Development of electrochemical biosensor based on Ni-doped ZnO nanorods for detecting miRNA-21 lung cancer biomarker

Development of electrochemical biosensor based on Ni-doped ZnO nanorods for detecting miRNA-21 lung cancer biomarker | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Development of electrochemical biosensor based on Ni-doped ZnO nanorods for detecting miRNA-21 lung cancer biomarker Yafeng Fan, Baoping Jiao, Zhongping Yu, Bingbing Zong, Xianzhen Wu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7608116/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 23 Dec, 2025 Read the published version in Microchimica Acta → Version 1 posted 10 You are reading this latest preprint version Abstract Circulatory miRNA-21 has shown promise as a stable and non-invasive biomarker for early diagnosis of cancer and is highly correlated with non-small cell lung cancer. In this study, a new kind of electrochemical biosensor was fabricated using the Ni-doped ZnO nanorods directly grown onto the surface of a glassy carbon electrode (GCE) for your sensitive and selective detection of miR-21. On the modified electrode surface: polydopamine (PDA) and crosslinked with glutaraldehyde, DNA probes were immobilized using the electrostatic attraction between a phosphate group and the PDA, and then treated with a solution of bovine serum albumin (BSA) to ensure that any unbound surfaces were saturated, thus preventing non-specific interactions. Electrochemical analyses were adopted to systematically investigate the progresses of the stepwise electrode modification and the hybridization. With the increasing of self-discharge time of the laser etched carbon-paste electrode The response to current gradually drop and the charge-transfer resistance increase, which indicates that the sensing interface has been successfully assembled. Following optimization, the biosensor was capable of detecting concentrations as low as 21.30 fM with dynamic linear range of 10 − 6 nM to 10 5 nM, good reproducibility and selectivity to the mismatch and non-complementary sequences. Crucially, recovery experiments in spiked human serum samples gave satisfactory results, confirming the clinical potential of the system. In general, the Ni doped ZnO nanorod-based biosensor provides sensitive, label-free, and low-cost detection of circulating miRNAs. Its modularity allows for simple conversion for detection of other nucleic acid-based biomarkers, implicating it as a useful diagnostic tool for early cancer diagnosis and point-of-care screening. miRNA-21 Circulating microRNA Ni-doped ZnO nanorods Electrochemical biosensor Human serum Lung Cancer biomarker Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction MicroRNAs (miRNAs) comprise a class of short, non-protein-coding RNA molecules, typically 19–24 nucleotides long, which have the ability to post-transcriptionally silence target mRNAs, serving as key gene expression regulators [ 1 , 2 ]. Dysregulation of miRNAs was closely correlated with different cancer types and their roles as oncogenes or tumor suppressors [ 3 ]. One of these miRNAs is microRNA-21 (miR-21), which is one of the most well-studied oncomiRs that overexpresses in numerous tumors, such as non-small cell lung cancer, a predominant source of cancer-associated mortality globally [ 4 ]. Therefore, highly precise and selective quantification of miRNA-21 is crucial for initial cancer screening and treatment monitoring, which may give us more time to live. Classical miRNA detection methods including Northern blotting, quantitative reverse transcription PCR, microarrays, next generation sequencing are employed as the gold standard [ 5 , 6 ]. However, these approaches have a number of limitations, such as trained staff, laboratory, intensive assay procedures, duration, and sample complexity which do not tolerate complex biological samples [ 6 , 7 ]. Such limitations further illustrate the pressing need for simple, low cost, sensitive and point-of-care alternatives. Due to the high sensitivity, low cost, fast responses and compatibility with miniaturization, electrochemical biosensors have been explosively studied as a promising platform for miRNA detection in recent years [ 8 , 9 ]. These nanomaterials when incorporated in electrode development greatly enhance the function of biosensor by enlarging the effective surface area, improving the electron transfer, and promoting selective interaction with biomolecules [ 10 , 11 ]. Of the numerous nanomaterials that possess applications in diverse fields, the nanostructured ZnO has distinct significance owning to its inherent characteristics of the wide bandgap of approximately 3.37 eV, along with a notably significant exciton binding energy, biocompatibility, chemical stability, and the feasibility for various morphological forms such as nanorods, nanowires, and nanoparticles [ 12 , 13 ]. These properties render ZnO-based nanostructures especially favorable as electrochemical transducers [ 14 ]. However, pure ZnO frequently has insufficient electrical conductivity and electron mobility, which might stunt the sensing property. In order to address these challenges, transition metal ion doping has been proposed as an effective means to tailor electronic structure, promote charge carrier concentration and enhance catalytic activity [ 15 , 16 ]. Among the several dopants, the nickel (Ni) comes to our notice, because of its an ionic radius similar to that of Zn 2+ , successfully substituting in the ZnO unit but resulting in lattice-shrink and oxygen vacancies formation [ 17 , 18 ]. Such modifications can greatly improve the electronic conductivity, surface reactivity and thus, biosensing performance [ 17 ]. Herein, we demonstrate for the fabrication of an electrochemical biosensor using Ni-doped ZnO nanorods for miRNA-21, lung cancer biomarker. The vertically erected Ni doped ZnO nanorods were grown on the conductive support, which employed the large surface area by the high surface-to-volume ratio, abundant active sites for probe immobilization, and facile electron transferring. By incorporating these designed nanostructures into the sensing device, the sensitive, selective and label-free detection of miRNA-21 was simply performed, illustrating their potentials in the development of new generation nanostructured biosensors for early cancer diagnosis. 2. Experimental 2.1. Chemicals Zinc acetate dihydrate (Zn(Ac)₂·2H₂O, ≥ 99%), sodium hydroxide (NaOH, ≥ 98%), alumina slurries (1.0, 0.3, and 0.05 µm) and polyethylene glycol (PEG-400, analytical grade) were obtained from Shanghai Maikelin Biochemical Technology Co., Ltd., China. Dopamine hydrochloride (≥ 98%), nafion, potassium ferrocyanide (K₄[Fe(CN)₆]· 3H₂O), potassium ferricyanide (K₃[Fe(CN)₆]), and glutaraldehyde solution (25%) were obtained from Shanghai Aladdin Bio-Chem Technology Co., Ltd., China. Nickel acetate tetrahydrate (Ni(Ac)₂·4H₂O, ≥ 98%), phosphate-buffered saline (PBS, 10 mM, pH 7.4) and bovine serum albumin (BSA, ≥ 98%) were sourced from BioFroxx, Guangzhou, China. Glassy carbon electrodes (GCE, 3 mm diameter) substrate was purchased from XFNano (Jiangsu, China). Materials Synthetic microRNA-21 (miR-21, 5′-UAGCUUAUCAGACUGAUGUUGA-3′) and Complementary probe DNA (5′–NH₂–TCAACATCAGTCTGATAAGCTA–3′) were synthesized by GENEWIZ (Suzhou, China) and purified using HPLC. Non-complementary and single base mismatched oligonucleotides were purchased from the same source for selectivity studies. Tris–HCl buffer (10 mM, pH 8.5) was acquired from Solarbio Life Sciences (Beijing, China). Milli-Q water (18.2 MΩ·cm resistivity at 25°C) as deionized (DI) water served as the solvent for all aqueous solutions throughout this study. molecular biology grade diethylpyrocarbonate-treated water was obtained from Beijing Tsingke Biotech Co., Ltd., Beijing, China, and was used in all experiments involving miRNA to avoid nuclease contamination. All other chemicals were of analytical grade and used as received. 2.2. Synthesis of Ni-doped ZnO nanorods Nickel doped ZnO nanostructure was grown by hydrothermal method [ 19 ]. To prepare the precursor solution, Zn(Ac)₂·2H₂O (1.0 mmol) and Ni(Ac)₂·4H₂O (0.030 mmol) corresponding to the desired Ni doping for 3 at% relative to Zn were dissolved in absolute ethanol (25.0 mL) under a continuous magnetic stirring until a clear solution was formed. Then, NaOH (8.00 mmol) was also dissolved in absolute ethanol (10.0 mL) to afford a homogeneous solution. The solution was infused slowly, drop by drop, into the metal acetate solution over 8–10 min with stirring at ~ 300 rpm. After that, the structure director PEG-400 (8.0 mL) was added slowly. Subsequently, the black product was mixed with ethanol (20 ml). Following 3 min of sonication to form a homogeneous mixture, the solution was transferred to an autoclave (50 mL, Teflon-lined stainless steel). The slurry was loaded into the autoclave to approximately 80% of its total volume. The sealed autoclave was subsequently subjected to hydrothermal treatment at 140°C for 24 h in a convection oven. After reacting hydrothermally, the autoclave was allowed to cool naturally to ambient temperature over 5 h. The resulting gray product, comprising Ni-doped ZnO nanorods, was collected via centrifugation (6000 rpm, 10 min) and subsequently purified through washing three times with absolute ethanol and three times with DI water. After drying the samples at 60°C for 4 h in a convection oven, the samples calcined in air at 300°C for 2 h (heating rate: 2°C min⁻¹) to improve their crystallinity. For comparison, undoped ZnO nanorods were prepared following an identical method but in the absence of any nickel precursor. For modification of electrodes, GCEs were polished with alumina slurries, followed by ultrasonication in ethanol and DI water (5 min each) to achieve the clean and smooth surface. The dried powder (2.0 mg) was dispersed in 1 mL ethanol (containing 0.05% Nafion as a binder) and sonicated for 15 min, resulting a stable Ni doped ZnO nanorod suspension. The GCE was modified by drop-casting 10 µL of the suspension onto its polished surface, followed by thermal treatment at 60°C for 1 h to dry the film and construct the uniformly modified electrode surface. The electrodes were kept in a desiccator until further functionalization. 2.3. Probe Immobilization For PDA coating of nanorods modified electrode [ 20 ], a dopamine·HCl solution (2 mg·ml⁻¹) was formulated in Tris–HCl buffer. To deposit a conformal polydopamine coating (PDA), the as-obtained Ni doped ZnO/GCE was immersed in the solution under mild stirring at ambient temperature for 50 min. Following modification, the electrode was rinsed with copious amounts of DI water to remove any unbound material and dried under a gentle stream of N₂. PDA's abundant catechol and amine functional groups, providing a multitude of active sites for coordination and covalent binding for the immobilization of other biomolecules [ 21 ]. Subsequently, for preparation glutaraldehyde-mediated covalent probe DNA immobilization [ 22 ], the PDA-coated electrode was modified by incubation in glutaraldehyde (2.5% v/v) in PBS for 30 min at room temperature; to generate reactive aldehyde groups. After being activated, the electrode was washed in PBS and DI water for the removal of unreacted glutaraldehyde. The activated surface was coated by drop-casting 10 µL of the solution (1 µM amino terminated DNA probe (complementary to miRNA-21 ; 5′–NH₂–probe–3′) in PBS), followed by a 2-hour incubation at ambient temperature (≈ 25°C) to allow for Schiff base formation between aldehyde and amine [ 22 ]. The electrode was then washed intensively with PBS followed by DI water. It was followed by incubation the substrate in 1% (w/v) BSA solution in PBS for 30 min at ambient temperature to block non-specific binding sites [ 23 ]. After the wash with blocking, the electrode was purified via sequential rinsing with PBS and DI water. Finally, it was stored in a fresh PBS solution at 4°C to preserve its stability. The final modified electrode with BSA/DNA/GA/PDA/ Ni doped ZnO/GCE designated as DNA immobilized Ni-doped ZnO/GCE. 2.4. Characterization of Ni doped ZnO Nanorods The surface morphology of the modified GCE was analyzed with a JEOL JSM-7610F (Japan) field emission scanning electron microscope (FE-SEM). Elemental analysis was performed by EDX (Oxford Instruments, UK). The crystallographic structure of nanorods was characterized by an X-ray diffractometer (XRD) using a Bruker D8 Advance (Germany) using Cu Kα radiation (λ = 1.5406 Å). The surface chemical composition and oxidation states were measured with 4.3 X-ray Photoelectron Spectroscopy (XPS; Thermo Scientific K-Alpha+, USA). For characterization of polydopamine functionalization and a DNA immobilization on the Ni doped ZnO nanorods, Fourier transform infrared spectroscopy (FTIR) analysis was carried out on a FTIR-430 Jasco (Japan) spectrometer, with an ATR accessory as the sample cell. 2.5. Electrochemical measurement Electrochemical analysis was performed in a three-electrode configuration with a Pt plate as the auxiliary electrode, a bare or Ni doped ZnO modified electrode as working electrode, and an Ag/AgCl (sat. KCl) reference electrode. The electrochemical cell contained a solution of 5 mM potassium ferri/ferrocyanide (1:1) in 0.1 M KCl as the supporting electrolyte. Cyclic voltammograms (CVs) were recorded within a potential window of − 0.6 to + 0.4 V vs. Ag/AgCl applying a scan rate of 50 mVs⁻¹. Electrochemical impedance spectroscopy (EIS) was acquired at 10 mV AC perturbation across a frequency range of 10 2 to 10 − 4 kHz. Differential pulse voltammograms (DPVs) were recorded with settings of 50 mVs⁻¹ scan rate, 50 mV pulse amplitude, 50 ms pulse width, and 4 mV step potential. The hybridization step was performed by incubating the probe-functionalized electrode in 50 µL of the different concentrations of target solution for 30 minutes at 37°C, and then washed before voltametric measurements were recorded. The calibration curves were obtained with the plot of ΔI versus the logarithm of miRNA-21 concentration. The limit of detection (LOD) was calculated as 3σ/S (σ: standard deviation of the blank; S: calibration slope). 2.6. Study specificity, reproducibility and operational stability To verify the specificity and exclude background interference, a series of control experiments was performed. An unmodified electrode (probe-modified electrode but without target incubation) was employed to measure the background current response (baseline) and the standard deviation (σ blank). To test the non-specific adsorption, a no-probe control electrode was incubated with miRNA-21 using the same procedure. In addition, the biosensor was tested against non-target miRNAs and a single-base mismatched miRNA sequence to verify the hybridization specificity and discriminate the signals. Selectivity was studied by comparing the electrochemical signal from the biosensor in the presence of complementary miRNA-21 to that obtained for non-complementary and mismatched sequences. The reproducibility was evaluated by preparing five individual Ni doped ZnO/GCE electrodes with the same preparation procedures and double checking their electrochemical responses towards 1 nM miRNA-21. The precision of the method was evaluated using relative standard deviation (RSD). Stability was studied by holding the modified electrodes at 4°C in PBS, and the response was measured over varying periods (0, 5, 10, 15, 20 and 25 days). 2.7. Assessment of method for human serum sample The practical utility of the biosensor was tested in human serum obtained from of healthy volunteers. Serum was diluted 10% (v/v) in RNase free PBS to minimize the matrix effects. Different concentrations of synthetic miRNA-21 (10 − 2 , 10 − 1 , and 1 nM) were added to the diluted serum as positive controls. After incubation of the probe-modified electrodes with 50 µL of spiked serum at 37°C for 30 min, the electrodes were gently washed. Electrochemical tests were carried out with DPV analyses. Human microRNA-21(miR-21) ELISA Kit (Sunlong Biotech Co., Ltd, Hangzhou, China) was utilized for determination microRNA-21 in real samples. 3. Results and discussion 3.1. Investigation of structural characteristics of Ni-doped ZnO nanorods The morphologies of the prepared Ni-doped ZnO nanorods were assessed by the FE-SEM. The image in Fig. 1 A clearly shows that the grown products had a rod-like shape and the well-defined of hexagonal structures, which were in agreement with the crystal phase of wurtzite ZnO. The nanorods were rather even with the diameter of 60–80 nm, the length in hundreds of nanometers and the well aligned length-columns on the electrode surface. The elemental composition of the as-synthesized Ni-ZnO nanorods was verified by EDS, as displayed in Fig. 1 B. The strong peaks correspond to Zn and O, indicating that the principal component of the product is ZnO as anticipated. A weak, but clear Ni signal was detected, thus confirming the successful integration of Ni²⁺ ions in the lattice of ZnO. The small intensity of the Ni peak in comparison with those of Zn and O is related to the low dopant concentration used in the synthesis. On the basis of quantitative elemental analysis (EDS Table in Fig. 1 B), it is found that the atomic percentage ratio of Ni/Zn is ~ 4.9% in good accordance with the theoretical doping level [ 24 , 25 ]. These findings indeed support the composition analysis and morphology of the ZnO nanorods indicating efficient replacement of Zn 2+ by Ni 2+ in ZnO. The XRD result of the pure ZnO and doped ZnO nanorods can also be seen in Fig. 1 C. For doped sample, the appeared diffraction peaks at 2θ values of 31.66° (100), 34.42° (002), 36.39° (101), 47.58° (102), 56.59° (110), 62.78° (103), 66.28° (200), 67.92° (112), 69.04° (201) 72.52° (004), and 77.29° (202) are well described to standard ICDD file No. 36-1451 for hexagonal wurtzite ZnO (space group P6₃mc), confirming that the prepared nanorods remain as a single-phase ZnO without presence of secondary impurities [ 26 ]. The introduction of Ni²⁺ ion into ZnO lattice caused an increase in the value of the diffraction peaks toward higher 2θ corresponding with the undoped ZnO, which shows the lattice contraction attributed to the substitution of larger Zn²⁺ (0.74 Å) by smaller Ni²⁺ (0.69 Å) ions. Furthermore, the reduction in intensity of the peaks and broadening of the lines in the Ni-doped ZnO nanorods indicate the reduced crystallite size and the increase in lattice strain by the addition of Ni [ 25 ]. The peak of (101) reflection was the highest, implying the preferred orientation growth along this direction. These results indicate that the Ni²⁺ ions successfully occupied the tetrahedral sites of the Zn²⁺ sublattice in the ZnO structure, causing a desired extent of distortion that is useful to alter electronic and surface behaviors for biosensing studies. FTIR spectra of the Ni-doped ZnO nanorods and DNA immobilized Ni-doped ZnO nanorods are presented in Fig. 1 D. FTIR spectra of the Ni-doped ZnO nanorods exhibits a strong absorption peaks at ∼400–600 cm⁻¹ was recorded due to stretching vibration of metal – oxygen (Zn–O) which is extremely sensitive to the Ni²⁺ substitution inducing lattice dynamics [ 27 ]. FTIR spectra of the DNA immobilized Ni-doped ZnO nanorods shows sequential bands corresponding to inorganic and organic components which confirmed the modified electrode constituted with complete components PDA, glutaraldehyde crosslinking, DNA and BSA. As observed, vibrational bands appearing at 1186, 1500 and 1595 cm − 1 correspond to C–O aromatic stretch, C = N or/and C = C, C = O, respectively, and wide vibrational bands in 3325 cm − 1 is related to the overlapping of –OH or N–H stretching modes in catechol and amine groups of PDA [ 28 ]. Moreover, the prominent peak appeared at around 1730 cm⁻¹ due to C = O stretching for aldehyde groups would confirm the formation of Schiff group (imine) formation between amine groups of PDA and dialdehyde moiety of glutaraldehyde took place successfully [ 29 ]. Additionally, the markers of DNA phosphate backbone vibrations were determined: asymmetric PO₂⁻ stretching about 1238 cm⁻¹ and symmetric P–O–C stretching around 1090 cm⁻¹. These vibrations are also well characterized as fingerprints of the DNA phosphates [ 30 ]. Furthermore, the characteristic amide I and amide II bands, observed at approximately 1655 cm⁻¹ (C = O stretch) and 1540 cm⁻¹ (N–H bend / C–N stretch) respectively, are indicative of BSA's proteinaceous structure [ 31 ]. They are characteristic bands for proteins and are commonly used to verify immobilization protein using FTIR. Figure 2 depicts the results of XPS analyses of pure ZnO and Ni-doped ZnO nanorods. Figure 2 A exhibits the survey scan of the pure ZnO and Ni-doped ZnO nanorods. The constituent elements of the Zn 2p and O 1s peaks for both samples and Ni 2p for doped sample are detected. Zn 2p spectra in Fig. 2 B shows that on the pristine ZnO, Zn 2p doublet peaks are descriptively Zn 2p 3/2 and Zn 2p 1/2 located at 1021.8 eV and 1044.8 eV, respectively, consistent with Zn²⁺ in the wurtzite phase of ZnO [ 32 ]. On the other hand, the Zn 2p peak positions in Ni-doped ZnO are hardly shifted, which implies that the oxidation state of Zn is hardly modified by Ni doping, but does slightly affect the local lattice environment as it substitutes [ 33 ]. Ni 2p spectra in Fig. 2 C reveals the presence of two principal peaks (854.5 and 855.7 eV) and a shake-up satellite peak (861.1 eV) in the Ni 2p spectrum confirming the incorporation of Ni²⁺ and Ni³⁺ oxidation states in the ZnO lattice [ 34 ]. No Ni was detected from pristine ZnO, verifying the purity of the undoped material. O 1s spectra in Fig. 2 D shows in pristine ZnO, the O 1s spectrum is comprised of lattice oxygen (O²⁻ at 529.7 eV) and surface-adsorbed oxygen/hydroxyl groups (532.0 eV) [ 35 ]. In the Ni-doped ZnO another component appeared at 530.0 eV due to the oxygen vacancies by the Ni doping [ 36 ]. The proportion of this defect-related component increased with Ni doping, indicating that doping can promote the formation of oxygen defects, which may promote electron transfer and enhance electrochemical performance. The results confirm that doping of Ni introduces more defect states (O vacancies) by not altering the Zn²⁺ oxidation valence. Ni is incorporated as evidenced from the Ni²⁺/Ni³⁺ peaks observed in the XPS analysis. More defects and weak lattice distortion in Ni doped ZnO can promote electron transfer sensitivities, which is essential for the biosensing performance. 3.2. Assessment of the Modified Electrodes' Electrochemical Performance CV, EIS, and DPV responses of electrodes at varied stages of modification were thoroughly characterized in supporting electrolyte. In CV analysis (Fig. 3 A), the unmodified GCE gave the minimum redox current and the farthest peak-to-peak distance, suggesting the retarded electron transfer. After loading with ZnO nanorods (ZnO/GCE), the peak currents were enhanced and ΔEp shrunk due to the increased surface area and semiconducting behavior of ZnO [ 37 ]. Further integration of Ni into the ZnO nanorods led to a more pronounced increase in current response, implying that Ni-doping promotes the electrical conductivity of the ZnO thus providing a faster charge transfer (Ni-doped ZnO/GCE) [ 38 , 39 ]. Upon surface functionalization with PDA, glutaraldehyde, DNA, and BSA layers (DNA immobilized Ni-doped ZnO/GCE), however, the electrode activity decreased progressively. With a PDA coating and glutaraldehyde crosslinking, the redox peak currents were lower and the peak separation was larger, which is due to partial blocking of the polymeric and the crosslinking layers [ 40 , 41 ]. The immobilization of DNA probes decreased the current response further, because the anionic phosphate backbone of the DNA, that electrostatically repels the negatively charged redox probe and makes it difficult to approach the electrode surface [ 42 , 43 ]. Finally, after BSA blocking, the current response decreased even more, indicating that excellent surface passivation and reduction in nonspecific adsorption sites was achieved [ 44 ]. On hybridizing with target miRNA-21 (miRNA-21/DNA/Ni-doped ZnO/GCE), redox peak currents of the CV response further decreased with higher extent than that on the probe-modified electrode. This can be attributed to more negatively charged strands binding to the surface, increasingly hindering the electron transfer kinetics of the redox probe The EIS test was consistent with that obtained from the CV test. The charge transfer resistance (Rct) values, which correspond to the diameter of the semicircular region in the Nyquist plots, were obtained to evaluate the interfacial electron transfer kinetics. The Nyquist plots in Fig. 3 B indicated the bare GCE had the highest Rct, which was significantly reduced after ZnO nanorod modification. Ni-doping further decreased Rct but also confirmed that the presence of Ni facilitates electron transfer. In contrast, each biofunctionalization step progressively increased Rct, consistent with the insulating and steric effects of PDA, glutaraldehyde, DNA, and BSA layers. After hybridization with miRNA-21, an additional increase in Rct was achieved, which indicates the suppressed charge-transfer process owing to the duplex on the electrode surface. Results were consistent when confirmed by DPV analysis as exhibited in Fig. 3 C. The peak currents of the Ni-doped ZnO nanorods gave the highest value and the values of peak intensity decreased with the modification of the surface, respectively. The signal intensity decrease demonstrated that the construction of the sensing interface was step-by-step and successful. More significantly bound by target miRNA-21, the DPV peak current was obviously further decreased as compared with the probe modified electrode. ΔI (the current difference values between the nonspecific hybridization and the probe-only format) was the analytical signal for the quantitation of miRNA-21. 3.3. Fine-Tuning of electrode modification and assay parameters To reach the fine-tuning the biosensor fabrication and measurement protocol, a series of parameters in the course of electrode preparation and measurement as Ni doping content in Ni-doped ZnO nanorods, volume of Ni-doped ZnO nanorods on GCE, the PDA incubation time, concentration of glutaraldehyde, ssDNA probe concentration, BSA incubation time and supporting electrolyte pH were screened systematically, and resulted signal of DPV measurements for determination 1 nM miRNA are shown in Fig. 4 . For study the effect of Ni doping content, Ni-doped ZnO nanorods were hydrothermally synthesized using various amounts of nickel precursor (0.25–5.0 at% with respect to Zn). The DPV measurements in Fig. 4 A indicated that the 3.0 at% Ni doped ZnO nanorods exhibited the highest signal for 1 nM miRNA-21 target, demonstrated that 3.0 at% Ni doping provided the highest electron transfer rate and the smallest charge transfer resistance, and a further increasing Ni content led to the structural distortion and partial agglomeration of the nanorods, resulting in low conductivity and poor reproducibility. For optimization of nanorod suspension volume, in modification GCE, 5 to 20 µL of the Ni-doped ZnO nanorods suspension was drop-casted onto a GCE. As depicted in Fig. 4 B, the best current response for 1 nM miRNA-21 target and most reliable surface coverage were achieved with 10 µL as it delivered a homogeneous nanorod film. To optimization PDA the incubation time, the Tris buffer formed PDA layer was optimized by assessment the incubation time from 30 min to 100 min, and 60 min was found to produce the greatest signal change upon the hybridization of 1× 10⁻⁸ M miRNA-21 as exhibited in Fig. 4 C. For study the effect of amount of crosslinker, the concentration of the glutaraldehyde cross-linker was also changed in the range of 1–5% (v/v). As shown in Fig. 4 D, the optimal balance between covalent DNA immobilization and probe retention was achieved with 2.5% glutaraldehyde for 30 min. To study the probe DNA concentration, various amounts of amino-modified ssDNA probes (0.1–5 µM) were coated on the activated electrode. As observed in Fig. 4 E, DPV measurements demonstrated that 1 µM was the optimum probe concentration due to the most efficient hybridization, and least steric hindrance caused by the overpopulated probes. The efficiency of BSA blocking was also investigated by changing the incubation time (10–60 min). 30 min blocking with 1% BSA was found to retain the high signal reproducibility and to eliminate nonspecific adsorption (Fig. 4 F). The effect of pH of electrolyte on the DPV response was studied by varying the pH of the solution ranging from 5.0 to 8.5. The maximum signal change occurs at pH 7.4 and the ideal DNA probe hybridization solution, due in part to the preservation of the stability of the corresponding modified electrode. All in all, the as-optimized conditions,1.0 at% Ni doping, 10 µL nanorod suspension, 1 h PDA modified period, 2.5% glutaraldehyde, 1 µM of probe DNA, 30 min BSA mixture blocking as well as pH 7.4 electrolyte enabled the bioelectrode to offer efficient electron transfer, high probe load, low non-specific absorption, and wonderful long-term stability. 3.4. Performance of miRNA biosensor Selectivity represents a critical figure of merit for the fabricated biosensor. To study this feature, the electrochemical behaviors of the DNA immobilized Ni-doped ZnO/GCE were measured with and without the target miRNA-21, control miR-141, and one-base mismatched sequence after the hybridization. As illustrated in Fig. 5 A, the immobilized onto the electrode surface was triggered by hybridization with the complementary miRNA-21 target, and the complementary miRNA-21 did also induce the strongest current decrease. This is a result of electrostatic repulsion between the negatively charged redox probe and the anionic phosphate groups of the DNA, which creates a charge-transfer barrier. On the other hand, when the hybridization with the mismatched and non-target sequences, negligible current changes were observed, affirming its selective recognition capabilities. The comparative analysis of peak current changes at three concentrations (10 4 , 1 and 10⁻ 6 nM) is presented in Fig. 5 B, the differences between non-target/mismatched and target strands were clearly observable for each concentration, except the lowest one (10⁻ 6 nM), where responses for both strands were overlapped within the error bars. This suggests that the working detection window of the biosensor falls in the 10 4 to 10⁻ 5 nM. The long-term stability of the fabricated biosensor was investigated under refrigerated conditions (4°C) for 25 days and measuring the current response for determination 1 nM miRNA-21. As shown in Fig. 5 C, the electrode still exhibited ∼96.41% of the original current with gradual signal decay, which indicated that the immobilization method (PDA-assisted binding, glutaraldehyde crosslink and BSA blocking) was robust and the prepared sensing interface was durable. Finally, the reproducibility of the biosensor was examined with five different electrodes prepared using the same process and in identical experimental conditions when using 1 nM miRNA-21 (Fig. 5 D). The responses obtained were all slightly different from each other (i.e., RSD of less than 4%) indicating the good reproducibility and the well-established synthetic process of the biosensor. The analytical performance of the proposed DNA immobilized Ni-doped ZnO/GCE-based biosensing platform towards different concentrations of miRNA-21 target (Fig. 6 A). The biosensor was applied in the concentration range from 10 − 6 nM to 10 5 nM by DPV. With the increase in concentration of miRNA-21 target, the peak current decreases slowly, which can be explained by the hindrance of the redox probe [Fe(CN)₆]³⁻ / ⁴⁻diffusion to the electrode surface caused by the immobilized oligonucleotides and surface modifications. To more clearly present the influence, change of the peak current (ΔI) was obtained by the response with DNA immobilized Ni-doped ZnO/GCE prior to hybridization and that after hybridization with miRNA-21 (Fig. 6 B). Under optimal conditions, it was found that there was a linear relationship between ΔI and the logarithm of the miRNA-21 concentration in the range of 10 − 6 nM to 10 5 nM, with a correlation coefficient of 0.9984 and LOD of 21.30 fM, indicating the high sensitivity of the prepared biosensor. The doped Ni in the ZnO nanorods not only effectively improves the electron transportation but also leads to more binding sites by the increased defect states, therefore it shows better electrochemical performance than the pristine ZnO nanorods. A comparative analysis of the biosensor's key analytical figures of merit with existing electrochemical miRNA detection methods is summarized in Table 1 . The detection limit and dynamic range obtained in the current work have the same or even a higher value compared to the previous attempts, which is owed to the enhanced surface by PDA-moderated functionalization and crosslinking stability of glutaraldehyde, the Ni-doping of ZnO nanorods, indicating that the designed platform was reliable and could be used for practical detection of miRNA-21. Table 1 A comparative analysis of electrochemical miRNA-21 biosensor in present other reports for miRNA-21 biosensors. Electrode Technique LOD (fM) Linear Range (nM) Ref. DNA/Silicon photonic bimodal interferometric waveguide BiMW 0.025 Up to 100 [ 45 ] DNA/MoSe 2 NPs/AuTF/Silicon Wafer EIS 4.4 10 − 5 to 10 2 [ 8 ] dsDNA/G-quadruplex LSV 5.68 2×10 − 5 to 5 [ 9 ] DNA/methylene blue/screen-printed gold electrode SWV 2×10 6 20 to160 [ 10 ] DNA/Methylene blue-Hemin/gold electrode DPV 0.15 10 − 6 to 10 [ 11 ] ssDNA/graphene oxide/Au composite DPV 10 3 10 − 5 to 10 5 [ 46 ] Peptide nucleic acid/thiolated Au nanostructures/single-wall carbon nanotubes / fluorine-doped tin oxide DPV 0.01 10 − 8 to 10 3 [ 47 ] DNA hydrogel/ polyethylene terephthalate/indium tin oxide DPV 5×10 6 10 to 5×10 4 [ 48 ] dhDNA/graphene oxide/ chitosan@polyvinylpyrrolidone-Au nanourchin/GCE DPV 1.24 2×10 − 6 to 10 5 [ 49 ] dsDNA/ graphene/pencil graphite electrodes DPV 3120 --- [ 50 ] DNA immobilized Ni-doped ZnO DPV 21.30 10 − 6 to 10 5 This work BiMW: Bimodal waveguide interferometers; LSV: Linear sweep voltammetry; SWV: Square-wave voltammetry 3.5. Analysis of miRNA-21 in Biological Fluids Early diagnosis of cancer using circulating miRNA-21 as a biomarker is highly preferred due to the availability of such miRNAs in body fluids and minimal invasiveness of the protocol. Moreover, miRNA-21 was found to be up-regulated in the serum from non-small cell lung cancer patients, and proper quantification of serum miRNA-21 is essential for early diagnosis. In order to assess the real-world application of the developed biosensing platform, the feasibility of this platform was tested by adding miRNA-21 into known human serum concentrations via recovery experiments with the DNA immobilized Ni-doped ZnO/GCE. As demonstrated in Table 2 , the recovery rates for investigated concentrations varied from 90.00% to 99.70% with RSD of less than 4.11%, which described the feasible coincidence between original and spiking levels, and again, they further confirmed the reliability of the developed biosensor in a real biological matrix. Experimental data obtained with the electrochemical biosensor was also compared to the results of a commercial Human microRNA-21ELISA Kit. Recoveries studies demonstrated the accuracy and precision of the sensor with real samples too, by representing an excellent correlation between miRNA-21 content obtained between both methods. These results demonstrate the successful detection of a specific miRNA target in a complex sample matrix, with tolerance to potential interfering species, and as such, a potential solid platform for real sample analysis. The successful Quantification of extracellular miRNA-21 in serum can provide compelling evidence for the viability of the proposed system which can offer the possibility for quick, facile and accurate quantification of miRNAs in various clinical samples, potentially facilitating the non-invasive early diagnosis of cancer. Table 2 Detection of miRNA-21 in the human serum of healthy volunteers using the developed sensor (n = 4). DNA immobilized Ni-doped ZnO/GCE Human microRNA-21ELISA Kit Volunteer Spiked miRNA-21 (nM) Detected miRNA-21 (nM) Recovery (%) RSD (%) Detected miRNA-21 (nM) Recovery (%) RSD (%) Relative difference (%) V1 0.010 0.009 90.00 4.11 0.009 90.00 4.28 0.0000 0.100 0.098 98.00 3.68 0.099 99.00 3.43 1.0101 1.000 0.992 99.20 4.08 0.994 99.40 4.44 0.2012 V2 0.010 0.009 90.00 3.29 0.009 90.00 4.08 0.0000 0.100 0.096 96.00 3.56 0.093 93.00 3.49 -3.2258 1.000 0.997 99.70 4.09 0.996 99.60 3.72 -0.1004 4. Conclusion In this work, for the first time, a Ni-doped ZnO nanorods-based electrochemical biosensor was established and it was found to be an efficient biosensor for the sensitive determination of miRNA-21, which is an important miRNA in the diagnosis of lung cancer. The hydrothermally grown Ni-doped ZnO nanorods exhibited a conducting and well-crystallized background, and the introduction of Ni²⁺ in ZnO structure notably improved electron transfer properties in comparison to pristine ZnO. The follow-up surface derivatizations on the patterned electrode surface, including PDA decoration, glutaraldehyde activation, probe DNA immobilization and BSA blocking, were systematically confirmed by CV, EIS, and DPV measurements, resulting in a sequential increase in charge-transfer resistance and decrease in redox current, which proved the successive construction of the sensing interface. The resulting sensor had a low LOD of 21.30 fM and the linear dynamic range of detection was 10 − 6 nM to 10 5 nM, indicating high sensitivity and reproducibility. Additionally, recovery tests performed with human serum samples demonstrated that the developed biosensor was suitable for use in complicated biological specimens, with acceptable recovery results within an acceptable analytical range. As opposed to traditional electrodes, the Ni-doped ZnO biosensor has many merits in electron transfer, easy immobilization and could be adapted to the miRNA circulatory detection without amplification or labeling. These unique advantages have rendered the platform as a promising strategy for early diagnosis of non-small cell lung cancer by less-invasive analysis of serum samples. Moreover, besides lung cancer detection, the modular design of biosensor may be readily adapted for other clinically significant miRNAs or nucleic acid biomarkers, by designing a new capture probe sequence. Further works will need to explore the combination of this biosensing approach with portable/smartphone readout device together with multiplexing capability and to validate with larger size of clinical samples to facilitate their translation as point of care tool. In summary, the Ni-doped ZnO nanorod-based biosensor is a sensitive, selective, low-cost and clinically relevant platform, and has great potential to develop the cancer miRNA diagnosis area. Declarations Funding The authors did not receive support from any organization for the submitted work. Author Contribution Y.F. and X.W. conceived and designed the study. B.J. and Z.Y. carried out the experiments and data collection. B.Z. assisted with materials preparation and characterization. H.L. and X.W. supervised the project and provided critical revisions. All authors discussed the results, contributed to manuscript preparation, and approved the final version. References Ranganathan K, Sivasankar V (2014) MicroRNAs - Biology and clinical applications. J Oral Maxillofac Pathol 18:229–234 O'Brien J, Hayder H, Zayed Y, Peng C (2018) Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front Endocrinol (Lausanne) 9:402 Otmani K, Lewalle P (2021) Tumor Suppressor miRNA in Cancer Cells and the Tumor Microenvironment: Mechanism of Deregulation and Clinical Implications. Front Oncol 11:708765 Wang W, Li X, Liu C, Zhang X, Wu Y, Diao M, Tan S, Huang S, Cheng Y, You T (2022) MicroRNA-21 as a diagnostic and prognostic biomarker of lung cancer: a systematic review and meta-analysis. Biosci Rep 42 Ouyang T, Liu Z, Han Z, Ge Q (2019) MicroRNA Detection Specificity: Recent Advances and Future Perspective. Anal Chem 91:3179–3186 Yang S, Rothman RE (2004) PCR-based diagnostics for infectious diseases: uses, limitations, and future applications in acute-care settings. Lancet Infect Dis 4:337–348 Ghosh R, Gilda JE, Gomes AV (2014) The necessity of and strategies for improving confidence in the accuracy of western blots. Expert Rev Proteom 11:549–560 Belivani Ardakani A, Nayeri M, Nasirizadeh N, Ostovari F, Seifati SM (2025) Development of an electrochemical biosensor based on MoSe2 nanoparticles and AuNPs modified silicon wafer for measuring lung cancer biomarker, miR-21. Microchem J 213:113805 Meng F, Yu W, Chen C, Guo S, Tian X, Miao Y, Ma L, Zhang X, Yu Y, Huang L, Qian K, Wang J (2022) A Versatile Electrochemical Biosensor for the Detection of Circulating MicroRNA toward Non-Small Cell Lung Cancer Diagnosis. Small 18:2200784 Cimmino W, Migliorelli D, Singh S, Miglione A, Generelli S, Cinti S (2023) Design of a printed electrochemical strip towards miRNA-21 detection in urine samples: optimization of the experimental procedures for real sample application. Anal Bioanal Chem 415:4511–4520 Shao H, Xue X, Sun Z, Zheng X, Shi P (2025) Detection of microRNA-21 based on smartly designed ratiometric electrochemical sensor and dual-signal amplification. Anal Chim Acta 1336:343444 Savari R, Fakhar O, Rouhi J (2025) An electrochemical sensor based on ZnO–CuO nanocomposites for vancomycin detection in food samples. Ceram Int 51:22266–22276 Anjum S, Hashim M, Malik SA, Khan M, Lorenzo JM, Abbasi BH, Hano C (2021) Recent Advances in Zinc Oxide Nanoparticles (ZnO NPs) for Cancer Diagnosis, Target Drug Delivery, and Treatment. Cancers (Basel) 13 Rodrigues J, Pereira SO, Zanoni J, Rodrigues C, Brás M, Costa FM, Monteiro T (2022) ZnO Transducers for Photoluminescence-Based Biosensors: A Review. Chemosensors 10:39 Zhang H, Feng B, Chen Y, Jin P, Ruan R, Xu B, Zheng Z, Zhou G, Zhang Y, Wang K, Zhong Y, Fan Y (2025) Study on the Influence Mechanism of Alkaline Earth Element Doping on the Thermoelectric Properties of ZnO. Micromachines 16:850 Kholtobina AS, Kovaleva EA, Melchakova J, Ovchinnikov SG, Kuzubov AA (2021) Theoretical Investigation of the Prospect to Tailor ZnO Electronic Properties with VP Thin Films. Nanomaterials 11:1412 Basri SH, Majid WHA, Talik NA, Sarjidan MAM (2018) Tailoring electronics structure, electrical and magnetic properties of synthesized transition metal (Ni)-doped ZnO thin film. J Alloys Compd 769:640–648 Anandan M, Dinesh S, Christopher B, Krishnakumar N, Krishnamurthy B, Ayyar M (2024) Multifaceted investigations of co-precipitated Ni-doped ZnO nanoparticles: Systematic study on structural integrity, optical interplay and photocatalytic performances. Physica B 674:415597 Cheng C, Xu G, Zhang H, Luo Y (2008) Hydrothermal synthesis Ni-doped ZnO nanorods with room-temperature ferromagnetism. Mater Lett 62:1617–1620 Fedorenko V, Damberga D, Grundsteins K, Ramanavicius A, Ramanavicius S, Coy E, Iatsunskyi I, Viter R (2021) Application of Polydopamine Functionalized Zinc Oxide for Glucose Biosensor Design. Polymers 13:2918 Xu Z, Wang T, Liu J (2022) Recent Development of Polydopamine Anti-Bacterial Nanomaterials. Int J Mol Sci 23:7278 Zhang Y, Geng X, Ai J, Gao Q, Qi H, Zhang C (2015) Signal amplification detection of DNA using a sensor fabricated by one-step covalent immobilization of amino-terminated probe DNA onto the polydopamine-modified screen-printed carbon electrode. Sens Actuators B 221:1535–1541 Jeyachandran YL, Mielczarski JA, Mielczarski E, Rai B (2010) Efficiency of blocking of non-specific interaction of different proteins by BSA adsorbed on hydrophobic and hydrophilic surfaces. J Colloid Interface Sci 341:136–142 Abood I (2017) Structural, Optical and magnetic properties of Ni-Doped ZnO synthesized by Co-precipitation method (2017) J Nanotechnol Material Sci 4 (1): 1–8. J. Nanotech Mater Sci. 4:1–8 Elhamdi I, Souissi H, Taktak O, Elghoul J, Kammoun S, Dhahri E, Costa BFO (2022) Experimental and modeling study of ZnO:Ni nanoparticles for near-infrared light emitting diodes. RSC Adv 12:13074–13086 Savaloni H, Savari R (2018) Nano-structural variations of ZnO:N thin films as a function of deposition angle and annealing conditions: XRD, AFM, FESEM and EDS analyses. Mater Chem Phys 214:402–420 SivaKarthik P, Thangaraj V, Kumaresan S, Vallalperuman K (2017) Comparative study of Co and Ni substituted ZnO nanoparticles: synthesis, structural, optical and photocatalytic activity. J Mater Sci: Mater Electron 28:10582–10588 Viter R, Fedorenko V, Gabriunaite I, Tepliakova I, Ramanavicius S, Holubnycha V, Ramanavicius A, Valiūnienė A (2023) Electrochemical and Optical Properties of Fluorine Doped Tin Oxide Modified by ZnO Nanorods and Polydopamine. Chemosensors 11:106 Chang MC, Tanaka J (2002) FT-IR study for hydroxyapatite/collagen nanocomposite cross-linked by glutaraldehyde. Biomaterials 23:4811–4818 Serec K, Šegedin N, Krajačić M, Dolanski Babić S (2021) Conformational Transitions of Double-Stranded DNA in Thin Films. Appl Sci 11:2360 Alhazmi HA, Al Bratty M, Meraya AM, Najmi A, Alam MS, Javed SA, Ahsan W (2021) Spectroscopic characterization of the interactions of bovine serum albumin with medicinally important metal ions: platinum (IV), iridium (III) and iron (II). Acta Biochim Pol 68:99–107 Hyun DE, Choi JC, Kim YH, Ra Y, Sim JS, Lee JK, Kang YC (2025) Electrodeposited ZnO/Zn (OH) 2 Nanosheets as a Functional Interface for Dendrite-Free Lithium Metal Anodes. Small 2503607. Yildiz A, Kayhan B, Yurduguzel B, Rambu AP, Iacomi F, Simon S (2011) Ni doping effect on electrical conductivity of ZnO nanocrystalline thin films. J Mater Sci: Mater Electron 22:1473–1478 Peck MA, Langell MA (2012) Comparison of Nanoscaled and Bulk NiO Structural and Environmental Characteristics by XRD, XAFS, and XPS. Chem Mater 24:4483–4490 Zhang Q, Zhao X, Duan L, Shen H, Liu R, Hou T (2020) Optical and photocatalytic properties of a ZnO@C core/shell sphere with rich oxygen vacancies. CrystEngComm 22:5245–5254 Chang F-M, Brahma S, Huang J-H, Wu Z-Z, Lo K-Y (2019) Strong correlation between optical properties and mechanism in deficiency of normalized self-assembly ZnO nanorods. Sci Rep 9:905 Jagadish R, Yellappa S, Mahanthappa M, Chandrasekhar KB (2017) Zinc Oxide Nanoparticle-modified Glassy Carbon Electrode as a Highly Sensitive Electrochemical Sensor for the Detection of Caffeine. J Chin Chem Soc 64:813–821 Üzar N, Abdulaziz U, Erbas OG, Aydin M, Dolgun MF (2024) Enhancement of structural, optical, electrical, optoelectronic and thermoelectric properties of ZnO thin film via Ni doping and Ni-B co-doping. Phys Scr 99:075995 Jiang B-C, Yang S-H (2021) Nickel-Doped ZnO Nanowalls with Enhanced Electron Transport Ability for Electrochemical Water Splitting. Nanomaterials 11:1980 Gao B, Su L, Tong Y, Guan M, Zhang X (2014) Ion permeability of polydopamine films revealed using a prussian blue-based electrochemical method. J Phys Chem B 118:12781–12787 López-Gallego F, Betancor L, Mateo C, Hidalgo A, Alonso-Morales N, Dellamora-Ortiz G, Guisán JM, Fernández-Lafuente R (2005) Enzyme stabilization by glutaraldehyde crosslinking of adsorbed proteins on aminated supports. J Biotechnol 119:70–75 Zhao W-W, Xu J-J, Chen H-Y (2014) Photoelectrochemical DNA Biosensors. Chem Rev 114:7421–7441 Thapa K, Liu W, Wang R (2022) Nucleic acid-based electrochemical biosensor: Recent advances in probe immobilization and signal amplification strategies. WIREs Nanomed Nanobiotechnol 14:e1765 Park JH, Sut TN, Jackman JA, Ferhan AR, Yoon BK, Cho N-J (2017) Controlling adsorption and passivation properties of bovine serum albumin on silica surfaces by ionic strength modulation and cross-linking. Phys Chem Chem Phys 19:8854–8865 Calvo-Lozano O, García-Aparicio P, Raduly L-Z, Estévez MC, Berindan-Neagoe I, Ferracin M, Lechuga LM (2022) One-Step and Real-Time Detection of microRNA-21 in Human Samples for Lung Cancer Biosensing Diagnosis. Anal Chem 94:14659–14665 Shin Low S, Pan Y, Ji D, Li Y, Lu Y, He Y, Chen Q, Liu Q (2020) Smartphone-based portable electrochemical biosensing system for detection of circulating microRNA-21 in saliva as a proof-of-concept. Sens Actuators B 308:127718 Sabahi A, Salahandish R, Ghaffarinejad A, Omidinia E (2020) Electrochemical nano-genosensor for highly sensitive detection of miR-21 biomarker based on SWCNT-grafted dendritic Au nanostructure for early detection of prostate cancer. Talanta 209:120595 Liu S, Su W, Li Y, Zhang L, Ding X (2018) Manufacturing of an electrochemical biosensing platform based on hybrid DNA hydrogel: Taking lung cancer-specific miR-21 as an example. Biosens Bioelectron 103:1–5 Khodadoust A, Nasirizadeh N, Seyfati SM, Taheri RA, Ghanei M, Bagheri H (2023) High-performance strategy for the construction of electrochemical biosensor for simultaneous detection of miRNA-141 and miRNA-21 as lung cancer biomarkers. Talanta 252:123863 Kilic T, Erdem A, Erac Y, Seydibeyoglu MO, Okur S, Ozsoz M (2015) Electrochemical Detection of a Cancer Biomarker mir-21 in Cell Lysates Using Graphene Modified Sensors. Electroanalysis 27:317–326 Additional Declarations No competing interests reported. Supplementary Files GeraphicalAbstract.png Cite Share Download PDF Status: Published Journal Publication published 23 Dec, 2025 Read the published version in Microchimica Acta → Version 1 posted Editorial decision: Revision requested 16 Oct, 2025 Reviews received at journal 16 Oct, 2025 Reviewers agreed at journal 24 Sep, 2025 Reviews received at journal 23 Sep, 2025 Reviewers agreed at journal 23 Sep, 2025 Reviewers agreed at journal 22 Sep, 2025 Reviewers invited by journal 22 Sep, 2025 Editor assigned by journal 16 Sep, 2025 Submission checks completed at journal 16 Sep, 2025 First submitted to journal 13 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7608116","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":523807970,"identity":"440e0615-c0de-4e68-af00-f28e767991ba","order_by":0,"name":"Yafeng Fan","email":"","orcid":"","institution":"Shanxi Provincial Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yafeng","middleName":"","lastName":"Fan","suffix":""},{"id":523807971,"identity":"50c05ab8-5c89-41ab-b39d-aa9584dc0e7a","order_by":1,"name":"Baoping Jiao","email":"","orcid":"","institution":"Shanxi Provincial Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Baoping","middleName":"","lastName":"Jiao","suffix":""},{"id":523807972,"identity":"91300f07-3c4f-482f-b918-763027093290","order_by":2,"name":"Zhongping Yu","email":"","orcid":"","institution":"Shanxi Provincial Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhongping","middleName":"","lastName":"Yu","suffix":""},{"id":523807973,"identity":"e3d9d0d7-2121-4108-83e0-5c6512dc663b","order_by":3,"name":"Bingbing Zong","email":"","orcid":"","institution":"Shanxi Provincial Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Bingbing","middleName":"","lastName":"Zong","suffix":""},{"id":523807974,"identity":"826dc260-dbee-4c76-9d9d-a8a274203af2","order_by":4,"name":"Xianzhen Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYJCCA0CcAOMk8DMzH35AmhbJdrY0A2JsQmgxOM+jIIFPqcGNHMMDP3fU5fFLNzB/5t1hl2d8mIfBgKHGJhq3lrSEg71n2Iol5xxgk5x5JrnY7DDvgQcMx9JyG3BoMbuRfOAAbxtP4oYbCWwMH9sOJG47zJdgwNhwGI+WxIaDf9skEvffSGD+kAjUsrmZx0ACv5bkA4d52wwSN0gkMEiAbNnATECL/ZlnCYdl2xISZwAdBvJL4ozDwEBOwOMXyfYc449v2+oS+2ckgEMssb//8OEHH2pscGpBAvwfGBhhyhIIK4cCuJZRMApGwSgYBUgAAMYjYlziJjldAAAAAElFTkSuQmCC","orcid":"","institution":"Shanxi Provincial Cancer Hospital","correspondingAuthor":true,"prefix":"","firstName":"Xianzhen","middleName":"","lastName":"Wu","suffix":""},{"id":523807975,"identity":"33dcf6b6-ea32-41f8-acde-9cc228e2a53c","order_by":5,"name":"Haiyan Li","email":"","orcid":"","institution":"Shanxi Provincial Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Haiyan","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2025-09-13 14:53:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7608116/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7608116/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00604-025-07709-6","type":"published","date":"2025-12-23T15:57:04+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":92718553,"identity":"b2773dd2-25f0-4467-87a6-e11165268be3","added_by":"auto","created_at":"2025-10-03 13:06:06","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2736696,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/95bdef79aaed3b0693889fb6.docx"},{"id":92718372,"identity":"7cedd5ad-42a9-4da0-bd2e-04af102b10de","added_by":"auto","created_at":"2025-10-03 12:58:05","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1048494,"visible":true,"origin":"","legend":"","description":"","filename":"GeraphicalAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/01bea9eabe54e25294088ef8.png"},{"id":92718362,"identity":"89fdfed9-9585-4f29-b43d-2bbef5acdcd5","added_by":"auto","created_at":"2025-10-03 12:58:05","extension":"json","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7565,"visible":true,"origin":"","legend":"","description":"","filename":"bf26e51686374540b0337bd9930b438b.json","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/ee03afd73df8efd7f59d5ccd.json"},{"id":92718368,"identity":"302bdddb-c858-4af6-b825-3dfc7b12f1cb","added_by":"auto","created_at":"2025-10-03 12:58:05","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":132856,"visible":true,"origin":"","legend":"","description":"","filename":"bf26e51686374540b0337bd9930b438b1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/b5c3ddae97751c12bae243f9.xml"},{"id":92718554,"identity":"04630f88-9f5a-4ef9-bfb9-85009d260b38","added_by":"auto","created_at":"2025-10-03 13:06:06","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1048494,"visible":true,"origin":"","legend":"","description":"","filename":"GeraphicalAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/329f6873db60cd1bb95a53fd.png"},{"id":92718556,"identity":"80f0fdd0-4679-40c8-894f-5695f7f84d7b","added_by":"auto","created_at":"2025-10-03 13:06:06","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1040403,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/f0ca89ed2dea59d59cafde9b.png"},{"id":92718374,"identity":"9d27d3a8-2024-4494-a242-dfa3abcd966e","added_by":"auto","created_at":"2025-10-03 12:58:06","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":577437,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/95a625603522286817fad584.jpeg"},{"id":92718379,"identity":"c4d16109-472c-4b58-b465-3f6a9014fc68","added_by":"auto","created_at":"2025-10-03 12:58:06","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":464879,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/0e178682432d7c7b6555161c.png"},{"id":92718380,"identity":"d0a8bb8e-c2d3-46a2-81bd-d918e049b72d","added_by":"auto","created_at":"2025-10-03 12:58:06","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":311065,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/dddb6f51ffdd3331ab505b06.png"},{"id":92718386,"identity":"c7828660-7364-47ad-b15d-37465cf2b600","added_by":"auto","created_at":"2025-10-03 12:58:06","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":251574,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/1ef63fecc2bf09a5cfdd79c0.png"},{"id":92718376,"identity":"96a42a9f-f86a-4adc-bd7a-4f9e81708330","added_by":"auto","created_at":"2025-10-03 12:58:06","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":349567,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/8b069229c327ce8ce43d6340.png"},{"id":92718550,"identity":"91e8bea8-8464-4370-88af-96782cd21809","added_by":"auto","created_at":"2025-10-03 13:06:05","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57619,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineGeraphicalAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/ae76a92daa2521d7d86049b6.png"},{"id":92719401,"identity":"f84a1fd7-f024-4801-93db-a19ac44df200","added_by":"auto","created_at":"2025-10-03 13:14:06","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":113490,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/d94dba6a470cb29861452518.png"},{"id":92718559,"identity":"eaedd9a7-2e7e-44a4-af59-35ccacd2fef7","added_by":"auto","created_at":"2025-10-03 13:06:06","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":120738,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/79c4d1a34b2bec885c2a5cc8.png"},{"id":92718384,"identity":"3bbf1a14-cf43-4659-b6fa-0a199964f9fe","added_by":"auto","created_at":"2025-10-03 12:58:06","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":130990,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/8404c3c9f3bdc1f82126a93a.png"},{"id":92718557,"identity":"0c094206-be8d-429f-a021-242ba2e6bb23","added_by":"auto","created_at":"2025-10-03 13:06:06","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":88600,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/514f3aff59d9a1b9027ecb0f.png"},{"id":92719399,"identity":"29605afd-6fab-477d-b3d4-20fe3f53f1ed","added_by":"auto","created_at":"2025-10-03 13:14:06","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":67360,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/a50e1a369d78a72073152caa.png"},{"id":92719400,"identity":"92dc2f0d-bb4b-457d-83de-2a0b2a9ee60c","added_by":"auto","created_at":"2025-10-03 13:14:06","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":87507,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/63501b1d64dacf6f2d119fca.png"},{"id":92718382,"identity":"3ac257c7-8602-4965-9798-d2683bf1a963","added_by":"auto","created_at":"2025-10-03 12:58:06","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":134064,"visible":true,"origin":"","legend":"","description":"","filename":"bf26e51686374540b0337bd9930b438b1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/dcaebb9cfc7ed4c87c163e5a.xml"},{"id":92718389,"identity":"68810a6f-4289-4301-aa77-d6d22eaeb169","added_by":"auto","created_at":"2025-10-03 12:58:06","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":139915,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/2834bb22c3813f26830da549.html"},{"id":92718547,"identity":"db42b926-2273-4cd1-ba1d-8b45074a1440","added_by":"auto","created_at":"2025-10-03 13:06:05","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1040403,"visible":true,"origin":"","legend":"\u003cp\u003e(A) FE-SEM image and (B) EDS spectrum of prepared Ni-doped ZnO nanorods. (C) XRD result of the prepared pure ZnO and Ni-doped ZnO nanorods. (D) FTIR spectra of the Ni-doped ZnO nanorods and DNA immobilized Ni-doped ZnO nanorods.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/4e9f9d9cf55a1c85dabcc3e2.png"},{"id":92718364,"identity":"d8b555d3-3dfe-42a6-850b-292d48d71779","added_by":"auto","created_at":"2025-10-03 12:58:05","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":220185,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Comparative wide-scan of the pure ZnO and Ni-doped ZnO nanorods; (B) XPS Zn 2p; (C) XPS Ni 2p; and (D) XPS O 1s.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/0075ec7fe933d2fa0650081d.png"},{"id":92718548,"identity":"e1f08f91-0877-4526-b77d-51888b3a1fc7","added_by":"auto","created_at":"2025-10-03 13:06:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":464879,"visible":true,"origin":"","legend":"\u003cp\u003e(A) CV, (B) Nyquist plots and (C) DPV responses of electrodes (GCE, ZnO/GCE, Ni-doped ZnO/GCE, DNA/Ni-doped ZnO/GCE and miRNA-21/DNA/Ni-doped ZnO/GCE) at varied stages of modification.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/ab0dae2f754ede1b6c05f708.png"},{"id":92718365,"identity":"bb38b78a-5a36-4a30-a4a1-4f829eed90bc","added_by":"auto","created_at":"2025-10-03 12:58:05","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":311065,"visible":true,"origin":"","legend":"\u003cp\u003eResulted signal of DPV measurements for determination 1 nM miRNA-21 for effect of (A) Ni doping content in Ni-doped ZnO nanorods, (B) volume of Ni-doped ZnO nanorods on GCE, (C) the PDA incubation time, (D) concentration of glutaraldehyde, (E) ssDNA probe concentration, and (F) BSA incubation time (n=4).\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/8b25711200944ae4d29318c2.png"},{"id":92719398,"identity":"795e2bd9-6e97-4794-b98c-4ae76b9e80b6","added_by":"auto","created_at":"2025-10-03 13:14:05","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":251574,"visible":true,"origin":"","legend":"\u003cp\u003e(A) DPV response of DNA immobilized Ni-doped ZnO/GCE in the presence of 1 nM miRNA-21 target, non-target miR-141, and one-base mismatched sequence, (B) obtained signal for different concentrations (10\u003csup\u003e4\u003c/sup\u003e, 1 and 10⁻\u003csup\u003e6\u003c/sup\u003e nM) of miRNA-21 target, non-target miR-141, and one-base mismatched sequence. (C) Stability tests after storage at 4 °C for 25 days, and (D) reproducibility tests with five independently fabricated electrodes. Assessments were carried out in supporting electrolyte containing 1 nM miRNA-21 using DPV (n=4).\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/41329b0c4c94bdd013381d1d.png"},{"id":92718552,"identity":"8fd26dee-af23-4b90-9859-f8f29215fe30","added_by":"auto","created_at":"2025-10-03 13:06:06","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":349567,"visible":true,"origin":"","legend":"\u003cp\u003e(A) The analytical performance of the proposed DNA immobilized Ni-doped ZnO/GCE- towards different concentrations of miRNA-21 target by DPV in supporting electrolyte. (B) The obtained calibration curve.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/1cf312f1e0e2f19b359c61e7.png"},{"id":99172225,"identity":"fabf1815-a257-4d17-8c51-3a3b535f79e0","added_by":"auto","created_at":"2025-12-29 16:04:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3131557,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/3c915f5d-c311-4b31-a3f8-80f9803b0171.pdf"},{"id":92719397,"identity":"b407c452-aa7c-4d4a-8757-e29cace0eb49","added_by":"auto","created_at":"2025-10-03 13:14:05","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1048494,"visible":true,"origin":"","legend":"","description":"","filename":"GeraphicalAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7608116/v1/289b1cfda6c363d136f5dc67.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Development of electrochemical biosensor based on Ni-doped ZnO nanorods for detecting miRNA-21 lung cancer biomarker","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eMicroRNAs (miRNAs) comprise a class of short, non-protein-coding RNA molecules, typically 19\u0026ndash;24 nucleotides long, which have the ability to post-transcriptionally silence target mRNAs, serving as key gene expression regulators [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Dysregulation of miRNAs was closely correlated with different cancer types and their roles as oncogenes or tumor suppressors [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. One of these miRNAs is microRNA-21 (miR-21), which is one of the most well-studied oncomiRs that overexpresses in numerous tumors, such as non-small cell lung cancer, a predominant source of cancer-associated mortality globally [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Therefore, highly precise and selective quantification of miRNA-21 is crucial for initial cancer screening and treatment monitoring, which may give us more time to live. Classical miRNA detection methods including Northern blotting, quantitative reverse transcription PCR, microarrays, next generation sequencing are employed as the gold standard [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. However, these approaches have a number of limitations, such as trained staff, laboratory, intensive assay procedures, duration, and sample complexity which do not tolerate complex biological samples [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Such limitations further illustrate the pressing need for simple, low cost, sensitive and point-of-care alternatives.\u003c/p\u003e\u003cp\u003eDue to the high sensitivity, low cost, fast responses and compatibility with miniaturization, electrochemical biosensors have been explosively studied as a promising platform for miRNA detection in recent years [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. These nanomaterials when incorporated in electrode development greatly enhance the function of biosensor by enlarging the effective surface area, improving the electron transfer, and promoting selective interaction with biomolecules [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Of the numerous nanomaterials that possess applications in diverse fields, the nanostructured ZnO has distinct significance owning to its inherent characteristics of the wide bandgap of approximately 3.37 eV, along with a notably significant exciton binding energy, biocompatibility, chemical stability, and the feasibility for various morphological forms such as nanorods, nanowires, and nanoparticles [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. These properties render ZnO-based nanostructures especially favorable as electrochemical transducers [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eHowever, pure ZnO frequently has insufficient electrical conductivity and electron mobility, which might stunt the sensing property. In order to address these challenges, transition metal ion doping has been proposed as an effective means to tailor electronic structure, promote charge carrier concentration and enhance catalytic activity [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Among the several dopants, the nickel (Ni) comes to our notice, because of its an ionic radius similar to that of Zn\u003csup\u003e2+\u003c/sup\u003e, successfully substituting in the ZnO unit but resulting in lattice-shrink and oxygen vacancies formation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Such modifications can greatly improve the electronic conductivity, surface reactivity and thus, biosensing performance [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eHerein, we demonstrate for the fabrication of an electrochemical biosensor using Ni-doped ZnO nanorods for miRNA-21, lung cancer biomarker. The vertically erected Ni doped ZnO nanorods were grown on the conductive support, which employed the large surface area by the high surface-to-volume ratio, abundant active sites for probe immobilization, and facile electron transferring. By incorporating these designed nanostructures into the sensing device, the sensitive, selective and label-free detection of miRNA-21 was simply performed, illustrating their potentials in the development of new generation nanostructured biosensors for early cancer diagnosis.\u003c/p\u003e"},{"header":"2. Experimental","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Chemicals\u003c/h2\u003e\u003cp\u003eZinc acetate dihydrate (Zn(Ac)₂\u0026middot;2H₂O, \u0026ge;\u0026thinsp;99%), sodium hydroxide (NaOH, \u0026ge;\u0026thinsp;98%), alumina slurries (1.0, 0.3, and 0.05 \u0026micro;m) and polyethylene glycol (PEG-400, analytical grade) were obtained from Shanghai Maikelin Biochemical Technology Co., Ltd., China. Dopamine hydrochloride (\u0026ge;\u0026thinsp;98%), nafion, potassium ferrocyanide (K₄[Fe(CN)₆]\u0026middot; 3H₂O), potassium ferricyanide (K₃[Fe(CN)₆]), and glutaraldehyde solution (25%) were obtained from Shanghai Aladdin Bio-Chem Technology Co., Ltd., China. Nickel acetate tetrahydrate (Ni(Ac)₂\u0026middot;4H₂O, \u0026ge;\u0026thinsp;98%), phosphate-buffered saline (PBS, 10 mM, pH 7.4) and bovine serum albumin (BSA, \u0026ge;\u0026thinsp;98%) were sourced from BioFroxx, Guangzhou, China. Glassy carbon electrodes (GCE, 3 mm diameter) substrate was purchased from XFNano (Jiangsu, China). Materials Synthetic microRNA-21 (miR-21, 5\u0026prime;-UAGCUUAUCAGACUGAUGUUGA-3\u0026prime;) and Complementary probe DNA (5\u0026prime;\u0026ndash;NH₂\u0026ndash;TCAACATCAGTCTGATAAGCTA\u0026ndash;3\u0026prime;) were synthesized by GENEWIZ (Suzhou, China) and purified using HPLC. Non-complementary and single base mismatched oligonucleotides were purchased from the same source for selectivity studies. Tris\u0026ndash;HCl buffer (10 mM, pH 8.5) was acquired from Solarbio Life Sciences (Beijing, China). Milli-Q water (18.2 MΩ\u0026middot;cm resistivity at 25\u0026deg;C) as deionized (DI) water served as the solvent for all aqueous solutions throughout this study. molecular biology grade diethylpyrocarbonate-treated water was obtained from Beijing Tsingke Biotech Co., Ltd., Beijing, China, and was used in all experiments involving miRNA to avoid nuclease contamination. All other chemicals were of analytical grade and used as received.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Synthesis of Ni-doped ZnO nanorods\u003c/h2\u003e\u003cp\u003eNickel doped ZnO nanostructure was grown by hydrothermal method [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. To prepare the precursor solution, Zn(Ac)₂\u0026middot;2H₂O (1.0 mmol) and Ni(Ac)₂\u0026middot;4H₂O (0.030 mmol) corresponding to the desired Ni doping for 3 at% relative to Zn were dissolved in absolute ethanol (25.0 mL) under a continuous magnetic stirring until a clear solution was formed. Then, NaOH (8.00 mmol) was also dissolved in absolute ethanol (10.0 mL) to afford a homogeneous solution. The solution was infused slowly, drop by drop, into the metal acetate solution over 8\u0026ndash;10 min with stirring at ~\u0026thinsp;300 rpm. After that, the structure director PEG-400 (8.0 mL) was added slowly. Subsequently, the black product was mixed with ethanol (20 ml). Following 3 min of sonication to form a homogeneous mixture, the solution was transferred to an autoclave (50 mL, Teflon-lined stainless steel). The slurry was loaded into the autoclave to approximately 80% of its total volume. The sealed autoclave was subsequently subjected to hydrothermal treatment at 140\u0026deg;C for 24 h in a convection oven. After reacting hydrothermally, the autoclave was allowed to cool naturally to ambient temperature over 5 h. The resulting gray product, comprising Ni-doped ZnO nanorods, was collected via centrifugation (6000 rpm, 10 min) and subsequently purified through washing three times with absolute ethanol and three times with DI water. After drying the samples at 60\u0026deg;C for 4 h in a convection oven, the samples calcined in air at 300\u0026deg;C for 2 h (heating rate: 2\u0026deg;C min⁻\u0026sup1;) to improve their crystallinity. For comparison, undoped ZnO nanorods were prepared following an identical method but in the absence of any nickel precursor.\u003c/p\u003e\u003cp\u003eFor modification of electrodes, GCEs were polished with alumina slurries, followed by ultrasonication in ethanol and DI water (5 min each) to achieve the clean and smooth surface. The dried powder (2.0 mg) was dispersed in 1 mL ethanol (containing 0.05% Nafion as a binder) and sonicated for 15 min, resulting a stable Ni doped ZnO nanorod suspension. The GCE was modified by drop-casting 10 \u0026micro;L of the suspension onto its polished surface, followed by thermal treatment at 60\u0026deg;C for 1 h to dry the film and construct the uniformly modified electrode surface. The electrodes were kept in a desiccator until further functionalization.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Probe Immobilization\u003c/h2\u003e\u003cp\u003eFor PDA coating of nanorods modified electrode [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], a dopamine\u0026middot;HCl solution (2 mg\u0026middot;ml⁻\u0026sup1;) was formulated in Tris\u0026ndash;HCl buffer. To deposit a conformal polydopamine coating (PDA), the as-obtained Ni doped ZnO/GCE was immersed in the solution under mild stirring at ambient temperature for 50 min. Following modification, the electrode was rinsed with copious amounts of DI water to remove any unbound material and dried under a gentle stream of N₂. PDA's abundant catechol and amine functional groups, providing a multitude of active sites for coordination and covalent binding for the immobilization of other biomolecules [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSubsequently, for preparation glutaraldehyde-mediated covalent probe DNA immobilization [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], the PDA-coated electrode was modified by incubation in glutaraldehyde (2.5% v/v) in PBS for 30 min at room temperature; to generate reactive aldehyde groups. After being activated, the electrode was washed in PBS and DI water for the removal of unreacted glutaraldehyde. The activated surface was coated by drop-casting 10 \u0026micro;L of the solution (1 \u0026micro;M amino terminated DNA probe (complementary to miRNA-21 ; 5\u0026prime;\u0026ndash;NH₂\u0026ndash;probe\u0026ndash;3\u0026prime;) in PBS), followed by a 2-hour incubation at ambient temperature (\u0026asymp;\u0026thinsp;25\u0026deg;C) to allow for Schiff base formation between aldehyde and amine [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The electrode was then washed intensively with PBS followed by DI water. It was followed by incubation the substrate in 1% (w/v) BSA solution in PBS for 30 min at ambient temperature to block non-specific binding sites [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. After the wash with blocking, the electrode was purified via sequential rinsing with PBS and DI water. Finally, it was stored in a fresh PBS solution at 4\u0026deg;C to preserve its stability. The final modified electrode with BSA/DNA/GA/PDA/ Ni doped ZnO/GCE designated as DNA immobilized Ni-doped ZnO/GCE.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. Characterization of Ni doped ZnO Nanorods\u003c/h2\u003e\u003cp\u003eThe surface morphology of the modified GCE was analyzed with a JEOL JSM-7610F (Japan) field emission scanning electron microscope (FE-SEM). Elemental analysis was performed by EDX (Oxford Instruments, UK). The crystallographic structure of nanorods was characterized by an X-ray diffractometer (XRD) using a Bruker D8 Advance (Germany) using Cu Kα radiation (λ\u0026thinsp;=\u0026thinsp;1.5406 \u0026Aring;). The surface chemical composition and oxidation states were measured with 4.3 X-ray Photoelectron Spectroscopy (XPS; Thermo Scientific K-Alpha+, USA). For characterization of polydopamine functionalization and a DNA immobilization on the Ni doped ZnO nanorods, Fourier transform infrared spectroscopy (FTIR) analysis was carried out on a FTIR-430 Jasco (Japan) spectrometer, with an ATR accessory as the sample cell.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Electrochemical measurement\u003c/h2\u003e\u003cp\u003eElectrochemical analysis was performed in a three-electrode configuration with a Pt plate as the auxiliary electrode, a bare or Ni doped ZnO modified electrode as working electrode, and an Ag/AgCl (sat. KCl) reference electrode. The electrochemical cell contained a solution of 5 mM potassium ferri/ferrocyanide (1:1) in 0.1 M KCl as the supporting electrolyte. Cyclic voltammograms (CVs) were recorded within a potential window of \u0026minus;\u0026thinsp;0.6 to +\u0026thinsp;0.4 V vs. Ag/AgCl applying a scan rate of 50 mVs⁻\u0026sup1;. Electrochemical impedance spectroscopy (EIS) was acquired at 10 mV AC perturbation across a frequency range of 10\u003csup\u003e2\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e kHz. Differential pulse voltammograms (DPVs) were recorded with settings of 50 mVs⁻\u0026sup1; scan rate, 50 mV pulse amplitude, 50 ms pulse width, and 4 mV step potential. The hybridization step was performed by incubating the probe-functionalized electrode in 50 \u0026micro;L of the different concentrations of target solution for 30 minutes at 37\u0026deg;C, and then washed before voltametric measurements were recorded. The calibration curves were obtained with the plot of ΔI versus the logarithm of miRNA-21 concentration. The limit of detection (LOD) was calculated as 3σ/S (σ: standard deviation of the blank; S: calibration slope).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Study specificity, reproducibility and operational stability\u003c/h2\u003e\u003cp\u003eTo verify the specificity and exclude background interference, a series of control experiments was performed. An unmodified electrode (probe-modified electrode but without target incubation) was employed to measure the background current response (baseline) and the standard deviation (σ blank). To test the non-specific adsorption, a no-probe control electrode was incubated with miRNA-21 using the same procedure. In addition, the biosensor was tested against non-target miRNAs and a single-base mismatched miRNA sequence to verify the hybridization specificity and discriminate the signals. Selectivity was studied by comparing the electrochemical signal from the biosensor in the presence of complementary miRNA-21 to that obtained for non-complementary and mismatched sequences.\u003c/p\u003e\u003cp\u003eThe reproducibility was evaluated by preparing five individual Ni doped ZnO/GCE electrodes with the same preparation procedures and double checking their electrochemical responses towards 1 nM miRNA-21. The precision of the method was evaluated using relative standard deviation (RSD). Stability was studied by holding the modified electrodes at 4\u0026deg;C in PBS, and the response was measured over varying periods (0, 5, 10, 15, 20 and 25 days).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Assessment of method for human serum sample\u003c/h2\u003e\u003cp\u003eThe practical utility of the biosensor was tested in human serum obtained from of healthy volunteers. Serum was diluted 10% (v/v) in RNase free PBS to minimize the matrix effects. Different concentrations of synthetic miRNA-21 (10\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, and 1 nM) were added to the diluted serum as positive controls. After incubation of the probe-modified electrodes with 50 \u0026micro;L of spiked serum at 37\u0026deg;C for 30 min, the electrodes were gently washed. Electrochemical tests were carried out with DPV analyses. Human microRNA-21(miR-21) ELISA Kit (Sunlong Biotech Co., Ltd, Hangzhou, China) was utilized for determination microRNA-21 in real samples.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results and discussion","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e3.1. Investigation of structural characteristics of Ni-doped ZnO nanorods\u003c/h2\u003e\u003cp\u003eThe morphologies of the prepared Ni-doped ZnO nanorods were assessed by the FE-SEM. The image in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA clearly shows that the grown products had a rod-like shape and the well-defined of hexagonal structures, which were in agreement with the crystal phase of wurtzite ZnO. The nanorods were rather even with the diameter of 60\u0026ndash;80 nm, the length in hundreds of nanometers and the well aligned length-columns on the electrode surface.\u003c/p\u003e\u003cp\u003eThe elemental composition of the as-synthesized Ni-ZnO nanorods was verified by EDS, as displayed in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB. The strong peaks correspond to Zn and O, indicating that the principal component of the product is ZnO as anticipated. A weak, but clear Ni signal was detected, thus confirming the successful integration of Ni\u0026sup2;⁺ ions in the lattice of ZnO. The small intensity of the Ni peak in comparison with those of Zn and O is related to the low dopant concentration used in the synthesis. On the basis of quantitative elemental analysis (EDS Table in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), it is found that the atomic percentage ratio of Ni/Zn is ~\u0026thinsp;4.9% in good accordance with the theoretical doping level [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. These findings indeed support the composition analysis and morphology of the ZnO nanorods indicating efficient replacement of Zn\u003csup\u003e2+\u003c/sup\u003e by Ni\u003csup\u003e2+\u003c/sup\u003e in ZnO.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe XRD result of the pure ZnO and doped ZnO nanorods can also be seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC. For doped sample, the appeared diffraction peaks at 2θ values of 31.66\u0026deg; (100), 34.42\u0026deg; (002), 36.39\u0026deg; (101), 47.58\u0026deg; (102), 56.59\u0026deg; (110), 62.78\u0026deg; (103), 66.28\u0026deg; (200), 67.92\u0026deg; (112), 69.04\u0026deg; (201) 72.52\u0026deg; (004), and 77.29\u0026deg; (202) are well described to standard ICDD file No. 36-1451 for hexagonal wurtzite ZnO (space group P6₃mc), confirming that the prepared nanorods remain as a single-phase ZnO without presence of secondary impurities [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The introduction of Ni\u0026sup2;⁺ ion into ZnO lattice caused an increase in the value of the diffraction peaks toward higher 2θ corresponding with the undoped ZnO, which shows the lattice contraction attributed to the substitution of larger Zn\u0026sup2;⁺ (0.74 \u0026Aring;) by smaller Ni\u0026sup2;⁺ (0.69 \u0026Aring;) ions. Furthermore, the reduction in intensity of the peaks and broadening of the lines in the Ni-doped ZnO nanorods indicate the reduced crystallite size and the increase in lattice strain by the addition of Ni [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The peak of (101) reflection was the highest, implying the preferred orientation growth along this direction. These results indicate that the Ni\u0026sup2;⁺ ions successfully occupied the tetrahedral sites of the Zn\u0026sup2;⁺ sublattice in the ZnO structure, causing a desired extent of distortion that is useful to alter electronic and surface behaviors for biosensing studies.\u003c/p\u003e\u003cp\u003eFTIR spectra of the Ni-doped ZnO nanorods and DNA immobilized Ni-doped ZnO nanorods are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD. FTIR spectra of the Ni-doped ZnO nanorods exhibits a strong absorption peaks at \u0026sim;400\u0026ndash;600 cm⁻\u0026sup1; was recorded due to stretching vibration of metal \u0026ndash; oxygen (Zn\u0026ndash;O) which is extremely sensitive to the Ni\u0026sup2;⁺ substitution inducing lattice dynamics [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. FTIR spectra of the DNA immobilized Ni-doped ZnO nanorods shows sequential bands corresponding to inorganic and organic components which confirmed the modified electrode constituted with complete components PDA, glutaraldehyde crosslinking, DNA and BSA. As observed, vibrational bands appearing at 1186, 1500 and 1595 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e correspond to C\u0026ndash;O aromatic stretch, C\u0026thinsp;=\u0026thinsp;N or/and C\u0026thinsp;=\u0026thinsp;C, C\u0026thinsp;=\u0026thinsp;O, respectively, and wide vibrational bands in 3325 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003eis related to the overlapping of \u0026ndash;OH or N\u0026ndash;H stretching modes in catechol and amine groups of PDA [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Moreover, the prominent peak appeared at around 1730 cm⁻\u0026sup1; due to C\u0026thinsp;=\u0026thinsp;O stretching for aldehyde groups would confirm the formation of Schiff group (imine) formation between amine groups of PDA and dialdehyde moiety of glutaraldehyde took place successfully [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Additionally, the markers of DNA phosphate backbone vibrations were determined: asymmetric PO₂⁻ stretching about 1238 cm⁻\u0026sup1; and symmetric P\u0026ndash;O\u0026ndash;C stretching around 1090 cm⁻\u0026sup1;. These vibrations are also well characterized as fingerprints of the DNA phosphates [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Furthermore, the characteristic amide I and amide II bands, observed at approximately 1655 cm⁻\u0026sup1; (C\u0026thinsp;=\u0026thinsp;O stretch) and 1540 cm⁻\u0026sup1; (N\u0026ndash;H bend / C\u0026ndash;N stretch) respectively, are indicative of BSA's proteinaceous structure [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. They are characteristic bands for proteins and are commonly used to verify immobilization protein using FTIR.\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e depicts the results of XPS analyses of pure ZnO and Ni-doped ZnO nanorods. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA exhibits the survey scan of the pure ZnO and Ni-doped ZnO nanorods. The constituent elements of the Zn 2p and O 1s peaks for both samples and Ni 2p for doped sample are detected. Zn 2p spectra in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB shows that on the pristine ZnO, Zn 2p doublet peaks are descriptively Zn 2p\u003csub\u003e3/2\u003c/sub\u003e and Zn 2p\u003csub\u003e1/2\u003c/sub\u003e located at 1021.8 eV and 1044.8 eV, respectively, consistent with Zn\u0026sup2;⁺ in the wurtzite phase of ZnO [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. On the other hand, the Zn 2p peak positions in Ni-doped ZnO are hardly shifted, which implies that the oxidation state of Zn is hardly modified by Ni doping, but does slightly affect the local lattice environment as it substitutes [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Ni 2p spectra in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC reveals the presence of two principal peaks (854.5 and 855.7 eV) and a shake-up satellite peak (861.1 eV) in the Ni 2p spectrum confirming the incorporation of Ni\u0026sup2;⁺ and Ni\u0026sup3;⁺ oxidation states in the ZnO lattice [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. No Ni was detected from pristine ZnO, verifying the purity of the undoped material. O 1s spectra in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD shows in pristine ZnO, the O 1s spectrum is comprised of lattice oxygen (O\u0026sup2;⁻ at 529.7 eV) and surface-adsorbed oxygen/hydroxyl groups (532.0 eV) [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In the Ni-doped ZnO another component appeared at 530.0 eV due to the oxygen vacancies by the Ni doping [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The proportion of this defect-related component increased with Ni doping, indicating that doping can promote the formation of oxygen defects, which may promote electron transfer and enhance electrochemical performance. The results confirm that doping of Ni introduces more defect states (O vacancies) by not altering the Zn\u0026sup2;⁺ oxidation valence. Ni is incorporated as evidenced from the Ni\u0026sup2;⁺/Ni\u0026sup3;⁺ peaks observed in the XPS analysis. More defects and weak lattice distortion in Ni doped ZnO can promote electron transfer sensitivities, which is essential for the biosensing performance.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e3.2. Assessment of the Modified Electrodes' Electrochemical Performance\u003c/h2\u003e\u003cp\u003eCV, EIS, and DPV responses of electrodes at varied stages of modification were thoroughly characterized in supporting electrolyte. In CV analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), the unmodified GCE gave the minimum redox current and the farthest peak-to-peak distance, suggesting the retarded electron transfer. After loading with ZnO nanorods (ZnO/GCE), the peak currents were enhanced and ΔEp shrunk due to the increased surface area and semiconducting behavior of ZnO [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Further integration of Ni into the ZnO nanorods led to a more pronounced increase in current response, implying that Ni-doping promotes the electrical conductivity of the ZnO thus providing a faster charge transfer (Ni-doped ZnO/GCE) [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Upon surface functionalization with PDA, glutaraldehyde, DNA, and BSA layers (DNA immobilized Ni-doped ZnO/GCE), however, the electrode activity decreased progressively. With a PDA coating and glutaraldehyde crosslinking, the redox peak currents were lower and the peak separation was larger, which is due to partial blocking of the polymeric and the crosslinking layers [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The immobilization of DNA probes decreased the current response further, because the anionic phosphate backbone of the DNA, that electrostatically repels the negatively charged redox probe and makes it difficult to approach the electrode surface [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Finally, after BSA blocking, the current response decreased even more, indicating that excellent surface passivation and reduction in nonspecific adsorption sites was achieved [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. On hybridizing with target miRNA-21 (miRNA-21/DNA/Ni-doped ZnO/GCE), redox peak currents of the CV response further decreased with higher extent than that on the probe-modified electrode. This can be attributed to more negatively charged strands binding to the surface, increasingly hindering the electron transfer kinetics of the redox probe\u003c/p\u003e\u003cp\u003eThe EIS test was consistent with that obtained from the CV test. The charge transfer resistance (Rct) values, which correspond to the diameter of the semicircular region in the Nyquist plots, were obtained to evaluate the interfacial electron transfer kinetics. The Nyquist plots in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB indicated the bare GCE had the highest Rct, which was significantly reduced after ZnO nanorod modification. Ni-doping further decreased Rct but also confirmed that the presence of Ni facilitates electron transfer. In contrast, each biofunctionalization step progressively increased Rct, consistent with the insulating and steric effects of PDA, glutaraldehyde, DNA, and BSA layers. After hybridization with miRNA-21, an additional increase in Rct was achieved, which indicates the suppressed charge-transfer process owing to the duplex on the electrode surface.\u003c/p\u003e\u003cp\u003eResults were consistent when confirmed by DPV analysis as exhibited in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC. The peak currents of the Ni-doped ZnO nanorods gave the highest value and the values of peak intensity decreased with the modification of the surface, respectively. The signal intensity decrease demonstrated that the construction of the sensing interface was step-by-step and successful. More significantly bound by target miRNA-21, the DPV peak current was obviously further decreased as compared with the probe modified electrode. ΔI (the current difference values between the nonspecific hybridization and the probe-only format) was the analytical signal for the quantitation of miRNA-21.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.3. Fine-Tuning of electrode modification and assay parameters\u003c/h2\u003e\u003cp\u003eTo reach the fine-tuning the biosensor fabrication and measurement protocol, a series of parameters in the course of electrode preparation and measurement as Ni doping content in Ni-doped ZnO nanorods, volume of Ni-doped ZnO nanorods on GCE, the PDA incubation time, concentration of glutaraldehyde, ssDNA probe concentration, BSA incubation time and supporting electrolyte pH were screened systematically, and resulted signal of DPV measurements for determination 1 nM miRNA are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eFor study the effect of Ni doping content, Ni-doped ZnO nanorods were hydrothermally synthesized using various amounts of nickel precursor (0.25\u0026ndash;5.0 at% with respect to Zn). The DPV measurements in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA indicated that the 3.0 at% Ni doped ZnO nanorods exhibited the highest signal for 1 nM miRNA-21 target, demonstrated that 3.0 at% Ni doping provided the highest electron transfer rate and the smallest charge transfer resistance, and a further increasing Ni content led to the structural distortion and partial agglomeration of the nanorods, resulting in low conductivity and poor reproducibility.\u003c/p\u003e\u003cp\u003eFor optimization of nanorod suspension volume, in modification GCE, 5 to 20 \u0026micro;L of the Ni-doped ZnO nanorods suspension was drop-casted onto a GCE. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, the best current response for 1 nM miRNA-21 target and most reliable surface coverage were achieved with 10 \u0026micro;L as it delivered a homogeneous nanorod film. To optimization PDA the incubation time, the Tris buffer formed PDA layer was optimized by assessment the incubation time from 30 min to 100 min, and 60 min was found to produce the greatest signal change upon the hybridization of 1\u0026times; 10⁻⁸ M miRNA-21 as exhibited in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC.\u003c/p\u003e\u003cp\u003eFor study the effect of amount of crosslinker, the concentration of the glutaraldehyde cross-linker was also changed in the range of 1\u0026ndash;5% (v/v). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, the optimal balance between covalent DNA immobilization and probe retention was achieved with 2.5% glutaraldehyde for 30 min. To study the probe DNA concentration, various amounts of amino-modified ssDNA probes (0.1\u0026ndash;5 \u0026micro;M) were coated on the activated electrode. As observed in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, DPV measurements demonstrated that 1 \u0026micro;M was the optimum probe concentration due to the most efficient hybridization, and least steric hindrance caused by the overpopulated probes.\u003c/p\u003e\u003cp\u003eThe efficiency of BSA blocking was also investigated by changing the incubation time (10\u0026ndash;60 min). 30 min blocking with 1% BSA was found to retain the high signal reproducibility and to eliminate nonspecific adsorption (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). The effect of pH of electrolyte on the DPV response was studied by varying the pH of the solution ranging from 5.0 to 8.5. The maximum signal change occurs at pH 7.4 and the ideal DNA probe hybridization solution, due in part to the preservation of the stability of the corresponding modified electrode. All in all, the as-optimized conditions,1.0 at% Ni doping, 10 \u0026micro;L nanorod suspension, 1 h PDA modified period, 2.5% glutaraldehyde, 1 \u0026micro;M of probe DNA, 30 min BSA mixture blocking as well as pH 7.4 electrolyte enabled the bioelectrode to offer efficient electron transfer, high probe load, low non-specific absorption, and wonderful long-term stability.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.4. Performance of miRNA biosensor\u003c/h2\u003e\u003cp\u003eSelectivity represents a critical figure of merit for the fabricated biosensor. To study this feature, the electrochemical behaviors of the DNA immobilized Ni-doped ZnO/GCE were measured with and without the target miRNA-21, control miR-141, and one-base mismatched sequence after the hybridization. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, the immobilized onto the electrode surface was triggered by hybridization with the complementary miRNA-21 target, and the complementary miRNA-21 did also induce the strongest current decrease. This is a result of electrostatic repulsion between the negatively charged redox probe and the anionic phosphate groups of the DNA, which creates a charge-transfer barrier. On the other hand, when the hybridization with the mismatched and non-target sequences, negligible current changes were observed, affirming its selective recognition capabilities. The comparative analysis of peak current changes at three concentrations (10\u003csup\u003e4\u003c/sup\u003e, 1 and 10⁻\u003csup\u003e6\u003c/sup\u003e nM) is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, the differences between non-target/mismatched and target strands were clearly observable for each concentration, except the lowest one (10⁻\u003csup\u003e6\u003c/sup\u003e nM), where responses for both strands were overlapped within the error bars. This suggests that the working detection window of the biosensor falls in the 10\u003csup\u003e4\u003c/sup\u003e to 10⁻\u003csup\u003e5\u003c/sup\u003e nM.\u003c/p\u003e\u003cp\u003eThe long-term stability of the fabricated biosensor was investigated under refrigerated conditions (4\u0026deg;C) for 25 days and measuring the current response for determination 1 nM miRNA-21. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, the electrode still exhibited \u0026sim;96.41% of the original current with gradual signal decay, which indicated that the immobilization method (PDA-assisted binding, glutaraldehyde crosslink and BSA blocking) was robust and the prepared sensing interface was durable.\u003c/p\u003e\u003cp\u003eFinally, the reproducibility of the biosensor was examined with five different electrodes prepared using the same process and in identical experimental conditions when using 1 nM miRNA-21 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). The responses obtained were all slightly different from each other (i.e., RSD of less than 4%) indicating the good reproducibility and the well-established synthetic process of the biosensor.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe analytical performance of the proposed DNA immobilized Ni-doped ZnO/GCE-based biosensing platform towards different concentrations of miRNA-21 target (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The biosensor was applied in the concentration range from 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e nM to 10\u003csup\u003e5\u003c/sup\u003e nM by DPV. With the increase in concentration of miRNA-21 target, the peak current decreases slowly, which can be explained by the hindrance of the redox probe [Fe(CN)₆]\u0026sup3;⁻\u003csup\u003e/\u003c/sup\u003e⁴⁻diffusion to the electrode surface caused by the immobilized oligonucleotides and surface modifications.\u003c/p\u003e\u003cp\u003eTo more clearly present the influence, change of the peak current (ΔI) was obtained by the response with DNA immobilized Ni-doped ZnO/GCE prior to hybridization and that after hybridization with miRNA-21 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Under optimal conditions, it was found that there was a linear relationship between ΔI and the logarithm of the miRNA-21 concentration in the range of 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e nM to 10\u003csup\u003e5\u003c/sup\u003e nM, with a correlation coefficient of 0.9984 and LOD of 21.30 fM, indicating the high sensitivity of the prepared biosensor. The doped Ni in the ZnO nanorods not only effectively improves the electron transportation but also leads to more binding sites by the increased defect states, therefore it shows better electrochemical performance than the pristine ZnO nanorods. A comparative analysis of the biosensor's key analytical figures of merit with existing electrochemical miRNA detection methods is summarized in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The detection limit and dynamic range obtained in the current work have the same or even a higher value compared to the previous attempts, which is owed to the enhanced surface by PDA-moderated functionalization and crosslinking stability of glutaraldehyde, the Ni-doping of ZnO nanorods, indicating that the designed platform was reliable and could be used for practical detection of miRNA-21.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eA comparative analysis of electrochemical miRNA-21 biosensor in present other reports for miRNA-21 biosensors.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eElectrode\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTechnique\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLOD (fM)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLinear Range (nM)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eRef.\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA/Silicon photonic bimodal interferometric waveguide\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eBiMW\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.025\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eUp to 100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA/MoSe\u003csub\u003e2\u003c/sub\u003eNPs/AuTF/Silicon Wafer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eEIS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e to 10\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003edsDNA/G-quadruplex\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLSV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5.68\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e to 5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA/methylene blue/screen-printed gold electrode\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSWV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2\u0026times;10\u003csup\u003e6\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e20 to160\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA/Methylene blue-Hemin/gold electrode\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDPV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e to 10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003essDNA/graphene oxide/Au composite\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDPV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e to 10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePeptide nucleic acid/thiolated Au nanostructures/single-wall carbon nanotubes / fluorine-doped tin oxide\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDPV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e to 10\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA hydrogel/ polyethylene terephthalate/indium tin oxide\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDPV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5\u0026times;10\u003csup\u003e6\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10 to 5\u0026times;10\u003csup\u003e4\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003edhDNA/graphene oxide/ chitosan@polyvinylpyrrolidone-Au nanourchin/GCE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDPV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1.24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e to 10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003edsDNA/ graphene/pencil graphite electrodes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDPV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3120\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e---\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA immobilized Ni-doped ZnO\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDPV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e21.30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e to 10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eThis work\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eBiMW: Bimodal waveguide interferometers; LSV: Linear sweep voltammetry; SWV: Square-wave voltammetry\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.5. Analysis of miRNA-21 in Biological Fluids\u003c/h2\u003e\u003cp\u003eEarly diagnosis of cancer using circulating miRNA-21 as a biomarker is highly preferred due to the availability of such miRNAs in body fluids and minimal invasiveness of the protocol. Moreover, miRNA-21 was found to be up-regulated in the serum from non-small cell lung cancer patients, and proper quantification of serum miRNA-21 is essential for early diagnosis. In order to assess the real-world application of the developed biosensing platform, the feasibility of this platform was tested by adding miRNA-21 into known human serum concentrations via recovery experiments with the DNA immobilized Ni-doped ZnO/GCE. As demonstrated in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, the recovery rates for investigated concentrations varied from 90.00% to 99.70% with RSD of less than 4.11%, which described the feasible coincidence between original and spiking levels, and again, they further confirmed the reliability of the developed biosensor in a real biological matrix. Experimental data obtained with the electrochemical biosensor was also compared to the results of a commercial Human microRNA-21ELISA Kit. Recoveries studies demonstrated the accuracy and precision of the sensor with real samples too, by representing an excellent correlation between miRNA-21 content obtained between both methods. These results demonstrate the successful detection of a specific miRNA target in a complex sample matrix, with tolerance to potential interfering species, and as such, a potential solid platform for real sample analysis. The successful Quantification of extracellular miRNA-21 in serum can provide compelling evidence for the viability of the proposed system which can offer the possibility for quick, facile and accurate quantification of miRNAs in various clinical samples, potentially facilitating the non-invasive early diagnosis of cancer.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDetection of miRNA-21 in the human serum of healthy volunteers using the developed sensor (n\u0026thinsp;=\u0026thinsp;4).\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"12\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e\u003cp\u003eDNA immobilized Ni-doped ZnO/GCE\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"5\" nameend=\"c9\" namest=\"c5\"\u003e\u003cp\u003eHuman microRNA-21ELISA Kit\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c12\" namest=\"c10\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVolunteer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003eSpiked miRNA-21 (nM)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eDetected miRNA-21 (nM)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eRecovery (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u003cp\u003eRSD (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eDetected miRNA-21 (nM)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c9\"\u003e\u003cp\u003eRecovery (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c10\"\u003e\u003cp\u003eRSD (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e\u003cp\u003eRelative difference (%)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eV1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003e0.010\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.009\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e90.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u003cp\u003e4.11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.009\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e90.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e4.28\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e\u003cp\u003e0.0000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003e0.100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.098\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e98.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u003cp\u003e3.68\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.099\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e99.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e3.43\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e\u003cp\u003e1.0101\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003e1.000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.992\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e99.20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u003cp\u003e4.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.994\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e99.40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e4.44\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e\u003cp\u003e0.2012\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eV2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003e0.010\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.009\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e90.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u003cp\u003e3.29\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.009\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e90.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e4.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e\u003cp\u003e0.0000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003e0.100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.096\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e96.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u003cp\u003e3.56\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.093\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e93.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e3.49\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e\u003cp\u003e-3.2258\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003e1.000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.997\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e99.70\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u003cp\u003e4.09\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.996\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e99.60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e3.72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e\u003cp\u003e-0.1004\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eIn this work, for the first time, a Ni-doped ZnO nanorods-based electrochemical biosensor was established and it was found to be an efficient biosensor for the sensitive determination of miRNA-21, which is an important miRNA in the diagnosis of lung cancer. The hydrothermally grown Ni-doped ZnO nanorods exhibited a conducting and well-crystallized background, and the introduction of Ni\u0026sup2;⁺ in ZnO structure notably improved electron transfer properties in comparison to pristine ZnO. The follow-up surface derivatizations on the patterned electrode surface, including PDA decoration, glutaraldehyde activation, probe DNA immobilization and BSA blocking, were systematically confirmed by CV, EIS, and DPV measurements, resulting in a sequential increase in charge-transfer resistance and decrease in redox current, which proved the successive construction of the sensing interface. The resulting sensor had a low LOD of 21.30 fM and the linear dynamic range of detection was 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e nM to 10\u003csup\u003e5\u003c/sup\u003e nM, indicating high sensitivity and reproducibility. Additionally, recovery tests performed with human serum samples demonstrated that the developed biosensor was suitable for use in complicated biological specimens, with acceptable recovery results within an acceptable analytical range. As opposed to traditional electrodes, the Ni-doped ZnO biosensor has many merits in electron transfer, easy immobilization and could be adapted to the miRNA circulatory detection without amplification or labeling. These unique advantages have rendered the platform as a promising strategy for early diagnosis of non-small cell lung cancer by less-invasive analysis of serum samples. Moreover, besides lung cancer detection, the modular design of biosensor may be readily adapted for other clinically significant miRNAs or nucleic acid biomarkers, by designing a new capture probe sequence. Further works will need to explore the combination of this biosensing approach with portable/smartphone readout device together with multiplexing capability and to validate with larger size of clinical samples to facilitate their translation as point of care tool. In summary, the Ni-doped ZnO nanorod-based biosensor is a sensitive, selective, low-cost and clinically relevant platform, and has great potential to develop the cancer miRNA diagnosis area.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThe authors did not receive support from any organization for the submitted work.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eY.F. and X.W. conceived and designed the study. B.J. and Z.Y. carried out the experiments and data collection. B.Z. assisted with materials preparation and characterization. H.L. and X.W. supervised the project and provided critical revisions. All authors discussed the results, contributed to manuscript preparation, and approved the final version.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRanganathan K, Sivasankar V (2014) MicroRNAs - Biology and clinical applications. J Oral Maxillofac Pathol 18:229\u0026ndash;234\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eO'Brien J, Hayder H, Zayed Y, Peng C (2018) Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front Endocrinol (Lausanne) 9:402\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOtmani K, Lewalle P (2021) Tumor Suppressor miRNA in Cancer Cells and the Tumor Microenvironment: Mechanism of Deregulation and Clinical Implications. Front Oncol 11:708765\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang W, Li X, Liu C, Zhang X, Wu Y, Diao M, Tan S, Huang S, Cheng Y, You T (2022) MicroRNA-21 as a diagnostic and prognostic biomarker of lung cancer: a systematic review and meta-analysis. Biosci Rep 42\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOuyang T, Liu Z, Han Z, Ge Q (2019) MicroRNA Detection Specificity: Recent Advances and Future Perspective. Anal Chem 91:3179\u0026ndash;3186\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang S, Rothman RE (2004) PCR-based diagnostics for infectious diseases: uses, limitations, and future applications in acute-care settings. Lancet Infect Dis 4:337\u0026ndash;348\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGhosh R, Gilda JE, Gomes AV (2014) The necessity of and strategies for improving confidence in the accuracy of western blots. Expert Rev Proteom 11:549\u0026ndash;560\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBelivani Ardakani A, Nayeri M, Nasirizadeh N, Ostovari F, Seifati SM (2025) Development of an electrochemical biosensor based on MoSe2 nanoparticles and AuNPs modified silicon wafer for measuring lung cancer biomarker, miR-21. Microchem J 213:113805\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMeng F, Yu W, Chen C, Guo S, Tian X, Miao Y, Ma L, Zhang X, Yu Y, Huang L, Qian K, Wang J (2022) A Versatile Electrochemical Biosensor for the Detection of Circulating MicroRNA toward Non-Small Cell Lung Cancer Diagnosis. Small 18:2200784\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCimmino W, Migliorelli D, Singh S, Miglione A, Generelli S, Cinti S (2023) Design of a printed electrochemical strip towards miRNA-21 detection in urine samples: optimization of the experimental procedures for real sample application. Anal Bioanal Chem 415:4511\u0026ndash;4520\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShao H, Xue X, Sun Z, Zheng X, Shi P (2025) Detection of microRNA-21 based on smartly designed ratiometric electrochemical sensor and dual-signal amplification. Anal Chim Acta 1336:343444\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSavari R, Fakhar O, Rouhi J (2025) An electrochemical sensor based on ZnO\u0026ndash;CuO nanocomposites for vancomycin detection in food samples. Ceram Int 51:22266\u0026ndash;22276\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAnjum S, Hashim M, Malik SA, Khan M, Lorenzo JM, Abbasi BH, Hano C (2021) Recent Advances in Zinc Oxide Nanoparticles (ZnO NPs) for Cancer Diagnosis, Target Drug Delivery, and Treatment. Cancers (Basel) 13\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRodrigues J, Pereira SO, Zanoni J, Rodrigues C, Br\u0026aacute;s M, Costa FM, Monteiro T (2022) ZnO Transducers for Photoluminescence-Based Biosensors: A Review. Chemosensors 10:39\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang H, Feng B, Chen Y, Jin P, Ruan R, Xu B, Zheng Z, Zhou G, Zhang Y, Wang K, Zhong Y, Fan Y (2025) Study on the Influence Mechanism of Alkaline Earth Element Doping on the Thermoelectric Properties of ZnO. Micromachines 16:850\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKholtobina AS, Kovaleva EA, Melchakova J, Ovchinnikov SG, Kuzubov AA (2021) Theoretical Investigation of the Prospect to Tailor ZnO Electronic Properties with VP Thin Films. Nanomaterials 11:1412\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBasri SH, Majid WHA, Talik NA, Sarjidan MAM (2018) Tailoring electronics structure, electrical and magnetic properties of synthesized transition metal (Ni)-doped ZnO thin film. J Alloys Compd 769:640\u0026ndash;648\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAnandan M, Dinesh S, Christopher B, Krishnakumar N, Krishnamurthy B, Ayyar M (2024) Multifaceted investigations of co-precipitated Ni-doped ZnO nanoparticles: Systematic study on structural integrity, optical interplay and photocatalytic performances. Physica B 674:415597\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheng C, Xu G, Zhang H, Luo Y (2008) Hydrothermal synthesis Ni-doped ZnO nanorods with room-temperature ferromagnetism. Mater Lett 62:1617\u0026ndash;1620\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFedorenko V, Damberga D, Grundsteins K, Ramanavicius A, Ramanavicius S, Coy E, Iatsunskyi I, Viter R (2021) Application of Polydopamine Functionalized Zinc Oxide for Glucose Biosensor Design. Polymers 13:2918\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu Z, Wang T, Liu J (2022) Recent Development of Polydopamine Anti-Bacterial Nanomaterials. Int J Mol Sci 23:7278\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Geng X, Ai J, Gao Q, Qi H, Zhang C (2015) Signal amplification detection of DNA using a sensor fabricated by one-step covalent immobilization of amino-terminated probe DNA onto the polydopamine-modified screen-printed carbon electrode. Sens Actuators B 221:1535\u0026ndash;1541\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJeyachandran YL, Mielczarski JA, Mielczarski E, Rai B (2010) Efficiency of blocking of non-specific interaction of different proteins by BSA adsorbed on hydrophobic and hydrophilic surfaces. J Colloid Interface Sci 341:136\u0026ndash;142\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbood I (2017) Structural, Optical and magnetic properties of Ni-Doped ZnO synthesized by Co-precipitation method (2017) J Nanotechnol Material Sci 4 (1): 1\u0026ndash;8. J. Nanotech Mater Sci. 4:1\u0026ndash;8\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eElhamdi I, Souissi H, Taktak O, Elghoul J, Kammoun S, Dhahri E, Costa BFO (2022) Experimental and modeling study of ZnO:Ni nanoparticles for near-infrared light emitting diodes. RSC Adv 12:13074\u0026ndash;13086\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSavaloni H, Savari R (2018) Nano-structural variations of ZnO:N thin films as a function of deposition angle and annealing conditions: XRD, AFM, FESEM and EDS analyses. Mater Chem Phys 214:402\u0026ndash;420\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSivaKarthik P, Thangaraj V, Kumaresan S, Vallalperuman K (2017) Comparative study of Co and Ni substituted ZnO nanoparticles: synthesis, structural, optical and photocatalytic activity. J Mater Sci: Mater Electron 28:10582\u0026ndash;10588\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eViter R, Fedorenko V, Gabriunaite I, Tepliakova I, Ramanavicius S, Holubnycha V, Ramanavicius A, Valiūnienė A (2023) Electrochemical and Optical Properties of Fluorine Doped Tin Oxide Modified by ZnO Nanorods and Polydopamine. Chemosensors 11:106\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChang MC, Tanaka J (2002) FT-IR study for hydroxyapatite/collagen nanocomposite cross-linked by glutaraldehyde. Biomaterials 23:4811\u0026ndash;4818\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSerec K, Šegedin N, Krajačić M, Dolanski Babić S (2021) Conformational Transitions of Double-Stranded DNA in Thin Films. Appl Sci 11:2360\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlhazmi HA, Al Bratty M, Meraya AM, Najmi A, Alam MS, Javed SA, Ahsan W (2021) Spectroscopic characterization of the interactions of bovine serum albumin with medicinally important metal ions: platinum (IV), iridium (III) and iron (II). Acta Biochim Pol 68:99\u0026ndash;107\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHyun DE, Choi JC, Kim YH, Ra Y, Sim JS, Lee JK, Kang YC (2025) Electrodeposited ZnO/Zn (OH) 2 Nanosheets as a Functional Interface for Dendrite-Free Lithium Metal Anodes. Small 2503607.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYildiz A, Kayhan B, Yurduguzel B, Rambu AP, Iacomi F, Simon S (2011) Ni doping effect on electrical conductivity of ZnO nanocrystalline thin films. J Mater Sci: Mater Electron 22:1473\u0026ndash;1478\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeck MA, Langell MA (2012) Comparison of Nanoscaled and Bulk NiO Structural and Environmental Characteristics by XRD, XAFS, and XPS. Chem Mater 24:4483\u0026ndash;4490\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Q, Zhao X, Duan L, Shen H, Liu R, Hou T (2020) Optical and photocatalytic properties of a ZnO@C core/shell sphere with rich oxygen vacancies. CrystEngComm 22:5245\u0026ndash;5254\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChang F-M, Brahma S, Huang J-H, Wu Z-Z, Lo K-Y (2019) Strong correlation between optical properties and mechanism in deficiency of normalized self-assembly ZnO nanorods. Sci Rep 9:905\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJagadish R, Yellappa S, Mahanthappa M, Chandrasekhar KB (2017) Zinc Oxide Nanoparticle-modified Glassy Carbon Electrode as a Highly Sensitive Electrochemical Sensor for the Detection of Caffeine. J Chin Chem Soc 64:813\u0026ndash;821\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e\u0026Uuml;zar N, Abdulaziz U, Erbas OG, Aydin M, Dolgun MF (2024) Enhancement of structural, optical, electrical, optoelectronic and thermoelectric properties of ZnO thin film via Ni doping and Ni-B co-doping. Phys Scr 99:075995\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang B-C, Yang S-H (2021) Nickel-Doped ZnO Nanowalls with Enhanced Electron Transport Ability for Electrochemical Water Splitting. Nanomaterials 11:1980\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGao B, Su L, Tong Y, Guan M, Zhang X (2014) Ion permeability of polydopamine films revealed using a prussian blue-based electrochemical method. J Phys Chem B 118:12781\u0026ndash;12787\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eL\u0026oacute;pez-Gallego F, Betancor L, Mateo C, Hidalgo A, Alonso-Morales N, Dellamora-Ortiz G, Guis\u0026aacute;n JM, Fern\u0026aacute;ndez-Lafuente R (2005) Enzyme stabilization by glutaraldehyde crosslinking of adsorbed proteins on aminated supports. J Biotechnol 119:70\u0026ndash;75\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao W-W, Xu J-J, Chen H-Y (2014) Photoelectrochemical DNA Biosensors. Chem Rev 114:7421\u0026ndash;7441\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThapa K, Liu W, Wang R (2022) Nucleic acid-based electrochemical biosensor: Recent advances in probe immobilization and signal amplification strategies. WIREs Nanomed Nanobiotechnol 14:e1765\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePark JH, Sut TN, Jackman JA, Ferhan AR, Yoon BK, Cho N-J (2017) Controlling adsorption and passivation properties of bovine serum albumin on silica surfaces by ionic strength modulation and cross-linking. Phys Chem Chem Phys 19:8854\u0026ndash;8865\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCalvo-Lozano O, Garc\u0026iacute;a-Aparicio P, Raduly L-Z, Est\u0026eacute;vez MC, Berindan-Neagoe I, Ferracin M, Lechuga LM (2022) One-Step and Real-Time Detection of microRNA-21 in Human Samples for Lung Cancer Biosensing Diagnosis. Anal Chem 94:14659\u0026ndash;14665\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShin Low S, Pan Y, Ji D, Li Y, Lu Y, He Y, Chen Q, Liu Q (2020) Smartphone-based portable electrochemical biosensing system for detection of circulating microRNA-21 in saliva as a proof-of-concept. Sens Actuators B 308:127718\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSabahi A, Salahandish R, Ghaffarinejad A, Omidinia E (2020) Electrochemical nano-genosensor for highly sensitive detection of miR-21 biomarker based on SWCNT-grafted dendritic Au nanostructure for early detection of prostate cancer. Talanta 209:120595\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu S, Su W, Li Y, Zhang L, Ding X (2018) Manufacturing of an electrochemical biosensing platform based on hybrid DNA hydrogel: Taking lung cancer-specific miR-21 as an example. Biosens Bioelectron 103:1\u0026ndash;5\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhodadoust A, Nasirizadeh N, Seyfati SM, Taheri RA, Ghanei M, Bagheri H (2023) High-performance strategy for the construction of electrochemical biosensor for simultaneous detection of miRNA-141 and miRNA-21 as lung cancer biomarkers. Talanta 252:123863\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKilic T, Erdem A, Erac Y, Seydibeyoglu MO, Okur S, Ozsoz M (2015) Electrochemical Detection of a Cancer Biomarker mir-21 in Cell Lysates Using Graphene Modified Sensors. Electroanalysis 27:317\u0026ndash;326\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"microchimica-acta","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"miac","sideBox":"Learn more about [Microchimica Acta](https://link.springer.com/journal/604)","snPcode":"604","submissionUrl":"https://submission.springernature.com/new-submission/604/3","title":"Microchimica Acta","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"miRNA-21, Circulating microRNA, Ni-doped ZnO nanorods, Electrochemical biosensor, Human serum, Lung Cancer biomarker","lastPublishedDoi":"10.21203/rs.3.rs-7608116/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7608116/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCirculatory miRNA-21 has shown promise as a stable and non-invasive biomarker for early diagnosis of cancer and is highly correlated with non-small cell lung cancer. In this study, a new kind of electrochemical biosensor was fabricated using the Ni-doped ZnO nanorods directly grown onto the surface of a glassy carbon electrode (GCE) for your sensitive and selective detection of miR-21. On the modified electrode surface: polydopamine (PDA) and crosslinked with glutaraldehyde, DNA probes were immobilized using the electrostatic attraction between a phosphate group and the PDA, and then treated with a solution of bovine serum albumin (BSA) to ensure that any unbound surfaces were saturated, thus preventing non-specific interactions. Electrochemical analyses were adopted to systematically investigate the progresses of the stepwise electrode modification and the hybridization. With the increasing of self-discharge time of the laser etched carbon-paste electrode The response to current gradually drop and the charge-transfer resistance increase, which indicates that the sensing interface has been successfully assembled. Following optimization, the biosensor was capable of detecting concentrations as low as 21.30 fM with dynamic linear range of 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e nM to 10\u003csup\u003e5\u003c/sup\u003e nM, good reproducibility and selectivity to the mismatch and non-complementary sequences. Crucially, recovery experiments in spiked human serum samples gave satisfactory results, confirming the clinical potential of the system. In general, the Ni doped ZnO nanorod-based biosensor provides sensitive, label-free, and low-cost detection of circulating miRNAs. Its modularity allows for simple conversion for detection of other nucleic acid-based biomarkers, implicating it as a useful diagnostic tool for early cancer diagnosis and point-of-care screening.\u003c/p\u003e","manuscriptTitle":"Development of electrochemical biosensor based on Ni-doped ZnO nanorods for detecting miRNA-21 lung cancer biomarker","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-03 12:58:01","doi":"10.21203/rs.3.rs-7608116/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-16T16:48:14+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-16T14:47:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"101914546898976199739266062362838206100","date":"2025-09-24T11:15:07+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-23T05:36:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"170089849516724382871057934286661532021","date":"2025-09-23T04:21:53+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"65789190077923022501232197227104807990","date":"2025-09-22T18:33:18+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-22T12:59:12+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-16T23:34:27+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-16T23:34:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"Microchimica Acta","date":"2025-09-13T14:49:06+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"microchimica-acta","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"miac","sideBox":"Learn more about [Microchimica Acta](https://link.springer.com/journal/604)","snPcode":"604","submissionUrl":"https://submission.springernature.com/new-submission/604/3","title":"Microchimica Acta","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"fbbd5bfd-caee-465f-87e6-eea26bf73671","owner":[],"postedDate":"October 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-12-29T15:59:08+00:00","versionOfRecord":{"articleIdentity":"rs-7608116","link":"https://doi.org/10.1007/s00604-025-07709-6","journal":{"identity":"microchimica-acta","isVorOnly":false,"title":"Microchimica Acta"},"publishedOn":"2025-12-23 15:57:04","publishedOnDateReadable":"December 23rd, 2025"},"versionCreatedAt":"2025-10-03 12:58:01","video":"","vorDoi":"10.1007/s00604-025-07709-6","vorDoiUrl":"https://doi.org/10.1007/s00604-025-07709-6","workflowStages":[]},"version":"v1","identity":"rs-7608116","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7608116","identity":"rs-7608116","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}