The Proliferation Regulation Role of 17β-Estradiol-Induced miR-16-5p in Mouse Thymic Epithelial Cells

The Proliferation Regulation Role of 17β-Estradiol-Induced miR-16-5p in Mouse Thymic Epithelial Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Proliferation Regulation Role of 17β-Estradiol-Induced miR-16-5p in Mouse Thymic Epithelial Cells Dongguang Guo, Mingyan Chen, Jinhe Tian, Yaojia He, Yugu Li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3618025/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract To investigate the proliferation regulation role of 17β-Estradiol(E2)-induced miR-16-5p in mouse thymic epithelial cells. The miRNA expression profiles in the 50 nmo/L E2 treated MTEC1 cells were determined by high-throughput sequencing. Then the significantly upregulated miRNA expression that responsive to E2 was screened and validated. Subsequently, the proliferation functions and mechanism of screened miRNA were analyzed in MTEC1 cells. MiR-16-5p was found that significantly upregulated and had “high” levels of of expression among the 36 upregulation miRNAs, which were significantly induced by 50 nmol/L E2. Transfection assays showed that overexpression of miR-16-5p reduced cell viability, suppressed cell proliferation, and induced cell cycle arrest at the G0/G1 phase in MTEC1 cells. Results from further analysis confirmed CCND1 and Igfbp3 as the target genes of miR-16-5p, and that the effects of Igfbp3 knockdown were similar to those of miR-16-5p overexpression in MTEC1 cells. Moreover, it is similar to the roles of E2 affect MTEC1 cells proliferation, a significant up-regulation trend of miR-16-5p expression levels in MTEC1 cells was observed from 25 nmol/L to 50 nmol/L E2 after treatment for 6 h, 12 h, 24 h, and 48 h, respectively. This data indicated that the expression of miR-16-5p is an E2-responsive miRNA in MTEC1 cells, and also provided evidence that miR-16-5p has a proliferation role in MTEC1 cells proliferation. Suggests that E2 may affect thymic thymus involution by regulating the expression of miRNA in TECs. miR-16-5p 17β-Estradiol TECs cell proliferation thymus involution Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The thymus is the primary central lymphoid organ that plays a critical role in the cellular immune response[ 1 ]. However, during aging, the thymus undergoes progressive involution or atrophy. In addition to the morphological changes and a reduction in thymic mass, it also exhibits a significantly decreased ability to produce new T cells and a decline of immune function[ 2 – 5 ]. Thymic epithelial cells (TECs) are an indispensable part of the stromal compartment and can provide a unique microenvironment and signals for various stages of T-cell development[ 6 – 9 ]. There is now a lot of evidence suggesting that age-related thymic involution is tightly associated with the microenvironment changes and dysfunction of the thymic microenvironment cells[ 10 – 14 ]. Therefore, as the predominant component of the thymic microenvironment, TECs are essential factors for aging-related thymus involution [ 2 , 15 – 17 ]. Dysregulation of sex hormones has been considered as one of the most important factors causes of age-related thymus involution[ 18 ]. As one of the female sex hormones, estrogen (17β-Estradiol, E2), can produce several biological effects through binding to the estrogen receptors (ER) α and β[ 19 ]. Evidence from animal studies indicated that E2 has significant immune modulatory properties, including induction of thymic involution[ 20 ]. High levels of E2 in mice thymus were shown that can induce thymic involution via reduction of thymocyte cellularity, inhibit thymocyte proliferation, and depletion of early thymic progenitors[ 21 , 22 ]. On the other hand, there is evidence demonstrating that E2 mediated transcriptional regulation of genes involved in the control of cell proliferation and survival in TECs[ 23 ]. These indicated that E2 has a crucial role in regulating thymus involution. MicroRNAs (miRNAs) are a class of small, non-coding RNAs that play an important role in gene regulation by targeting the 3′UTR [ 24 ]. Findings from several studies indicate that miRNAs network as a novel pathway plays an important role as regulators in thymus involution and are closely correlated with TEC proliferation[ 25 – 30 ]. Particularly important is the connection between E2 signaling and epigenetic regulation are crucial regulatory mechanisms for thymus development, their interaction in cells has been reported to increase the level of cell-specificity and fine-tuning of transcriptional regulation[ 26 , 31 ]. However, the link of E2 in miRNA expression in TECs remains unclear. Our previous results showed that 50 nmol/L E2 has an inhibitory effect on cell proliferation[ 32 ]. However, the significantly changed miRNA in MTEC1 cells after treatment with E2 remains ambiguous. In this study, the miRNA expression profiles were obtained by high throughput sequencing, based on the sequencing results, we provided evidence that the E2-responsive miRNA, miR-16-5p, which is not only E2-responsive miRNA but also a functional miRNA for the proliferation of TECs, provide new insights for further explore the E2 functional TECs and thymus involution. Materials and methods Cell lines and cell culture Murine thymic epithelial cell line 1(MTEC1) cell was obtained from Peking University Health Science Center (Beijing, China). Human embryonic kidney 293T (HEK-293T) cell was obtained from the American Type Culture Collection (Manassas, USA). Both MTEC1 and HEK-293T cells were cultured in complete Dulbecco's Modified Eagle Medium (DMEM) (Gibco, Grand Island, USA) containing 10% fetal bovine serum (FBS) (Gibco) in a humidified atmosphere containing 5% CO 2 at 37°C. Hormone treatment Hormone treatment in MTEC1 cells was performed according to a previously described method[ 32 ]. Briefly, MTEC1 cells were seeded in a 6-well plate and cultured in a DMEM growth medium containing 10% FBS. Once the confluence of MTEC1 cells reached 70%~80%, the cells were starved for 24 h by replacing the growth medium with DMEM containing only 2%(v/v) FBS. Subsequently, the cells were then treated with different concentrations(1 nmol/L, 10 nmol/L, 25 nmol/L, 50 nmol/L) of 17β-Estradiol (E2, Sigma, St Louis, MO) in DMEM with 2% (v/v) FBS for a different time(6 h, 12 h, 24 h, 48 h). Cells that were treated with only ethanol in the same growth medium served as a control group. All the experiments were done in triplicate. High-throughput sequencing Cells from the treatment and control group were collected at 24 h and used for small RNA sequencing experiments. Total Ribonucleic acid (RNA) was extracted from each pool, corresponding to the six sample groups, treatment group, and control samples. These six samples were labeled E2-1, E2-2, E2-3, C-1, C-2, and C-3. For the six transcriptome library constructions, the RNA preparation, library construction, and single-end sequencing (36 bp) were performed on an Illumina Hiseq2500 at the LC-BIO (Hangzhou, China) following the vendor`s recommended protocol. Differential miRNA expression based on normalized deep-sequencing counts was analyzed using the Fisher exact test and Student t-test based on the design of the experiment. The significance threshold was set to be 0.01 and 0.05 in each test. RNA oligonucleotides and cell transfection The miR-16-5p mimic, mimic NC, miR-16-5p inhibitor, inhibitor NC, RNA- Igfbp3 (si Igfbp3 ) or RNA-NC(siRNA - NC) were designed and synthesized by RiboBio Co., Ltd (Guangzhou, China). Sequences of miR-16-5p mimic(catalog number: miR10000527-1-5), inhibitor (catalog number: miR20000527-1-5), si Igfbp3-001 (catalog number: siG2012210538377126), si Igfbp3-002 (catalog number: siG2012210538378218) and si Igfbp3-003 (catalog number: siG2012210538379310) are shown in Table 1 . But mimic-NC (catalog number: miR1N0000001-1-5), inhibitor-NC (catalog number: miR2N0000001-1-5), and si Igfbp3 NCs (catalog number: siN0000001-1-5) were confidentiality designed by RiboBio. To study gene function in the cellular environment, transfection studies were done one day before transfection, MTEC1 or HEK-293T cells were plated in the appropriate culture dish. When the plated cells reached approximately 60%~70% confluence, the oligonucleotides [50 nmol/Lmimic or mimic-NC, and 100 nmol/L inhibitors or inhibitor-NC], RNA- Igfbp3 (si Igfbp3 ), or siRNA-NC were transfected into cultured cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instruction. Table 1 Sequence of miRNA oligonucleotides used in the study Name Sequence (5′-3′) Type miR-16-5p mimic UAGCAGCACGUAAAUAUUGGCG Double-stranded RNA miR-16-5p inhibitor CGCCAAUAUUUACGUGCUGCUA Double-stranded RNA si Igfbp3 -001 GCTACAAAGTTGACTATGA Double stranded RNA si Igfbp3 -002 GCTACAAAGTTGACTATGA Double stranded RNA si Igfbp3 -003 GCTACAAAGTTGACTATGA Double stranded RNA Quantitative polymerase chain reaction (qPCR) Total RNAs were extracted from MTEC1 cells using TRIZOL (Takara, Kusatsu, Japan). Complementary Deoxyribonucleic acid (cDNA) was synthesized using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) following the manufacturer’s instructions. qPCR was performed with SYBR Green real-time PCR Master Mix (Toyobo). For measuring the expression of miRNAs in MTEC1 cells, the bulge-loop miRNA qRT-PCR Primer Sets (including one reverse transcription primer and a pair of quantitative PCR primers) specific for miR-16-5p and miR-22-3p were confidentiality designed by RiboBio (Guangzhou, China). As shown in Table 2 , the relative gene primers for messenger RNA (mRNA) were designed by the Primer Premier 5.0 software according to the published genome sequences. β-actin and U6 were used to normalize the relative abundance of mRNA and miRNA, respectively. Bio-Rad CFX96 Real-Time PCR system (Bio-Rad, Hercules, USA) was used to perform qPCR analysis. The relative expression level of each gene was calculated from three different experiments and was determined using the 2 −ΔΔCT method. All experiments were repeated at least three times. Table 2 Primer sequences are used for a reverse transcription-quantitative polymerase chain reaction. Gene Accession No. Primer sequence (5′-3′) Size (bp) Igf1 NM_ 017313812.3 F: TTGTGGATGAGTGTTGCTT 165 R: GCTTCGTTTTCTTGTTTGTC Igfbp3 NM_ 011243665.3 F: AGTGACCGATTCCAAGTTC 185 R: GTGTGTCCTCCATTTCTCTG Ctgf NM_ 010217.2 F: TCATCAAGACCTGTGCCT 118 R: TTCGTGTCCCTTACTTCCT Dusp3 NM_ 028207.3 F: GTGAGGCAGAATCGTGAG 100 R: CCTAGAGTTTCACCTTGCC CCND1 001379248.1 F: AGGCGGATGAGAACAAGCAGAC 175 R: CGGTAGCAGGAGAGGAAGTTG CCNE1 NM_ 007633.2 F: GCGTCTAAGCCCTCTGACCATTG 191 R: CAGAAGCAGCGAGGACACCATAAG Rarg NM_ 006520650.1 F: GATGGCTTCTCTCTCGGTGG 153 R: TCACAGGAGCTGACCCCATA Kmt2a NM_036154819.1 F: GGCCCTGTTGAATTCTCGGA 110 R: GGGAGCTTCGGGAAGGTATG Rapgef2 NM_ 030252869.2 F: TGCGAGAGAGCCAAATCTCC 97 R: GGCTCAATGTTGCGGAAGAG Trim35 NM_ 029979.3 F: GAGTGTGAGGAGGGTGAG 147 R: GCAGATACGCAGAGGTTC β-actin NM_007393 F: CATCCGTAAAGACCTCTATGCCAACC 171 R: ATGGAGCCACCGATCCACA Western blot analysis To obtain total proteins, cultured MTEC1 cells were lysed in Radio immunoprecipitation assay (RIPA) buffer [50 mMTris-HCl, pH 8.0, 250 mM NaCl, 1% NP40, 0.5% (w/v) sodium deoxycholate, and 0.1% sodium dodecylsulfate] (Beyotime, Nanjing, China) supplemented with protease and phosphatase inhibitor mixture(Sigma-Aldrich) and vortexed briefly. After centrifugation at 15,000 g for 15 min at 4°C, the protein sample was collected and the concentration was determined using the BCA kit (Beyotime). Sample buffer was used to dilute the lysates, once the proteins (20 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to polyvinylidene fluoride membranes (PVDF) (Millipore, Billerica, USA). After blocking with skimmed milk, the blots were incubated overnight at 4°C with mouse monoclonal antibodies, including anti-CCND1, anti-Igfbp3, and anti-GAPDH monoclonal antibodies. All these antibodies used were obtained from Santa Cruz Biotech (Santa Cruz, USA). The membranes were then washed and incubated with horseradish peroxidase-conjugated goat anti-mouse secondary antibodies (Santa Cruz) at 37°C for 90 min and then developed with BeyoECL Plus kit (Beyotime). Cell viability assay MTEC1 cells were seeded in a 96-well plate at a density of 2 ~ 5×10 3 cells per well and transfected with miR-16-5p mimic, miR-16-5p inhibitor, or miR-NC. Cell viability was analyzed at the indicated time points (24 h, 48 h, and 72 h) using the cell-counting kit-8 (CCK-8) regents (Beyotime) according to the manufacturer's instructions. Cell cycle assay MTEC1 cells were cultured in DMEM with 10% FBS at 48 h after transfection and then fixed with 70% ethanol overnight at − 20°C for 24 h. The cell cycle assay was determined using the Cell Cycle Analysis Kit (Beyotime) with a flow cytometer (BD Biosciences, San Jose, USA) and data was analyzed with Flow J (version 10) software. Cell apoptosis assay At 48 h after transfection, the cell apoptosis rate was quantified by gating propidium iodide and Annexin V-positive cells on a fluorescence-activated cell-sorting flow cytometer (BD Biosciences) according to the instructions of the Apoptosis and Necrosis Assay Kit (Kaiji, Nanjing, China). 5-ethynyl-20-deoxyuridine (EdU) assays MTEC1 cells seeded in 24-well plates were cultured to 50% density and then transfected. 48 h after transfection with mimics, inhibitors, or siRNAs. The cells were then fixed in 4% polyformaldehyde (PFA) at room temperature for 1 h. Subsequently, the cells were incubated with 0.5% Triton X-100 for 15 min. Finally, cells were stained by Cell-Light™EdU Cell Proliferation Detection Assay (RiboBio, Guangzhou, China) according to the operating instructions. The ratio of proliferative cells was calculated by the ratio of EdU-positive cells to Hoechst-positive cells[ 33 ]. The assay was performed in three biological replicates. Determination of Target Gene Bioinformatics prediction software [miRBase ( http://www.mirbase.org/ ), TargetScan ( http://www.targetscan.org/ ), and PicTar ( http://pictar.mdc-berlin.de/ )] were used to select candidate targets of miR-16-5p. Combined with the data on mRNA expression analyses from our previously published microarray data[ 32 ]. The potential targets that involved in cell proliferation, including CCND1 , CCNE1 , Insulin growth factor-I (Igf1) (5.00E-05), Insulin-like growth factor-binding protein 3 ( Igfbp3 ) (5.00E-05), Retinoic acid receptor gamma (Rarg) (2.90E-03), Lysine (K)-specific methyltransferase 2A (Kmt2a) (3.95E-02), Tripartite motif-containing 35( Trim35 ) (6.50E-04), Rap guanine nucleotide exchange factor (GEF) ( Rapgef2 ) (8.00E-04), Ctgf (5.00E-05), and dual-specificity phosphatase 3 ( Dusp3 ) (5.00E-05) were chosen as valid targets of miR-16-5p due to their expression levels was significantly downregulated as compared with the expression miR-16-5p in the 50 nmol/L E2 treated MTEC1 cells. Plasmids construction For the pmirGLO dual-luciferase miRNA target reporter vector, the 3′-untranslated regions (3′-UTRs) of CCND1 and Igfbp3 contained putative target sites of miR-16-5p were amplified by PCR from genomic DNA. The PCR products were then cloned between Sac Ⅰ and Sal Ⅰ sites of the luciferase reporter vector pmiRGLO (Promega, Madison, USA). The primer sequences of the CCND1 3′-UTR (NCBI reference sequence: NM_007631.2) (positions 1731 ~ 1737 bp and 1808 ~ 1814 bp) were as follows: forward, 5′-CGAGCTCGCCTTTCTATTAGGACTT-3′, and reverse, 5′-GCGTCGACAGCATGACAGGACGAT-3′, and the primer sequences of the Igfbp3 3′-UTR (NCBI reference sequence: XM_011243665.3) (positions 360 ~ 366 bp) were as follows: forward, 5′-CGAGCTCAAAAGACTGCCAACAAC-3′ and reverse 5′-GCGTCGACCACAGTTCCCAAGTAGAT-3′. The mutant (MUT) CCND1 and Igfbp3 3′-UTR plasmids were generated using the QuickChange® Mutagenesis kit (Stratagene) according to the manufacturer’s specifications. Both seed sequences for CCND1 were mutated from ‘GCUGCUA’ to ‘AUUUCGC’, and the seed sequences for Igfbp3 were mutated from ‘UGCUGCU’ to ‘ACGUCGU’ respectively. Dual-luciferase reporter assay The pmiRGLO- CCND1 -3′UTR (WT/MUT) and pmiRGLO -Igfbp3 -3′UTR (WT/MUT) plasmid (400 ng) with miR-16-5p mimic or mimic-NC were co-transfected into HEK-293T cells using Lipofectamine 3000 (Invitrogen) as per the manufacturer’s recommendation. The dual-luciferase activity was analyzed at 48 h after transfection using the Dual-luciferase Reporter Assay System (Promega, Madison, USA) as per the manufacturer's instructions. Luciferase activity was calculated as the ratio of Firefly to Renilla and each experiment was performed in triplicate. Statistical analysis All experiments were performed in triplicate and repeated at least three times. All data were represented as the mean ± SD. The statistical analysis was performed by using Student's t-test to determine the significant differences using commercial software (SPSS 17; SPSS, Chicago, USA). A value of p < 0.05 was deemed statistically significant. Results miRNA expression profiles in E2-treated MTEC1 cells To examine the expression profile of miRNAs in MTEC1 cells after E2 treatment, the MTEC1 cells were exposed to 50 nmol/L E2 for 24 h, then a miRNA high throughput sequencing analysis was performed, and a total of 4820 mature miRNA sequences were analyzed, 3356 were detected in all experimental groups. Of these, as shown in Fig. 1 a, 69 miRNA expressions were found that significantly differentially expressed using a cut-off with adjusted p values of < 0.05, including 36 downregulated and 33 upregulated miRNAs. Interestingly, we found that only two miRNAs expression, miR-16-5p and miR-22-3p, have “high” levels of expression among the 36 upregulation miRNAs which are significantly induced by E2. Next, we verified the expression level of miR-16-5p and miR-22-3p by qPCR. As shown in Fig. 1 b, consistent with the results of high throughput sequencing analysis, miR-16-5p (p < 0.05) and miR-22-3p(p < 0.05) was notably upregulated in MTEC1 cells following 50 nmol/L E2. Therefore, we speculated that both miR-16-5p and miR-22-3p may play a significant role in this process. Effects of miR-16-5p on MTEC1 cells viability and apoptosis To test our hypothesis, the mimics and inhibitors of miR-16-5p and miR-22-3p, or mimic-NC and inhibitor-NC were transfected into MTEC1 for gain- or loss-of-function experiments, respectively. As shown in Fig. 2 a and b , both miR-16-5p and miR-22-3p were found to be significantly up-regulated after transfected with mimics (p < 0.001, p < 0.001), and significantly down-regulated after transfected with miR-16-5p or miR-22-3p inhibitor(p < 0.001, p < 0.001). Further, CCK-8 assays were performed to evaluate the effect of miR-16-5p and miR-22-3p in MTEC1 cells. We found that overexpression of miR-16-5p in MTEC1 cells significantly inhibited cell viability at 48 and 72 h (p < 0.01, p < 0.001) after transfection, as compared with the control group ( Fig. 2 c). As expected, the miR-16-5p inhibitor exhibits an opposite effect on MTEC1 cell viability, and transfection of miR-16-5p inhibitor significantly increased cell viability at 48 and 72 h (p < 0.05, p < 0.01) (Fig. 2 d). The effect was inverse with the miR-16-5p mimic group. However, either transfected with miR-22-3p mimic or inhibitor in MTEC1 cells did not show significant effects on cell viability in MTEC1 cells. Besides, the flow cytometric analysis was also used to investigate the effect of miR-16-5p on cell apoptosis. As shown in Fig. 2 e, no obvious change was observed in the miR-16-5p mimic-transfected and miR-16-5p inhibitor-transfected cells. These results indicated that the expression of miR-16-5p did not affect cell apoptosis in MTEC1 cells. Effects of miR-16-5p on cell proliferation To understand how cell viability was decreased by miR-16-5p, the function of miR-16-5p in MTEC1 cells was determined by the EdU incorporation assay. As shown, miR-16-5p significantly decreased the percentage of EdU-positive proliferating cells, while down-regulated miR-16-5p significantly increased the percentage of EdU-positive proliferating cells ( Fig. 3a, b and c ). Consistently, flow cytometry showed that the number of cells was significantly increased in the G1 phase(p < 0.01)but reduced in the S and G2 phase（p < 0.01, p < 0.05） in the miR-16-5p mimic group than in the mimic-NC group（ Fig. 3d and e ）. However, the percentage of cells in the G1 phase was significantly decreased（p < 0.01）, and the percentage of cells in the G2 and S + G2 phase was significantly increased（p < 0.01, p < 0.01）in the miR-16-5p inhibitor group, as compared with the inhibitor-NC group（ Fig. 3d and f ）. Collectively, our data confirmed that elevated expression of miR-16-5p could significantly decrease cell proliferation in MTEC1 cells. Validation of CCND1 and Igfbp3 as the direct target of miR-16-5p To identify the potential targets of miR-16-5p, the CCND1, CCNE1 , and our previous transcriptome sequencing results[ 32 ]showed that the 8 potential targets had significantly lower mRNA expression in E2-treated MTEC1 cells were selected as a candidate to study. To confirm the real targets of miR-16-5p, the mRNA expression levels of these potential targets were measured in miR-16-5p mimic, mimic-NC, miR-16-5p inhibitor, and inhibitor-NC-transfected cells. As shown in Fig. 4 a, the expression levels of CCNE1 (p < 0.05), CCND1 (p < 0.05), Igfbp3 (p < 0.05), and Ctgf (p < 0.05) were substantially decreased when using a miR-16-5p mimic. On the contrary, the expression levels of CCND1 (p < 0.05), Igfbp3 (p < 0.05), and Dusp3 (p < 0.05) were significantly enhanced by a miR-16-5p inhibitor(Fig. 4 b). This indicated that miR-16-5p is likely to mainly target CCND1 and Igfbp3 genes. To further confirm the regulated roles, the western blotting revealed that miR-16-5p mimics downregulated CCND1 and Igfbp3, while miR-16-5p inhibitor upregulated CCND1 and Igfbp3 in MTEC1 cells. This data further suggested that miR-16-5p regulated CCND1 and Igfbp3 at least at the protein level in MTEC1 cells (Fig. 4 c and d ). To validate the above results, two conserved binding seed sequences (1731 ~ 1737 bp, 1808 ~ 1814 bp) in CCND1 3′UTR and a conserved sequence binding seed sequence (360 ~ 366 bp) in Igfbp3 3′UTR were identified by using the miRNA target analysis tools (Fig. 4 e and f ). A luciferase reporter assay was performed to confirm that miR-16-5p directly binds to the 3′-UTR of CCND1 and Igfbp3 in HEK-293T cells. The results showed that overexpression of miR-16-5p significantly reduced luciferase activity of the reporter gene in both wild types(p < 0.001, p < 0.05), but not mutants(Fig. 4 g and h ). This indicated that both CCND1 and Igfbp3 were negatively regulated by miR-16-5p in MTEC1 cells, confirmed CCND1 and Igfbp3 as targets of miR-16-5p. Effects of Igfbp3 knockdown were similar to those of miR-16-5p overexpression in MTEC1 cells To further investigate the role of Igfbp3 in MTEC1 cell function, we designed 3 different small interfering RNA (siRNA) products (si Igfbp3 -001, si Igfbp3 -002, and si Igfbp3 -003) and a scrambled siRNA as the negative control (siRNA-NC). Upon transfection into MTEC1 cells, qPCR and western blot analysis have shown that siI gfbp3 -003 could effectively knock down Igfbp3 expression as compared to the si Igfbp3 -001 and si Igfbp3 -002 in cell lines MTEC1. Thus, si Igfbp3 -003 was used in subsequent experiments (Fig. 5 a and b ). When si Igfbp3-003 was transfected into MTEC1 cells, the EdU assay analysis shown that transfection si Igfbp3-003 in MTEC1 cells significantly decreased (p < 0.01) the percentage of EdU-positive proliferating cells as compared with the siRNA-NC group cells(Fig. 5 c and d ). Consistent with the EdU cell proliferation assay, the cell cycle assay showed that silencing of Igfbp3 can induce cell cycle arrest at the G0/G1 phase in MTEC1 cells as compared with the siRNA-NC transfected group cells(Fig. 5 e and f ). These findings suggested that Igfbp3 affected the MTEC1 cell proliferation, just like that of the overexpression of miR-16-5p. MiR-16-5p is an E2-responsive miRNA in MTEC1 cells To further confirm the associations between E2 and miR-16-5p expression in MTEC1 cells, the expression levels of miR-16-5p were further measured in MTEC1 cells that were treated with E2 at different concentrations and different times. As shown in Fig. 6 , the results showed that miR-16-5p was significantly upregulated at the concentrations of 25 nmol/L, 50 nmol/L after E2 treatment for 6 h(p < 0.05, p < 0.05), 12 h (p < 0.05, p < 0.05), 24 h（p < 0.05, p < 0.05）, and 48 h（p < 0.001, p < 0.001）respectively. These results suggested that miR-16-5p is an E2-responsive miRNA in MTEC1 cells. Discussion It has been reported that miR-16-5p is expressed in various tissues, including the spleen, kidney, liver, pancreas, brain, skin, and skeletal muscle[ 34 – 36 ]. miR-16-5p also is a potential target in human diseases and cancers, which has been reported to be implicated in cell proliferation, apoptosis, and pathophysiology[ 37 ]. However, whether it contributes to the process of TEC proliferation remains unclear. To further test our hypothesis, an investigation was done on whether the overexpression of miR-16-5p has a regulation role in MTEC1 cells. The results of EdU and cell cycle assays revealed that overexpression of miR-16-5p inhibited the proliferation of MTEC1 cells. The results were also consistent with the many previous studies that have shown that miR-16 can modulate the cell cycle and inhibit cell proliferation in many kinds of cells[ 34 – 36 , 38 – 43 ]. CCND1 and CCNE1 is a critical cell cycle genes and a well-known target gene of miR-16-5p involved in many kinds of cell proliferation [ 44 – 47 ]. Furthermore, the most similar to our work is a previous study showed that the expression levels of CCND1 were significantly decreased when upregulated the expression of miR-16-5p in epithelial cells [ 48 , 49 ]. To further clarify the regulatory mechanism roles of miR-16-5p in MTEC1 cell proliferation, using 3´-UTR luciferase reporter assays, the specific binding of miR-16-5p to the 3’-UTR of CCND1 was confirmed. These results suggest that suppressing CCND1 expression in MTEC1 cells proliferation is an important mechanism by which miR-16-5p in MTEC1 cells. Igfbp3 is known to be the most abundant gene expressed in many tissues, it was also classified as a suppressor in regulating cell proliferation[ 50 ]. In addition, E2 was shown to exhibit a significantly inhibited role for Igfbp3 expression [ 51 ]. Here we found that elevated miR-16-5p levels correlated with a lower degree of Igfbp3 mRNA and protein expression in MTEC1 cells. To further analyze the regulatory mechanism of Igfbp3 in MTEC1 cell proliferation, we also found that miR-16-5p negatively regulated Igfbp3 expression via target binding as evidenced by the dual-luciferase reporter assay. This may be another important regulated mechanism that miR-16-5p has a growth-suppressive role in MTEC1 cell proliferation. Furthermore, the proliferation inhibits roles was also observed by EdU and cell cycle assay when knockdown of Igfbp3 in MTEC1 cells. All these results indicated that Igfbp3 is one of the key mediators in MTEC1 cell proliferation, which was coordinately regulated by E2-induced miR-16-5p in the E2-treated MTEC1 cells. On the other hand, to further confirm the associations between E2 and miR-16-5p expression in MTEC1 cells, we also found that miR-16-5p was significantly upregulated gradually in MTEC1 cells from 25 to 50 nmol/L E2 after treatment for 6 h, 12 h, 24 h, and 48 h, respectively. This confirmed that miR-16-5p is an E2-induced miRNA in response to E2-treated MTEC1 cells. In summary, we demonstrated that 50 nmol/L E2 can alter the expression of specific miRNAs in MTEC1 cells, and provide evidence that E2-induced miR-16-5p plays a modulation role in MTEC1 cell proliferation. These findings may provide new insight into the correlation between E2, cell cycle arrest, and miRNAs in TECs, and may also provide new mechanistic insights toward explaining E2 and thymus involution. Declarations Acknowledgments We would like to give our sincere gratitude to the reviewers for their constructive comments. Author contributions The original study design was undertaken by DG and YL. YH and JT prepared figures 1-3. Data were analyzed by MC and YL. The manuscript was written by DG. All authors reviewed the manuscript. Funding This work was supported by the National Natural Scientific Foundation of China (Grant numbers [32102632] and [31572475]) and the Doctoral Scientific Research Foundation of Xinxiang University (Grant numbers [1366020120]), Key Scientific Research Projects in Colleges and Universities of Henan (Grant numbers[24A180023]) Data availability Enquiries about data availability should be directed to the authors. Competing interests The authors have no commercial or other associations that might pose a confict of interest. References Chen R, Wang K, Feng Z, Zhang MY, Wu J, Geng JJ and Chen ZN (2020) CD147 deficiency in T cells prevents thymic involution by inhibiting the EMT process in TECs in the presence of TGFbeta. Cell Mol Immunol. doi: 10.1038/s41423-019-0353-7 Chaudhry MS, Velardi E, Dudakov JA and van den Brink MR (2016) Thymus: the next (re)generation. Immunol Rev 271:56-71. doi: 10.1111/imr.12418 Rezzani R, Nardo L, Favero G, Peroni M and Rodella LF (2014) Thymus and aging: morphological, radiological, and functional overview. Age (Dordr) 36:313-51. doi: 10.1007/s11357-013-9564-5 Palmer DB (2013) The effect of age on thymic function. Front Immunol 4:316. doi: 10.3389/fimmu.2013.00316 Hale JS, Boursalian TE, Turk GL and Fink PJ (2006) Thymic output in aged mice. Proc Natl Acad Sci U S A 103:8447-52. doi: 10.1073/pnas.0601040103 Manley NR, Richie ER, Blackburn CC, Condie BG and Sage J (2011) Structure and function of the thymic microenvironment. Front Biosci (Landmark Ed) 16:2461-77. doi: 10.2741/3866 Aw D and Palmer DB (2011) The origin and implication of thymic involution. Aging Dis 2:437-43. Anderson G, Lane PJ and Jenkinson EJ (2007) Generating intrathymic microenvironments to establish T-cell tolerance. Nat Rev Immunol 7:954-63. doi: 10.1038/nri2187 Xing Y, Jameson SC and Hogquist KA (2013) Thymoproteasome subunit-beta5T generates peptide-MHC complexes specialized for positive selection. Proc Natl Acad Sci U S A 110:6979-84. doi: 10.1073/pnas.1222244110 Vaidya HJ, Briones Leon A and Blackburn CC (2016) FOXN1 in thymus organogenesis and development. Eur J Immunol 46:1826-37. doi: 10.1002/eji.201545814 Olsen NJ, Olson G, Viselli SM, Gu X and Kovacs WJ (2001) Androgen receptors in thymic epithelium modulate thymus size and thymocyte development. Endocrinology 142:1278-83. doi: 10.1210/endo.142.3.8032 Gray DH, Seach N, Ueno T, Milton MK, Liston A, Lew AM, Goodnow CC and Boyd RL (2006) Developmental kinetics, turnover, and stimulatory capacity of thymic epithelial cells. Blood 108:3777-85. doi: 10.1182/blood-2006-02-004531 Gui J, Zhu X, Dohkan J, Cheng L, Barnes PF and Su DM (2007) The aged thymus shows normal recruitment of lymphohematopoietic progenitors but has defects in thymic epithelial cells. Int Immunol 19:1201-11. doi: 10.1093/intimm/dxm095 Anderson G and Jenkinson EJ (2001) Lymphostromal interactions in thymic development and function. Nat Rev Immunol 1:31-40. doi: 10.1038/35095500 Hauri-Hohl MM, Zuklys S, Keller MP, Jeker LT, Barthlott T, Moon AM, Roes J and Hollander GA (2008) TGF-beta signaling in thymic epithelial cells regulates thymic involution and postirradiation reconstitution. Blood 112:626-34. doi: 10.1182/blood-2007-10-115618 Zhou YJ, Peng H, Chen Y and Liu YL (2016) Alterations of Thymic Epithelial Cells in Lipopolysaccharide-induced Neonatal Thymus Involution. Chin Med J (Engl) 129:59-65. doi: 10.4103/0366-6999.172577 Zhang J, Wang Y, Aili A, Sun X, Pang X, Ge Q, Zhang Y and Jin R (2019) Th1 Biased Progressive Autoimmunity in Aged Aire-Deficient Mice Accelerated Thymic Epithelial Cell Senescence. Aging Dis 10:497-509. doi: 10.14336/AD.2018.0608 Ferrando-Martinez S, Ruiz-Mateos E, Dudakov JA, Velardi E, Grillari J, Kreil DP, Munoz-Fernandez MA, van den Brink MR and Leal M (2015) WNT signaling suppression in the senescent human thymus. J Gerontol A Biol Sci Med Sci 70:273-81. doi: 10.1093/gerona/glu030 Bucci M, Roviezzo F, Cicala C, Pinto A and Cirino G (2002) 17-beta-oestradiol-induced vasorelaxation in vitro is mediated by eNOS through hsp90 and akt/pkb dependent mechanism. Br J Pharmacol 135:1695-700. doi: 10.1038/sj.bjp.0704641 Yao G and Hou Y (2004) Thymic atrophy via estrogen-induced apoptosis is related to Fas/FasL pathway. Int Immunopharmacol 4:213-21. doi: 10.1016/j.intimp.2003.12.005 Zoller AL, Schnell FJ and Kersh GJ (2007) Murine pregnancy leads to reduced proliferation of maternal thymocytes and decreased thymic emigration. Immunology 121:207-15. doi: 10.1111/j.1365-2567.2006.02559.x Zoller AL and Kersh GJ (2006) Estrogen induces thymic atrophy by eliminating early thymic progenitors and inhibiting proliferation of beta-selected thymocytes. J Immunol 176:7371-8. doi: 10.4049/jimmunol.176.12.7371 Selvaraj V, Bunick D, Finnigan-Bunick C, Johnson RW, Wang H, Liu L and Cooke PS (2005) Gene expression profiling of 17beta-estradiol and genistein effects on mouse thymus. Toxicol Sci 87:97-112. doi: 10.1093/toxsci/kfi219 Pillai RS (2005) MicroRNA function: multiple mechanisms for a tiny RNA? RNA 11:1753-61. doi: 10.1261/rna.2248605 Ucar O and Rattay K (2015) Promiscuous Gene Expression in the Thymus: A Matter of Epigenetics, miRNA, and More? Front Immunol 6:93. doi: 10.3389/fimmu.2015.00093 Guo D, Ye Y, Qi J, Tan X, Zhang Y, Ma Y and Li Y (2017) Age and sex differences in microRNAs expression during the process of thymus aging. Acta Biochim Biophys Sin (Shanghai) 49:409-419. doi: 10.1093/abbs/gmx029 Guo D, Ye Y, Qi J, Xu L, Zhang L, Tan X, Tan Z, Yu X, Zhang Y, Ma Y and Li Y (2016) MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7. Acta Biochim Biophys Sin (Shanghai) 48:290-7. doi: 10.1093/abbs/gmv136 Guo D, Ye Y, Qi J, Zhang L, Xu L, Tan X, Yu X, Liu Q, Liu J, Zhang Y, Ma Y and Li Y (2016) MicroRNA-181a-5p enhances cell proliferation in medullary thymic epithelial cells via regulating TGF-beta signaling. Acta Biochim Biophys Sin (Shanghai) 48:840-9. doi: 10.1093/abbs/gmw068 Gong B, Wang X, Li B, Li Y, Lu R, Zhang K, Li B, Ma Y and Li Y (2020) miR-205-5p inhibits thymic epithelial cell proliferation via FA2H-TFAP2A feedback regulation in age-associated thymus involution. Mol Immunol 122:173-185. doi: 10.1016/j.molimm.2020.04.011 Papadopoulou AS, Dooley J, Linterman MA, Pierson W, Ucar O, Kyewski B, Zuklys S, Hollander GA, Matthys P, Gray DH, De Strooper B and Liston A (2011) The thymic epithelial microRNA network elevates the threshold for infection-associated thymic involution via miR-29a mediated suppression of the IFN-alpha receptor. Nat Immunol 13:181-7. doi: 10.1038/ni.2193 Vrtacnik P, Ostanek B, Mencej-Bedrac S and Marc J (2014) The many faces of estrogen signaling. Biochem Med (Zagreb) 24:329-42. doi: 10.11613/BM.2014.035 Wei C, Guo D, Li Y, Zhang K, Liang G, Li Y, Ma Y, Liu J and Li Y (2018) Profiling analysis of 17beta-estradiol-regulated lncRNAs in mouse thymic epithelial cells. Physiol Genomics 50:553-562. doi: 10.1152/physiolgenomics.00098.2017 Song M, Sun M, Xia L, Chen W and Yang C (2019) miR-19b-3p promotes human pancreatic cancer Capan-2 cells proliferation by targeting phosphatase and tension homolog. Ann Transl Med 7:236. doi: 10.21037/atm.2019.04.61 Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C and Bartel DP (2010) Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Genes Dev 24:992-1009. doi: 10.1101/gad.1884710 Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P and Kaessmann H (2013) Birth and expression evolution of mammalian microRNA genes. Genome Res 23:34-45. doi: 10.1101/gr.140269.112 Yamada K, Takizawa S, Ohgaku Y, Asami T, Furuya K, Yamamoto K, Takahashi F, Hamajima C, Inaba C, Endo K, Matsui R, Kitamura H and Tanaka S (2020) MicroRNA 16-5p is upregulated in calorie-restricted mice and modulates inflammatory cytokines of macrophages. Gene 725:144191. doi: 10.1016/j.gene.2019.144191 Zhang N, Li WW, Lv CM, Gao YW, Liu XL and Zhao L (2020) miR-16-5p and miR-19b-3p prevent amyloid beta-induced injury by targeting BACE1 in SH-SY5Y cells. Neuroreport 31:205-212. doi: 10.1097/WNR.0000000000001379 Zhang H, Yang K, Ren T, Huang Y, Tang X and Guo W (2018) miR-16-5p inhibits chordoma cell proliferation, invasion and metastasis by targeting Smad3. Cell Death Dis 9:680. doi: 10.1038/s41419-018-0738-z Krell A, Wolter M, Stojcheva N, Hertler C, Liesenberg F, Zapatka M, Weller M, Malzkorn B and Reifenberger G (2019) MiR-16-5p is frequently down-regulated in astrocytic gliomas and modulates glioma cell proliferation, apoptosis and response to cytotoxic therapy. Neuropathol Appl Neurobiol 45:441-458. doi: 10.1111/nan.12532 Cheng B, Ding F, Huang CY, Xiao H, Fei FY and Li J (2019) Role of miR-16-5p in the proliferation and metastasis of hepatocellular carcinoma. Eur Rev Med Pharmacol Sci 23:137-145. doi: 10.26355/eurrev_201901_16757 Ruan L and Qian X (2019) MiR-16-5p inhibits breast cancer by reducing AKT3 to restrain NF-kappaB pathway. Biosci Rep 39. doi: 10.1042/BSR20191611 Liu Z, Wang Y, Wang L, Yao B, Sun L, Liu R, Chen T, Niu Y, Tu K and Liu Q (2019) Long non-coding RNA AGAP2-AS1, functioning as a competitive endogenous RNA, upregulates ANXA11 expression by sponging miR-16-5p and promotes proliferation and metastasis in hepatocellular carcinoma. J Exp Clin Cancer Res 38:194. doi: 10.1186/s13046-019-1188-x Zhang K, Han Y, Zhao Y, Sun Y, Zou M, Fu Y and Peng X (2019) Upregulated gga-miR-16-5p Inhibits the Proliferation Cycle and Promotes the Apoptosis of MG-Infected DF-1 Cells by Repressing PIK3R1-Mediated the PI3K/Akt/NF-kappaB Pathway to Exert Anti-Inflammatory Effect. Int J Mol Sci 20. doi: 10.3390/ijms20051036 Bonci D, Coppola V, Musumeci M, Addario A, Giuffrida R, Memeo L, D'Urso L, Pagliuca A, Biffoni M, Labbaye C, Bartucci M, Muto G, Peschle C and De Maria R (2008) The miR-15a-miR-16-1 cluster controls prostate cancer by targeting multiple oncogenic activities. Nat Med 14:1271-7. doi: 10.1038/nm.1880 Ofir M, Hacohen D and Ginsberg D (2011) MiR-15 and miR-16 are direct transcriptional targets of E2F1 that limit E2F-induced proliferation by targeting cyclin E. Mol Cancer Res 9:440-7. doi: 10.1158/1541-7786.MCR-10-0344 Sun Y, Xiong Y, Yan C, Chen L, Chen D, Mi B and Liu G (2019) Downregulation of microRNA-16-5p accelerates fracture healing by promoting proliferation and inhibiting apoptosis of osteoblasts in patients with traumatic brain injury. Am J Transl Res 11:4746-4760. Wang F, Mao A, Tang J, Zhang Q, Yan J, Wang Y, Di C, Gan L, Sun C and Zhang H (2019) microRNA-16-5p enhances radiosensitivity through modulating Cyclin D1/E1-pRb-E2F1 pathway in prostate cancer cells. J Cell Physiol 234:13182-13190. doi: 10.1002/jcp.27989 Witalison EE, Cui X, Causey CP, Thompson PR and Hofseth LJ (2015) Molecular targeting of protein arginine deiminases to suppress colitis and prevent colon cancer. Oncotarget 6:36053-62. doi: 10.18632/oncotarget.5937 Basu PS, Majhi R, Ghosal S and Batabyal SK (2011) Peptidyl-arginine deiminase: an additional marker of rheumatoid arthritis. Clin Lab 57:1021-5. Shih HJ, Chen CL and Torng PL (2020) IGFBP3 inhibits angiogenesis through intracellular regulation of THBS1 expression. Am J Cancer Res 10:1728-1744. Maekawa T, Takeuchi S, Kanayama M and Takahashi S (2009) Estradiol, progesterone, and transforming growth factor alpha regulate insulin-like growth factor binding protein-3 (IGFBP3) expression in mouse endometrial cells. Zoolog Sci 26:131-8. doi: 10.2108/zsj.26.131 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3618025","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":249860707,"identity":"97c123c9-63e3-44a7-8359-d03d5bc8e8be","order_by":0,"name":"Dongguang Guo","email":"","orcid":"","institution":"Xinxiang University","correspondingAuthor":false,"prefix":"","firstName":"Dongguang","middleName":"","lastName":"Guo","suffix":""},{"id":249860708,"identity":"e6b28195-b17c-46f3-9ad6-f301f927f90c","order_by":1,"name":"Mingyan Chen","email":"","orcid":"","institution":"Xinxiang University","correspondingAuthor":false,"prefix":"","firstName":"Mingyan","middleName":"","lastName":"Chen","suffix":""},{"id":249860709,"identity":"1f739356-8eaf-49db-8e3b-91e4261bdcbc","order_by":2,"name":"Jinhe Tian","email":"","orcid":"","institution":"Xinxiang University","correspondingAuthor":false,"prefix":"","firstName":"Jinhe","middleName":"","lastName":"Tian","suffix":""},{"id":249860710,"identity":"50b582dd-8208-46c6-9a02-682e3366151d","order_by":3,"name":"Yaojia He","email":"","orcid":"","institution":"Xinxiang University","correspondingAuthor":false,"prefix":"","firstName":"Yaojia","middleName":"","lastName":"He","suffix":""},{"id":249860711,"identity":"e8f5ed66-75aa-4890-9c78-3ee5447bbfe9","order_by":4,"name":"Yugu Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYLCCBwY2cvzMzIcfEK8lwSDNWLKdLc2ABC0MhxM3nOdRkCBKtcGN9GsSCQWHEzcf5mEwYKixiSZCS06ZRIJBuvG2w7wHHjAcS8ttIEJLGlCLtey2w3wJBowNh4nWwsy4uZnHQIJILenHgFqcFTcwE6tF8swbZgtQIEscBgZyAjF+4Tue/vDGhz/AqOw/fPjBhxobwloUDvAgRWACIeUgIN/A/oAYdaNgFIyCUTCSAQA2PEEnTpXfegAAAABJRU5ErkJggg==","orcid":"","institution":"South China Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Yugu","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2023-11-16 03:44:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3618025/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3618025/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":46670287,"identity":"9874bdb3-8651-48ad-a475-f79539ddc2ed","added_by":"auto","created_at":"2023-11-17 18:12:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1234108,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eE2 responsive miRNAs expression in MTEC1 cells \u003c/strong\u003e(a) Heat map showing differentially expressed miRNA affected by 50 nmol/L E2 treatment. Relative expression is presented as a color gram (red: high expression; green: low expression). (b) Expression of miR-16-5p and miR-22-3p as determined by real-time PCR analysis. Data are presented with the mean ± standard deviation. *p\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-3618025/v1/027eb7da537c09cb5b802252.png"},{"id":46670282,"identity":"85e1355b-1c32-49e0-aa4e-af1d3e9ad34d","added_by":"auto","created_at":"2023-11-17 18:12:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":828496,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of miR-16-5p on MTEC1 cell viability and apoptosis \u003c/strong\u003e(a, b) The transfection efficiency of miR-16-5p and miR-22-3p mimic/inhibitor (50/100 nmol/L) into MTEC1 cells was measured at 48 h after transfection. (c, d) Cell viability analysis was performed by CCK-8 at 24 h, 48 h, and 72 h after miR-16-5p or miR-22-3p transfection. (e) At 48 h after transfection, miR-16-5p on cell apoptosis was analyzed by flow cytometry. Data are presented with the mean ± standard deviation. *p\u0026lt;0.05; **p\u0026lt;0.01; ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-3618025/v1/3715df25c2a88873ac295dcb.png"},{"id":46670829,"identity":"52da87fc-c5cb-488e-8200-46cf050439b8","added_by":"auto","created_at":"2023-11-17 18:20:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":899932,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of miR-16-5p on cell proliferation \u003c/strong\u003e(a) Cell proliferation was measured by the EdU incorporation assay. (b, c) Percentage of EdU-positive cells. (d) Cell cycle progression was assessed by flow cytometry. (e, f) Quantification of G1-phase, S-phase, or G2-phase cell percentage after transfection of miR-16-5p mimic or inhibitor in MTEC1 cells for 48 h. *p\u0026lt;0.05; **p\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-3618025/v1/33b42bb095ea89ac24fa083e.png"},{"id":46670830,"identity":"b4721226-b621-41f5-b1ff-7378930ed73b","added_by":"auto","created_at":"2023-11-17 18:20:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":777126,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eCCND1 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIgfbp3 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eare direct target genes of miR-16-5p \u003c/strong\u003e(a, b) Validation of the potential targets of miR-16-5p by qPCR. Data were normalized to the level of \u003cem\u003eβ-actin\u003c/em\u003e in each sample and the data were presented as 2\u003csup\u003e−ΔΔCT\u003c/sup\u003e. (c, d) Western blot analysis of protein levels of CCND1 and Igfbp3 in MTEC1 cells with overexpression or inhibition of miR-16-5p. GAPDH was used as the loading control. (e, f) Putative miR-16-5p binding sites within the mouse \u003cem\u003eCCND1\u003c/em\u003e and\u003cem\u003e Igfbp3 \u003c/em\u003e3′-UTR were predicted. Four kinds of pmiRGLO vectors were constructed and the five underlined nucleotides in the seed region of \u003cem\u003eCCND1\u003c/em\u003e and \u003cem\u003eIgfbp3 \u003c/em\u003e3′UTR were mutated to abolish the interaction between miR-16-5p and \u003cem\u003eCCND1\u003c/em\u003e, \u003cem\u003eIgfbp3 \u003c/em\u003e3′UTR, respectively. (g, h) Luciferase activity was measured in HEK-293T cells after co-transfected with miR-16-5p mimic (50 nmol/L) or mimic-NC (50 nmol/L) and the pmiRGLO-CCND1/Igfbp3-MUT (400 ng) or pmiRGLO-CCND1/Igfbp3-WT (400 ng). Data are presented with the mean ± standard deviation. *p\u0026lt;0.05, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-3618025/v1/5c05a028be131e47674284fd.png"},{"id":46670285,"identity":"a43bf140-1fcc-4a93-bc76-d89f9ee43607","added_by":"auto","created_at":"2023-11-17 18:12:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":567419,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIgfbp3 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003egene inhibition using \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIgfbp3 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003esiRNA toward cell proliferation \u003c/strong\u003eA total of 3 knockdown siRNA constructs were designed based on the junction site of \u003cem\u003eIgfbp3\u003c/em\u003e, and the knockdown efficiency was assessed by qPCR(a) and western-blot(b). For qPCR and western blot experiments, mRNA and protein levels were normalized to β-actin and GAPDH, respectively. (c) Cell proliferation was detected by EdU in MTEC1 cells after transfected with siRNA-NC or si\u003cem\u003eIgfbp3 \u003c/em\u003efor 48 h. (d) Percentage of EdU-positive cells. (e) Cell cycle progression was assessed by flow cytometry. (f) Quantification of G1-phase, S-phase, or G2-phase cell percentage after transfection of siRNA-NC or si\u003cem\u003eIgfbp3 \u003c/em\u003ein MTEC1 cells for 48 h. Data are presented with the mean ± standard deviation. *p\u0026lt;0.05, **p\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-3618025/v1/dd2a4b0aeec33e602c1a62d2.png"},{"id":46670283,"identity":"812eba0c-1a92-4a6e-a659-1630455be510","added_by":"auto","created_at":"2023-11-17 18:12:29","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":138087,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-16-5p is an E2-responsive miRNA in MTEC1 cells \u003c/strong\u003eThe expression levels of miR-16-5p were measured in MTEC1 cells by qPCR after treating with different concentrations of E2 for a different time. Data are presented with the mean ± standard deviation.\u003cem\u003e \u003c/em\u003e*p\u0026lt;0.05, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-3618025/v1/83273b24d35be49626966b60.png"},{"id":47509136,"identity":"faabc968-77d6-4a46-bf18-b8e3c48dfe29","added_by":"auto","created_at":"2023-12-03 15:07:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2417139,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3618025/v1/ef96e06a-e0b3-4630-9b27-48f1afe6d4a1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The Proliferation Regulation Role of 17β-Estradiol-Induced miR-16-5p in Mouse Thymic Epithelial Cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe thymus is the primary central lymphoid organ that plays a critical role in the cellular immune response[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. However, during aging, the thymus undergoes progressive involution or atrophy. In addition to the morphological changes and a reduction in thymic mass, it also exhibits a significantly decreased ability to produce new T cells and a decline of immune function[\u003cspan additionalcitationids=\"CR3 CR4\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Thymic epithelial cells (TECs) are an indispensable part of the stromal compartment and can provide a unique microenvironment and signals for various stages of T-cell development[\u003cspan additionalcitationids=\"CR7 CR8\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. There is now a lot of evidence suggesting that age-related thymic involution is tightly associated with the microenvironment changes and dysfunction of the thymic microenvironment cells[\u003cspan additionalcitationids=\"CR11 CR12 CR13\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Therefore, as the predominant component of the thymic microenvironment, TECs are essential factors for aging-related thymus involution [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDysregulation of sex hormones has been considered as one of the most important factors causes of age-related thymus involution[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. As one of the female sex hormones, estrogen (17β-Estradiol, E2), can produce several biological effects through binding to the estrogen receptors (ER) α and β[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Evidence from animal studies indicated that E2 has significant immune modulatory properties, including induction of thymic involution[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. High levels of E2 in mice thymus were shown that can induce thymic involution via reduction of thymocyte cellularity, inhibit thymocyte proliferation, and depletion of early thymic progenitors[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. On the other hand, there is evidence demonstrating that E2 mediated transcriptional regulation of genes involved in the control of cell proliferation and survival in TECs[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. These indicated that E2 has a crucial role in regulating thymus involution.\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) are a class of small, non-coding RNAs that play an important role in gene regulation by targeting the 3\u0026prime;UTR [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Findings from several studies indicate that miRNAs network as a novel pathway plays an important role as regulators in thymus involution and are closely correlated with TEC proliferation[\u003cspan additionalcitationids=\"CR26 CR27 CR28 CR29\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Particularly important is the connection between E2 signaling and epigenetic regulation are crucial regulatory mechanisms for thymus development, their interaction in cells has been reported to increase the level of cell-specificity and fine-tuning of transcriptional regulation[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, the link of E2 in miRNA expression in TECs remains unclear.\u003c/p\u003e \u003cp\u003eOur previous results showed that 50 nmol/L E2 has an inhibitory effect on cell proliferation[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. However, the significantly changed miRNA in MTEC1 cells after treatment with E2 remains ambiguous. In this study, the miRNA expression profiles were obtained by high throughput sequencing, based on the sequencing results, we provided evidence that the E2-responsive miRNA, miR-16-5p, which is not only E2-responsive miRNA but also a functional miRNA for the proliferation of TECs, provide new insights for further explore the E2 functional TECs and thymus involution.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell lines and cell culture\u003c/h2\u003e \u003cp\u003eMurine thymic epithelial cell line 1(MTEC1) cell was obtained from Peking University Health Science Center (Beijing, China). Human embryonic kidney 293T (HEK-293T) cell was obtained from the American Type Culture Collection (Manassas, USA). Both MTEC1 and HEK-293T cells were cultured in complete Dulbecco's Modified Eagle Medium (DMEM) (Gibco, Grand Island, USA) containing 10% fetal bovine serum (FBS) (Gibco) in a humidified atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eHormone treatment\u003c/h2\u003e \u003cp\u003eHormone treatment in MTEC1 cells was performed according to a previously described method[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Briefly, MTEC1 cells were seeded in a 6-well plate and cultured in a DMEM growth medium containing 10% FBS. Once the confluence of MTEC1 cells reached 70%~80%, the cells were starved for 24 h by replacing the growth medium with DMEM containing only 2%(v/v) FBS. Subsequently, the cells were then treated with different concentrations(1 nmol/L, 10 nmol/L, 25 nmol/L, 50 nmol/L) of 17β-Estradiol (E2, Sigma, St Louis, MO) in DMEM with 2% (v/v) FBS for a different time(6 h, 12 h, 24 h, 48 h). Cells that were treated with only ethanol in the same growth medium served as a control group. All the experiments were done in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eHigh-throughput sequencing\u003c/h2\u003e \u003cp\u003eCells from the treatment and control group were collected at 24 h and used for small RNA sequencing experiments. Total Ribonucleic acid (RNA) was extracted from each pool, corresponding to the six sample groups, treatment group, and control samples. These six samples were labeled E2-1, E2-2, E2-3, C-1, C-2, and C-3. For the six transcriptome library constructions, the RNA preparation, library construction, and single-end sequencing (36 bp) were performed on an Illumina Hiseq2500 at the LC-BIO (Hangzhou, China) following the vendor`s recommended protocol. Differential miRNA expression based on normalized deep-sequencing counts was analyzed using the Fisher exact test and Student t-test based on the design of the experiment. The significance threshold was set to be 0.01 and 0.05 in each test.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eRNA oligonucleotides and cell transfection\u003c/h2\u003e \u003cp\u003eThe miR-16-5p mimic, mimic NC, miR-16-5p inhibitor, inhibitor NC, RNA-\u003cem\u003eIgfbp3\u003c/em\u003e(si\u003cem\u003eIgfbp3\u003c/em\u003e) or RNA-NC(siRNA\u003cem\u003e-\u003c/em\u003eNC) were designed and synthesized by RiboBio Co., Ltd (Guangzhou, China). Sequences of miR-16-5p mimic(catalog number: miR10000527-1-5), inhibitor (catalog number: miR20000527-1-5), si\u003cem\u003eIgfbp3-001\u003c/em\u003e (catalog number: siG2012210538377126), si\u003cem\u003eIgfbp3-002\u003c/em\u003e (catalog number: siG2012210538378218) and si\u003cem\u003eIgfbp3-003\u003c/em\u003e(catalog number: siG2012210538379310) are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. But mimic-NC (catalog number: miR1N0000001-1-5), inhibitor-NC (catalog number: miR2N0000001-1-5), and si\u003cem\u003eIgfbp3\u003c/em\u003e NCs (catalog number: siN0000001-1-5) were confidentiality designed by RiboBio. To study gene function in the cellular environment, transfection studies were done one day before transfection, MTEC1 or HEK-293T cells were plated in the appropriate culture dish. When the plated cells reached approximately 60%~70% confluence, the oligonucleotides [50 nmol/Lmimic or mimic-NC, and 100 nmol/L inhibitors or inhibitor-NC], RNA-\u003cem\u003eIgfbp3\u003c/em\u003e(si\u003cem\u003eIgfbp3\u003c/em\u003e), or siRNA-NC were transfected into cultured cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, USA) according to the manufacturer\u0026rsquo;s instruction.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequence of miRNA oligonucleotides used in the study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eType\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-16-5p mimic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUAGCAGCACGUAAAUAUUGGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDouble-stranded RNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-16-5p inhibitor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCCAAUAUUUACGUGCUGCUA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDouble-stranded RNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esi\u003cem\u003eIgfbp3\u003c/em\u003e-001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTACAAAGTTGACTATGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDouble stranded RNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esi\u003cem\u003eIgfbp3\u003c/em\u003e-002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTACAAAGTTGACTATGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDouble stranded RNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esi\u003cem\u003eIgfbp3\u003c/em\u003e-003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTACAAAGTTGACTATGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDouble stranded RNA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative polymerase chain reaction (qPCR)\u003c/h2\u003e \u003cp\u003eTotal RNAs were extracted from MTEC1 cells using TRIZOL (Takara, Kusatsu, Japan). Complementary Deoxyribonucleic acid (cDNA) was synthesized using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) following the manufacturer\u0026rsquo;s instructions. qPCR was performed with SYBR Green real-time PCR Master Mix (Toyobo). For measuring the expression of miRNAs in MTEC1 cells, the bulge-loop miRNA qRT-PCR Primer Sets (including one reverse transcription primer and a pair of quantitative PCR primers) specific for miR-16-5p and miR-22-3p were confidentiality designed by RiboBio (Guangzhou, China). As shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, the relative gene primers for messenger RNA (mRNA) were designed by the Primer Premier 5.0 software according to the published genome sequences. \u003cem\u003eβ-actin\u003c/em\u003e and \u003cem\u003eU6\u003c/em\u003e were used to normalize the relative abundance of mRNA and miRNA, respectively. Bio-Rad CFX96 Real-Time PCR system (Bio-Rad, Hercules, USA) was used to perform qPCR analysis. The relative expression level of each gene was calculated from three different experiments and was determined using the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method. All experiments were repeated at least three times.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences are used for a reverse transcription-quantitative polymerase chain reaction.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession No.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSize (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIgf1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_ 017313812.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TTGTGGATGAGTGTTGCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e165\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GCTTCGTTTTCTTGTTTGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIgfbp3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_ 011243665.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: AGTGACCGATTCCAAGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e185\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GTGTGTCCTCCATTTCTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCtgf\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_ 010217.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TCATCAAGACCTGTGCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e118\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TTCGTGTCCCTTACTTCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDusp3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_ 028207.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GTGAGGCAGAATCGTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eR: CCTAGAGTTTCACCTTGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCCND1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e001379248.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: AGGCGGATGAGAACAAGCAGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e175\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CGGTAGCAGGAGAGGAAGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCCNE1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_ 007633.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GCGTCTAAGCCCTCTGACCATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e191\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CAGAAGCAGCGAGGACACCATAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRarg\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_ 006520650.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GATGGCTTCTCTCTCGGTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e153\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TCACAGGAGCTGACCCCATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKmt2a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_036154819.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GGCCCTGTTGAATTCTCGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e110\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GGGAGCTTCGGGAAGGTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRapgef2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_ 030252869.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TGCGAGAGAGCCAAATCTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GGCTCAATGTTGCGGAAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrim35\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_ 029979.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GAGTGTGAGGAGGGTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e147\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: GCAGATACGCAGAGGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_007393\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CATCCGTAAAGACCTCTATGCCAACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e171\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: ATGGAGCCACCGATCCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eTo obtain total proteins, cultured MTEC1 cells were lysed in Radio immunoprecipitation assay (RIPA) buffer [50 mMTris-HCl, pH 8.0, 250 mM NaCl, 1% NP40, 0.5% (w/v) sodium deoxycholate, and 0.1% sodium dodecylsulfate] (Beyotime, Nanjing, China) supplemented with protease and phosphatase inhibitor mixture(Sigma-Aldrich) and vortexed briefly. After centrifugation at 15,000 g for 15 min at 4\u0026deg;C, the protein sample was collected and the concentration was determined using the BCA kit (Beyotime). Sample buffer was used to dilute the lysates, once the proteins (20 \u0026micro;g) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to polyvinylidene fluoride membranes (PVDF) (Millipore, Billerica, USA). After blocking with skimmed milk, the blots were incubated overnight at 4\u0026deg;C with mouse monoclonal antibodies, including anti-CCND1, anti-Igfbp3, and anti-GAPDH monoclonal antibodies. All these antibodies used were obtained from Santa Cruz Biotech (Santa Cruz, USA). The membranes were then washed and incubated with horseradish peroxidase-conjugated goat anti-mouse secondary antibodies (Santa Cruz) at 37\u0026deg;C for 90 min and then developed with BeyoECL Plus kit (Beyotime).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assay\u003c/h2\u003e \u003cp\u003eMTEC1 cells were seeded in a 96-well plate at a density of 2\u0026thinsp;~\u0026thinsp;5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells per well and transfected with miR-16-5p mimic, miR-16-5p inhibitor, or miR-NC. Cell viability was analyzed at the indicated time points (24 h, 48 h, and 72 h) using the cell-counting kit-8 (CCK-8) regents (Beyotime) according to the manufacturer's instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCell cycle assay\u003c/h2\u003e \u003cp\u003eMTEC1 cells were cultured in DMEM with 10% FBS at 48 h after transfection and then fixed with 70% ethanol overnight at \u0026minus;\u0026thinsp;20\u0026deg;C for 24 h. The cell cycle assay was determined using the Cell Cycle Analysis Kit (Beyotime) with a flow cytometer (BD Biosciences, San Jose, USA) and data was analyzed with Flow J (version 10) software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCell apoptosis assay\u003c/h2\u003e \u003cp\u003eAt 48 h after transfection, the cell apoptosis rate was quantified by gating propidium iodide and Annexin V-positive cells on a fluorescence-activated cell-sorting flow cytometer (BD Biosciences) according to the instructions of the Apoptosis and Necrosis Assay Kit (Kaiji, Nanjing, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e5-ethynyl-20-deoxyuridine (EdU) assays\u003c/h2\u003e \u003cp\u003eMTEC1 cells seeded in 24-well plates were cultured to 50% density and then transfected. 48 h after transfection with mimics, inhibitors, or siRNAs. The cells were then fixed in 4% polyformaldehyde (PFA) at room temperature for 1 h. Subsequently, the cells were incubated with 0.5% Triton X-100 for 15 min. Finally, cells were stained by Cell-Light\u0026trade;EdU Cell Proliferation Detection Assay (RiboBio, Guangzhou, China) according to the operating instructions. The ratio of proliferative cells was calculated by the ratio of EdU-positive cells to Hoechst-positive cells[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The assay was performed in three biological replicates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of Target Gene\u003c/h2\u003e \u003cp\u003eBioinformatics prediction software [miRBase (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.mirbase.org/\u003c/span\u003e\u003cspan address=\"http://www.mirbase.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), TargetScan (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.targetscan.org/\u003c/span\u003e\u003cspan address=\"http://www.targetscan.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and PicTar (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://pictar.mdc-berlin.de/\u003c/span\u003e\u003cspan address=\"http://pictar.mdc-berlin.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)] were used to select candidate targets of miR-16-5p. Combined with the data on mRNA expression analyses from our previously published microarray data[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The potential targets that involved in cell proliferation, including \u003cem\u003eCCND1\u003c/em\u003e, \u003cem\u003eCCNE1\u003c/em\u003e, Insulin growth factor-I \u003cem\u003e(Igf1)\u003c/em\u003e (5.00E-05), Insulin-like growth factor-binding protein 3 (\u003cem\u003eIgfbp3\u003c/em\u003e) (5.00E-05), Retinoic acid receptor gamma \u003cem\u003e(Rarg)\u003c/em\u003e (2.90E-03), Lysine (K)-specific methyltransferase 2A \u003cem\u003e(Kmt2a)\u003c/em\u003e (3.95E-02), Tripartite motif-containing 35(\u003cem\u003eTrim35\u003c/em\u003e) (6.50E-04), Rap guanine nucleotide exchange factor (GEF) (\u003cem\u003eRapgef2\u003c/em\u003e) (8.00E-04), \u003cem\u003eCtgf\u003c/em\u003e(5.00E-05), and dual-specificity phosphatase 3 (\u003cem\u003eDusp3\u003c/em\u003e) (5.00E-05) were chosen as valid targets of miR-16-5p due to their expression levels was significantly downregulated as compared with the expression miR-16-5p in the 50 nmol/L E2 treated MTEC1 cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003ePlasmids construction\u003c/h2\u003e \u003cp\u003eFor the pmirGLO dual-luciferase miRNA target reporter vector, the 3\u0026prime;-untranslated regions (3\u0026prime;-UTRs) of \u003cem\u003eCCND1\u003c/em\u003e and \u003cem\u003eIgfbp3\u003c/em\u003e contained putative target sites of miR-16-5p were amplified by PCR from genomic DNA. The PCR products were then cloned between Sac Ⅰ and Sal Ⅰ sites of the luciferase reporter vector pmiRGLO (Promega, Madison, USA). The primer sequences of the \u003cem\u003eCCND1\u003c/em\u003e 3\u0026prime;-UTR (NCBI reference sequence: NM_007631.2) (positions 1731\u0026thinsp;~\u0026thinsp;1737 bp and 1808\u0026thinsp;~\u0026thinsp;1814 bp) were as follows: forward, 5\u0026prime;-CGAGCTCGCCTTTCTATTAGGACTT-3\u0026prime;, and reverse, 5\u0026prime;-GCGTCGACAGCATGACAGGACGAT-3\u0026prime;, and the primer sequences of the \u003cem\u003eIgfbp3\u003c/em\u003e 3\u0026prime;-UTR (NCBI reference sequence: XM_011243665.3) (positions 360\u0026thinsp;~\u0026thinsp;366 bp) were as follows: forward, 5\u0026prime;-CGAGCTCAAAAGACTGCCAACAAC-3\u0026prime; and reverse 5\u0026prime;-GCGTCGACCACAGTTCCCAAGTAGAT-3\u0026prime;. The mutant (MUT) \u003cem\u003eCCND1\u003c/em\u003e and \u003cem\u003eIgfbp3\u003c/em\u003e 3\u0026prime;-UTR plasmids were generated using the QuickChange\u0026reg; Mutagenesis kit (Stratagene) according to the manufacturer\u0026rsquo;s specifications. Both seed sequences for \u003cem\u003eCCND1\u003c/em\u003e were mutated from \u0026lsquo;GCUGCUA\u0026rsquo; to \u0026lsquo;AUUUCGC\u0026rsquo;, and the seed sequences for \u003cem\u003eIgfbp3\u003c/em\u003e were mutated from \u0026lsquo;UGCUGCU\u0026rsquo; to \u0026lsquo;ACGUCGU\u0026rsquo; respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eDual-luciferase reporter assay\u003c/h2\u003e \u003cp\u003eThe pmiRGLO-\u003cem\u003eCCND1\u003c/em\u003e-3\u0026prime;UTR (WT/MUT) and pmiRGLO\u003cem\u003e-Igfbp3\u003c/em\u003e-3\u0026prime;UTR (WT/MUT) plasmid (400 ng) with miR-16-5p mimic or mimic-NC were co-transfected into HEK-293T cells using Lipofectamine 3000 (Invitrogen) as per the manufacturer\u0026rsquo;s recommendation. The dual-luciferase activity was analyzed at 48 h after transfection using the Dual-luciferase Reporter Assay System (Promega, Madison, USA) as per the manufacturer's instructions. Luciferase activity was calculated as the ratio of Firefly to Renilla and each experiment was performed in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll experiments were performed in triplicate and repeated at least three times. All data were represented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. The statistical analysis was performed by using Student's t-test to determine the significant differences using commercial software (SPSS 17; SPSS, Chicago, USA). A value of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was deemed statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003emiRNA expression profiles in E2-treated MTEC1 cells\u003c/h2\u003e\n\u003cp\u003eTo examine the expression profile of miRNAs in MTEC1 cells after E2 treatment, the MTEC1 cells were exposed to 50 nmol/L E2 for 24 h, then a miRNA high throughput sequencing analysis was performed, and a total of 4820 mature miRNA sequences were analyzed, 3356 were detected in all experimental groups. Of these, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea, 69 miRNA expressions were found that significantly differentially expressed using a cut-off with adjusted p values of \u0026lt;\u0026thinsp;0.05, including 36 downregulated and 33 upregulated miRNAs.\u003c/p\u003e\n\u003cp\u003eInterestingly, we found that only two miRNAs expression, miR-16-5p and miR-22-3p, have \u0026ldquo;high\u0026rdquo; levels of expression among the 36 upregulation miRNAs which are significantly induced by E2. Next, we verified the expression level of miR-16-5p and miR-22-3p by qPCR. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb, consistent with the results of high throughput sequencing analysis, miR-16-5p (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and miR-22-3p(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) was notably upregulated in MTEC1 cells following 50 nmol/L E2. Therefore, we speculated that both miR-16-5p and miR-22-3p may play a significant role in this process.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n\u003ch2\u003eEffects of miR-16-5p on MTEC1 cells viability and apoptosis\u003c/h2\u003e\n\u003cp\u003eTo test our hypothesis, the mimics and inhibitors of miR-16-5p and miR-22-3p, or mimic-NC and inhibitor-NC were transfected into MTEC1 for gain- or loss-of-function experiments, respectively. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea \u003cstrong\u003eand b\u003c/strong\u003e, both miR-16-5p and miR-22-3p were found to be significantly up-regulated after transfected with mimics (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and significantly down-regulated after transfected with miR-16-5p or miR-22-3p inhibitor(p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\n\u003cp\u003eFurther, CCK-8 assays were performed to evaluate the effect of miR-16-5p and miR-22-3p in MTEC1 cells. We found that overexpression of miR-16-5p in MTEC1 cells significantly inhibited cell viability at 48 and 72 h (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) after transfection, as compared with the control group \u003cstrong\u003e(\u003c/strong\u003eFig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec). As expected, the miR-16-5p inhibitor exhibits an opposite effect on MTEC1 cell viability, and transfection of miR-16-5p inhibitor significantly increased cell viability at 48 and 72 h (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ed). The effect was inverse with the miR-16-5p mimic group. However, either transfected with miR-22-3p mimic or inhibitor in MTEC1 cells did not show significant effects on cell viability in MTEC1 cells.\u003c/p\u003e\n\u003cp\u003eBesides, the flow cytometric analysis was also used to investigate the effect of miR-16-5p on cell apoptosis. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ee, no obvious change was observed in the miR-16-5p mimic-transfected and miR-16-5p inhibitor-transfected cells. These results indicated that the expression of miR-16-5p did not affect cell apoptosis in MTEC1 cells.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n\u003ch2\u003eEffects of miR-16-5p on cell proliferation\u003c/h2\u003e\n\u003cp\u003eTo understand how cell viability was decreased by miR-16-5p, the function of miR-16-5p in MTEC1 cells was determined by the EdU incorporation assay. As shown, miR-16-5p significantly decreased the percentage of EdU-positive proliferating cells, while down-regulated miR-16-5p significantly increased the percentage of EdU-positive proliferating cells (\u003cstrong\u003eFig.\u0026nbsp;3a, b and c\u003c/strong\u003e). Consistently, flow cytometry showed that the number of cells was significantly increased in the G1 phase(p\u0026thinsp;\u0026lt;\u0026thinsp;0.01)but reduced in the S and G2 phase（p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05） in the miR-16-5p mimic group than in the mimic-NC group（\u003cstrong\u003eFig.\u0026nbsp;3d and e\u003c/strong\u003e）. However, the percentage of cells in the G1 phase was significantly decreased（p\u0026thinsp;\u0026lt;\u0026thinsp;0.01）, and the percentage of cells in the G2 and S\u0026thinsp;+\u0026thinsp;G2 phase was significantly increased（p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01）in the miR-16-5p inhibitor group, as compared with the inhibitor-NC group（\u003cstrong\u003eFig.\u0026nbsp;3d and f\u003c/strong\u003e）. Collectively, our data confirmed that elevated expression of miR-16-5p could significantly decrease cell proliferation in MTEC1 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eValidation of\u003c/strong\u003e \u003cstrong\u003eCCND1\u003c/strong\u003e \u003cstrong\u003eand\u003c/strong\u003e \u003cstrong\u003eIgfbp3\u003c/strong\u003e \u003cstrong\u003eas the direct target of miR-16-5p\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo identify the potential targets of miR-16-5p, the \u003cem\u003eCCND1, CCNE1\u003c/em\u003e, and our previous transcriptome sequencing results[\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e]showed that the 8 potential targets had significantly lower mRNA expression in E2-treated MTEC1 cells were selected as a candidate to study. To confirm the real targets of miR-16-5p, the mRNA expression levels of these potential targets were measured in miR-16-5p mimic, mimic-NC, miR-16-5p inhibitor, and inhibitor-NC-transfected cells. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea, the expression levels of \u003cem\u003eCCNE1\u003c/em\u003e(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), \u003cem\u003eCCND1\u003c/em\u003e(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), \u003cem\u003eIgfbp3\u003c/em\u003e(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and \u003cem\u003eCtgf\u003c/em\u003e(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were substantially decreased when using a miR-16-5p mimic. On the contrary, the expression levels of \u003cem\u003eCCND1\u003c/em\u003e(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), \u003cem\u003eIgfbp3\u003c/em\u003e(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), \u003cem\u003eand Dusp3\u003c/em\u003e(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were significantly enhanced by a miR-16-5p inhibitor(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb). This indicated that miR-16-5p is likely to mainly target \u003cem\u003eCCND1\u003c/em\u003e and \u003cem\u003eIgfbp3\u003c/em\u003e genes.\u003c/p\u003e\n\u003cp\u003eTo further confirm the regulated roles, the western blotting revealed that miR-16-5p mimics downregulated CCND1 and Igfbp3, while miR-16-5p inhibitor upregulated CCND1 and Igfbp3 in MTEC1 cells. This data further suggested that miR-16-5p regulated CCND1 and Igfbp3 at least at the protein level in MTEC1 cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec \u003cstrong\u003eand d\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eTo validate the above results, two conserved binding seed sequences (1731\u0026thinsp;~\u0026thinsp;1737 bp, 1808\u0026thinsp;~\u0026thinsp;1814 bp) in \u003cem\u003eCCND1\u003c/em\u003e 3\u0026prime;UTR and a conserved sequence binding seed sequence (360\u0026thinsp;~\u0026thinsp;366 bp) in \u003cem\u003eIgfbp3\u003c/em\u003e 3\u0026prime;UTR were identified by using the miRNA target analysis tools (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ee \u003cstrong\u003eand f\u003c/strong\u003e). A luciferase reporter assay was performed to confirm that miR-16-5p directly binds to the 3\u0026prime;-UTR of \u003cem\u003eCCND1\u003c/em\u003e and \u003cem\u003eIgfbp3\u003c/em\u003e in HEK-293T cells. The results showed that overexpression of miR-16-5p significantly reduced luciferase activity of the reporter gene in both wild types(p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but not mutants(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eg \u003cstrong\u003eand h\u003c/strong\u003e). This indicated that both \u003cem\u003eCCND1\u003c/em\u003e and \u003cem\u003eIgfbp3\u003c/em\u003e were negatively regulated by miR-16-5p in MTEC1 cells, confirmed \u003cem\u003eCCND1\u003c/em\u003e and \u003cem\u003eIgfbp3\u003c/em\u003e as targets of miR-16-5p.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffects of\u003c/strong\u003e \u003cstrong\u003eIgfbp3\u003c/strong\u003e \u003cstrong\u003eknockdown were similar to those of miR-16-5p overexpression in MTEC1 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further investigate the role of \u003cem\u003eIgfbp3\u003c/em\u003e in MTEC1 cell function, we designed 3 different small interfering RNA (siRNA) products (si\u003cem\u003eIgfbp3\u003c/em\u003e-001, si\u003cem\u003eIgfbp3\u003c/em\u003e-002, and si\u003cem\u003eIgfbp3\u003c/em\u003e-003) and a scrambled siRNA as the negative control (siRNA-NC). Upon transfection into MTEC1 cells, qPCR and western blot analysis have shown that siI\u003cem\u003egfbp3\u003c/em\u003e-003 could effectively knock down \u003cem\u003eIgfbp3\u003c/em\u003e expression as compared to the si\u003cem\u003eIgfbp3\u003c/em\u003e-001 and si\u003cem\u003eIgfbp3\u003c/em\u003e-002 in cell lines MTEC1. Thus, si\u003cem\u003eIgfbp3\u003c/em\u003e-003 was used in subsequent experiments (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea \u003cstrong\u003eand b\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eWhen si\u003cem\u003eIgfbp3-003\u003c/em\u003e was transfected into MTEC1 cells, the EdU assay analysis shown that transfection si\u003cem\u003eIgfbp3-003\u003c/em\u003e in MTEC1 cells significantly decreased (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) the percentage of EdU-positive proliferating cells as compared with the siRNA-NC group cells(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ec \u003cstrong\u003eand d\u003c/strong\u003e). Consistent with the EdU cell proliferation assay, the cell cycle assay showed that silencing of \u003cem\u003eIgfbp3\u003c/em\u003e can induce cell cycle arrest at the G0/G1 phase in MTEC1 cells as compared with the siRNA-NC transfected group cells(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ee \u003cstrong\u003eand f\u003c/strong\u003e). These findings suggested that \u003cem\u003eIgfbp3\u003c/em\u003e affected the MTEC1 cell proliferation, just like that of the overexpression of miR-16-5p.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n\u003ch2\u003eMiR-16-5p is an E2-responsive miRNA in MTEC1 cells\u003c/h2\u003e\n\u003cp\u003eTo further confirm the associations between E2 and miR-16-5p expression in MTEC1 cells, the expression levels of miR-16-5p were further measured in MTEC1 cells that were treated with E2 at different concentrations and different times. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, the results showed that miR-16-5p was significantly upregulated at the concentrations of 25 nmol/L, 50 nmol/L after E2 treatment for 6 h(p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), 12 h (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), 24 h（p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05）, and 48 h（p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001）respectively. These results suggested that miR-16-5p is an E2-responsive miRNA in MTEC1 cells.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIt has been reported that miR-16-5p is expressed in various tissues, including the spleen, kidney, liver, pancreas, brain, skin, and skeletal muscle[\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. miR-16-5p also is a potential target in human diseases and cancers, which has been reported to be implicated in cell proliferation, apoptosis, and pathophysiology[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. However, whether it contributes to the process of TEC proliferation remains unclear.\u003c/p\u003e \u003cp\u003eTo further test our hypothesis, an investigation was done on whether the overexpression of miR-16-5p has a regulation role in MTEC1 cells. The results of EdU and cell cycle assays revealed that overexpression of miR-16-5p inhibited the proliferation of MTEC1 cells. The results were also consistent with the many previous studies that have shown that miR-16 can modulate the cell cycle and inhibit cell proliferation in many kinds of cells[\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan additionalcitationids=\"CR39 CR40 CR41 CR42\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eCCND1\u003c/em\u003e and \u003cem\u003eCCNE1\u003c/em\u003e is a critical cell cycle genes and a well-known target gene of miR-16-5p involved in many kinds of cell proliferation [\u003cspan additionalcitationids=\"CR45 CR46\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Furthermore, the most similar to our work is a previous study showed that the expression levels of \u003cem\u003eCCND1\u003c/em\u003e were significantly decreased when upregulated the expression of miR-16-5p in epithelial cells [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. To further clarify the regulatory mechanism roles of miR-16-5p in MTEC1 cell proliferation, using 3\u0026acute;-UTR luciferase reporter assays, the specific binding of miR-16-5p to the 3\u0026rsquo;-UTR of \u003cem\u003eCCND1\u003c/em\u003e was confirmed. These results suggest that suppressing \u003cem\u003eCCND1\u003c/em\u003e expression in MTEC1 cells proliferation is an important mechanism by which miR-16-5p in MTEC1 cells.\u003c/p\u003e \u003cp\u003e \u003cem\u003eIgfbp3\u003c/em\u003e is known to be the most abundant gene expressed in many tissues, it was also classified as a suppressor in regulating cell proliferation[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. In addition, E2 was shown to exhibit a significantly inhibited role for \u003cem\u003eIgfbp3\u003c/em\u003e expression [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Here we found that elevated miR-16-5p levels correlated with a lower degree of \u003cem\u003eIgfbp3\u003c/em\u003e mRNA and protein expression in MTEC1 cells. To further analyze the regulatory mechanism of \u003cem\u003eIgfbp3\u003c/em\u003e in MTEC1 cell proliferation, we also found that miR-16-5p negatively regulated \u003cem\u003eIgfbp3\u003c/em\u003e expression via target binding as evidenced by the dual-luciferase reporter assay. This may be another important regulated mechanism that miR-16-5p has a growth-suppressive role in MTEC1 cell proliferation. Furthermore, the proliferation inhibits roles was also observed by EdU and cell cycle assay when knockdown of \u003cem\u003eIgfbp3\u003c/em\u003e in MTEC1 cells. All these results indicated that \u003cem\u003eIgfbp3\u003c/em\u003e is one of the key mediators in MTEC1 cell proliferation, which was coordinately regulated by E2-induced miR-16-5p in the E2-treated MTEC1 cells.\u003c/p\u003e \u003cp\u003eOn the other hand, to further confirm the associations between E2 and miR-16-5p expression in MTEC1 cells, we also found that miR-16-5p was significantly upregulated gradually in MTEC1 cells from 25 to 50 nmol/L E2 after treatment for 6 h, 12 h, 24 h, and 48 h, respectively. This confirmed that miR-16-5p is an E2-induced miRNA in response to E2-treated MTEC1 cells.\u003c/p\u003e \u003cp\u003eIn summary, we demonstrated that 50 nmol/L E2 can alter the expression of specific miRNAs in MTEC1 cells, and provide evidence that E2-induced miR-16-5p plays a modulation role in MTEC1 cell proliferation. These findings may provide new insight into the correlation between E2, cell cycle arrest, and miRNAs in TECs, and may also provide new mechanistic insights toward explaining E2 and thymus involution.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003eWe would like to give our sincere gratitude to the reviewers for their constructive comments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e The original study design was undertaken by DG and YL. YH and JT prepared figures 1-3. Data were analyzed by MC and YL. The manuscript was written by DG. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003eThis work was supported by the National Natural Scientific Foundation of China (Grant numbers [32102632] and [31572475]) and the Doctoral Scientific Research Foundation of Xinxiang University (Grant numbers [1366020120]), Key Scientific Research Projects in Colleges and Universities of Henan (Grant numbers[24A180023])\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003eEnquiries about data availability should be directed to the authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e The authors have no commercial or other associations that might pose a confict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChen R, Wang K, Feng Z, Zhang MY, Wu J, Geng JJ and Chen ZN (2020) CD147 deficiency in T cells prevents thymic involution by inhibiting the EMT process in TECs in the presence of TGFbeta. Cell Mol Immunol. doi: 10.1038/s41423-019-0353-7\u003c/li\u003e\n\u003cli\u003eChaudhry MS, Velardi E, Dudakov JA and van den Brink MR (2016) Thymus: the next (re)generation. Immunol Rev 271:56-71. doi: 10.1111/imr.12418\u003c/li\u003e\n\u003cli\u003eRezzani R, Nardo L, Favero G, Peroni M and Rodella LF (2014) Thymus and aging: morphological, radiological, and functional overview. Age (Dordr) 36:313-51. doi: 10.1007/s11357-013-9564-5\u003c/li\u003e\n\u003cli\u003ePalmer DB (2013) The effect of age on thymic function. Front Immunol 4:316. doi: 10.3389/fimmu.2013.00316\u003c/li\u003e\n\u003cli\u003eHale JS, Boursalian TE, Turk GL and Fink PJ (2006) Thymic output in aged mice. Proc Natl Acad Sci U S A 103:8447-52. doi: 10.1073/pnas.0601040103\u003c/li\u003e\n\u003cli\u003eManley NR, Richie ER, Blackburn CC, Condie BG and Sage J (2011) Structure and function of the thymic microenvironment. Front Biosci (Landmark Ed) 16:2461-77. doi: 10.2741/3866\u003c/li\u003e\n\u003cli\u003eAw D and Palmer DB (2011) The origin and implication of thymic involution. Aging Dis 2:437-43. \u003c/li\u003e\n\u003cli\u003eAnderson G, Lane PJ and Jenkinson EJ (2007) Generating intrathymic microenvironments to establish T-cell tolerance. Nat Rev Immunol 7:954-63. doi: 10.1038/nri2187\u003c/li\u003e\n\u003cli\u003eXing Y, Jameson SC and Hogquist KA (2013) Thymoproteasome subunit-beta5T generates peptide-MHC complexes specialized for positive selection. Proc Natl Acad Sci U S A 110:6979-84. doi: 10.1073/pnas.1222244110\u003c/li\u003e\n\u003cli\u003eVaidya HJ, Briones Leon A and Blackburn CC (2016) FOXN1 in thymus organogenesis and development. Eur J Immunol 46:1826-37. doi: 10.1002/eji.201545814\u003c/li\u003e\n\u003cli\u003eOlsen NJ, Olson G, Viselli SM, Gu X and Kovacs WJ (2001) Androgen receptors in thymic epithelium modulate thymus size and thymocyte development. Endocrinology 142:1278-83. doi: 10.1210/endo.142.3.8032\u003c/li\u003e\n\u003cli\u003eGray DH, Seach N, Ueno T, Milton MK, Liston A, Lew AM, Goodnow CC and Boyd RL (2006) Developmental kinetics, turnover, and stimulatory capacity of thymic epithelial cells. Blood 108:3777-85. doi: 10.1182/blood-2006-02-004531\u003c/li\u003e\n\u003cli\u003eGui J, Zhu X, Dohkan J, Cheng L, Barnes PF and Su DM (2007) The aged thymus shows normal recruitment of lymphohematopoietic progenitors but has defects in thymic epithelial cells. Int Immunol 19:1201-11. doi: 10.1093/intimm/dxm095\u003c/li\u003e\n\u003cli\u003eAnderson G and Jenkinson EJ (2001) Lymphostromal interactions in thymic development and function. Nat Rev Immunol 1:31-40. doi: 10.1038/35095500\u003c/li\u003e\n\u003cli\u003eHauri-Hohl MM, Zuklys S, Keller MP, Jeker LT, Barthlott T, Moon AM, Roes J and Hollander GA (2008) TGF-beta signaling in thymic epithelial cells regulates thymic involution and postirradiation reconstitution. Blood 112:626-34. doi: 10.1182/blood-2007-10-115618\u003c/li\u003e\n\u003cli\u003eZhou YJ, Peng H, Chen Y and Liu YL (2016) Alterations of Thymic Epithelial Cells in Lipopolysaccharide-induced Neonatal Thymus Involution. Chin Med J (Engl) 129:59-65. doi: 10.4103/0366-6999.172577\u003c/li\u003e\n\u003cli\u003eZhang J, Wang Y, Aili A, Sun X, Pang X, Ge Q, Zhang Y and Jin R (2019) Th1 Biased Progressive Autoimmunity in Aged Aire-Deficient Mice Accelerated Thymic Epithelial Cell Senescence. Aging Dis 10:497-509. doi: 10.14336/AD.2018.0608\u003c/li\u003e\n\u003cli\u003eFerrando-Martinez S, Ruiz-Mateos E, Dudakov JA, Velardi E, Grillari J, Kreil DP, Munoz-Fernandez MA, van den Brink MR and Leal M (2015) WNT signaling suppression in the senescent human thymus. J Gerontol A Biol Sci Med Sci 70:273-81. doi: 10.1093/gerona/glu030\u003c/li\u003e\n\u003cli\u003eBucci M, Roviezzo F, Cicala C, Pinto A and Cirino G (2002) 17-beta-oestradiol-induced vasorelaxation in vitro is mediated by eNOS through hsp90 and akt/pkb dependent mechanism. Br J Pharmacol 135:1695-700. doi: 10.1038/sj.bjp.0704641\u003c/li\u003e\n\u003cli\u003eYao G and Hou Y (2004) Thymic atrophy via estrogen-induced apoptosis is related to Fas/FasL pathway. Int Immunopharmacol 4:213-21. doi: 10.1016/j.intimp.2003.12.005\u003c/li\u003e\n\u003cli\u003eZoller AL, Schnell FJ and Kersh GJ (2007) Murine pregnancy leads to reduced proliferation of maternal thymocytes and decreased thymic emigration. Immunology 121:207-15. doi: 10.1111/j.1365-2567.2006.02559.x\u003c/li\u003e\n\u003cli\u003eZoller AL and Kersh GJ (2006) Estrogen induces thymic atrophy by eliminating early thymic progenitors and inhibiting proliferation of beta-selected thymocytes. J Immunol 176:7371-8. doi: 10.4049/jimmunol.176.12.7371\u003c/li\u003e\n\u003cli\u003eSelvaraj V, Bunick D, Finnigan-Bunick C, Johnson RW, Wang H, Liu L and Cooke PS (2005) Gene expression profiling of 17beta-estradiol and genistein effects on mouse thymus. Toxicol Sci 87:97-112. doi: 10.1093/toxsci/kfi219\u003c/li\u003e\n\u003cli\u003ePillai RS (2005) MicroRNA function: multiple mechanisms for a tiny RNA? RNA 11:1753-61. doi: 10.1261/rna.2248605\u003c/li\u003e\n\u003cli\u003eUcar O and Rattay K (2015) Promiscuous Gene Expression in the Thymus: A Matter of Epigenetics, miRNA, and More? Front Immunol 6:93. doi: 10.3389/fimmu.2015.00093\u003c/li\u003e\n\u003cli\u003eGuo D, Ye Y, Qi J, Tan X, Zhang Y, Ma Y and Li Y (2017) Age and sex differences in microRNAs expression during the process of thymus aging. Acta Biochim Biophys Sin (Shanghai) 49:409-419. doi: 10.1093/abbs/gmx029\u003c/li\u003e\n\u003cli\u003eGuo D, Ye Y, Qi J, Xu L, Zhang L, Tan X, Tan Z, Yu X, Zhang Y, Ma Y and Li Y (2016) MicroRNA-195a-5p inhibits mouse medullary thymic epithelial cells proliferation by directly targeting Smad7. Acta Biochim Biophys Sin (Shanghai) 48:290-7. doi: 10.1093/abbs/gmv136\u003c/li\u003e\n\u003cli\u003eGuo D, Ye Y, Qi J, Zhang L, Xu L, Tan X, Yu X, Liu Q, Liu J, Zhang Y, Ma Y and Li Y (2016) MicroRNA-181a-5p enhances cell proliferation in medullary thymic epithelial cells via regulating TGF-beta signaling. Acta Biochim Biophys Sin (Shanghai) 48:840-9. doi: 10.1093/abbs/gmw068\u003c/li\u003e\n\u003cli\u003eGong B, Wang X, Li B, Li Y, Lu R, Zhang K, Li B, Ma Y and Li Y (2020) miR-205-5p inhibits thymic epithelial cell proliferation via FA2H-TFAP2A feedback regulation in age-associated thymus involution. Mol Immunol 122:173-185. doi: 10.1016/j.molimm.2020.04.011\u003c/li\u003e\n\u003cli\u003ePapadopoulou AS, Dooley J, Linterman MA, Pierson W, Ucar O, Kyewski B, Zuklys S, Hollander GA, Matthys P, Gray DH, De Strooper B and Liston A (2011) The thymic epithelial microRNA network elevates the threshold for infection-associated thymic involution via miR-29a mediated suppression of the IFN-alpha receptor. Nat Immunol 13:181-7. doi: 10.1038/ni.2193\u003c/li\u003e\n\u003cli\u003eVrtacnik P, Ostanek B, Mencej-Bedrac S and Marc J (2014) The many faces of estrogen signaling. Biochem Med (Zagreb) 24:329-42. doi: 10.11613/BM.2014.035\u003c/li\u003e\n\u003cli\u003eWei C, Guo D, Li Y, Zhang K, Liang G, Li Y, Ma Y, Liu J and Li Y (2018) Profiling analysis of 17beta-estradiol-regulated lncRNAs in mouse thymic epithelial cells. Physiol Genomics 50:553-562. doi: 10.1152/physiolgenomics.00098.2017\u003c/li\u003e\n\u003cli\u003eSong M, Sun M, Xia L, Chen W and Yang C (2019) miR-19b-3p promotes human pancreatic cancer Capan-2 cells proliferation by targeting phosphatase and tension homolog. Ann Transl Med 7:236. doi: 10.21037/atm.2019.04.61\u003c/li\u003e\n\u003cli\u003eChiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C and Bartel DP (2010) Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Genes Dev 24:992-1009. doi: 10.1101/gad.1884710\u003c/li\u003e\n\u003cli\u003eMeunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P and Kaessmann H (2013) Birth and expression evolution of mammalian microRNA genes. Genome Res 23:34-45. doi: 10.1101/gr.140269.112\u003c/li\u003e\n\u003cli\u003eYamada K, Takizawa S, Ohgaku Y, Asami T, Furuya K, Yamamoto K, Takahashi F, Hamajima C, Inaba C, Endo K, Matsui R, Kitamura H and Tanaka S (2020) MicroRNA 16-5p is upregulated in calorie-restricted mice and modulates inflammatory cytokines of macrophages. Gene 725:144191. doi: 10.1016/j.gene.2019.144191\u003c/li\u003e\n\u003cli\u003eZhang N, Li WW, Lv CM, Gao YW, Liu XL and Zhao L (2020) miR-16-5p and miR-19b-3p prevent amyloid beta-induced injury by targeting BACE1 in SH-SY5Y cells. Neuroreport 31:205-212. doi: 10.1097/WNR.0000000000001379\u003c/li\u003e\n\u003cli\u003eZhang H, Yang K, Ren T, Huang Y, Tang X and Guo W (2018) miR-16-5p inhibits chordoma cell proliferation, invasion and metastasis by targeting Smad3. Cell Death Dis 9:680. doi: 10.1038/s41419-018-0738-z\u003c/li\u003e\n\u003cli\u003eKrell A, Wolter M, Stojcheva N, Hertler C, Liesenberg F, Zapatka M, Weller M, Malzkorn B and Reifenberger G (2019) MiR-16-5p is frequently down-regulated in astrocytic gliomas and modulates glioma cell proliferation, apoptosis and response to cytotoxic therapy. Neuropathol Appl Neurobiol 45:441-458. doi: 10.1111/nan.12532\u003c/li\u003e\n\u003cli\u003eCheng B, Ding F, Huang CY, Xiao H, Fei FY and Li J (2019) Role of miR-16-5p in the proliferation and metastasis of hepatocellular carcinoma. Eur Rev Med Pharmacol Sci 23:137-145. doi: 10.26355/eurrev_201901_16757\u003c/li\u003e\n\u003cli\u003eRuan L and Qian X (2019) MiR-16-5p inhibits breast cancer by reducing AKT3 to restrain NF-kappaB pathway. Biosci Rep 39. doi: 10.1042/BSR20191611\u003c/li\u003e\n\u003cli\u003eLiu Z, Wang Y, Wang L, Yao B, Sun L, Liu R, Chen T, Niu Y, Tu K and Liu Q (2019) Long non-coding RNA AGAP2-AS1, functioning as a competitive endogenous RNA, upregulates ANXA11 expression by sponging miR-16-5p and promotes proliferation and metastasis in hepatocellular carcinoma. J Exp Clin Cancer Res 38:194. doi: 10.1186/s13046-019-1188-x\u003c/li\u003e\n\u003cli\u003eZhang K, Han Y, Zhao Y, Sun Y, Zou M, Fu Y and Peng X (2019) Upregulated gga-miR-16-5p Inhibits the Proliferation Cycle and Promotes the Apoptosis of MG-Infected DF-1 Cells by Repressing PIK3R1-Mediated the PI3K/Akt/NF-kappaB Pathway to Exert Anti-Inflammatory Effect. Int J Mol Sci 20. doi: 10.3390/ijms20051036\u003c/li\u003e\n\u003cli\u003eBonci D, Coppola V, Musumeci M, Addario A, Giuffrida R, Memeo L, D\u0026apos;Urso L, Pagliuca A, Biffoni M, Labbaye C, Bartucci M, Muto G, Peschle C and De Maria R (2008) The miR-15a-miR-16-1 cluster controls prostate cancer by targeting multiple oncogenic activities. Nat Med 14:1271-7. doi: 10.1038/nm.1880\u003c/li\u003e\n\u003cli\u003eOfir M, Hacohen D and Ginsberg D (2011) MiR-15 and miR-16 are direct transcriptional targets of E2F1 that limit E2F-induced proliferation by targeting cyclin E. Mol Cancer Res 9:440-7. doi: 10.1158/1541-7786.MCR-10-0344\u003c/li\u003e\n\u003cli\u003eSun Y, Xiong Y, Yan C, Chen L, Chen D, Mi B and Liu G (2019) Downregulation of microRNA-16-5p accelerates fracture healing by promoting proliferation and inhibiting apoptosis of osteoblasts in patients with traumatic brain injury. Am J Transl Res 11:4746-4760. \u003c/li\u003e\n\u003cli\u003eWang F, Mao A, Tang J, Zhang Q, Yan J, Wang Y, Di C, Gan L, Sun C and Zhang H (2019) microRNA-16-5p enhances radiosensitivity through modulating Cyclin D1/E1-pRb-E2F1 pathway in prostate cancer cells. J Cell Physiol 234:13182-13190. doi: 10.1002/jcp.27989\u003c/li\u003e\n\u003cli\u003eWitalison EE, Cui X, Causey CP, Thompson PR and Hofseth LJ (2015) Molecular targeting of protein arginine deiminases to suppress colitis and prevent colon cancer. Oncotarget 6:36053-62. doi: 10.18632/oncotarget.5937\u003c/li\u003e\n\u003cli\u003eBasu PS, Majhi R, Ghosal S and Batabyal SK (2011) Peptidyl-arginine deiminase: an additional marker of rheumatoid arthritis. Clin Lab 57:1021-5. \u003c/li\u003e\n\u003cli\u003eShih HJ, Chen CL and Torng PL (2020) IGFBP3 inhibits angiogenesis through intracellular regulation of THBS1 expression. Am J Cancer Res 10:1728-1744. \u003c/li\u003e\n\u003cli\u003eMaekawa T, Takeuchi S, Kanayama M and Takahashi S (2009) Estradiol, progesterone, and transforming growth factor alpha regulate insulin-like growth factor binding protein-3 (IGFBP3) expression in mouse endometrial cells. Zoolog Sci 26:131-8. doi: 10.2108/zsj.26.131\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"miR-16-5p, 17β-Estradiol, TECs, cell proliferation, thymus involution","lastPublishedDoi":"10.21203/rs.3.rs-3618025/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3618025/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTo investigate the proliferation regulation role of 17β-Estradiol(E2)-induced miR-16-5p in mouse thymic epithelial cells. The miRNA expression profiles in the 50 nmo/L E2 treated MTEC1 cells were determined by high-throughput sequencing. Then the significantly upregulated miRNA expression that responsive to E2 was screened and validated. Subsequently, the proliferation functions and mechanism of screened miRNA were analyzed in MTEC1 cells. MiR-16-5p was found that significantly upregulated and had \u0026ldquo;high\u0026rdquo; levels of of expression among the 36 upregulation miRNAs, which were significantly induced by 50 nmol/L E2. Transfection assays showed that overexpression of miR-16-5p reduced cell viability, suppressed cell proliferation, and induced cell cycle arrest at the G0/G1 phase in MTEC1 cells. Results from further analysis confirmed \u003cem\u003eCCND1\u003c/em\u003e and \u003cem\u003eIgfbp3\u003c/em\u003e as the target genes of miR-16-5p, and that the effects of \u003cem\u003eIgfbp3\u003c/em\u003e knockdown were similar to those of miR-16-5p overexpression in MTEC1 cells. Moreover, it is similar to the roles of E2 affect MTEC1 cells proliferation, a significant up-regulation trend of miR-16-5p expression levels in MTEC1 cells was observed from 25 nmol/L to 50 nmol/L E2 after treatment for 6 h, 12 h, 24 h, and 48 h, respectively. This data indicated that the expression of miR-16-5p is an E2-responsive miRNA in MTEC1 cells, and also provided evidence that miR-16-5p has a proliferation role in MTEC1 cells proliferation. Suggests that E2 may affect thymic thymus involution by regulating the expression of miRNA in TECs.\u003c/p\u003e","manuscriptTitle":"The Proliferation Regulation Role of 17β-Estradiol-Induced miR-16-5p in Mouse Thymic Epithelial Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-11-17 18:12:24","doi":"10.21203/rs.3.rs-3618025/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9121e908-206f-4502-a120-b5cfc67111b3","owner":[],"postedDate":"November 17th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-12-03T14:59:29+00:00","versionOfRecord":[],"versionCreatedAt":"2023-11-17 18:12:24","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3618025","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3618025","identity":"rs-3618025","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}