Low to moderate dose 137 Cs (γ) radiation enhances M2 type macrophages function at short term associated with reduced inflammation at long term exposure in ApoE (-/-) mice

Low to moderate dose 137 Cs (γ) radiation enhances M2 type macrophages function at short term associated with reduced inflammation at long term exposure in ApoE (-/-) mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Low to moderate dose 137 Cs (γ) radiation enhances M2 type macrophages function at short term associated with reduced inflammation at long term exposure in ApoE (-/-) mice N. Rey, T. Ebrahimian, C . Gloaguen, D. Kereselidze, C. Elie, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3951325/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Effects of low doses of ionizing radiation on atherosclerosis are still a source of many uncertainties, and in particular whether these effects generate anti or pro-inflammatory responses. Furthermore, the delay of occurrence of such effects upon irradiation are unknown. Atheroprone ApoE (−/−) mice were exposed to single doses of 0, 0.05, 0.5 and 1 Gy of 137 Cs (γ) at 10.35 mGy.min − 1 dose rate. Short term (24 hours) effects on bone marrow-derived macrophage polarization and long term (100 days) consequences on atherosclerotic plaques were investigated. We found a significant dose-dependent increase of Chil3 and Retnla anti-inflammatory markers gene expression in M0 and M2 type macrophages upon 24 hours exposure and no effects on M1 types. These effects were associated with a dose-dependent increase of IL-10 and a reduction of IL-1beta secretions in M0 and M2 and an increase of IL-6 in M1 type macrophages. Circulating pro-inflammatory Ly6C High monocytes were reduced at 24 hours and anti-inflammatory Ly6C low monocytes were notably increased in the spleen 100 days upon irradiation. Long term exposures to any doses did not affect atherosclerotic plaque size determined by OilredO. However, a tendency in plaque stability, determined by collagen and alpha-smooth muscle actin increase was observed, associated with a significant reduction of plaque macrophage content at 1Gy. Taking together these findings show an increase of anti-inflammatory behavior of M2 macrophages with low to moderate doses of ionizing radiation at short term after irradiation, at long term these changes could influence atheromatous plaques after irradiation with decreased macrophages contents. These results suggest that the mechanisms that lead to on atheroprotective response after low and moderate doses of ionizing radiation would involve early effects on circulating monocytes and the macrophages polarization towards an anti-inflammatory profile. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Exposure to low dose of γ radiation implies thousands of people living particularly in areas close to Chernobyl or Fukushima power plant. Understanding the effects of low to moderate dose ionizing radiation (LMDIR) on atherosclerosis is still an ongoing process. It is well reported that cardiovascular diseases are aggravated with exposure to ionizing radiations (Mulrooney et al. 2016 ; Hoving et al. 2008 ; Shimizu et al. 2010 ; McGale et al. 2011 ; Bashar et al. 2014 ; Boivin et al. 1992 ). However, extrapolation through linear no threshold model does not seem to be reliable with low dose exposure and cardiovascular diseases (Vaiserman et al. 2018 ) and statistical limits prevent the risk-assessment under 0.5 Gy (Baselet et al. 2016 ). The dose of exposure is essential in predicting effects outcome. Recent studies have shown that effects caused by high doses are different from those caused by low doses. Indeed, Mitchel et al. (Mitchel et al. 2011 ) showed that effects of low doses were nonlinear in ApoE (−/−) mouse model and were atheroprotective. In contrast, Mancuso et al (Mancuso et al. 2015 ) showed a decrease in plaque density with chronic as opposed to acute exposure leading to detrimental effects on cardiovascular system. Le Gallic et al (Le Gallic et al. 2015a ) demonstrated that exposure to chronic LMDIR enhances plaque stability in ApoE (−/−) mice. These results confirm the modulatory effects of LMDIR in pre-existing inflammatory conditions (Franz Rödel et al. 2009 ; F Rödel et al. 2004 ; Lödermann et al. 2012 ; Hildebrandt et al. 2003 ; Dörthe Schaue et al. 2005 ; D. Schaue, Marples, et Trott 2002; Franz Rödel et al. 2004 ). One of the questions that has not yet been addressed, is long term effects of LMDIR on atherosclerosis. Exposure to high doses ionizing radiations was reported to have late effects on human body (Kamiya et al. 2015). In contrast, the possible long-term effects of LMDIR are still unclear. In the context of atherosclerosis long term effects of LMDIR, in terms of lesions size, stability and composition are unknown. A clinical study demonstrated that repeated LMDIR with a final dose of 3 Gy could have beneficial long term effects on painful skeletal disorder (Juniku et al. 2019 ). Atherosclerosis is a chronic inflammatory disease of medium and large arteries that could lead to myocardial infarction or stroke (Gister\aa et Hansson 2017). Plaque development is driven by entry of oxidized low density lipoproteins in the intima of arteries, triggering a pro-inflammatory reaction leading to transmigration of monocytes and their differentiation into macrophages that internalize ox-LDL to become foam cells. Foam cells contribute to plaque fragility. On the other hand, enrichment of smooth muscle cells within the plaque increases the stability, mainly by their capacity to produce collagen. Indeed, innate immune system is essential for the development and progression of atherosclerosis with monocytes and macrophages as main effectors (Gister\aa et Hansson 2017). Two subsets of circulating monocytes are identified in mice, The pro-inflammatory Ly6C High and patrolling Ly6C Low (Ziegler-Heitbrock et al. 2010 ; Yona et al. 2013 ; Geissmann, Jung, et Littman 2003; Ziegler-Heitbrock et al. 2010 ). Ly6C High subsets (Tacke et al. 2007 ; Swirski et al. 2007 ), expresse high levels of chemokine receptors CC-chemokine receptor 2 (CCR2) (Geissmann, Jung, et Littman 2003) and are recruited from the bone marrow and the spleen and give rise to M1 type pro-atherogenic macrophages (Robbins et al. 2012 ).They produce pro-inflammatory cytokines such as TNF-α, IL-18, IL-12, INF-γ or IL-1. Ly6C Low subpopulation is involved in wound repair and tissue remodeling (Auffray et al. 2007 ). They preferentially express cx3c-chemokine receptor 1 (CX3CR1) (Geissmann, Jung, et Littman 2003), and give rise to M2 type athero protective macrophages (Auffray et al. 2007 ; Brunet et al. 2016 ). They produce anti-inflammatory cytokines such as TGF-β or IL-10 (Sica et Mantovani 2012; Martinez et Gordon 2014; Murray et al. 2014a). T cells are also an important cell population within the atherosclerotic plaque (Song et al. 2001), there is also different T cell subtypes with pro-or anti-inflammatory properties (Tabas et Lichtman 2017). The aim of this study is to investigate short term effects of LMDIR on macrophage function, in terms of polarization, gene expression and cytokine production. As well as to evaluate potential long term effects on atherosclerotic plaque phenotype. Materials and methods Animals All experiments and procedures were carried out in accordance with the Guide for the Care and Use of Laboratory Animals as published by the French regulations for animal experiments (Ministry of Agriculture Order No. B92-032-01, 2006) with European Directives (86/609/CEE) and approved by the local ethical committee of the Institute for Radiological Protection and Nuclear Safety (permit number P15-06). All methods are reported in accordance with ARRIVE guidelines. 14, 15 and 16 weeks old ApoE (−/−) mice were purchased from Charles river and were maintained in our animal facility. Experiments were evaluated and approved by an internal animal ethical committee. Apolipoprotein E acts as the main ligand mediating removal of cholesterol enriched chylomicron and very low density lipoprotein remnants from the blood stream and plays an important role in lipoprotein metabolism. These mice develop atherosclerosis when fed a normal chow diet. The morphological features of early-stage lesions in ApoE (−/−) mice are very similar to those found in humans (Joven et al. 2007 ). Animals were maintained in a specific-pathogen-free environment and monitored daily. Irradiation Mice were exposed to LMDIR of 50, 500 and 1000 mGy of external γ rays from 137 Cs with a single dose rate (10, 35 mGy.min − 1 ). They were sacrificed 24h, or 100 days (long term) post irradiation. Short term effects were studied with primary cells. Long term effects were performed in order to study the phenotypical effects of ionizing radiations on atherosclerotic plaques. Isolation of bone-marrow-derived macrophages For cell isolation, femurs were isolated and placed in sterile petri dish containing sterile medium (RPMI 1640 + 10% fetal bovine serum and 1% streptomycin/penicillin) culture. Bone marrow was then extracted by flushing with 25-G needle, cells are then filtered with a 70 µm filter and centrifuged 10 min 500g. Cells were counted and distributed into 6-well cell culture plates at a concentration of 1.10 6 cells.ml − 1 and incubated at 37°C in 5% CO 2 /95% air for 1 hour prior medium change with RPMI 1640/10%/1%P/S with 50 ng.ml. −1 of Macrophage-Colony-Stimulating factor (MCSF) (Preprotech ref #315-02). Cells were maintained in culture for 5 days, with change of medium every 48 hours to remove non-adherent cells. On the fifth day, cells were polarized with IL-4 (10ng.ml − 1 ) (Preprotech ref #214 − 14) into M2 and with INFγ (50ng.ml − 1 ) (Preprotech ref #315-05) into M1 for 24 hours. Collagen and lipid staining Mice sacrificed 100 days post irradiation had hearts and aortas frozen in OCT. Cryosections of 7µm thickness were cut throughout the aortic sinus at several key points of the aortas for histological and immunohistochemical analysis. Five to ten sections per animal were stained with Oil Red O (Sigma-Aldrich) in order to evaluate plaque lipid contents, and 5–10 sections per animal were stained with picro-sirius red (Sigma Aldrich) to evaluate plaque collagen contents. Images were acquired using Axioscan. Mean Lesions and atherosclerotic area were calculated was calculated using Histolab software. Quantification of the positive stain area of plaque components was calculated as a percentage of total lesion area. Smooth muscle alpha-actin and macrophage immunofluorescent stainings. Macrophage and vascular smooth muscle cell plaque contents were determined by immunofluorescent staining with PE anti-mouse CD68 (diluted 1.100) (Biolegend clone FA-11) and mouse monoclonal anti-a-smooth muscle combined with FITC (diluted 1.250) (Sigma-Aldrich F3777). Lymphocyte content was assessed with rabbit anti-human CD3 (diluted 1.100) (DAKO, #A0452) and with secondary antibody goat-anti rabbit AF488 (diluted 1.400). Five to Seven sections were stained per animal. Nuclei was stained with DAPI. Cytokine Secretion Assay. Cell culture supernatants of polarized macrophages were harvested and stored at -80°C. IL-10 (M1000B), TGF-β (MB100B), TNF-α (MTA00B), Il-6 (M6000B), and Il-1β/Il-1F2 (MLB00C) levels were determined with ELISA kits (R&D Systems). ELISA’s were performed according to manufacturer’s instructions. Briefly, 50 µl of undiluted supernatant were incubated in flat transparent 96 well plate pre-coated with primary antibody for 2 hours and washed 4 or 5 times with a wash buffer solution containing distilled water and purchased wash buffer concentrate. After incubation, secondary antibody is added and incubated for another 2 hours and washed. Samples are then revealed after an incubation of 30 minutes by adding 100 µl of tetramethylbenzidine per well and reaction is stopped with 100 µl solution of diluted hydrochloric acid. Absorbance was measured in a microplate reader at 450 nm and weightlent correction was applied at 540 nm. Flow cytometry All organs (spleen, blood) were labeled with a mix of 6 antibodies CD115 (PE/Cy7 anti-mouse clone AF598 Biolegend #135524), CD11b (Efluor450 Clone M1/70 # 48-9668-80, Invitrogen), Ly6C (APC, clone RB6-8C5, # 17-5931-82), Ly6Gr1 (FITC, clone 1A8-Ly6g #11–0112), Cx3CR1 (Percp/Cy5.5 anti-mouse clone 5A011F11 #149010 Biolegend), CCR2 (PE #150610, clone 5A203G11 Biolegend). Briefly, blood Cells (1.10 6 blood cells) were treated with ACK lysis buffer in order to deplete erythrocytes. Then samples were labeled for 15 minutes with FcR blocking reagent (# 130-059-901- Mylteni) to prevent non-specific labeling. Cells were then washed with PBS after centrifugation (500 g). Bone marrow Cells were collected by flushing of bone marrow cells of mice femur. (1.10 6 cells). Cells were then labeled with FcR blocking reagent and then with antibody mix. For Spleen cells, spleens were crushed and then filtered with a 70µm filter. Cells were then collected, labeled with with FcR blocking reagent to prevent non-specific labeling, and then labeled with the antibody mix. Cells were then washed with PBS after centrifugation (500 g). Cells were washed twice with PBS containing 2% of FBS. Samples of labeled cells were then kept in cold ice in the dark until their passage in the cytometer. For BMDM cell culture, cells were removed from the 6 well plates and placed in PBS at 4°C at 1.10 − 6 cells per tube and stained with FcR blocking reagent (# 130-059-901- Mylteni) for 15 minutes and labeled with a mix of CD11b (PeCy7 clone M1/70 #11-0112-82 Invitrogen), F4-80 (PE clone 30 F11 #12-4801-82 Invitrogen) CD 206 (APC #46879 Invitrogen). Fluorescence was measured by cytometry using FACSCanto II (BD Biosciences) and analyzed with Flowjo Software. Compensation beads were used for color compensation, and FMO samples were used as negative control. PCR Total messenger RNA was extracted from bone-marrow-derived macrophages using Tri-Reagent Solution (Life technologies-T9424). RNA concentration was determined using Nanodrop ND1000 spetrophotometer and RNA purity was assessed using Agilent 2100 Bioanalyzer. One microgram of total mRNA was synthesized to 20 µl for cDNA, using the high-capacity cDNA Reverse Transcription Kit from Applied Biosystems (Thermofisher Scientific Baltics UAB) according to manufacturer’s protocol and performed with SYBR Mastercycler gradient (#5331). Quantitative chain polymerase reaction analysis was performed with a QuantStudio 12K Flex Real-Time PCR System (Life technologies) using and a standard cycler protocol (50°C for 2 minutes followed by 10 minutes at 95°C, then starting with the first cycle, 95°C for 15 seconds, and 60°C for 1 minute followed by a melting curve, 95°C for 15 seconds, 60°C for 1 minute, and 95°C for 15 seconds repeated 40 times). All samples were normalized to Gapdh (glyceraldehyde-3-phospate dehydrogenase), Hprt (Hypoxanthine-guanine phosphoribosyltransferase) and βactin by geometric mean. The control samples served as a reference value of 1. All simples were run in duplicate and quantification was performed using 2 −ΔΔCtT method. The following primers were used: Hprt ( Forward : TCAGTCAACGGGGACATAAA, Reverse : GGGGCTGTACTGCTTAACCAG). Gapdh ( Forward : AGGTCGGTGTGAACGGATTTG, Reverse : TGTAGACCATGTAGTTGAGGTCA) β-actin ( Forward : AGGAAGGAAGGCTGGAAGAG, Reverse : TCCCTGGAGAAGAGCTACGA) Interleukin 6 ( Forward : CCTTCTTGGGACTGATGCTGGTG, Reverse : AGGTCTGTTGGGAGTGGTATCCTC) Arginase 1 ( Forward : CTCCAAGCCAAAGTCCTTAGAG, Foward : CTCCAAGCCAAAGTCCTTAGAG) Retnla ( Foward : GGAGCTGTCATTAGGGACATCA, Reverse : TCCCAAGATCCACAGGCAAA) Chil3 ( Forward : TCTGGGTACAAGATCCCTGAA, Reverse : TTTCTCCAGTGTAGCCATCCTT) TNFα ( Foward : AGCCGATGGGTTGTACCTTG Reverse : GTGGGTGAGGAGCACGTAGTC) EGR2 ( Forward : CCCTTTGACCAGATGAACGGAG, Reverse : AAGCTACTCGGATACGGGAGATC) Statistical analysis In our study, we present two approaches of statistical analysis. The first approach is for univariate analysis while the second one is to multivariate analysis. Univariate involves the analysis of a single variable and multivariate analysis examines all variables, which will give a better idea regarding the variances involved with the data. Results to univariate analysis are presented as means ± SEM. Data were compared with two-way analysis of variance (ANOVA) or two-way ANOVA for repeated measures, with all ANOVA tests followed by a Student–Newman–Keuls posthoc test, or with an unpaired t-test, as appropriate. P < 0.05 was considered statistically significant. In the case of multivariate analysis, we use multi-blocks analysis (Regularized Generalized Canonical Correlation Analysis, RGCCA) as described in (Garali et al. 2018 ). From a statistical data analysis point of view, RGCCA subsumes a remarkably large number of well-known methods. Briefly, for polarization experiment we combine data from flow cytometry, genic expression and ELISA assay in order to evaluate the impact of irradiation on multiple parameters (MCSF, Il4, INFγ). We consider each type of data as a block (a modality). We then illustrate how relationships between the most relevant variables can be displayed and we interpret the results by visualizing the observations and variables in a common space. In the search of biomarkers associated with the irradiation dose rate we apply RGCCA to identify variables from the three blocks (flow cytometry, genic expression and ELISA data). The between-block connection associated with this objective of analysis is presented in Fig. 2 with an additional connection between the superblock and the irradiation dose. A superblock is defined as the concatenation of all the blocks and the corresponding global components can be derived. The space spanned by the global components is viewed as a compromise space that integrates all the modalities, which is called a common space. In order to ensure comparability between variables and blocks, the data have to be preprocessed. To make variables comparable, we standardize our data (zero mean and unit variance) and we opt for a strategy that divides each block by the square root of its number of variables (Westerhuis, Kourti, et MacGregor 1998). Results LMDIR enhances gene expression of anti-inflammatory Chil-3, Retnla, Arg-1 and Egr2 in M0 and M2 type macrophages at 24 hours of irradiation. We previously discussed the response to low dose of ionizing irradiation to inflammation as a modulatory effect. Studying the impact of LMDIR on macrophages secretory function would bring additional insight on macrophage response to LMDIR. Bone marrow-derived cells from ApoE (−/−) mice were polarized with IL-4 and INFγ into M2 and M1 type macrophages respectively. Figure 1 represents levels of gene expression of pro inflammatory M1 markers IL-6 and TNF-α and anti-inflammatory M2-markers Arginase 1, Retnla, Chil3 and Egr2 in M0, M1 and M2 macrophages according different doses. For M0 macrophages we observe that M2 markers were significantly upregulated with 1 Gy exposure (Chil3: 4.5 fold (p = 0.0005), Arg1: 2.9 fold (p = 0.002)).In contrast, the pro inflammatory TNF-α expression is reduced by 50% with 0.5 Gy (p = 0.006). For M1 macrophages, we did not observe significant changes at any dose of exposure (Fig. 1 C). Similarly, to M1 macrophages, the analysis of gene expression shows a significant upregulation in anti-inflammatory parameters for M2 macrophages (Fig. 1 A.). In fact, there is a significant increase with each dose for the genes: chil3 (3.1 fold at 0.05 Gy-p = 0.005-2.8 fold at 0.5 Gy-p = 0.0007, 2.15 fold at 1 Gy-p = 0.002) and Retnla (1.66 fold at 0.05 Gy-p = 0.04, 2.28 fold at 0.5 Gy-p = 0.002 and 1.78 fold at 1 Gy-p = 0.02). Arg1 and Egr2 were also upregulated at 1.67 (p = 0.001) and 1.43 (p = 0.008) fold respectively at the highest dose of exposure (1Gy). No difference was observed in pro-inflammatory markers IL-6 and TNFα. These results suggest an anti-inflammatory response in M1 and M0 macrophages. LMDIR enhances IL-10 secretion by M0 and M2 and IL-6 secretion by M1 macrophages at 24 hours of irradiation. Twenty-four hours after irradiation, analysis of cytokine secretion shows an increase in the secretion of IL-10 by M2 macrophages (Fig. 2 .A) with all tested doses (2.1 fold at 0.05 Gy, 3.3 fold at 0.5 Gy and 3 fold at 1 Gy (p = 0.017, p < 0.001 and p = 0.036). Surprisingly, an 8-fold increase in TNF-α (p = 0.018) at 0.5 Gy was also observed. Similarly, in M0 macrophages IL-10 was also increased 1.7 fold at 0.5 Gy (p = 0.029) and 1.5 at 1 Gy (p = 0.029) (Fig. 2 .B). In M1 macrophages we detected a 3-fold increase of IL-6 (p = 0.008) at 0.5 Gy (Fig. 2 .C). Superblock analysis correlates lL-10 secretion with 0.5 and 1 Gy in M0 and M2 macrophages. No notable changes seem to be induced by irradiation within macrophages phenotype parameters (data not shown). RGCCA analysis combining RT-PCR, ELISA and flow cytometry showed a clear separation according to component 1 (Fig. 3 − 1) for M0 macrophages between lower doses control and 0.05 Gy groups and higher doses 0.5 and 1 Gy group 24 hours after irradiation. The separation of lower doses is correlated with IL-1 secretion whereas the 0.5 and 1 Gy doses were associated with IL-10 cytokine secretion and with F480-CD206 + phenotypes. For M1 macrophages, we observe a more pro inflammatory secretion as IL-1 is significantly associated with lower doses, and TNFα is correlated with 0.5 and 1 Gy (Fig. 3 − 2). Finally, M2 type have a similar response as M0 type macrophages, such that 0 and 0.05 Gy dose are in favor with an enhancement of IL-1 secretion, IL-10 is significantly correlated with 0.5 and 1 Gy doses (Fig. 3 – 3 ). Increased blood Ly6C High and Ly6C Low monocytes 10 days post irradiation, whereas only splenic Ly6C low was increased 100 days post irradiation. Flow cytometry analysis of blood samples provided an overview of the effects of irradiation on circulating monocytes. Ly6C High monocytes are Pro inflammatory monocytes and accumulate in atherosclerotic plaque in contrast to Ly6C low monocytes that are anti inflammatorry (Tacke et al. 2007 ). We observed several differences, overtime, in the proportions of both Ly6C High and Ly6C Low : Twenty-four hours post irradiation, Ly6C High proportions were significantly decreased at 1 Gy by 0.25-fold (p = 0.002) compared to control. 10 days post irradiation, the opposite effect occurred and Ly6C High monocytes were increased by 3-fold (p < 0.001). Finally, after 100 days, no differences were observed (Fig. 4 A) For Ly6C low subtypes, a significant 5-fold increase (p = 0.004) was detected at 1 Gy 10 days post irradiation. No significant changes occurred in any other time point or doses (Fig. 4 B, Fig. 4 C). Spleen can be a site of extramedullary hematopoiesis and has been shown to be a monocytes reservoir (Swirski et al. 2009 ) and is believed to be the source of inflammatory ly6C high monocytes that infiltrate atherosclerotic lesions (Robbins et al. 2012 ). These monocytes have a similar phenotype than those in circulating blood and can be mobilized to the injured vessels. Flow cytometry analysis of spleen samples provided an insight of Ly6C High and Ly6C low proportions at two time-points, 10 and 100 days post irradiation. A 0.3-fold decrease was found (p = 0.015) at 0.5 Gy for Ly6C High subtypes compared to the control group (Fig. 5 A), and no changes in Ly6C low at 10 days post irradiation. However, a significant 3-fold increase of Ly6C Low was observed at 100 days post irradiation, at 0.05 (p = 0.048) and 1 Gy (p = 0.035) (Fig. 5 B, Fig. 5 C). LMDIR does not affect atherosclerotic plaque size and stability at 100 days post irradiation. In terms of plaque size and composition, Oil red O staining revealed no differences in atherosclerotic lesion size. Collagen content assessed by Picrosirius red staining (Fig. 6 ) and α SMA not show any differences at any doses of exposure (Fig. 7 ). LMDIR decreases macrophage content at higher doses and does not alter lymphocyte content. Plaque CD68 + macrophages contents (Fig. 8 ) shows a linear decrease as the dose of exposure increases, and macrophage content was significantly reduced from 12–1.5% 100 days post irradiation (p = 0.036) as compared to non-exposed controls. Plaque lymphocyte contents, assessed by CD3 staining (Fig. 9 ) was not different between groups although CD3 + staining tended to increase with1 Gy exposure but did not reach the significance. Discussion In this study, we evaluated short and long term effects of LMDIR on macrophages in atheroprone ApoE (−/−) mice. We found that moderate doses favor an anti-inflammatory M2-prone response at short term with M2 and M0 macrophages. Additionally, 1 Gy dose triggers a decrease in plaque CD68 + macrophages at long term. Macrophages can be in vitro differentiated into classically activated M1 type by LPS or INFγ, that mediate defense of the host against a wide range of pathogens, and participate in several chronic inflammatory diseases (Murray et Wynn 2011) including atherosclerosis. Or into alternatively activated M2 type with the capacity to secrete anti-inflammatory IL-10 and TGFβ and are involved in wound healing (Ferrante et Leibovich 2012; Sica et Mantovani 2012; Kiefer et al. 2001 ). Our study showed that LMDIR led to an increase in specific genes related to M2 macrophages, such as Egr2, Arg-1, Chil3 and Retnla that were all upregulated at 1Gy dose and Chil3 and Retlna were also significantly upregulated at lower doses (0.05 and 0.5). IL-4 is one of the main cytokines driving M2 polarization, and is an enhancer of Arg-1, Chil3 Retnla, and Egr2 (Veremeyko et al. 2018 ; Martinez, Helming, et Gordon 2009). An argument could be made that LMDIR facilitates IL-4 role of increasing the expression of these specific genes. Also, Egr2 controls inflammation by regulating B and T response and by preventing release of pro inflammatory cytokines (Li et al. 2012 ). It has been shown that knock down of Egr2 decreases expression of Arg-1, Retnla and Chil-3 (Veremeyko et al. 2018 ) thus an enhanced expression of Egr2 could stimulate expression of the other 3 M2 markers. On the other hand, exposure to LMDIR also enhanced secretion of IL-10 by M2 macrophages at 0.5 and 1 Gy suggesting that moderate doses potentiate anti-inflammatory role of M2 macrophages. In addition, RGCCA analysis correlated the enhanced secretion of IL-10 with higher proportions of CD11b + F4/80-CD206 + macrophages exposed to 0.5 and 1 Gy. CD206 is a transmembrane glycoprotein considered as an M2 type macrophage marker (Porcheray et al. 2005 ; Murray et al. 2014b) and is known to be upregulated by IL-10 (Svensson et al. 2011 ). One could believe that LMDIR enhances anti-inflammatory cytokine secretion by increasing expression of CD206 on macrophage cell membrane. However, there is no evidence in the literature that IL-10 stimulates M2 marker genes mentioned above, in addition, Egr2 has the propriety to inhibit IL-10 (Veremeyko et al. 2018 ). Therefore, LMDIR could impact both cytokine secretion and gene expression in an independent manner. In other studies, bone marrow-derived macrophages in C57/bl6 irradiated mice have an anti-inflammatory profile, with an enhancement of M2 related gene expression and an increase of the expression of Arg-1 (Coates et al. 2008 ). These effects were obtained with much higher dose than us (4 Gy) but were surprisingly similar. More recently, Wunderlich et al (Wunderlich et al. 2015 ) exposed peritoneal macrophages to low doses of X rays, and found that M1 type macrophages secreted higher levels of TGF-β and lower doses of IL-1β at 0.5 Gy. which is in favor of an anti-inflammatory response induced by LMDIR. In the context of atherosclerosis, macrophage polarization into an M2-type could have a potential protective effect on the disease, by reducing inflammation. Regarding blood monocytic populations, Ly6C high subtypes were highly reduced with 1 Gy exposure, however the opposite effect is observed with the same dose at day 10 post irradiation, with a 4-fold increase as compared to the control group. This suggests an increased proliferation of these subsets only few days after irradiation since no changes were observed at day 100 post irradiation. Similarly, patrolling Ly6C low monocytes were also increased by 5-fold with 1 Gy exposure, as Ly6C High monocyte trend, therefore we believe that irradiation did not induce monocyte conversion from Ly6C high into Ly6C Low . Interestingly, Splenic Ly6C low subtypes were significantly increased not at 10 but 100 days post irradiation in a nonlinear manner with 0.05 and 1 Gy exposures compared to controls. This profile is different from the blood and could be a long-term effect of an increased Ly6C low reservoir. One possibility could be increased blood Ly6C +/- monocytes entered in the spleen. We also know that spleen can be an important source of monocytes during inflammation and that they can be recruited into the atherosclerotic plaque (Swirski et al. 2009 ), they are also important in resolving inflammation in heart failure (Halade et al. 2018 ). The use of fate mapping techniques or adoptive transfer could help to predict the effects of LMDIR on the splenic reservoir and the atherosclerotic plaque. One of the main questions of our study were long term effects of LMDIR on plaque size, stability and inflammatory profile. Atherosclerotic plaques are characterized by an increase in the proliferation of oxidized LDL-capturing macrophages, responsible of highly inflammatory necrotic core formation. This phenomenon are associated with plaque instability, with a decrease in smooth muscle cells and collagen contents, a thin fibrous cap which eventually could cause plaque rupture (Virmani et al. 2000 ; 2005 ). Although plaque rupture is rare in mice as compared to humans, similar morphological features of atheroma prone to rupture can be found in their lesions (Falk et al. 2007 ). Plaque collagen content, that is an index of plaque stability showed no difference between exposed and non-exposed animals. Also, LMDIR did not affect plaque size and lipid contents, indicating that plaque morphology remains unchanged long term after exposure. Regarding immune cells within the plaque, although CD3 + lymphocytes were unchanged, CD68 + macrophages were significantly decreased with 1 Gy exposure, indicating possibly a reduced macrophage proliferation withmoderate irradiation, decreasing inflammation in atheromatous plaque. However, we have to keep in mind that CD68 marker could also be expressed by smooth muscle cells, as it has been previously described (Basatemur et al. 2019 ). However, since plaque smooth muscle cells were not decreased compared to controls, we consider that decrease of CD68 + concerns mainly plaque macrophages. This study showed that LMDIR enhanced anti-inflammatory function of M2 macrophages with 1 Gy exposure. An increase of IL-10 secretion inhibits macrophage activation and proliferation (O’Farrell et al. 1998 ) and the increase of M2 gene markers is an indicator of an enhanced activity of M2 macrophages which could induce plaque regression. The decrease in total plaque macrophages 100 days post irradiation could be a long-term consequence of the observed short term M2 macrophage activation by LMDIR. Our results suggests that exposure of ApoE (-/-) mice to LMDIR regulates immune response at short term and long term following irradiation. First an anti-inflammatory response of primary M0 and M2 macrophages occurs, followed by long term decrease in plaque macrophages at 1 Gy exposure. These results are in line with an atheroprotective effects of moderate doses of ionizing radiations observed in previous studies (Le Gallic et al. 2015b ; Ebrahimian et al. 2017 ; Mitchel et al. 2011 ; Mancuso et al. 2015 ). Declarations Author Contributions Conceptualization, Talin Ebrahimian, Stephanie Lehoux and Teni Ebrahimian; Data curation, Nicolas Rey, Céline Gloaguen, Chloe Brizais and Florence Bachelot; Formal analysis, Nicolas Rey, Céline Gloaguen, Dimitri Kereselidze, Chloe Brizais, Florence Bachelot and Imene Garali-Zineddine; Funding acquisition, Teni Ebrahimian; Investigation, Nicolas Rey; Methodology, Nicolas Rey, Céline Gloaguen, Dimitri Kereselidze, Christelle Elie, Chloe Brizais, Florence Bachelot, Goran Riazi, Virginie Monceau and Christelle Demarquay; Software, Nicolas Rey, Virginie Monceau and Imene Garali-Zineddine; Supervision, Stephanie Lehoux and Teni Ebrahimian; Validation, Talin Ebrahimian, Christelle Demarquay, Dmitry Klokov and Stephanie Lehoux; Visualization, Dmitry Klokov; Writing – original draft, Nicolas Rey; Writing – review & editing, Talin Ebrahimian. Data Availability/ Availability of Data and Materials. The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. References Auffray, Cedric, Darin Fogg, Meriem Garfa, Gaelle Elain, Olivier Join-Lambert, Samer Kayal, Sabine Sarnacki, Ana Cumano, Gregoire Lauvau, et Frederic Geissmann. 2007. « Monitoring of blood vessels and tissues by a population of monocytes with patrolling behavior ». Science 317 (5838): 666–670. Basatemur, Gemma L, Helle F Jørgensen, Murray CH Clarke, Martin R Bennett, et Ziad Mallat. 2019. « Vascular smooth muscle cells in atherosclerosis ». Nature reviews cardiology , 1–18. Baselet, Bjorn, Charlotte Rombouts, Abderrafi Mohammed Benotmane, Sarah Baatout, et An Aerts. 2016. « Cardiovascular diseases related to ionizing radiation: The risk of low-dose exposure (Review) ». International Journal of Molecular Medicine 38 (6): 1623‑41. Bashar, Khalid, Donagh Healy, Mary Clarke-Moloney, Paul Burke, Eamon Kavanagh, et Stewart-Redmond Walsh. 2014. « Effects of neck radiation therapy on extra-cranial carotid arteries atherosclerosis disease prevalence: systematic review and a meta-analysis ». PloS one 9 (10): e110389. Boivin, Jean-François, George B Hutchison, Jay H Lubin, et Peter Mauch. 1992. « Coronary artery disease mortality in patients treated for Hodgkin’s disease ». Cancer 69 (5): 1241–1247. Brunet, Alexandre, Manon LeBel, Benoit Egarnes, Carine Paquet-Bouchard, Anne-Julie Lessard, Jacques P Brown, et Jean Gosselin. 2016. « NR4A1-dependent Ly6Clow monocytes contribute to reducing joint inflammation in arthritic mice through Treg cells ». European journal of immunology 46 (12): 2789–2800. Coates, Philip J, Jana K Rundle, Sally A Lorimore, et Eric G Wright. 2008. « Indirect macrophage responses to ionizing radiation: implications for genotype-dependent bystander signaling ». Cancer research 68 (2): 450–456. Ebrahimian, T. G., L. Beugnies, J. Surette, N. Priest, Y. Gueguen, C. Gloaguen, M. Benderitter, J. R. Jourdain, et K. Tack. 2017. « Chronic Exposure to External Low-Dose Gamma Radiation Induces an Increase in Anti-inflammatory and Anti-oxidative Parameters Resulting in Atherosclerotic Plaque Size Reduction in ApoE–/–Mice ». Radiation research 189 (2): 187‑96. Falk, Erling, Stephen M Schwartz, Zorina S Galis, et Michael E Rosenfeld. 2007. « Neointimal cracks (plaque rupture?) and thrombosis in wrapped arteries without flow ». Arteriosclerosis, thrombosis, and vascular biology 27 (1): 248–249. Ferrante, Christopher J, et Samuel Joseph Leibovich. 2012. « Regulation of macrophage polarization and wound healing ». Advances in wound care 1 (1): 10–16. Garali, Imene, Isaac M Adanyeguh, Farid Ichou, Vincent Perlbarg, Alexandre Seyer, Benoit Colsch, Ivan Moszer, et al. 2018. « A strategy for multimodal data integration: application to biomarkers identification in spinocerebellar ataxia ». Briefings in bioinformatics 19 (6): 1356–1369. Geissmann, Frederic, Steffen Jung, et Dan R Littman. 2003. « Blood monocytes consist of two principal subsets with distinct migratory properties ». Immunity 19 (1): 71–82. Gister\aa, Anton, et Göran K Hansson. 2017. « The immunology of atherosclerosis ». Nature Reviews Nephrology 13 (6): 368. Halade, Ganesh V, Paul C Norris, Vasundhara Kain, Charles N Serhan, et Kevin A Ingle. 2018. « Splenic leukocytes define the resolution of inflammation in heart failure ». Science signaling 11 (520): eaao1818. Hildebrandt, G, A Radlingmayr, S Rosenthal, R Rothe, J Jahns, M Hindemith, F Rödel, et F Kamprad. 2003. « Low-dose radiotherapy (LD-RT) and the modulation of iNOS expression in adjuvant-induced arthritis in rats ». International journal of radiation biology 79 (12): 993–1001. Hoving, Saske, Sylvia Heeneman, Marion JJ Gijbels, Johannes AM te Poele, Nicola S Russell, Mat JAP Daemen, et Fiona A Stewart. 2008. « Single-dose and fractionated irradiation promote initiation and progression of atherosclerosis and induce an inflammatory plaque phenotype in ApoE-/- mice ». International Journal of Radiation Oncology* Biology* Physics 71 (3): 848–857. Joven, Jorge, Anna Rull, Natàlia Ferré, Joan Carles Escolà-Gil, Judit Marsillach, Blai Coll, Carlos Alonso-Villaverde, Gerard Aragones, Joan Claria, et Jordi Camps. 2007. « The results in rodent models of atherosclerosis are not interchangeable: the influence of diet and strain ». Atherosclerosis 195 (2): e85–e92. Juniku, Nderim, Oliver Micke, M Heinrich Seegenschmiedt, et Ralph Muecke. 2019. « Radiotherapy for painful benign skeletal disorders ». Strahlentherapie und Onkologie 195 (12): 1068–1073. Kamiya, Kenji, Kotaro Ozasa, Suminori Akiba, Ohstura Niwa, Kazunori Kodama, Noboru Takamura, Elena K. Zaharieva, Yuko Kimura, et Richard Wakeford. 2015. « Long-term effects of radiation exposure on health ». The Lancet 386 (9992): 469‑78. Kiefer, Reinhard, Bernd C Kieseier, Guido Stoll, et Hans-Peter Hartung. 2001. « The role of macrophages in immune-mediated damage to the peripheral nervous system ». Progress in neurobiology 64 (2): 109–127. Le Gallic, Clélia, Yohann Phalente, Line Manens, Isabelle Dublineau, Marc Benderitter, Yann Gueguen, Stephanie Lehoux, et Teni G. Ebrahimian. 2015a. « Chronic Internal Exposure to Low Dose 137 Cs Induces Positive Impact on the Stability of Atherosclerotic Plaques by Reducing Inflammation in ApoE-/-Mice ». PloS one 10 (6): e0128539. ———. 2015b. « Chronic Internal Exposure to Low Dose 137Cs Induces Positive Impact on the Stability of Atherosclerotic Plaques by Reducing Inflammation in ApoE-/- Mice ». Édité par Esther Lutgens. PLOS ONE 10 (6): e0128539. https://doi.org/10.1371/journal.pone.0128539. Li, Suling, Tizong Miao, Meera Sebastian, Punamdip Bhullar, Emma Ghaffari, Mengya Liu, Alistair LJ Symonds, et Ping Wang. 2012. « The transcription factors Egr2 and Egr3 are essential for the control of inflammation and antigen-induced proliferation of B and T cells ». Immunity 37 (4): 685–696. Lödermann, Barbara, Roland Wunderlich, Silke Frey, Christine Schorn, Sonja Stangl, Franz Rödel, Ludwig Keilholz, Rainer Fietkau, Udo S Gaipl, et Benjamin Frey. 2012. « Low dose ionising radiation leads to a NF-κB dependent decreased secretion of active IL-1β by activated macrophages with a discontinuous dose-dependency ». International journal of radiation biology . Mancuso, Mariateresa, Emanuela Pasquali, Ignacia Braga-Tanaka III, Satoshi Tanaka, Alessandro Pannicelli, Paola Giardullo, Simonetta Pazzaglia, Soile Tapio, Michael J. Atkinson, et Anna Saran. 2015. « Acceleration of atherogenesis in ApoE−/− mice exposed to acute or low-dose-rate ionizing radiation ». Oncotarget 6 (31): 31263. Martinez, Fernando O, et Siamon Gordon. 2014. « The M1 and M2 paradigm of macrophage activation: time for reassessment ». F1000prime reports 6. Martinez, Fernando O, Laura Helming, et Siamon Gordon. 2009. « Alternative activation of macrophages: an immunologic functional perspective ». Annual review of immunology 27: 451–483. McGale, Paul, Sarah C Darby, Per Hall, Jan Adolfsson, Nils-Olof Bengtsson, Anna M Bennet, Tommy Fornander, et al. 2011. « Incidence of heart disease in 35,000 women treated with radiotherapy for breast cancer in Denmark and Sweden ». Radiotherapy and Oncology 100 (2): 167–175. Mitchel, R. E. J., M. Hasu, M. Bugden, H. Wyatt, G. Hildebrandt, Y. X. Chen, N. D. Priest, et S. C. Whitman. 2013. « Low-Dose Radiation Exposure and Protection Against Atherosclerosis in ApoE–/–Mice: The Influence of P53 Heterozygosity ». Radiation research 179 (2): 190‑99. Mitchel, R. E. J., M. Hasu, M. Bugden, H. Wyatt, M. P. Little, A. Gola, G. Hildebrandt, N. D. Priest, et S. C. Whitman. 2011. « Low-dose radiation exposure and atherosclerosis in ApoE−/− mice ». Radiation research 175 (5): 665‑76. Mulrooney, Daniel A, Gregory T Armstrong, Sujuan Huang, Kirsten K Ness, Matthew J Ehrhardt, Vijaya M Joshi, Juan Carlos Plana, et al. 2016. « Cardiac outcomes in adult survivors of childhood cancer exposed to cardiotoxic therapy: a cross-sectional study ». Annals of internal medicine 164 (2): 93–101. Murray, Peter J, Judith E Allen, Subhra K Biswas, Edward A Fisher, Derek W Gilroy, Sergij Goerdt, Siamon Gordon, et al. 2014a. « Macrophage activation and polarization: nomenclature and experimental guidelines ». Immunity 41 (1): 14–20. ———. 2014b. « Macrophage activation and polarization: nomenclature and experimental guidelines ». Immunity 41 (1): 14–20. Murray, Peter J, et Thomas A Wynn. 2011. « Protective and pathogenic functions of macrophage subsets ». Nature reviews immunology 11 (11): 723–737. O’Farrell, Anne-Marie, Ying Liu, Kevin W Moore, et Alice L-F Mui. 1998. « IL-10 inhibits macrophage activation and proliferation by distinct signaling mechanisms: evidence for Stat3-dependent and-independent pathways ». The EMBO journal 17 (4): 1006–1018. Porcheray, F, S Viaud, A-C Rimaniol, C Leone, B Samah, N Dereuddre-Bosquet, D Dormont, et G Gras. 2005. « Macrophage activation switching: an asset for the resolution of inflammation ». Clinical & Experimental Immunology 142 (3): 481–489. Robbins, Clinton S, Aleksey Chudnovskiy, Philipp J Rauch, Jose-Luiz Figueiredo, Yoshiko Iwamoto, Rostic Gorbatov, Martin Etzrodt, et al. 2012. « Extramedullary hematopoiesis generates Ly-6Chigh monocytes that infiltrate atherosclerotic lesions ». Circulation 125 (2): 364–374. Rödel, F, M Hantschel, G Hildebrandt, S Schultze-Mosgau, C Rödel, M Herrmann, R Sauer, et RE Voll. 2004. « Dose-dependent biphasic induction and transcriptional activity of nuclear factor kappa B (NF-κ B) in EA. hy. 926 endothelial cells after low-dose X-irradiation ». International journal of radiation biology 80 (2): 115–123. Rödel, Franz, Franz Rödel, Ludwig Keilholz, Franz Rödel, Ludwig Keilholz, Martin Herrmann, Christian Weiss, et al. 2009. « Activator protein 1 shows a biphasic induction and transcriptional activity after low dose X-irradiation in EA. hy. 926 endothelial cells: Brief definite report ». Autoimmunity 42 (4): 343–345. Rödel, Franz, Ulrich Schaller, Stefan Schultze-Mosgau, Horst-Ulrich Beuscher, Ludwig Keilholz, Martin Herrmann, Reinhard Voll, Rolf Sauer, et Guido Hildebrandt. 2004. « The induction of TGF-β 1 and NF-κB parallels a biphasic time course of leukocyte/endothelial cell adhesion following low-dose X-irradiation ». Strahlentherapie und Onkologie 180 (4): 194–200. Schaue, D., Brian Marples, et K. R. Trott. 2002. « The effects of low-dose X-irradiation on the oxidative burst in stimulated macrophages ». International journal of radiation biology 78 (7): 567‑76. Schaue, Dörthe, Jutta Jahns, Guido Hildebrandt, et Klaus-Rüdiger Trott. 2005. « Radiation treatment of acute inflammation in mice ». International journal of radiation biology 81 (9): 657‑67. Shimizu, Yukiko, Kazunori Kodama, Nobuo Nishi, Fumiyoshi Kasagi, Akihiko Suyama, Midori Soda, Eric J Grant, et al. 2010. « Radiation exposure and circulatory disease risk: Hiroshima and Nagasaki atomic bomb survivor data, 1950-2003 ». Bmj 340: b5349. Sica, Antonio, et Alberto Mantovani. 2012. « Macrophage plasticity and polarization: in vivo veritas ». The Journal of clinical investigation 122 (3): 787–795. Song, Li, Cynthia Leung, Christian Schindler, et others. 2001. « Lymphocytes are important in early atherosclerosis ». The Journal of clinical investigation 108 (2): 251–259. Svensson, Judit, Maria C Jenmalm, Andreas Matussek, Robert Geffers, Göran Berg, et Jan Ernerudh. 2011. « Macrophages at the fetal–maternal interface express markers of alternative activation and are induced by M-CSF and IL-10 ». The Journal of Immunology 187 (7): 3671–3682. Swirski, Filip K, Peter Libby, Elena Aikawa, Pilar Alcaide, F William Luscinskas, Ralph Weissleder, Mikael J Pittet, et others. 2007. « Ly-6C hi monocytes dominate hypercholesterolemia-associated monocytosis and give rise to macrophages in atheromata ». The Journal of clinical investigation 117 (1): 195–205. Swirski, Filip K, Matthias Nahrendorf, Martin Etzrodt, Moritz Wildgruber, Virna Cortez-Retamozo, Peter Panizzi, Jose-Luiz Figueiredo, et al. 2009. « Identification of splenic reservoir monocytes and their deployment to inflammatory sites ». Science 325 (5940): 612–616. Tabas, Ira, et Andrew H. Lichtman. 2017. « Monocyte-macrophages and T cells in atherosclerosis ». Immunity 47 (4): 621‑34. Tacke, Frank, David Alvarez, Theodore J Kaplan, Claudia Jakubzick, Rainer Spanbroek, Jaime Llodra, Alexandre Garin, et al. 2007. « Monocyte subsets differentially employ CCR2, CCR5, and CX3CR1 to accumulate within atherosclerotic plaques ». The Journal of clinical investigation 117 (1): 185–194. Vaiserman, Alexander, Alexander Koliada, Oksana Zabuga, et Yehoshua Socol. 2018. « Health impacts of low-dose ionizing radiation: current scientific debates and regulatory issues ». Dose-Response 16 (3): 1559325818796331. Veremeyko, Tatyana, Amanda WY Yung, Daniel C Anthony, Tatyana Strekalova, et Eugene D Ponomarev. 2018. « Early growth response gene-2 is essential for M1 and M2 macrophage activation and plasticity by modulation of the transcription factor CEBPβ ». Frontiers in Immunology 9: 2515. Virmani, Renu, Frank D Kolodgie, Allen P Burke, Andrew Farb, et Stephen M Schwartz. 2000. « Lessons from sudden coronary death: a comprehensive morphological classification scheme for atherosclerotic lesions ». Arteriosclerosis, thrombosis, and vascular biology 20 (5): 1262–1275. Virmani, Renu, Frank D Kolodgie, Allen P Burke, Aloke V Finn, Herman K Gold, Thomas N Tulenko, Steven P Wrenn, et Jagat Narula. 2005. « Atherosclerotic plaque progression and vulnerability to rupture: angiogenesis as a source of intraplaque hemorrhage ». Arteriosclerosis, thrombosis, and vascular biology 25 (10): 2054–2061. Westerhuis, Johan A, Theodora Kourti, et John F MacGregor. 1998. « Analysis of multiblock and hierarchical PCA and PLS models ». Journal of Chemometrics: A Journal of the Chemometrics Society 12 (5): 301–321. Wunderlich, R, A Ernst, F Rödel, R Fietkau, O Ott, K Lauber, B Frey, et US Gaipl. 2015. « Low and moderate doses of ionizing radiation up to 2 Gy modulate transmigration and chemotaxis of activated macrophages, provoke an anti-inflammatory cytokine milieu, but do not impact upon viability and phagocytic function ». Clinical & Experimental Immunology 179 (1): 50–61. Yona, Simon, Ki-Wook Kim, Yochai Wolf, Alexander Mildner, Diana Varol, Michal Breker, Dalit Strauss-Ayali, et al. 2013. « Fate mapping reveals origins and dynamics of monocytes and tissue macrophages under homeostasis ». Immunity 38 (1): 79–91. Ziegler-Heitbrock, Loems, Petronela Ancuta, Suzanne Crowe, Marc Dalod, Veronika Grau, Derek N Hart, Pieter JM Leenen, et al. 2010. « Nomenclature of monocytes and dendritic cells in blood ». Blood 116 (16): e74–e80. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 18 Mar, 2024 Reviews received at journal 02 Mar, 2024 Reviewers agreed at journal 24 Feb, 2024 Reviewers invited by journal 24 Feb, 2024 Editor assigned by journal 24 Feb, 2024 Editor invited by journal 24 Feb, 2024 Submission checks completed at journal 24 Feb, 2024 First submitted to journal 12 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3951325","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":274827567,"identity":"aab018f2-b957-41ed-afe2-5ba351e7a395","order_by":0,"name":"N. Rey","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"N.","middleName":"","lastName":"Rey","suffix":""},{"id":274827568,"identity":"86f3f5be-3105-4834-b1c5-44f96fa71258","order_by":1,"name":"T. Ebrahimian","email":"","orcid":"","institution":"McGill University","correspondingAuthor":false,"prefix":"","firstName":"T.","middleName":"","lastName":"Ebrahimian","suffix":""},{"id":274827569,"identity":"7d80add0-7f30-4886-8ebf-6f6b23b5dd19","order_by":2,"name":"C . Gloaguen","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"C","middleName":".","lastName":"Gloaguen","suffix":""},{"id":274827570,"identity":"744dd0cf-2343-4bb1-80a7-99d2c56084b0","order_by":3,"name":"D. Kereselidze","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"D.","middleName":"","lastName":"Kereselidze","suffix":""},{"id":274827571,"identity":"6f1ec8b5-0402-4688-96b1-3a005e78876c","order_by":4,"name":"C. Elie","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"C.","middleName":"","lastName":"Elie","suffix":""},{"id":274827572,"identity":"4c294b6f-929f-4f46-8a40-0b9a3f635ee8","order_by":5,"name":"C. Brizais","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"C.","middleName":"","lastName":"Brizais","suffix":""},{"id":274827573,"identity":"fd55693b-0d4a-41bb-9073-e6781e53793d","order_by":6,"name":"F. Bachelot","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"F.","middleName":"","lastName":"Bachelot","suffix":""},{"id":274827574,"identity":"5db6e599-76b7-4a79-8f07-f53b599cd5b5","order_by":7,"name":"G. Riazi","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"G.","middleName":"","lastName":"Riazi","suffix":""},{"id":274827575,"identity":"d8b38a15-0e9b-4436-bf35-75909bbba0fd","order_by":8,"name":"V. Monceau","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"V.","middleName":"","lastName":"Monceau","suffix":""},{"id":274827576,"identity":"fc8b83fd-2ca9-4227-b4a3-8ed530348e56","order_by":9,"name":"C . Demarquay","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"C","middleName":".","lastName":"Demarquay","suffix":""},{"id":274827577,"identity":"6c2792da-e857-4162-89eb-5511a6afba5a","order_by":10,"name":"I. Garali Zineddine","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"I.","middleName":"Garali","lastName":"Zineddine","suffix":""},{"id":274827578,"identity":"63e78955-34eb-483a-a1a6-84a493ea476e","order_by":11,"name":"D . Klokov","email":"","orcid":"","institution":"McGill University","correspondingAuthor":false,"prefix":"","firstName":"D","middleName":".","lastName":"Klokov","suffix":""},{"id":274827579,"identity":"a33eb236-0111-480d-85e3-e2ab7aebb62a","order_by":12,"name":"S. Lehoux","email":"","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":false,"prefix":"","firstName":"S.","middleName":"","lastName":"Lehoux","suffix":""},{"id":274827580,"identity":"505af86d-1bff-4ca6-8f7f-5f7ca024dc56","order_by":13,"name":"T.G. Ebrahimian","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYJCCA2AkwdjAkMDAIMcGFrPBrZwHXYsxREsafi0QXRIQVmIDIS327L0HDzBU3Mnnn93cuuFBzZ30Punjzx4wJNzDbQvPuYQDDGeeWc64c7DtRsKxZ7ltfDnmBgwJxbi1SOQYHGBsO2zAcCMRqIXtcG4bDw+bBOOPBNxa5N8Atfw7bCAP1vLvcDobD/szCYYEPFokeIBaGg4bGIC0JLYdTmDjYTDDr+UM0GFALxgYgrX0HTYEOsxMIgGPFvb2M8YfPtTcMZC7kf7s5o9vh+Xle4AO+4BHCxhgShPQMApGwSgYBaOAAAAA/IVY41Hal5oAAAAASUVORK5CYII=","orcid":"","institution":"Institut de radioprotection et de sûreté nucléaire","correspondingAuthor":true,"prefix":"","firstName":"T.G.","middleName":"","lastName":"Ebrahimian","suffix":""}],"badges":[],"createdAt":"2024-02-12 15:29:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3951325/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3951325/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51681015,"identity":"7b8b4283-831f-4569-9e5e-4515e79ec59f","added_by":"auto","created_at":"2024-02-27 06:39:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":71185,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3951325/v1/c3ef0c0a141b6facd8be5d9b.png"},{"id":51681014,"identity":"5252ffe3-da1f-403d-95e8-ea2c4af769c1","added_by":"auto","created_at":"2024-02-27 06:39:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":69800,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3951325/v1/3c1abe3445edbffc766fdae6.png"},{"id":51681012,"identity":"68b7a9d2-f54a-4104-ad7b-8297fc641d4c","added_by":"auto","created_at":"2024-02-27 06:39:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":92465,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3951325/v1/a2a78ad05740d8e95e500543.png"},{"id":51681016,"identity":"b4132ac2-d3d8-48c5-a5fe-87a3020eec03","added_by":"auto","created_at":"2024-02-27 06:39:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":71604,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3951325/v1/6ff646d982ab400d820a85e5.png"},{"id":51681013,"identity":"cd0fd871-1d66-4812-a662-3288aaf1ec31","added_by":"auto","created_at":"2024-02-27 06:39:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":75490,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3951325/v1/4a5c3df02d289671544f688c.png"},{"id":51681019,"identity":"77d8dc4b-0e76-4f09-a946-93a80b7ccb77","added_by":"auto","created_at":"2024-02-27 06:39:20","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":250178,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-3951325/v1/0c76a8a97e8765e91b80ee12.png"},{"id":51681018,"identity":"67cfa3e0-d5a3-4f8e-99a0-9d4878ad99ed","added_by":"auto","created_at":"2024-02-27 06:39:20","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":302920,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-3951325/v1/43582c696331c350077b4ee5.png"},{"id":51681020,"identity":"87f0dc26-8ca6-4af5-bf9d-fca72aa2a074","added_by":"auto","created_at":"2024-02-27 06:39:20","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":167334,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-3951325/v1/2dc68475964bbce0312a40ac.png"},{"id":51681899,"identity":"a3f42a95-a2fc-4069-b466-dbcc000e2751","added_by":"auto","created_at":"2024-02-27 06:47:20","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":200342,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-3951325/v1/081ac6aee52004341e250291.png"},{"id":51682202,"identity":"49c22315-c294-42cd-890e-fcca93f1f635","added_by":"auto","created_at":"2024-02-27 06:55:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1582533,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3951325/v1/475b1fe8-34db-434c-8d45-7c29541313fc.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Low to moderate dose 137 Cs (γ) radiation enhances M2 type macrophages function at short term associated with reduced inflammation at long term exposure in ApoE (-/-) mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eExposure to low dose of γ radiation implies thousands of people living particularly in areas close to Chernobyl or Fukushima power plant. Understanding the effects of low to moderate dose ionizing radiation (LMDIR) on atherosclerosis is still an ongoing process. It is well reported that cardiovascular diseases are aggravated with exposure to ionizing radiations (Mulrooney et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Hoving et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Shimizu et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; McGale et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Bashar et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Boivin et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1992\u003c/span\u003e). However, extrapolation through linear no threshold model does not seem to be reliable with low dose exposure and cardiovascular diseases (Vaiserman et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) and statistical limits prevent the risk-assessment under 0.5 Gy (Baselet et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The dose of exposure is essential in predicting effects outcome. Recent studies have shown that effects caused by high doses are different from those caused by low doses. Indeed, Mitchel et al. (Mitchel et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) showed that effects of low doses were nonlinear in ApoE\u003csup\u003e(\u0026minus;/\u0026minus;)\u003c/sup\u003e mouse model and were atheroprotective. In contrast, Mancuso et al (Mancuso et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) showed a decrease in plaque density with chronic as opposed to acute exposure leading to detrimental effects on cardiovascular system. Le Gallic et al (Le Gallic et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2015a\u003c/span\u003e) demonstrated that exposure to chronic LMDIR enhances plaque stability in ApoE\u003csup\u003e(\u0026minus;/\u0026minus;)\u003c/sup\u003e mice. These results confirm the modulatory effects of LMDIR in pre-existing inflammatory conditions (Franz R\u0026ouml;del et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; F R\u0026ouml;del et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; L\u0026ouml;dermann et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Hildebrandt et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; D\u0026ouml;rthe Schaue et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; D. Schaue, Marples, et Trott 2002; Franz R\u0026ouml;del et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). One of the questions that has not yet been addressed, is long term effects of LMDIR on atherosclerosis. Exposure to high doses ionizing radiations was reported to have late effects on human body (Kamiya et al. 2015). In contrast, the possible long-term effects of LMDIR are still unclear.\u003c/p\u003e \u003cp\u003eIn the context of atherosclerosis long term effects of LMDIR, in terms of lesions size, stability and composition are unknown. A clinical study demonstrated that repeated LMDIR with a final dose of 3 Gy could have beneficial long term effects on painful skeletal disorder (Juniku et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAtherosclerosis is a chronic inflammatory disease of medium and large arteries that could lead to myocardial infarction or stroke (Gister\\aa et Hansson 2017). Plaque development is driven by entry of oxidized low density lipoproteins in the intima of arteries, triggering a pro-inflammatory reaction leading to transmigration of monocytes and their differentiation into macrophages that internalize ox-LDL to become foam cells. Foam cells contribute to plaque fragility. On the other hand, enrichment of smooth muscle cells within the plaque increases the stability, mainly by their capacity to produce collagen.\u003c/p\u003e \u003cp\u003eIndeed, innate immune system is essential for the development and progression of atherosclerosis with monocytes and macrophages as main effectors (Gister\\aa et Hansson 2017). Two subsets of circulating monocytes are identified in mice, The pro-inflammatory Ly6C\u003csup\u003eHigh\u003c/sup\u003e and patrolling Ly6C\u003csup\u003eLow\u003c/sup\u003e (Ziegler-Heitbrock et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Yona et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Geissmann, Jung, et Littman 2003; Ziegler-Heitbrock et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Ly6C\u003csup\u003eHigh\u003c/sup\u003e subsets (Tacke et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Swirski et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2007\u003c/span\u003e), expresse high levels of chemokine receptors CC-chemokine receptor 2 (CCR2) (Geissmann, Jung, et Littman 2003) and are recruited from the bone marrow and the spleen and give rise to M1 type pro-atherogenic macrophages (Robbins et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).They produce pro-inflammatory cytokines such as TNF-α, IL-18, IL-12, INF-γ or IL-1. Ly6C\u003csup\u003eLow\u003c/sup\u003e subpopulation is involved in wound repair and tissue remodeling (Auffray et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). They preferentially express cx3c-chemokine receptor 1 (CX3CR1) (Geissmann, Jung, et Littman 2003), and give rise to M2 type athero protective macrophages (Auffray et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Brunet et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). They produce anti-inflammatory cytokines such as TGF-β or IL-10 (Sica et Mantovani 2012; Martinez et Gordon 2014; Murray et al. 2014a).\u003c/p\u003e \u003cp\u003eT cells are also an important cell population within the atherosclerotic plaque (Song et al. 2001), there is also different T cell subtypes with pro-or anti-inflammatory properties (Tabas et Lichtman 2017).\u003c/p\u003e \u003cp\u003eThe aim of this study is to investigate short term effects of LMDIR on macrophage function, in terms of polarization, gene expression and cytokine production. As well as to evaluate potential long term effects on atherosclerotic plaque phenotype.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eAnimals\u003c/p\u003e \u003cp\u003e All experiments and procedures were carried out in accordance with the Guide for the Care and Use of Laboratory Animals as published by the French regulations for animal experiments (Ministry of Agriculture Order No. B92-032-01, 2006) with European Directives (86/609/CEE) and approved by the local ethical committee of the Institute for Radiological Protection and Nuclear Safety (permit number P15-06). All methods are reported in accordance with ARRIVE guidelines.\u003c/p\u003e \u003cp\u003e14, 15 and 16 weeks old ApoE\u003csup\u003e(\u0026minus;/\u0026minus;)\u003c/sup\u003e mice were purchased from Charles river and were maintained in our animal facility. Experiments were evaluated and approved by an internal animal ethical committee. Apolipoprotein E acts as the main ligand mediating removal of cholesterol enriched chylomicron and very low density lipoprotein remnants from the blood stream and plays an important role in lipoprotein metabolism. These mice develop atherosclerosis when fed a normal chow diet. The morphological features of early-stage lesions in ApoE\u003csup\u003e(\u0026minus;/\u0026minus;)\u003c/sup\u003e mice are very similar to those found in humans (Joven et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Animals were maintained in a specific-pathogen-free environment and monitored daily.\u003c/p\u003e \u003cp\u003eIrradiation\u003c/p\u003e \u003cp\u003eMice were exposed to LMDIR of 50, 500 and 1000 mGy of external γ rays from \u003csup\u003e137\u003c/sup\u003eCs with a single dose rate (10, 35 mGy.min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e).\u003c/p\u003e \u003cp\u003eThey were sacrificed 24h, or 100 days (long term) post irradiation. Short term effects were studied with primary cells. Long term effects were performed in order to study the phenotypical effects of ionizing radiations on atherosclerotic plaques.\u003c/p\u003e \u003cp\u003eIsolation of bone-marrow-derived macrophages\u003c/p\u003e \u003cp\u003eFor cell isolation, femurs were isolated and placed in sterile petri dish containing sterile medium (RPMI 1640\u0026thinsp;+\u0026thinsp;10% fetal bovine serum and 1% streptomycin/penicillin) culture. Bone marrow was then extracted by flushing with 25-G needle, cells are then filtered with a 70 \u0026micro;m filter and centrifuged 10 min 500g. Cells were counted and distributed into 6-well cell culture plates at a concentration of 1.10\u003csup\u003e6\u003c/sup\u003e cells.ml\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and incubated at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e/95% air for 1 hour prior medium change with RPMI 1640/10%/1%P/S with 50 ng.ml.\u003csup\u003e\u0026minus;1\u003c/sup\u003e of Macrophage-Colony-Stimulating factor (MCSF) (Preprotech ref #315-02). Cells were maintained in culture for 5 days, with change of medium every 48 hours to remove non-adherent cells. On the fifth day, cells were polarized with IL-4 (10ng.ml\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) (Preprotech ref #214\u0026thinsp;\u0026minus;\u0026thinsp;14) into M2 and with INFγ (50ng.ml\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) (Preprotech ref #315-05) into M1 for 24 hours.\u003c/p\u003e \u003cp\u003eCollagen and lipid staining\u003c/p\u003e \u003cp\u003eMice sacrificed 100 days post irradiation had hearts and aortas frozen in OCT. Cryosections of 7\u0026micro;m thickness were cut throughout the aortic sinus at several key points of the aortas for histological and immunohistochemical analysis. Five to ten sections per animal were stained with Oil Red O (Sigma-Aldrich) in order to evaluate plaque lipid contents, and 5\u0026ndash;10 sections per animal were stained with picro-sirius red (Sigma Aldrich) to evaluate plaque collagen contents. Images were acquired using Axioscan. Mean Lesions and atherosclerotic area were calculated was calculated using Histolab software. Quantification of the positive stain area of plaque components was calculated as a percentage of total lesion area.\u003c/p\u003e \u003cp\u003eSmooth muscle alpha-actin and macrophage immunofluorescent stainings.\u003c/p\u003e \u003cp\u003eMacrophage and vascular smooth muscle cell plaque contents were determined by immunofluorescent staining with PE anti-mouse CD68 (diluted 1.100) (Biolegend clone FA-11) and mouse monoclonal anti-a-smooth muscle combined with FITC (diluted 1.250) (Sigma-Aldrich F3777). Lymphocyte content was assessed with rabbit anti-human CD3 (diluted 1.100) (DAKO, #A0452) and with secondary antibody goat-anti rabbit AF488 (diluted 1.400). Five to Seven sections were stained per animal. Nuclei was stained with DAPI.\u003c/p\u003e \u003cp\u003eCytokine Secretion Assay.\u003c/p\u003e \u003cp\u003eCell culture supernatants of polarized macrophages were harvested and stored at -80\u0026deg;C. IL-10 (M1000B), TGF-β (MB100B), TNF-α (MTA00B), Il-6 (M6000B), and Il-1β/Il-1F2 (MLB00C) levels were determined with ELISA kits (R\u0026amp;D Systems). ELISA\u0026rsquo;s were performed according to manufacturer\u0026rsquo;s instructions. Briefly, 50 \u0026micro;l of undiluted supernatant were incubated in flat transparent 96 well plate pre-coated with primary antibody for 2 hours and washed 4 or 5 times with a wash buffer solution containing distilled water and purchased wash buffer concentrate. After incubation, secondary antibody is added and incubated for another 2 hours and washed. Samples are then revealed after an incubation of 30 minutes by adding 100 \u0026micro;l of tetramethylbenzidine per well and reaction is stopped with 100 \u0026micro;l solution of diluted hydrochloric acid. Absorbance was measured in a microplate reader at 450 nm and weightlent correction was applied at 540 nm.\u003c/p\u003e \u003cp\u003eFlow cytometry\u003c/p\u003e \u003cp\u003eAll organs (spleen, blood) were labeled with a mix of 6 antibodies CD115 (PE/Cy7 anti-mouse clone AF598 Biolegend #135524), CD11b (Efluor450 Clone M1/70 # 48-9668-80, Invitrogen), Ly6C (APC, clone RB6-8C5, # 17-5931-82), Ly6Gr1 (FITC, clone 1A8-Ly6g #11\u0026ndash;0112), Cx3CR1 (Percp/Cy5.5 anti-mouse clone 5A011F11 #149010 Biolegend), CCR2 (PE #150610, clone 5A203G11 Biolegend).\u003c/p\u003e \u003cp\u003eBriefly, blood Cells (1.10\u003csup\u003e6\u003c/sup\u003e blood cells) were treated with ACK lysis buffer in order to deplete erythrocytes. Then samples were labeled for 15 minutes with FcR blocking reagent (# 130-059-901- Mylteni) to prevent non-specific labeling. Cells were then washed with PBS after centrifugation (500 g).\u003c/p\u003e \u003cp\u003eBone marrow Cells were collected by flushing of bone marrow cells of mice femur. (1.10 \u003csup\u003e6\u003c/sup\u003e cells). Cells were then labeled with FcR blocking reagent and then with antibody mix. For Spleen cells, spleens were crushed and then filtered with a 70\u0026micro;m filter. Cells were then collected, labeled with with FcR blocking reagent to prevent non-specific labeling, and then labeled with the antibody mix. Cells were then washed with PBS after centrifugation (500 g). Cells were washed twice with PBS containing 2% of FBS. Samples of labeled cells were then kept in cold ice in the dark until their passage in the cytometer. For BMDM cell culture, cells were removed from the 6 well plates and placed in PBS at 4\u0026deg;C at 1.10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e cells per tube and stained with FcR blocking reagent (# 130-059-901- Mylteni) for 15 minutes and labeled with a mix of CD11b (PeCy7 clone M1/70 #11-0112-82 Invitrogen), F4-80 (PE clone 30 F11 #12-4801-82 Invitrogen) CD 206 (APC #46879 Invitrogen).\u003c/p\u003e \u003cp\u003eFluorescence was measured by cytometry using FACSCanto II (BD Biosciences) and analyzed with Flowjo Software. Compensation beads were used for color compensation, and FMO samples were used as negative control.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePCR\u003c/h2\u003e \u003cp\u003eTotal messenger RNA was extracted from bone-marrow-derived macrophages using Tri-Reagent Solution (Life technologies-T9424). RNA concentration was determined using Nanodrop ND1000 spetrophotometer and RNA purity was assessed using Agilent 2100 Bioanalyzer. One microgram of total mRNA was synthesized to 20 \u0026micro;l for cDNA, using the high-capacity cDNA Reverse Transcription Kit from Applied Biosystems (Thermofisher Scientific Baltics UAB) according to manufacturer\u0026rsquo;s protocol and performed with SYBR Mastercycler gradient (#5331). Quantitative chain polymerase reaction analysis was performed with a QuantStudio 12K Flex Real-Time PCR System (Life technologies) using and a standard cycler protocol (50\u0026deg;C for 2 minutes followed by 10 minutes at 95\u0026deg;C, then starting with the first cycle, 95\u0026deg;C for 15 seconds, and 60\u0026deg;C for 1 minute followed by a melting curve, 95\u0026deg;C for 15 seconds, 60\u0026deg;C for 1 minute, and 95\u0026deg;C for 15 seconds repeated 40 times). All samples were normalized to Gapdh (glyceraldehyde-3-phospate dehydrogenase), Hprt (Hypoxanthine-guanine phosphoribosyltransferase) and βactin by geometric mean. The control samples served as a reference value of 1. All simples were run in duplicate and quantification was performed using 2\u003csup\u003e\u0026minus;ΔΔCtT\u003c/sup\u003e method. The following primers were used: Hprt (\u003cb\u003eForward\u003c/b\u003e: TCAGTCAACGGGGACATAAA, \u003cb\u003eReverse\u003c/b\u003e: GGGGCTGTACTGCTTAACCAG). Gapdh (\u003cb\u003eForward\u003c/b\u003e : AGGTCGGTGTGAACGGATTTG, \u003cb\u003eReverse\u003c/b\u003e : TGTAGACCATGTAGTTGAGGTCA) β-actin (\u003cb\u003eForward\u003c/b\u003e : AGGAAGGAAGGCTGGAAGAG, \u003cb\u003eReverse\u003c/b\u003e : TCCCTGGAGAAGAGCTACGA) Interleukin 6 (\u003cb\u003eForward\u003c/b\u003e : CCTTCTTGGGACTGATGCTGGTG, \u003cb\u003eReverse\u003c/b\u003e : AGGTCTGTTGGGAGTGGTATCCTC) Arginase 1 (\u003cb\u003eForward\u003c/b\u003e : CTCCAAGCCAAAGTCCTTAGAG, \u003cb\u003eFoward\u003c/b\u003e : CTCCAAGCCAAAGTCCTTAGAG) Retnla (\u003cb\u003eFoward\u003c/b\u003e : GGAGCTGTCATTAGGGACATCA, \u003cb\u003eReverse\u003c/b\u003e : TCCCAAGATCCACAGGCAAA) Chil3 (\u003cb\u003eForward\u003c/b\u003e : TCTGGGTACAAGATCCCTGAA, \u003cb\u003eReverse\u003c/b\u003e : TTTCTCCAGTGTAGCCATCCTT) TNFα (\u003cb\u003eFoward\u003c/b\u003e : AGCCGATGGGTTGTACCTTG \u003cb\u003eReverse\u003c/b\u003e : GTGGGTGAGGAGCACGTAGTC) EGR2 (\u003cb\u003eForward\u003c/b\u003e : CCCTTTGACCAGATGAACGGAG, \u003cb\u003eReverse\u003c/b\u003e : AAGCTACTCGGATACGGGAGATC)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eIn our study, we present two approaches of statistical analysis. The first approach is for univariate analysis while the second one is to multivariate analysis. Univariate involves the analysis of a single variable and multivariate analysis examines all variables, which will give a better idea regarding the variances involved with the data. Results to univariate analysis are presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Data were compared with two-way analysis of variance (ANOVA) or two-way ANOVA for repeated measures, with all ANOVA tests followed by a Student\u0026ndash;Newman\u0026ndash;Keuls posthoc test, or with an unpaired t-test, as appropriate. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. In the case of multivariate analysis, we use multi-blocks analysis (Regularized Generalized Canonical Correlation Analysis, RGCCA) as described in (Garali et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). From a statistical data analysis point of view, RGCCA subsumes a remarkably large number of well-known methods. Briefly, for polarization experiment we combine data from flow cytometry, genic expression and ELISA assay in order to evaluate the impact of irradiation on multiple parameters (MCSF, Il4, INFγ). We consider each type of data as a block (a modality). We then illustrate how relationships between the most relevant variables can be displayed and we interpret the results by visualizing the observations and variables in a common space. In the search of biomarkers associated with the irradiation dose rate we apply RGCCA to identify variables from the three blocks (flow cytometry, genic expression and ELISA data). The between-block connection associated with this objective of analysis is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e with an additional connection between the superblock and the irradiation dose. A superblock is defined as the concatenation of all the blocks and the corresponding global components can be derived. The space spanned by the global components is viewed as a compromise space that integrates all the modalities, which is called a common space. In order to ensure comparability between variables and blocks, the data have to be preprocessed. To make variables comparable, we standardize our data (zero mean and unit variance) and we opt for a strategy that divides each block by the square root of its number of variables (Westerhuis, Kourti, et MacGregor 1998).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eLMDIR \u003cem\u003eenhances gene expression of anti-inflammatory Chil-3, Retnla, Arg-1 and Egr2 in M0 and M2 type macrophages at 24 hours of irradiation.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eWe previously discussed the response to low dose of ionizing irradiation to inflammation as a modulatory effect. Studying the impact of LMDIR on macrophages secretory function would bring additional insight on macrophage response to LMDIR. Bone marrow-derived cells from ApoE\u003csup\u003e(\u0026minus;/\u0026minus;)\u003c/sup\u003e mice were polarized with IL-4 and INFγ into M2 and M1 type macrophages respectively. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e represents levels of gene expression of pro inflammatory M1 markers IL-6 and TNF-α and anti-inflammatory M2-markers Arginase 1, Retnla, Chil3 and Egr2 in M0, M1 and M2 macrophages according different doses. For M0 macrophages we observe that M2 markers were significantly upregulated with 1 Gy exposure (Chil3: 4.5 fold (p\u0026thinsp;=\u0026thinsp;0.0005), Arg1: 2.9 fold (p\u0026thinsp;=\u0026thinsp;0.002)).In contrast, the pro inflammatory TNF-α expression is reduced by 50% with 0.5 Gy (p\u0026thinsp;=\u0026thinsp;0.006). For M1 macrophages, we did not observe significant changes at any dose of exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Similarly, to M1 macrophages, the analysis of gene expression shows a significant upregulation in anti-inflammatory parameters for M2 macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA.). In fact, there is a significant increase with each dose for the genes: chil3 (3.1 fold at 0.05 Gy-p\u0026thinsp;=\u0026thinsp;0.005-2.8 fold at 0.5 Gy-p\u0026thinsp;=\u0026thinsp;0.0007, 2.15 fold at 1 Gy-p\u0026thinsp;=\u0026thinsp;0.002) and Retnla (1.66 fold at 0.05 Gy-p\u0026thinsp;=\u0026thinsp;0.04, 2.28 fold at 0.5 Gy-p\u0026thinsp;=\u0026thinsp;0.002 and 1.78 fold at 1 Gy-p\u0026thinsp;=\u0026thinsp;0.02). Arg1 and Egr2 were also upregulated at 1.67 (p\u0026thinsp;=\u0026thinsp;0.001) and 1.43 (p\u0026thinsp;=\u0026thinsp;0.008) fold respectively at the highest dose of exposure (1Gy). No difference was observed in pro-inflammatory markers IL-6 and TNFα. These results suggest an anti-inflammatory response in M1 and M0 macrophages.\u003c/p\u003e \u003cp\u003e \u003cem\u003eLMDIR enhances IL-10 secretion by M0 and M2 and IL-6 secretion by M1 macrophages at 24 hours of irradiation.\u003c/em\u003e \u003c/p\u003e \u003cp\u003eTwenty-four hours after irradiation, analysis of cytokine secretion shows an increase in the secretion of IL-10 by M2 macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.A) with all tested doses (2.1 fold at 0.05 Gy, 3.3 fold at 0.5 Gy and 3 fold at 1 Gy (p\u0026thinsp;=\u0026thinsp;0.017, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 and p\u0026thinsp;=\u0026thinsp;0.036). Surprisingly, an 8-fold increase in TNF-α (p\u0026thinsp;=\u0026thinsp;0.018) at 0.5 Gy was also observed. Similarly, in M0 macrophages IL-10 was also increased 1.7 fold at 0.5 Gy (p\u0026thinsp;=\u0026thinsp;0.029) and 1.5 at 1 Gy (p\u0026thinsp;=\u0026thinsp;0.029) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.B). In M1 macrophages we detected a 3-fold increase of IL-6 (p\u0026thinsp;=\u0026thinsp;0.008) at 0.5 Gy (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.C).\u003c/p\u003e \u003cp\u003e \u003cem\u003eSuperblock analysis correlates lL-10 secretion with 0.5 and 1 Gy in M0 and M2 macrophages.\u003c/em\u003e \u003c/p\u003e \u003cp\u003eNo notable changes seem to be induced by irradiation within macrophages phenotype parameters (data not shown). RGCCA analysis combining RT-PCR, ELISA and flow cytometry showed a clear separation according to component 1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026thinsp;\u0026minus;\u0026thinsp;1) for M0 macrophages between lower doses control and 0.05 Gy groups and higher doses 0.5 and 1 Gy group 24 hours after irradiation. The separation of lower doses is correlated with IL-1 secretion whereas the 0.5 and 1 Gy doses were associated with IL-10 cytokine secretion and with F480-CD206\u0026thinsp;+\u0026thinsp;phenotypes. For M1 macrophages, we observe a more pro inflammatory secretion as IL-1 is significantly associated with lower doses, and TNFα is correlated with 0.5 and 1 Gy (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026thinsp;\u0026minus;\u0026thinsp;2). Finally, M2 type have a similar response as M0 type macrophages, such that 0 and 0.05 Gy dose are in favor with an enhancement of IL-1 secretion, IL-10 is significantly correlated with 0.5 and 1 Gy doses (Fig.\u0026nbsp;\u0026lt;link rid=\"fig10\"\u0026gt;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u0026lt;/link\u0026gt;\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eIncreased blood Ly6C\u003c/em\u003e \u003csup\u003e \u003cem\u003eHigh\u003c/em\u003e \u003c/sup\u003e \u003cem\u003eand Ly6C\u003c/em\u003e\u003csup\u003e\u003cem\u003eLow\u003c/em\u003e\u003c/sup\u003e \u003cem\u003emonocytes 10 days post irradiation, whereas only splenic Ly6C\u003c/em\u003e\u003csup\u003e\u003cem\u003elow\u003c/em\u003e\u003c/sup\u003e \u003cem\u003ewas increased 100 days post irradiation.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eFlow cytometry analysis of blood samples provided an overview of the effects of irradiation on circulating monocytes. Ly6C\u003csup\u003eHigh\u003c/sup\u003e monocytes are Pro inflammatory monocytes and accumulate in atherosclerotic plaque in contrast to Ly6C\u003csup\u003elow\u003c/sup\u003e monocytes that are anti inflammatorry (Tacke et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). We observed several differences, overtime, in the proportions of both Ly6C\u003csup\u003eHigh\u003c/sup\u003e and Ly6C\u003csup\u003eLow\u003c/sup\u003e: Twenty-four hours post irradiation, Ly6C\u003csup\u003eHigh\u003c/sup\u003e proportions were significantly decreased at 1 Gy by 0.25-fold (p\u0026thinsp;=\u0026thinsp;0.002) compared to control. 10 days post irradiation, the opposite effect occurred and Ly6C\u003csup\u003eHigh\u003c/sup\u003e monocytes were increased by 3-fold (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Finally, after 100 days, no differences were observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eA) For Ly6C\u003csup\u003elow\u003c/sup\u003e subtypes, a significant 5-fold increase (p\u0026thinsp;=\u0026thinsp;0.004) was detected at 1 Gy 10 days post irradiation. No significant changes occurred in any other time point or doses (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eSpleen can be a site of extramedullary hematopoiesis and has been shown to be a monocytes reservoir (Swirski et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) and is believed to be the source of inflammatory ly6C\u003csup\u003ehigh\u003c/sup\u003e monocytes that infiltrate atherosclerotic lesions (Robbins et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). These monocytes have a similar phenotype than those in circulating blood and can be mobilized to the injured vessels. Flow cytometry analysis of spleen samples provided an insight of Ly6C\u003csup\u003eHigh\u003c/sup\u003e and Ly6C\u003csup\u003elow\u003c/sup\u003e proportions at two time-points, 10 and 100 days post irradiation. A 0.3-fold decrease was found (p\u0026thinsp;=\u0026thinsp;0.015) at 0.5 Gy for Ly6C\u003csup\u003eHigh\u003c/sup\u003e subtypes compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), and no changes in Ly6C\u003csup\u003elow\u003c/sup\u003e at 10 days post irradiation. However, a significant 3-fold increase of Ly6C\u003csup\u003eLow\u003c/sup\u003e was observed at 100 days post irradiation, at 0.05 (p\u0026thinsp;=\u0026thinsp;0.048) and 1 Gy (p\u0026thinsp;=\u0026thinsp;0.035) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eLMDIR \u003cem\u003edoes not affect atherosclerotic plaque size and stability at 100 days post irradiation.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eIn terms of plaque size and composition, Oil red O staining revealed no differences in atherosclerotic lesion size. Collagen content assessed by Picrosirius red staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003e) and α SMA not show any differences at any doses of exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eLMDIR \u003cem\u003edecreases macrophage content at higher doses and does not alter lymphocyte content.\u003c/em\u003e\u003c/p\u003e \u003cp\u003ePlaque CD68\u0026thinsp;+\u0026thinsp;macrophages contents (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e) shows a linear decrease as the dose of exposure increases, and macrophage content was significantly reduced from 12\u0026ndash;1.5% 100 days post irradiation (p\u0026thinsp;=\u0026thinsp;0.036) as compared to non-exposed controls. Plaque lymphocyte contents, assessed by CD3 staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e) was not different between groups although CD3\u0026thinsp;+\u0026thinsp;staining tended to increase with1 Gy exposure but did not reach the significance.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we evaluated short and long term effects of LMDIR on macrophages in atheroprone ApoE\u003csup\u003e(\u0026minus;/\u0026minus;)\u003c/sup\u003e mice. We found that moderate doses favor an anti-inflammatory M2-prone response at short term with M2 and M0 macrophages. Additionally, 1 Gy dose triggers a decrease in plaque CD68\u0026thinsp;+\u0026thinsp;macrophages at long term.\u003c/p\u003e \u003cp\u003eMacrophages can be \u003cem\u003ein vitro\u003c/em\u003e differentiated into classically activated M1 type by LPS or INFγ, that mediate defense of the host against a wide range of pathogens, and participate in several chronic inflammatory diseases (Murray et Wynn 2011) including atherosclerosis. Or into alternatively activated M2 type with the capacity to secrete anti-inflammatory IL-10 and TGFβ and are involved in wound healing (Ferrante et Leibovich 2012; Sica et Mantovani 2012; Kiefer et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOur study showed that LMDIR led to an increase in specific genes related to M2 macrophages, such as Egr2, Arg-1, Chil3 and Retnla that were all upregulated at 1Gy dose and Chil3 and Retlna were also significantly upregulated at lower doses (0.05 and 0.5). IL-4 is one of the main cytokines driving M2 polarization, and is an enhancer of Arg-1, Chil3 Retnla, and Egr2 (Veremeyko et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Martinez, Helming, et Gordon 2009). An argument could be made that LMDIR facilitates IL-4 role of increasing the expression of these specific genes. Also, Egr2 controls inflammation by regulating B and T response and by preventing release of pro inflammatory cytokines (Li et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). It has been shown that knock down of Egr2 decreases expression of Arg-1, Retnla and Chil-3 (Veremeyko et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) thus an enhanced expression of Egr2 could stimulate expression of the other 3 M2 markers.\u003c/p\u003e \u003cp\u003eOn the other hand, exposure to LMDIR also enhanced secretion of IL-10 by M2 macrophages at 0.5 and 1 Gy suggesting that moderate doses potentiate anti-inflammatory role of M2 macrophages. In addition, RGCCA analysis correlated the enhanced secretion of IL-10 with higher proportions of CD11b\u0026thinsp;+\u0026thinsp;F4/80-CD206\u0026thinsp;+\u0026thinsp;macrophages exposed to 0.5 and 1 Gy. CD206 is a transmembrane glycoprotein considered as an M2 type macrophage marker (Porcheray et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Murray et al. 2014b) and is known to be upregulated by IL-10 (Svensson et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). One could believe that LMDIR enhances anti-inflammatory cytokine secretion by increasing expression of CD206 on macrophage cell membrane. However, there is no evidence in the literature that IL-10 stimulates M2 marker genes mentioned above, in addition, Egr2 has the propriety to inhibit IL-10 (Veremeyko et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Therefore, LMDIR could impact both cytokine secretion and gene expression in an independent manner.\u003c/p\u003e \u003cp\u003eIn other studies, bone marrow-derived macrophages in C57/bl6 irradiated mice have an anti-inflammatory profile, with an enhancement of M2 related gene expression and an increase of the expression of Arg-1 (Coates et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). These effects were obtained with much higher dose than us (4 Gy) but were surprisingly similar. More recently, Wunderlich et al (Wunderlich et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) exposed peritoneal macrophages to low doses of X rays, and found that M1 type macrophages secreted higher levels of TGF-β and lower doses of IL-1β at 0.5 Gy. which is in favor of an anti-inflammatory response induced by LMDIR. In the context of atherosclerosis, macrophage polarization into an M2-type could have a potential protective effect on the disease, by reducing inflammation.\u003c/p\u003e \u003cp\u003eRegarding blood monocytic populations, Ly6C\u003csup\u003ehigh\u003c/sup\u003e subtypes were highly reduced with 1 Gy exposure, however the opposite effect is observed with the same dose at day 10 post irradiation, with a 4-fold increase as compared to the control group. This suggests an increased proliferation of these subsets only few days after irradiation since no changes were observed at day 100 post irradiation. Similarly, patrolling Ly6C\u003csup\u003elow\u003c/sup\u003e monocytes were also increased by 5-fold with 1 Gy exposure, as Ly6C\u003csup\u003eHigh\u003c/sup\u003e monocyte trend, therefore we believe that irradiation did not induce monocyte conversion from Ly6C\u003csup\u003ehigh\u003c/sup\u003e into Ly6C\u003csup\u003eLow\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eInterestingly, Splenic Ly6C\u003csup\u003elow\u003c/sup\u003e subtypes were significantly increased not at 10 but 100 days post irradiation in a nonlinear manner with 0.05 and 1 Gy exposures compared to controls. This profile is different from the blood and could be a long-term effect of an increased Ly6C\u003csup\u003elow\u003c/sup\u003e reservoir. One possibility could be increased blood Ly6C +/- monocytes entered in the spleen. We also know that spleen can be an important source of monocytes during inflammation and that they can be recruited into the atherosclerotic plaque (Swirski et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), they are also important in resolving inflammation in heart failure (Halade et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The use of fate mapping techniques or adoptive transfer could help to predict the effects of LMDIR on the splenic reservoir and the atherosclerotic plaque.\u003c/p\u003e \u003cp\u003eOne of the main questions of our study were long term effects of LMDIR on plaque size, stability and inflammatory profile. Atherosclerotic plaques are characterized by an increase in the proliferation of oxidized LDL-capturing macrophages, responsible of highly inflammatory necrotic core formation. This phenomenon are associated with plaque instability, with a decrease in smooth muscle cells and collagen contents, a thin fibrous cap which eventually could cause plaque rupture (Virmani et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Although plaque rupture is rare in mice as compared to humans, similar morphological features of atheroma prone to rupture can be found in their lesions (Falk et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Plaque collagen content, that is an index of plaque stability showed no difference between exposed and non-exposed animals. Also, LMDIR did not affect plaque size and lipid contents, indicating that plaque morphology remains unchanged long term after exposure. Regarding immune cells within the plaque, although CD3\u0026thinsp;+\u0026thinsp;lymphocytes were unchanged, CD68\u0026thinsp;+\u0026thinsp;macrophages were significantly decreased with 1 Gy exposure, indicating possibly a reduced macrophage proliferation withmoderate irradiation, decreasing inflammation in atheromatous plaque. However, we have to keep in mind that CD68 marker could also be expressed by smooth muscle cells, as it has been previously described (Basatemur et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, since plaque smooth muscle cells were not decreased compared to controls, we consider that decrease of CD68\u0026thinsp;+\u0026thinsp;concerns mainly plaque macrophages.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThis study showed that LMDIR enhanced anti-inflammatory function of M2 macrophages with 1 Gy exposure. An increase of IL-10 secretion inhibits macrophage activation and proliferation (O\u0026rsquo;Farrell et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e1998\u003c/span\u003e) and the increase of M2 gene markers is an indicator of an enhanced activity of M2 macrophages which could induce plaque regression. The decrease in total plaque macrophages 100 days post irradiation could be a long-term consequence of the observed short term M2 macrophage activation by LMDIR.\u003c/p\u003e\u003cp\u003eOur results suggests that exposure of ApoE\u003csup\u003e(-/-)\u003c/sup\u003e mice to LMDIR regulates immune response at short term and long term following irradiation. First an anti-inflammatory response of primary M0 and M2 macrophages occurs, followed by long term decrease in plaque macrophages at 1 Gy exposure. These results are in line with an atheroprotective effects of moderate doses of ionizing radiations observed in previous studies (Le Gallic et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2015b\u003c/span\u003e; Ebrahimian et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Mitchel et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Mancuso et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAuthor Contributions\u003c/p\u003e\n\u003cp\u003eConceptualization, Talin Ebrahimian, Stephanie Lehoux and Teni Ebrahimian; Data curation, Nicolas Rey, C\u0026eacute;line Gloaguen, Chloe Brizais and Florence Bachelot; Formal analysis, Nicolas Rey, C\u0026eacute;line Gloaguen, Dimitri Kereselidze, Chloe Brizais, Florence Bachelot and Imene Garali-Zineddine; Funding acquisition, Teni Ebrahimian; Investigation, Nicolas Rey; Methodology, Nicolas Rey, C\u0026eacute;line Gloaguen, Dimitri Kereselidze, Christelle Elie, Chloe Brizais, Florence Bachelot, Goran Riazi, Virginie Monceau and Christelle Demarquay; Software, Nicolas Rey, Virginie Monceau and Imene Garali-Zineddine; Supervision, Stephanie Lehoux and Teni Ebrahimian; Validation, Talin Ebrahimian, Christelle Demarquay, Dmitry Klokov and Stephanie Lehoux; Visualization, Dmitry Klokov; Writing \u0026ndash; original draft, Nicolas Rey; Writing \u0026ndash; review \u0026amp; editing, Talin Ebrahimian.\u003c/p\u003e\n\u003ch3\u003eData Availability/ Availability of Data and Materials.\u003c/h3\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAuffray, Cedric, Darin Fogg, Meriem Garfa, Gaelle Elain, Olivier Join-Lambert, Samer Kayal, Sabine Sarnacki, Ana Cumano, Gregoire Lauvau, et Frederic Geissmann. 2007. \u0026laquo; Monitoring of blood vessels and tissues by a population of monocytes with patrolling behavior \u0026raquo;. \u003cem\u003eScience\u003c/em\u003e 317 (5838): 666\u0026ndash;670.\u003c/li\u003e\n\u003cli\u003eBasatemur, Gemma L, Helle F J\u0026oslash;rgensen, Murray CH Clarke, Martin R Bennett, et Ziad Mallat. 2019. \u0026laquo; Vascular smooth muscle cells in atherosclerosis \u0026raquo;. \u003cem\u003eNature reviews cardiology\u003c/em\u003e, 1\u0026ndash;18.\u003c/li\u003e\n\u003cli\u003eBaselet, Bjorn, Charlotte Rombouts, Abderrafi Mohammed Benotmane, Sarah Baatout, et An Aerts. 2016. \u0026laquo; Cardiovascular diseases related to ionizing radiation: The risk of low-dose exposure (Review) \u0026raquo;. \u003cem\u003eInternational Journal of Molecular Medicine\u003c/em\u003e 38 (6): 1623‑41.\u003c/li\u003e\n\u003cli\u003eBashar, Khalid, Donagh Healy, Mary Clarke-Moloney, Paul Burke, Eamon Kavanagh, et Stewart-Redmond Walsh. 2014. \u0026laquo; Effects of neck radiation therapy on extra-cranial carotid arteries atherosclerosis disease prevalence: systematic review and a meta-analysis \u0026raquo;. \u003cem\u003ePloS one\u003c/em\u003e 9 (10): e110389.\u003c/li\u003e\n\u003cli\u003eBoivin, Jean-Fran\u0026ccedil;ois, George B Hutchison, Jay H Lubin, et Peter Mauch. 1992. \u0026laquo; Coronary artery disease mortality in patients treated for Hodgkin\u0026rsquo;s disease \u0026raquo;. \u003cem\u003eCancer\u003c/em\u003e 69 (5): 1241\u0026ndash;1247.\u003c/li\u003e\n\u003cli\u003eBrunet, Alexandre, Manon LeBel, Benoit Egarnes, Carine Paquet-Bouchard, Anne-Julie Lessard, Jacques P Brown, et Jean Gosselin. 2016. \u0026laquo; NR4A1-dependent Ly6Clow monocytes contribute to reducing joint inflammation in arthritic mice through Treg cells \u0026raquo;. \u003cem\u003eEuropean journal of immunology\u003c/em\u003e 46 (12): 2789\u0026ndash;2800.\u003c/li\u003e\n\u003cli\u003eCoates, Philip J, Jana K Rundle, Sally A Lorimore, et Eric G Wright. 2008. \u0026laquo; Indirect macrophage responses to ionizing radiation: implications for genotype-dependent bystander signaling \u0026raquo;. \u003cem\u003eCancer research\u003c/em\u003e 68 (2): 450\u0026ndash;456.\u003c/li\u003e\n\u003cli\u003eEbrahimian, T. G., L. Beugnies, J. Surette, N. Priest, Y. Gueguen, C. Gloaguen, M. Benderitter, J. R. Jourdain, et K. Tack. 2017. \u0026laquo; Chronic Exposure to External Low-Dose Gamma Radiation Induces an Increase in Anti-inflammatory and Anti-oxidative Parameters Resulting in Atherosclerotic Plaque Size Reduction in ApoE\u0026ndash;/\u0026ndash;Mice \u0026raquo;. \u003cem\u003eRadiation research\u003c/em\u003e 189 (2): 187‑96.\u003c/li\u003e\n\u003cli\u003eFalk, Erling, Stephen M Schwartz, Zorina S Galis, et Michael E Rosenfeld. 2007. \u0026laquo; Neointimal cracks (plaque rupture?) and thrombosis in wrapped arteries without flow \u0026raquo;. \u003cem\u003eArteriosclerosis, thrombosis, and vascular biology\u003c/em\u003e 27 (1): 248\u0026ndash;249.\u003c/li\u003e\n\u003cli\u003eFerrante, Christopher J, et Samuel Joseph Leibovich. 2012. \u0026laquo; Regulation of macrophage polarization and wound healing \u0026raquo;. \u003cem\u003eAdvances in wound care\u003c/em\u003e 1 (1): 10\u0026ndash;16.\u003c/li\u003e\n\u003cli\u003eGarali, Imene, Isaac M Adanyeguh, Farid Ichou, Vincent Perlbarg, Alexandre Seyer, Benoit Colsch, Ivan Moszer, et al. 2018. \u0026laquo; A strategy for multimodal data integration: application to biomarkers identification in spinocerebellar ataxia \u0026raquo;. \u003cem\u003eBriefings in bioinformatics\u003c/em\u003e 19 (6): 1356\u0026ndash;1369.\u003c/li\u003e\n\u003cli\u003eGeissmann, Frederic, Steffen Jung, et Dan R Littman. 2003. \u0026laquo; Blood monocytes consist of two principal subsets with distinct migratory properties \u0026raquo;. \u003cem\u003eImmunity\u003c/em\u003e 19 (1): 71\u0026ndash;82.\u003c/li\u003e\n\u003cli\u003eGister\\aa, Anton, et G\u0026ouml;ran K Hansson. 2017. \u0026laquo; The immunology of atherosclerosis \u0026raquo;. \u003cem\u003eNature Reviews Nephrology\u003c/em\u003e 13 (6): 368.\u003c/li\u003e\n\u003cli\u003eHalade, Ganesh V, Paul C Norris, Vasundhara Kain, Charles N Serhan, et Kevin A Ingle. 2018. \u0026laquo; Splenic leukocytes define the resolution of inflammation in heart failure \u0026raquo;. \u003cem\u003eScience signaling\u003c/em\u003e 11 (520): eaao1818.\u003c/li\u003e\n\u003cli\u003eHildebrandt, G, A Radlingmayr, S Rosenthal, R Rothe, J Jahns, M Hindemith, F R\u0026ouml;del, et F Kamprad. 2003. \u0026laquo; Low-dose radiotherapy (LD-RT) and the modulation of iNOS expression in adjuvant-induced arthritis in rats \u0026raquo;. \u003cem\u003eInternational journal of radiation biology\u003c/em\u003e 79 (12): 993\u0026ndash;1001.\u003c/li\u003e\n\u003cli\u003eHoving, Saske, Sylvia Heeneman, Marion JJ Gijbels, Johannes AM te Poele, Nicola S Russell, Mat JAP Daemen, et Fiona A Stewart. 2008. \u0026laquo; Single-dose and fractionated irradiation promote initiation and progression of atherosclerosis and induce an inflammatory plaque phenotype in ApoE-/- mice \u0026raquo;. \u003cem\u003eInternational Journal of Radiation Oncology* Biology* Physics\u003c/em\u003e 71 (3): 848\u0026ndash;857.\u003c/li\u003e\n\u003cli\u003eJoven, Jorge, Anna Rull, Nat\u0026agrave;lia Ferr\u0026eacute;, Joan Carles Escol\u0026agrave;-Gil, Judit Marsillach, Blai Coll, Carlos Alonso-Villaverde, Gerard Aragones, Joan Claria, et Jordi Camps. 2007. \u0026laquo; The results in rodent models of atherosclerosis are not interchangeable: the influence of diet and strain \u0026raquo;. \u003cem\u003eAtherosclerosis\u003c/em\u003e 195 (2): e85\u0026ndash;e92.\u003c/li\u003e\n\u003cli\u003eJuniku, Nderim, Oliver Micke, M Heinrich Seegenschmiedt, et Ralph Muecke. 2019. \u0026laquo; Radiotherapy for painful benign skeletal disorders \u0026raquo;. \u003cem\u003eStrahlentherapie und Onkologie\u003c/em\u003e 195 (12): 1068\u0026ndash;1073.\u003c/li\u003e\n\u003cli\u003eKamiya, Kenji, Kotaro Ozasa, Suminori Akiba, Ohstura Niwa, Kazunori Kodama, Noboru Takamura, Elena K. Zaharieva, Yuko Kimura, et Richard Wakeford. 2015. \u0026laquo; Long-term effects of radiation exposure on health \u0026raquo;. \u003cem\u003eThe Lancet\u003c/em\u003e 386 (9992): 469‑78.\u003c/li\u003e\n\u003cli\u003eKiefer, Reinhard, Bernd C Kieseier, Guido Stoll, et Hans-Peter Hartung. 2001. \u0026laquo; The role of macrophages in immune-mediated damage to the peripheral nervous system \u0026raquo;. \u003cem\u003eProgress in neurobiology\u003c/em\u003e 64 (2): 109\u0026ndash;127.\u003c/li\u003e\n\u003cli\u003eLe Gallic, Cl\u0026eacute;lia, Yohann Phalente, Line Manens, Isabelle Dublineau, Marc Benderitter, Yann Gueguen, Stephanie Lehoux, et Teni G. Ebrahimian. 2015a. \u0026laquo; Chronic Internal Exposure to Low Dose 137 Cs Induces Positive Impact on the Stability of Atherosclerotic Plaques by Reducing Inflammation in ApoE-/-Mice \u0026raquo;. \u003cem\u003ePloS one\u003c/em\u003e 10 (6): e0128539.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2015b. \u0026laquo; Chronic Internal Exposure to Low Dose 137Cs Induces Positive Impact on the Stability of Atherosclerotic Plaques by Reducing Inflammation in ApoE-/- Mice \u0026raquo;. \u0026Eacute;dit\u0026eacute; par Esther Lutgens. \u003cem\u003ePLOS ONE\u003c/em\u003e 10 (6): e0128539. https://doi.org/10.1371/journal.pone.0128539.\u003c/li\u003e\n\u003cli\u003eLi, Suling, Tizong Miao, Meera Sebastian, Punamdip Bhullar, Emma Ghaffari, Mengya Liu, Alistair LJ Symonds, et Ping Wang. 2012. \u0026laquo; The transcription factors Egr2 and Egr3 are essential for the control of inflammation and antigen-induced proliferation of B and T cells \u0026raquo;. \u003cem\u003eImmunity\u003c/em\u003e 37 (4): 685\u0026ndash;696.\u003c/li\u003e\n\u003cli\u003eL\u0026ouml;dermann, Barbara, Roland Wunderlich, Silke Frey, Christine Schorn, Sonja Stangl, Franz R\u0026ouml;del, Ludwig Keilholz, Rainer Fietkau, Udo S Gaipl, et Benjamin Frey. 2012. \u0026laquo; Low dose ionising radiation leads to a NF-\u0026kappa;B dependent decreased secretion of active IL-1\u0026beta; by activated macrophages with a discontinuous dose-dependency \u0026raquo;. \u003cem\u003eInternational journal of radiation biology\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eMancuso, Mariateresa, Emanuela Pasquali, Ignacia Braga-Tanaka III, Satoshi Tanaka, Alessandro Pannicelli, Paola Giardullo, Simonetta Pazzaglia, Soile Tapio, Michael J. Atkinson, et Anna Saran. 2015. \u0026laquo; Acceleration of atherogenesis in ApoE\u0026minus;/\u0026minus; mice exposed to acute or low-dose-rate ionizing radiation \u0026raquo;. \u003cem\u003eOncotarget\u003c/em\u003e 6 (31): 31263.\u003c/li\u003e\n\u003cli\u003eMartinez, Fernando O, et Siamon Gordon. 2014. \u0026laquo; The M1 and M2 paradigm of macrophage activation: time for reassessment \u0026raquo;. \u003cem\u003eF1000prime reports\u003c/em\u003e 6.\u003c/li\u003e\n\u003cli\u003eMartinez, Fernando O, Laura Helming, et Siamon Gordon. 2009. \u0026laquo; Alternative activation of macrophages: an immunologic functional perspective \u0026raquo;. \u003cem\u003eAnnual review of immunology\u003c/em\u003e 27: 451\u0026ndash;483.\u003c/li\u003e\n\u003cli\u003eMcGale, Paul, Sarah C Darby, Per Hall, Jan Adolfsson, Nils-Olof Bengtsson, Anna M Bennet, Tommy Fornander, et al. 2011. \u0026laquo; Incidence of heart disease in 35,000 women treated with radiotherapy for breast cancer in Denmark and Sweden \u0026raquo;. \u003cem\u003eRadiotherapy and Oncology\u003c/em\u003e 100 (2): 167\u0026ndash;175.\u003c/li\u003e\n\u003cli\u003eMitchel, R. E. J., M. Hasu, M. Bugden, H. Wyatt, G. Hildebrandt, Y. X. Chen, N. D. Priest, et S. C. Whitman. 2013. \u0026laquo; Low-Dose Radiation Exposure and Protection Against Atherosclerosis in ApoE\u0026ndash;/\u0026ndash;Mice: The Influence of P53 Heterozygosity \u0026raquo;. \u003cem\u003eRadiation research\u003c/em\u003e 179 (2): 190‑99.\u003c/li\u003e\n\u003cli\u003eMitchel, R. E. J., M. Hasu, M. Bugden, H. Wyatt, M. P. Little, A. Gola, G. Hildebrandt, N. D. Priest, et S. C. Whitman. 2011. \u0026laquo; Low-dose radiation exposure and atherosclerosis in ApoE\u0026minus;/\u0026minus; mice \u0026raquo;. \u003cem\u003eRadiation research\u003c/em\u003e 175 (5): 665‑76.\u003c/li\u003e\n\u003cli\u003eMulrooney, Daniel A, Gregory T Armstrong, Sujuan Huang, Kirsten K Ness, Matthew J Ehrhardt, Vijaya M Joshi, Juan Carlos Plana, et al. 2016. \u0026laquo; Cardiac outcomes in adult survivors of childhood cancer exposed to cardiotoxic therapy: a cross-sectional study \u0026raquo;. \u003cem\u003eAnnals of internal medicine\u003c/em\u003e 164 (2): 93\u0026ndash;101.\u003c/li\u003e\n\u003cli\u003eMurray, Peter J, Judith E Allen, Subhra K Biswas, Edward A Fisher, Derek W Gilroy, Sergij Goerdt, Siamon Gordon, et al. 2014a. \u0026laquo; Macrophage activation and polarization: nomenclature and experimental guidelines \u0026raquo;. \u003cem\u003eImmunity\u003c/em\u003e 41 (1): 14\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003e\u0026mdash;\u0026mdash;\u0026mdash;. 2014b. \u0026laquo; Macrophage activation and polarization: nomenclature and experimental guidelines \u0026raquo;. \u003cem\u003eImmunity\u003c/em\u003e 41 (1): 14\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003eMurray, Peter J, et Thomas A Wynn. 2011. \u0026laquo; Protective and pathogenic functions of macrophage subsets \u0026raquo;. \u003cem\u003eNature reviews immunology\u003c/em\u003e 11 (11): 723\u0026ndash;737.\u003c/li\u003e\n\u003cli\u003eO\u0026rsquo;Farrell, Anne-Marie, Ying Liu, Kevin W Moore, et Alice L-F Mui. 1998. \u0026laquo; IL-10 inhibits macrophage activation and proliferation by distinct signaling mechanisms: evidence for Stat3-dependent and-independent pathways \u0026raquo;. \u003cem\u003eThe EMBO journal\u003c/em\u003e 17 (4): 1006\u0026ndash;1018.\u003c/li\u003e\n\u003cli\u003ePorcheray, F, S Viaud, A-C Rimaniol, C Leone, B Samah, N Dereuddre-Bosquet, D Dormont, et G Gras. 2005. \u0026laquo; Macrophage activation switching: an asset for the resolution of inflammation \u0026raquo;. \u003cem\u003eClinical \u0026amp; Experimental Immunology\u003c/em\u003e 142 (3): 481\u0026ndash;489.\u003c/li\u003e\n\u003cli\u003eRobbins, Clinton S, Aleksey Chudnovskiy, Philipp J Rauch, Jose-Luiz Figueiredo, Yoshiko Iwamoto, Rostic Gorbatov, Martin Etzrodt, et al. 2012. \u0026laquo; Extramedullary hematopoiesis generates Ly-6Chigh monocytes that infiltrate atherosclerotic lesions \u0026raquo;. \u003cem\u003eCirculation\u003c/em\u003e 125 (2): 364\u0026ndash;374.\u003c/li\u003e\n\u003cli\u003eR\u0026ouml;del, F, M Hantschel, G Hildebrandt, S Schultze-Mosgau, C R\u0026ouml;del, M Herrmann, R Sauer, et RE Voll. 2004. \u0026laquo; Dose-dependent biphasic induction and transcriptional activity of nuclear factor kappa B (NF-\u0026kappa; B) in EA. hy. 926 endothelial cells after low-dose X-irradiation \u0026raquo;. \u003cem\u003eInternational journal of radiation biology\u003c/em\u003e 80 (2): 115\u0026ndash;123.\u003c/li\u003e\n\u003cli\u003eR\u0026ouml;del, Franz, Franz R\u0026ouml;del, Ludwig Keilholz, Franz R\u0026ouml;del, Ludwig Keilholz, Martin Herrmann, Christian Weiss, et al. 2009. \u0026laquo; Activator protein 1 shows a biphasic induction and transcriptional activity after low dose X-irradiation in EA. hy. 926 endothelial cells: Brief definite report \u0026raquo;. \u003cem\u003eAutoimmunity\u003c/em\u003e 42 (4): 343\u0026ndash;345.\u003c/li\u003e\n\u003cli\u003eR\u0026ouml;del, Franz, Ulrich Schaller, Stefan Schultze-Mosgau, Horst-Ulrich Beuscher, Ludwig Keilholz, Martin Herrmann, Reinhard Voll, Rolf Sauer, et Guido Hildebrandt. 2004. \u0026laquo; The induction of TGF-\u0026beta; 1 and NF-\u0026kappa;B parallels a biphasic time course of leukocyte/endothelial cell adhesion following low-dose X-irradiation \u0026raquo;. \u003cem\u003eStrahlentherapie und Onkologie\u003c/em\u003e 180 (4): 194\u0026ndash;200.\u003c/li\u003e\n\u003cli\u003eSchaue, D., Brian Marples, et K. R. Trott. 2002. \u0026laquo; The effects of low-dose X-irradiation on the oxidative burst in stimulated macrophages \u0026raquo;. \u003cem\u003eInternational journal of radiation biology\u003c/em\u003e 78 (7): 567‑76.\u003c/li\u003e\n\u003cli\u003eSchaue, D\u0026ouml;rthe, Jutta Jahns, Guido Hildebrandt, et Klaus-R\u0026uuml;diger Trott. 2005. \u0026laquo; Radiation treatment of acute inflammation in mice \u0026raquo;. \u003cem\u003eInternational journal of radiation biology\u003c/em\u003e 81 (9): 657‑67.\u003c/li\u003e\n\u003cli\u003eShimizu, Yukiko, Kazunori Kodama, Nobuo Nishi, Fumiyoshi Kasagi, Akihiko Suyama, Midori Soda, Eric J Grant, et al. 2010. \u0026laquo; Radiation exposure and circulatory disease risk: Hiroshima and Nagasaki atomic bomb survivor data, 1950-2003 \u0026raquo;. \u003cem\u003eBmj\u003c/em\u003e 340: b5349.\u003c/li\u003e\n\u003cli\u003eSica, Antonio, et Alberto Mantovani. 2012. \u0026laquo; Macrophage plasticity and polarization: in vivo veritas \u0026raquo;. \u003cem\u003eThe Journal of clinical investigation\u003c/em\u003e 122 (3): 787\u0026ndash;795.\u003c/li\u003e\n\u003cli\u003eSong, Li, Cynthia Leung, Christian Schindler, et others. 2001. \u0026laquo; Lymphocytes are important in early atherosclerosis \u0026raquo;. \u003cem\u003eThe Journal of clinical investigation\u003c/em\u003e 108 (2): 251\u0026ndash;259.\u003c/li\u003e\n\u003cli\u003eSvensson, Judit, Maria C Jenmalm, Andreas Matussek, Robert Geffers, G\u0026ouml;ran Berg, et Jan Ernerudh. 2011. \u0026laquo; Macrophages at the fetal\u0026ndash;maternal interface express markers of alternative activation and are induced by M-CSF and IL-10 \u0026raquo;. \u003cem\u003eThe Journal of Immunology\u003c/em\u003e 187 (7): 3671\u0026ndash;3682.\u003c/li\u003e\n\u003cli\u003eSwirski, Filip K, Peter Libby, Elena Aikawa, Pilar Alcaide, F William Luscinskas, Ralph Weissleder, Mikael J Pittet, et others. 2007. \u0026laquo; Ly-6C hi monocytes dominate hypercholesterolemia-associated monocytosis and give rise to macrophages in atheromata \u0026raquo;. \u003cem\u003eThe Journal of clinical investigation\u003c/em\u003e 117 (1): 195\u0026ndash;205.\u003c/li\u003e\n\u003cli\u003eSwirski, Filip K, Matthias Nahrendorf, Martin Etzrodt, Moritz Wildgruber, Virna Cortez-Retamozo, Peter Panizzi, Jose-Luiz Figueiredo, et al. 2009. \u0026laquo; Identification of splenic reservoir monocytes and their deployment to inflammatory sites \u0026raquo;. \u003cem\u003eScience\u003c/em\u003e 325 (5940): 612\u0026ndash;616.\u003c/li\u003e\n\u003cli\u003eTabas, Ira, et Andrew H. Lichtman. 2017. \u0026laquo; Monocyte-macrophages and T cells in atherosclerosis \u0026raquo;. \u003cem\u003eImmunity\u003c/em\u003e 47 (4): 621‑34.\u003c/li\u003e\n\u003cli\u003eTacke, Frank, David Alvarez, Theodore J Kaplan, Claudia Jakubzick, Rainer Spanbroek, Jaime Llodra, Alexandre Garin, et al. 2007. \u0026laquo; Monocyte subsets differentially employ CCR2, CCR5, and CX3CR1 to accumulate within atherosclerotic plaques \u0026raquo;. \u003cem\u003eThe Journal of clinical investigation\u003c/em\u003e 117 (1): 185\u0026ndash;194.\u003c/li\u003e\n\u003cli\u003eVaiserman, Alexander, Alexander Koliada, Oksana Zabuga, et Yehoshua Socol. 2018. \u0026laquo; Health impacts of low-dose ionizing radiation: current scientific debates and regulatory issues \u0026raquo;. \u003cem\u003eDose-Response\u003c/em\u003e 16 (3): 1559325818796331.\u003c/li\u003e\n\u003cli\u003eVeremeyko, Tatyana, Amanda WY Yung, Daniel C Anthony, Tatyana Strekalova, et Eugene D Ponomarev. 2018. \u0026laquo; Early growth response gene-2 is essential for M1 and M2 macrophage activation and plasticity by modulation of the transcription factor CEBP\u0026beta; \u0026raquo;. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e 9: 2515.\u003c/li\u003e\n\u003cli\u003eVirmani, Renu, Frank D Kolodgie, Allen P Burke, Andrew Farb, et Stephen M Schwartz. 2000. \u0026laquo; Lessons from sudden coronary death: a comprehensive morphological classification scheme for atherosclerotic lesions \u0026raquo;. \u003cem\u003eArteriosclerosis, thrombosis, and vascular biology\u003c/em\u003e 20 (5): 1262\u0026ndash;1275.\u003c/li\u003e\n\u003cli\u003eVirmani, Renu, Frank D Kolodgie, Allen P Burke, Aloke V Finn, Herman K Gold, Thomas N Tulenko, Steven P Wrenn, et Jagat Narula. 2005. \u0026laquo; Atherosclerotic plaque progression and vulnerability to rupture: angiogenesis as a source of intraplaque hemorrhage \u0026raquo;. \u003cem\u003eArteriosclerosis, thrombosis, and vascular biology\u003c/em\u003e 25 (10): 2054\u0026ndash;2061.\u003c/li\u003e\n\u003cli\u003eWesterhuis, Johan A, Theodora Kourti, et John F MacGregor. 1998. \u0026laquo; Analysis of multiblock and hierarchical PCA and PLS models \u0026raquo;. \u003cem\u003eJournal of Chemometrics: A Journal of the Chemometrics Society\u003c/em\u003e 12 (5): 301\u0026ndash;321.\u003c/li\u003e\n\u003cli\u003eWunderlich, R, A Ernst, F R\u0026ouml;del, R Fietkau, O Ott, K Lauber, B Frey, et US Gaipl. 2015. \u0026laquo; Low and moderate doses of ionizing radiation up to 2 Gy modulate transmigration and chemotaxis of activated macrophages, provoke an anti-inflammatory cytokine milieu, but do not impact upon viability and phagocytic function \u0026raquo;. \u003cem\u003eClinical \u0026amp; Experimental Immunology\u003c/em\u003e 179 (1): 50\u0026ndash;61.\u003c/li\u003e\n\u003cli\u003eYona, Simon, Ki-Wook Kim, Yochai Wolf, Alexander Mildner, Diana Varol, Michal Breker, Dalit Strauss-Ayali, et al. 2013. \u0026laquo; Fate mapping reveals origins and dynamics of monocytes and tissue macrophages under homeostasis \u0026raquo;. \u003cem\u003eImmunity\u003c/em\u003e 38 (1): 79\u0026ndash;91.\u003c/li\u003e\n\u003cli\u003eZiegler-Heitbrock, Loems, Petronela Ancuta, Suzanne Crowe, Marc Dalod, Veronika Grau, Derek N Hart, Pieter JM Leenen, et al. 2010. \u0026laquo; Nomenclature of monocytes and dendritic cells in blood \u0026raquo;. \u003cem\u003eBlood\u003c/em\u003e 116 (16): e74\u0026ndash;e80.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3951325/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3951325/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEffects of low doses of ionizing radiation on atherosclerosis are still a source of many uncertainties, and in particular whether these effects generate anti or pro-inflammatory responses. Furthermore, the delay of occurrence of such effects upon irradiation are unknown. Atheroprone ApoE\u003csup\u003e(\u0026minus;/\u0026minus;)\u003c/sup\u003e mice were exposed to single doses of 0, 0.05, 0.5 and 1 Gy of \u003csup\u003e137\u003c/sup\u003eCs (γ) at 10.35 mGy.min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e dose rate. Short term (24 hours) effects on bone marrow-derived macrophage polarization and long term (100 days) consequences on atherosclerotic plaques were investigated. We found a significant dose-dependent increase of Chil3 and Retnla anti-inflammatory markers gene expression in M0 and M2 type macrophages upon 24 hours exposure and no effects on M1 types. These effects were associated with a dose-dependent increase of IL-10 and a reduction of IL-1beta secretions in M0 and M2 and an increase of IL-6 in M1 type macrophages. Circulating pro-inflammatory Ly6C\u003csup\u003eHigh\u003c/sup\u003e monocytes were reduced at 24 hours and anti-inflammatory Ly6C\u003csup\u003elow\u003c/sup\u003e monocytes were notably increased in the spleen 100 days upon irradiation.\u003c/p\u003e \u003cp\u003eLong term exposures to any doses did not affect atherosclerotic plaque size determined by OilredO. However, a tendency in plaque stability, determined by collagen and alpha-smooth muscle actin increase was observed, associated with a significant reduction of plaque macrophage content at 1Gy.\u003c/p\u003e \u003cp\u003eTaking together these findings show an increase of anti-inflammatory behavior of M2 macrophages with low to moderate doses of ionizing radiation at short term after irradiation, at long term these changes could influence atheromatous plaques after irradiation with decreased macrophages contents. These results suggest that the mechanisms that lead to on atheroprotective response after low and moderate doses of ionizing radiation would involve early effects on circulating monocytes and the macrophages polarization towards an anti-inflammatory profile.\u003c/p\u003e","manuscriptTitle":"Low to moderate dose 137 Cs (γ) radiation enhances M2 type macrophages function at short term associated with reduced inflammation at long term exposure in ApoE (-/-) mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-27 06:39:15","doi":"10.21203/rs.3.rs-3951325/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-03-18T05:52:29+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-03-02T08:38:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"9c4b1613-fcb3-46b2-849b-10076f66dd02","date":"2024-02-25T03:19:12+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-02-25T01:40:41+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-02-25T01:30:09+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-02-24T11:09:36+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-02-24T11:05:20+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-02-12T15:20:35+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e78a94b8-3165-4e20-a684-d7c0b682c7ae","owner":[],"postedDate":"February 27th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-05-24T06:51:45+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-27 06:39:15","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3951325","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3951325","identity":"rs-3951325","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}