez-Romero E (2018) Nitrogen fixation in cereals. Front Microbiol 9:1794. doi: 10.3389/fmicb.2018.01794\u003c/li\u003e\n\u003cli\u003eRosier A, Medeiros FH, Bais HP (2018) Defining plant growth-promoting rhizobacteria molecular and biochemical networks in beneficial plant-microbe interactions. Plant Soil 428: 35-55. doi:10.1007/s11104-018-3679-5\u003c/li\u003e\n\u003cli\u003eSarita S, Priefer UB, Prell J, Sharma PK (2008) Diversity of \u003cem\u003enifH\u003c/em\u003e gene amplified from rhizosphere soil DNA. Curr Sci 10:109-115. doi: 10.1007/s13213-011-0339-x\u003c/li\u003e\n\u003cli\u003eShahi SK, Kumar A (2016) Isolation and genetic analysis of multidrug resistant bacteria from diabetic foot ulcers. Front Microbiol 6:1464. doi: 10.3389/fmicb.2015.01464\u003c/li\u003e\n\u003cli\u003eShen YQ, Bonnot F, Imsand EM, RoseFigura JM, Sjölander K, Klinman JP (2012) Distribution and properties of the genes encoding the biosynthesis of the bacterial cofactor, pyrroloquinoline quinone. Biochemistry 51:2265-2275. doi: 10.1021/bi201763d\u003c/li\u003e\n\u003cli\u003eSingh RP, Shelke GM, Kumar A, Jha PN (2015) Biochemistry and genetics of ACC deaminase: a weapon to \u0026ldquo;stress ethylene\u0026rdquo; produced in plants. Front Microbiol 6:937. doi: 10.3389/fmicb.2015.00937 \u003c/li\u003e\n\u003cli\u003eSoni R, Suyal DC, Sai S, Goel R (2016) Exploration of \u003cem\u003enifH\u003c/em\u003e gene through soil metagenomes of the western Indian Himalayas. 3 Biotech 6:25. doi: 10.1007/s13205-015-0324-3 \u003c/li\u003e\n\u003cli\u003eUeda T, Suga Y, Yahiro N, Matsuguchi T (1995) Remarkable N\u003csub\u003e2\u003c/sub\u003e-fixing bacterial diversity detected in rice roots by molecular evolutionary analysis of \u003cem\u003enifH\u003c/em\u003e gene sequences. J Bacteriol 177:1414-1417. doi: 10.1128/jb.177.5.1414-1417.1995\u003c/li\u003e\n\u003cli\u003eWang Q, Wang D, Agathokleous E, Cheng C, Shang B, Feng Z (2023) Soil microbial community involved in nitrogen cycling in rice fields treated with antiozonant under ambient ozone. Appl Environ Microbiol 89:e00180. doi: 10.1128/aem.00180-23\u003c/li\u003e\n\u003cli\u003eWang C, Zheng MM, Shen RF (2020) Diazotrophic communities are more responsive to maize cultivation than phosphorus fertilization in an acidic soil. Plant Soil 452:499-512. doi: 10.1007/s11104-020-04596-z\u003c/li\u003e\n\u003cli\u003eWu L, Ma K, Lu Y (2009) Prevalence of betaproteobacterial sequences in \u003cem\u003enifH\u003c/em\u003e gene pools associated with roots of modern rice cultivars. Microb Ecol 57:58-68. doi: 10.1007/s00248-008-9403-x\u003c/li\u003e\n\u003cli\u003eYao M, Ose T, Sugimoto H, Horiuchi A, Nakagawa A, Wakatsuki S, Yokoi D, Murakami T, Honma M, Tanaka I (2000) Crystal structure of 1-aminocyclopropane-1-carboxylate deaminase from \u003cem\u003eHansenula saturnus\u003c/em\u003e. J Biol Chem 275:34557-34565. doi: 10.1074/jbc.M004681200 \u003c/li\u003e\n\u003cli\u003eZilius M, Samuiloviene A, Stanislauskienė R, Broman E, Bonaglia S, Me\u0026scaron;kys R, Zaiko A (2020) Depicting temporal, functional, and phylogenetic patterns in estuarine diazotrophic communities from environmental DNA and RNA. Microb Ecol 81:36-51. doi: 10.1007/s00248-020-01562-1\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Rhizosphere, Plant growth-promoting genes, Multiplex PCR, Next generation DNA sequencing","lastPublishedDoi":"10.21203/rs.3.rs-3110729/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3110729/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eBackgrounds and Aims\u003c/em\u003eAn attempt has been made to assess the distribution and diversity of important plant growth-promoting genes from the metagenomic DNA of rice rhizosphere soil.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMethods\u003c/em\u003e A novel multiplex polymerase chain reaction was developed for the amplification of three important genes namely \u003cem\u003enifH\u003c/em\u003e,\u003cem\u003e pqqC\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003e simultaneously from the metagenomic DNA. Next generation sequencing was employed for the sequencing of above genes for the assessment of diversity.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eResults\u003c/em\u003e Ninety six \u003cem\u003enifH\u003c/em\u003e clones from the metagenomic DNA of rice rhizosphere were selected which belonged to 15 groups on the basis of RFLP. Sequencing of the representative 15 clones showed higher level of similarity with the uncultured bacteria. Similarly, 12 clones of \u003cem\u003epqqC\u003c/em\u003e were selected, majority of the clones showed similarity with both uncultured and cultured bacteria. \u003cem\u003eNGS of nifH\u003c/em\u003e showed fourteen types of genera with varying number of OTUs, the dominant genus identified as \u003cem\u003eHalorhodospira \u003c/em\u003e(7.38%). \u003cem\u003epqqC\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003eshowed seven types of genera with varying number of OTUs. The highest abundance of \u003cem\u003ePseudomonas\u003c/em\u003e sp.\u003cem\u003e \u003c/em\u003e(48.73%) was noted in \u003cem\u003epqqC\u003c/em\u003e and \u003cem\u003eaccd-DR \u003c/em\u003eshowed the abundance of\u003cem\u003e Acidovorax\u003c/em\u003e sp. (58.28%).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConclusions\u003c/em\u003e Altogether, findings of this study suggest marked diversity in \u003cem\u003enifH, pqqC\u003c/em\u003e and \u003cem\u003eaccd-DR\u003c/em\u003egenes in rice rhizosphere. It would be desirable to apply both clone-based sequencing and NGS for the analysis of total bacterial community and plant growth promoting genes from the metagenome of any habitat.\u003c/p\u003e","manuscriptTitle":"Clone-based sequencing and NGS of plant growth-promoting genes from metagenomic DNA of rice rhizosphere show marked diversity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-07-12 14:29:56","doi":"10.21203/rs.3.rs-3110729/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"75e4eade-c834-40e8-a89b-36fb549f503b","owner":[],"postedDate":"July 12th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-07-24T08:28:44+00:00","versionOfRecord":[],"versionCreatedAt":"2023-07-12 14:29:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3110729","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3110729","identity":"rs-3110729","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}