Detection of a conserved bacterial symbiosis in non-frugivorous Australian fruit flies (Diptera, Tephritidae, Tephritinae) supports its widespread association | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Detection of a conserved bacterial symbiosis in non-frugivorous Australian fruit flies (Diptera, Tephritidae, Tephritinae) supports its widespread association Ivana Carofano, Isabel Martinez-Sañudo, Markus Riegler, David L. Hancock, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7808998/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 08 Jan, 2026 Read the published version in Microbial Ecology → Version 1 posted 16 You are reading this latest preprint version Abstract Several insect lineages, including some fruit flies, have evolved mutualistic associations with primary symbiotic bacteria. Some species of Tephritinae, the most specialized subfamily of fruit flies (Diptera, Tephritidae) predominantly infesting flowerheads of Asteraceae, harbour co-evolved, vertically transmitted and non-culturable bacterial symbionts in their midgut, known as Candidatus Stammerula spp. (Enterobacteriaceae). While such associations have previously been reported in the Palearctic and Hawaiian Archipelago, their occurrence in Australasia had not been investigated. In this study, eight Australian species from six genera belonging to the Tephritini tribe were analysed using bacterial (16S rRNA gene) and mitochondrial (16S rRNA and COI–tRNALeu–COII genes) markers. We detected the presence of specific symbiotic bacteria in all sampled species. Phylogenetic analyses showed that, with one exception, all Australian symbionts clustered in a well-supported monophyletic clade with Stammerula detected in Palearctic and Hawaiian Tephritini. Distinct Stammerula lineages were identified in several taxa, while two species, Trupanea prolata and Spathulina acroleuca shared identical symbiont sequences and the same host plant. Notably, Australian and Palearctic Sphenella spp. harboured closely related symbionts. The cophylogenetic analysis revealed a substantial congruence between host and symbiont tree, supporting a history of cospeciation and suggesting biogeographic links between Australasian and Palearctic taxa. Overall, the results expand the geographic knowledge of Tephritini- Stammerula association and highlight a global pattern of co-diversification. Symbiosis Fruit flies Bacteria Coevolution Host switch Asteraceae Figures Figure 1 Figure 2 Figure 3 Introduction The Tephritidae, commonly known as the true fruit flies, is a large family of Diptera, with approximately 4,300 described species worldwide in almost 500 genera. It includes some of the most biologically interesting and economically important fly species [ 1 , 2 ]. Within this family, the subfamily Tephritinae is considered the most specialized lineage. Its larvae predominantly infest flowerheads of Asteraceae and tephritines are therefore classified as non-frugivorous species, as their larval food consists of plant parts other than fleshy fruits [ 3 , 4 ]. This subfamily includes at least 203 genera and 1,847 species distributed across all biogeographic regions, with the greatest species diversity occurring in the tropics [ 5 , 6 ]. While generally not considered pestiferous, several Tephritinae species have been introduced as classical biological control agents against Asteraceae weeds in different regions of the world [ 7 , 8 ]. Several species within the Tephritidae are known to harbour symbiotic bacteria which help support their fitness. The first described primary and heritable bacterial symbiosis of insects was that of the olive fly Bactrocera oleae (Rossi) [ 9 ], which harbours the bacterium Candidatus Erwinia dacicola (hereafter Erwinia dacicola ), an obligate symbiont involved in detoxifying olive polyphenols [ 10 , 11 ]. A primary symbiosis has also been identified in the subfamily Tephritinae, particularly in species belonging to the tribe Tephritini [ 12 ]. This tribe is the largest and most widespread among all Tephritinae [ 4 ]. The ecological success and evolutionary radiation of the Tephritini may have been facilitated by the establishment of stable bacterial symbioses. These symbionts may play a key role in rendering the tissues of Asteraceae digestible, as these tissues are rich in polyphenols and defensive compounds known to hinder insect digestion [ 13 ]. Studies on various Palearctic genera and species of Tephritini have consistently revealed species-specific bacterial symbionts belonging to a monophyletic clade within the Enterobacteriaceae, for which the name Candidatus Stammerula has been proposed (hereafter Stammerula ). Within this clade, for the monophyletic and well-supported subclade represented by symbionts of species in the genus Tephritis Latreille, the name Stammerula tephritidis was proposed [ 12 ]. Subsequently, in a study conducted across the Hawaiian Islands on more than 25 endemic species of Tephritini, the presence of symbionts belonging to the genus Stammerula was confirmed. The Hawaiian symbionts grouped with those of palearctic Trupanea Schrank species in a supported subclade showing an average divergence in the 16S rRNA gene of 1%. Based on this, the designation Stammerula trupaneae was proposed [ 14 ]. The identification of distinct yet closely related bacterial symbionts in flies of different genera and distributed across multiple biogeographic regions supports the hypothesis that symbiotic cospeciation within the Tephritini involved codivergence events after an ancient acquisition. These bacteria, located in specialized structures in the midgut outside the peritrophic membrane, are vertically transmitted and show high specificity even among closely related tephritid species, suggesting a stable association with their hosts [ 15 , 16 ]. It is noteworthy that the presence of symbiotic Stammerula bacteria appears to be clearly connected to the tribe Tephritini, which, among the fly species investigated to date, represents a monophyletic and well-supported group of symbiotic bacteria. However, knowledge about the geographic distribution of Stammerula symbionts in the Tephritini tribe remains limited and fragmented. Due to its isolation and geological history, Australia provides an ideal setting for evolutionary studies [ 17 ]. Indeed, Australia is well known for having experienced radiations of plants and animals [ 18 – 20 ]. Expanding the study to include Australian Tephritini represents an intriguing opportunity to gain new insights into the evolution of symbioses within the tribe and to test the hypothesis of a global distribution of Stammerula bacteria as symbionts of Tephritini. To expand the knowledge about the evolutionary history of the bacterial symbiosis in this group of tephritid flies, the present study aimed to investigate the presence and phylogenetic identity of bacterial symbionts associated with Australian Tephritini species, and to analyse the phylogenetic relationships between symbionts and hosts across Australian species and species of other biogeographic regions (palearctic: Europe; oceanic: Hawaii). Materials and methods Insect sampling and identification A total of 33 specimens belonging to eight Tephritini species from seven genera were collected in the Sydney region, New South Wales, Australia (Table 1 ). The Tephritini fauna of Australia includes 77 species from 23 genera [ 21 ]. Specimens were obtained either by collecting them directly on Asteraceae host plants in the field using an aspirator or by rearing them from infested flower heads. For the latter method, infested flower heads were placed into mesh bags and kept in the laboratory until adult emergence. Following the methodology described by Mazzon [ 22 ], the newly emerged adults were then transferred to net cages and maintained for at least 7 days under room conditions, fed with a 50% sucrose solution, before being stored in absolute ethanol at -80°C until DNA extraction. All adult samples were identified using morphological identification keys [ 21 , 23 ]. For the molecular analyses, flies were dissected to extract the intestinal tract hosting symbionts, following the procedure described by Mazzon [ 12 ]. Table 1 Collection details for the Australian Tephritini specimens and their host plants including the number of sequenced specimens (n; biological replicates). GenBank accession numbers are provided for insect mitochondrial fragments COI–tRNA–COII and 16S rRNA and bacterial symbiont 16S rRNA fragments obtained in this study. Each accession number corresponds to a distinct haplotype (host or symbiont, respectively). Species that are represented with more than one row include different mitochondrial haplotypes and/or bacterial 16 rRNA gene sequences. Distribution status of each species is indicated by letters in parentheses: (E) endemic to Australia, (W) widespread (in and outside Australia). * Austrotephritis poenia specimens collected from Schoenia filifolia and Podolepis jaceoides are not distinguished separately in this dataset. Taxon and distribution n Host plant Coordinates GenBank accessions Insect: COI-COII Insect: 16S rRNA Symbiont: 16S rRNA Campiglossa sororcula (W) 3 Bidens pilosa 33.61 S 150.75 E PV442354 PV364013 PV363879 “ 2 “ - - PV364014 - Austrotephritis poenia (E) 3 Schoenia filifolia and Podolepis jaceoides* 33.61 S 150.75 E PV442358 PV364008 PV363870 “ 2 “ 33.61 S 150.75 E PV442360 - PV363869 “ 1 “ 33.61 S 150.75 E PV442359 - - Spathulina acroleuca (W) 2 Calotis lappulacea 33.61 S 150.75 E PV442363 PV364018 PV363886 “ 2 “ - PV364020 - Austrotephritis fuscata (E) 2 Xerochrysum bracteatum 33.62 S 150.75 E PV442344 PV363998 PV363874 “ 3 “ - - - PV363875 Austrotephritis pelia (E) 5 Chrysocephalum apiculatum 34.07 S 150.76 E PV442352 PV364003 PV363864 Sphenella ruficeps (E) 1 Senecio minimus 38.83 S 146.13 E PV442365 PV364022 PV363891 Trupanea prolata (E) 4 Senecio madagascariensis 33.62 S 150.75 E PV442366 PV364023 PV363892 “ 1 “ - PV442369 - - Paraspathulina apicomacula (E) 1 Vittadinia cuneata 33.62 S 150.75 E PV442361 PV364016 PV363884 “ 1 PV442362 - - Insect host analyses: DNA extraction, amplification and sequencing DNA was extracted from the insect's guts using the Qiagen DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. The total DNA was quantified using the Qubit Fluorometer with the dsDNA High-Sensitivity Assay Kit (ThermoFisher Scientific, Life Technologies). Two fragments of the mitochondrial genome of the fly specimens were amplified: the 16S rRNA gene and a fragment encompassing the 3’ region of the cytochrome oxidase subunit I (COI), tRNA-Leu and the 5’ region of cytochrome oxidase subunit II (COII). Since not all primer pairs were equally effective across species, multiple combinations were tested (Table 2 ). Table 2 Primers used in the polymerase chain and sequencing reactions for the 16S rRNA and the COI-tRNALeu-COII genes. Target gene Primer name Sequence 5′→3′ Source 16S rRNA LR-J-12883 CTCCGGTTTGAACTCAGATC [ 24 ] TV-N-14202 AGCATTTCATTTACATTGAA [ 25 ] DFI2 GATTTATAGGGTCTTCTCGTC [ 16 ] DR GATGTACCGGAAGGTGTATCT [ 16 ] LRN13398 CGCCTGTTTAACAAAAACAT [ 26 , 27 ] N1-J12261 m TACTTCGTAAGAAATTGTTTGAGC [ 26 , 27 ] COI-tRNALeu-COII C1-J-2195 TTGATTTTTTGGTCATCCAGAAGT [ 26 , 27 ] TKN3796 ACTATAAAATGGTTTAAGAG [ 26 , 27 ] C1-J-2183 CAACATTTATTTTGATTTTTTGG [ 26 , 27 ] TL2-N-3014 TCCATTGCACTAATCTGCCATATTA [ 26 , 27 ] The PCR reactions were performed in a 20 µl volume containing 4 µl of 5x colourless GoTaq Flexi Buffer (Promega), 2 mM MgCl, 100 µM dNTPs, 1 µl of each primer at 10 mM, 1U of GoTaq Flexi DNA polymerase (Promega) and 2 µl of extracted DNA. The standard thermal profile for the amplification of the 16S rRNA gene was: hold for 5 minutes at 96°C, 35 cycles of 96°C for 50 s, an annealing step ranging between 52°C and 60°C for 50 s, 72°C for 1 minute, and extension for 5 minutes at 72°C. For the COI-tRNA-Leu-COII amplification, the following thermocycling profile was used: hold for 5 minutes at 96°C, 35 cycles of 96°C for 1 minute, an annealing step ranging between 50°C and 60°C for 1 minute, 72°C for 2 minutes and extension for 5 minutes at 72°C. The annealing temperature was adjusted according to the insect species, ranging from 52°C for specimens showing efficient amplification at lower temperatures to 60°C for those requiring a higher temperature. The amplified products were examined by gel electrophoresis on 1% agarose gel. PCR-amplified products were purified with a mix of exonuclease and antarctic phosphatase (New England Biolabs) and sequenced at the BMR Genomics service at Padova, Italy. All fly sequences were deposited in GenBank (Table 1 ). Symbiont analyses: bacterial DNA extraction, amplification and sequencing A fragment of the bacterial 16S rRNA gene was amplified for the same DNA extracts used for the amplification of the mitochondrial gene fragments using the universal primers fD1 (forward: 5’-AGAGTTTGATCCTGGCTCAG-3’) and rP1 (reverse: 5’-ACGGTTACCTTGTTACGACTT-3’) [ 28 ]. The PCR master mix had the same composition as used for the fly mitochondrial gene amplification. The cycling program for the bacterial 16S rRNA gene included an initial denaturation at 95°C for 2 minutes, 35 cycles at 96°C for 30 s, 56°C for 30 s, 72°C for 90 s and a final extension at 72°C for 10 minutes. PCR products were purified and sequenced as carried out for the fly mitochondrial genes. All bacterial symbiont sequences were deposited in GenBank (Table 1 ). Phylogenetic analyses of the fly species The fly mitochondrial sequences were examined and aligned using MEGA 12 [ 29 ]. Low-quality regions at the beginning and end of each sequence were trimmed and low-quality sequences were not included in the analysis. The protein coding sequences were translated with Transeq (EMBOSS: http://www.ebi.ac.uk/Tools/emboss/transeq/index.html ) to identify any nuclear mitochondrial pseudogenes. Identical insect sequences associated with the same symbiont were removed prior to constructing the final phylogenetic tree, in order to avoid redundancy in the dataset. Sequences of fifteen Hawaiian tephritid species [ 14 ] and fifteen European tephritid species [ 16 ] were included in the analyses as references (Table S1 ). Maximum likelihood (ML) phylogenetic analyses were inferred with IQ-TREE v.2.3.6, using the best fitting evolutionary model [ 30 ]. Branch support in ML trees was assessed with 100 bootstrap replicates. The trees were viewed with FigTree v.1.4.5 [ 31 ]. Phylogenetic analyses of the bacterial symbionts The bacterial 16S rRNA gene sequences were aligned using MEGA 12 [ 29 ]. For the phylogenetic analyses, redundant haplotypes were represented with a single sequence. A set of 39 symbiont sequences from GenBank (Table S1 ) was included as reference. Phylogenetic trees were inferred using maximum likelihood (ML) implemented in the software IQ-TREE version 2.3.6 [ 32 ]. The optimal substitution model for the dataset was determined using IQ-TREE. Host-symbiont cophylogenetic analyses For the examination of the congruence between the fly and bacterial symbiont phylogenies two methods were used: a tree-based method, executed in Jane 4.0 [ 33 ] and a distance-based method, PACo [ 34 ] implemented in R [ 35 ]. Cophylogenetic analyses were conducted using a reduced data set including all the Australian species and some representative species from Europe and Hawaii. Jane 4.0 compares host and symbiont tree topologies using a combination of a genetic algorithm and a dynamic programming approach that runs in polynomial time. This method allows the software to optimally map the parasite tree onto the host tree by assigning costs to different evolutionary events. In addition, this program supports multihost parasites and multiparasite hosts. Five types of events are included in the analyses: cospeciation, duplication, failure to diverge, loss and duplication with host switch, and each event can be set [ 33 , 36 ]. In this study two models with different event cost schemes were evaluated: setting 1 assuming no cost for cospeciation and cost = 1 for all other events (cospeciation = 0, duplication = 1, duplication & host switch = 2, loss = 1, failure to diverge = 1); setting 2 assuming cost = 1 for all events (cospeciation = 1, duplication = 1, duplication & host switch = 2, loss = 1, failure to diverge = 1). The parameters of the genetic algorithm were 500 generations and a population size of 100. PACo was used to assess the null hypothesis of random association between host and symbiont phylogenies. This system estimates the phylogenetic congruence by comparing patristic distance matrices derived from the phylogenetic trees of the hosts and symbionts and projecting them into a common Euclidean space following methods described by Legendre & Anderson [ 37 ] and Peres-Neto & Jackson [ 38 ]. The analysis was performed in RStudio environment using the paco package [ 39 ] operating 10,000 permutations to evaluate the significance of the global fit and of individual host–symbiont associations. Results Sequencing of flies and their endosymbionts A total of 33 specimens belonging to eight species across six genera of Australian Tephritini were collected. The sample set included one species each of the genera Campiglossa Rondani Sphenella Robineau-Dwsvoidy, Spathulina Rondani, Paraspathulina Hardy & Drew and Trupanea , and three species of the genus Austrotephritis Hancock & Drew (Fig. 1 ). Approximately 925 bp and 1329 bp were obtained for the partial mitochondrial 16S rRNA and COI-tRNALeu-COII genes, respectively. The sequences were concatenated to create a merged dataset of approximately 2257 bp for each of 21 individuals that successfully amplified (Table 1 ). The amplification and sequencing of the bacterial 16S rRNA gene from the midgut contents of all the 33 specimens enabled the recovery of an average of 1279 bp. A distinctive bacterial sequence was retrieved for each of six out of the eight species examined. In contrast, two species, Trupanea prolata Hardy & Drew and Spathulina Acroleuca (Schiner), shared identical bacterial sequences. Phylogeny of Australian Tephritini After low-quality trimming, sequences of the COI-tRNALeu-COII fragment were translated with Transeq, and the presence of any nuclear mitochondrial pseudogenes was excluded. Phylogenetic analyses were conducted on the concatenated dataset using the ML method, employing the General Time Reversible model with empirical base frequencies, a proportion of invariant sites, and a gamma-distributed rate variation across four categories (GTR + F + I + G4), which was selected as the best-fitting model of nucleotide evolution determined by IQ-TREE. The phylogeny of the united data recovered different high-supported clades (Figure S1 ). In particular, the phylogenetic results showed that all Tephritini species included in the dataset clustered together in a well-supported monophyletic clade (UFBoot/SH-aLRT: 98.2/100) (Figure S1 ). The endemic T. prolata grouped within the Tephritis group sensu [ 40 ], specifically within the genus Trupanea , which included species from both Europe and Hawaii (UFBoot/SH-aLRT: 99.8/100). In the same way, the endemic S. rucifeps clustered with the European S. marginata , and Campiglossa sororcula was included in the Campiglossa group clade. The widespread Spathulina acroleuca and the endemic Australian species, Paraspathulina apicomacula Hardy & Drew, Austrotephritis poenia , A. pelia (Schiner) and A. fuscata clustered together in a supported clade (UFBoot/SH-aLRT: 85.8/91) (Figure S1 ). Some species, for which multiple specimens were analysed, exhibited different mitochondrial haplotypes. In detail, two haplotypes were found for A. pelia (pairwise distance: 0.0004), P. apicomacula (pairwise distance: 0.0009) and T. prolata (pairwise distance: 0.0004), while three haplotypes for A. poenia (pairwise distance: 0.0009) (Figure S1 ). Identity and phylogeny of endosymbionts BLAST analyses revealed 98–99% identity between almost all bacterial sequences analysed with Stammerula sequences, previously retrieved from European and Hawaiian Tephritini. The only exception was the bacterial sequence of Campiglossa ( = Dioxyna ) sororcula (Wiedemann), a geographically widespread species (Micronesian Islands and tropical and subtropical regions), which showed a lower percentage of identity to Stammerula (96.12%) and a higher similarity (99.14%) to the symbiont of the Palaearctic C. ( = Dioxyna ) bidentis (Robineau-Desvoidy). Phylogenetic reconstruction was performed using the ML method based on the GTR + F + I + G4 model of evolution as suggested by IQ-TREE. The phylogenetic tree included Stammerula symbionts of European [ 12 ] and Hawaiian [ 14 ] Tephritini species. The bacteria associated with seven of the eight Australian Tephritini species examined clustered in the well-supported and monophyletic clade (UFBoot/SH-aLRT: 98.5/100) corresponding to Stammerula sp. (Fig. 2 ). The symbiont of the species C. ( = Dioxyna ) sororcula represented the only exception among the Australian Tephritini. It clustered within the Erwinia group clade (UFBoot/SH-aLRT: 99.7/97). According to previous findings on some European Campiglossa species, it differed from Stammerula sp. and was related to Erwinia dacicola and the free-living E. persicina. Specifically, the symbionts of C. ( = Dioxyna ) sororcula exhibited strong similarity to those of the European C. ( = Dioxyna ) bidentis and C. guttella (Rondani) (Fig. 2 ). Within the Stammerula sp. clade, the bacterial symbiont of Sphenella ruficeps (Macquart) was closely related to that of the European S. marginata (Fallen) (UFBoot/SH-aLRT: 98.4/100). In the same Stammerula clade, the bacterial symbionts of the geographically widespread Spathulina acroleuca (Micronesian Islands, Japan, Africa, Asia to Australia, New Caledonia, Philippines, Fiji and Taiwan) and the Australian endemic genera Austrotephritis and Paraspathulina , investigated here for the first time, grouped together in a subclade that is not fully resolved due to limited sequence divergence (UFBoot/SH-aLRT: 80.2/37). In addition, two distinct bacterial sequences were detected in the species A. fuscata (Maquart) and A. poenia (Walker) (Fig. 2 ). Interestingly, all five samples of the endemic species Trupanea prolata appeared to share the same bacterial symbiont as the widespread S. acroleuca , and did not cluster with Stammerula trupaneae , previously detected in Trupanea species from Europe and Hawaii (Fig. 2 ). Coevolutionary analyses To assess the coevolution between the flies and their bacterial symbionts, all haplotypes of the Australian species were analysed together with the corresponding bacterial symbiont sequences. Additionally, the dataset included Trupanea arboreae Hardy as a representative of the Trupanea genus from Hawaii, T. stellata (Fuesslin) as the European representative of the same genus, and Sphenella marginata and Campiglossa bidentis as European representatives of their respective genera. Bactrocera oleae and its symbiont E. dacicola were also included as outgroups. In four cases, there were multiple host haplotypes for a symbiont lineage and in one case there were two symbiont haplotypes for one host lineage (Fig. 3 ). Both the tree-based method (Jane 4.0) and the distance-based method, (PACo) indicated a significant signal of cophylogeny between the hosts and their associated bacteria. For the tree-based method, two commonly used event cost models were applied. Four failure-to-diverge and five co-speciation events were detected for both the first (0, 1, 1, 2, 1) and the second (1, 1, 1, 2, 1) settings. The reconciliation analysis showed a significantly higher number of cospeciation events than expected by chance ( p < 0.01 ), indicating a notable congruence between the host and symbiont trees (Figure S2). Examples of possible reconstructions are shown in Figure S3. For instance, the analyses suggested that species of the endemic genus Austrotephritis have cospeciated with their symbionts. A host switch was identified for the symbionts of T. prolata and S. acroleuca (Figure S3). PACo analysis evaluates the congruence between host and symbiont phylogenies by comparing their respective patristic distance matrices, using a Procrustean approach. To test the global fit, this method quantified the contribution of each individual host-symbiont association and identified a significant congruence between insect hosts and their associated symbiotic bacteria ( p = 0.0003). However, residual analysis revealed that not all associations contributed equally to the global fit. While several links showed very low residuals, indicating strong phylogenetic congruence, others exhibited higher levels of incongruence, suggesting variable degrees of cophylogenetic structure across associations. Notably, 13 out of 19 links showed extremely low residual values (PACo residual < 0.001), highlighting their potential role in driving the observed global congruence. Discussion Our study represents the first investigation of symbiotic bacteria in non-frugivorous Australian tephritid flies belonging to the tribe Tephritini, as well as the first genetic characterization and phylogenetic placement of some of these Australian Tephritini (i. e Paraspathulina apicomacula , Austrotephritis fuscata , A. poenia , A. pelia , Trupanea prolata and Sphenella ruficeps ). The sampled diversity in our study represents approximately 30% of Australia’s known Tephritini genera, providing a robust basis for interpreting the phylogenetic patterns observed. The results reveal the presence of bacterial symbionts strictly associated with the analysed fly species, according to previous studies on Palearctic and endemic Hawaiian Tephritini species, which described these obligate and vertically transmitted symbionts [ 12 , 14 , 16 ]. One of the most relevant findings of this study is that the bacterial symbionts of seven of the eight examined species belonging to the genera Austrotephritis , Spathulina , Paraspathulina , Trupanea and Sphenella consistently clustered within the monophyletic clade of Stammerula . This same clade has previously been detected in Tephritini from the Palearctic (Europe) and Oceanic (Hawaii) biogeographic regions [ 12 , 14 ] reinforcing the hypothesis that Stammerula represents a widespread and evolutionarily conserved symbiotic lineage across the tribe. Our cophylogenetic analyses provide strong evidence for a significant evolutionary association between the tribe Tephritini and their bacterial symbionts, consistent with the hypothesis of long-term codivergence. Both the tree-based approach (Jane 4.0) and the distance-based method (PACo) detected a statistically significant signal of coevolution, supporting the view that the phylogenetic histories of hosts and their symbionts are not independent. Nevertheless, a few host-switching events were detected, suggesting that, while codivergence has been the dominant process shaping these associations, occasional host shifts have also contributed to their evolutionary history. PACo analysis revealed a highly significant global fit between host and symbiont phylogenies ( p = 0.0003). Thirteen out of 19 associations showed extremely low residual values (residual < 0.001), indicating strong phylogenetic congruence. These robust associations involved Australian species of Austrotephritis , Trupanea and Paraspathulina , highlighting their key role in shaping the overall cophylogenetic structure. In contrast, associations with higher residuals suggest episodes of evolutionary decoupling, likely due to occasional host switches, symbiont replacements, or events of loss and reacquisition. In line with these findings, tree-based reconciliation analysis using Jane 4.0 indicated that cospeciation is recurrent over evolutionary time. Specifically, the number of observed cospeciation events was significantly higher than expected by chance ( p < 0.01), supporting a non-random pattern of congruence between host and symbiont trees. This was particularly evident in species of the endemic Australian genus Austrotephritis , for which a clear pattern of codivergence was observed, further suggesting that tight host–symbiont specificity characterizes these lineages. The host-switch event involved a symbiont lineage shared by Trupanea prolata and Spathulina acroleuca , pointing to isolated instances of occasional horizontal transmission, as previously reported for other Tephritini species [ 16 ]. In this specific case, the Stammerula symbiont carried by T. prolata was found to be genetically identical to that associated with S. acroleuca across all analysed individuals. This may indicate that T. prolata has lost its original symbiont and subsequently acquired the symbiont of S. acroleuca . Indeed, this Stammerula lineage is phylogenetically distant from those previously identified in the Palearctic Trupanea genus and Hawaiian species (pairwise distance: 0.03), suggesting a replacement event (Fig. 3 ; Figure S3). The deviation from strict vertical transmission might be explained by the sharing of the host plant Calotis lappulacea . This endemic Australian Asteraceae has been recorded as a host for T. prolata [ 21 , 41 ], but it may also act as a suitable resource for S. acroleuca due to its broad ecological range at least for adult visitation (Hancock, pers. comm.) offering a plausible pathway for symbiont exchange. The extracellular nature of this symbiont could also have favoured this exchange. In adult flies the symbiotic bacteria are in a protected environment, within specialized crypts located between the peritrophic membrane and the midgut epithelium, while in larvae they reside in intestinal blind sacs [ 15 ] which lack the protection of the peritrophic membrane. Thus, they are more exposed to potential replacement. In addition, vertical transmission via egg surface contamination [ 9 , 15 ], together with host plant-sharing behaviour among Tephritini species, may further facilitate horizontal transfer and disrupt strict maternal transmission [ 16 ]. Another intriguing result concerns C. sororcula , a species originally described from Tenerife and the Canary Islands [ 42 ] and subsequently found to be widespread globally. Interestingly, as previously observed in other Palearctic Campiglossa species ( C. guttella and C. bidentis ), its symbiont clusters within the Erwinia genus clade [ 12 ], showing approximately 99% sequence identity with Erwinia persicina . This finding supports the hypothesis that species within the genus Campiglossa may have lost their ancestral Stammerula symbionts at some point during their evolutionary history and acquired Erwinia instead. The only known exception to this pattern remains the Palearctic C. doronici (Loew), which still harbours Stammerula . This potential symbiont replacement highlights the dynamic nature of host–microbe associations, even within closely related taxa, and suggests that ecological or physiological factors may have driven such a transition. When considering the endemic Australian Tephritini genera, the observed cophylogenetic patterns support the hypothesis of a long-term coevolutionary history between these flies and their associated symbionts, Stammerula . The monophyletic clustering of both hosts and symbionts suggests that these associations originated from a common ancestral lineage. This scenario is consistent with the broader biogeographical and evolutionary framework of the Tephritini tribe, where ancient acquisition of Stammerula likely occurred in a common ancestor, followed by parallel diversification of hosts and symbionts. Together, these findings are consistent with a mosaic coevolutionary process, characterized by cospeciating events, localized adaptations, and occasional losses or replacements of symbionts in certain host lineages. Such patterns, well-documented in insular Tephritini radiations, such as those in the Hawaiian Islands [ 14 ], further support the role of host-symbiont coevolution as a driver of diversification in Australian Tephritini. While our findings support the hypothesis of symbiotic cospeciation within the Tephritini, an alternative hypothesis of repeated, independent acquisitions of closely related bacterial symbionts by different host species (phylogenetic tracking) should also be considered. In several insect-bacterial symbiont associations, what initially appeared as cospeciation has later been interpreted as repeated, independent acquisition of closely related bacterial lineages by host species. For example, repeated acquisition events have been documented in adelgids [ 43 ] and feather lice [ 44 ]. In this scenario, closely related Tephritini species could have independently acquired similar bacterial symbionts adapted to their ecological niches. This perspective does not exclude cospeciation overall but highlights that some observed congruence between host and symbiont phylogenies could result from recurrent acquisitions of pre-adapted symbionts. Expanding taxon sampling and including genomic data from the symbionts could help distinguish between cospeciation and phylogenetic tracking in Tephritini. The stable presence of Stammerula within the tribe, including Australian Tephritini, suggests a consolidated symbiotic specialization, potentially linked to a larval diet based on Asteraceae. In Australia, species with known biology are mostly associated with Asteraceae and (in some species of Oedaspis Loew in tribe Dithrycini) Goodeniaceae, with the latter sharing with Asteraceae the presence of inulin [ 21 , 45 ]. This polysaccharide, together with polyphenols and other secondary metabolites, represents one of the non-digestible carbohydrates commonly found in Asteraceae tissues, and may have driven the evolution of a functional symbiotic association in Tephritini. Future studies should investigate whether the presence of bacterial symbionts enables Tephritini to exploit such host plants. Numerous microorganisms are known to produce inulinases, enzymes classified as hydrolases that specifically cleave the β-2,1 linkages of inulin, hydrolysing it into fructose and glucose [ 46 ]. Although there is currently no direct evidence of inulinase production by insect symbionts, several studies have shown that microbial communities in insect guts provide enzymes for the digestion of complex polysaccharides, such as cellulose, xylan and starch, which are essential for adaptation to plant-based diets [ 47 , 48 ]. While inulin itself has not yet been directly investigated in this context, it is plausible that Stammerula in Tephritini may provide inulinase activity, thus facilitating the exploitation of plants rich in this fructan. The stable presence of symbionts in Tephritini may therefore reflect an evolutionary adaptation to a diet rich in structurally complex compounds such as inulin. However, in addition to species within the tribe Tephritini, there are other tribes of the subfamily Tephritinae, such as Myopitini, Terelliini and Xiphosiini, that are also known to develop in flower heads or stems of Asteraceae [ 4 ], but for which no specific primary symbionts have been described to date [ 16 ]. This suggests that additional biological factors must be considered in explaining the role of Stammerula in Tephritini, beyond a simple association with Asteraceae as larval hosts. Conclusion Overall, this study provides new insights into the symbiotic associations and evolutionary dynamics of Australian endemic Tephritini. All investigated species, with the exception of the genus Campiglossa , harboured specific bacterial symbionts belonging to the genus Stammerula , consistent with previous evidence describing this symbiont as a widespread and host-specific bacterial symbiont within the Tephritini tribe [ 12 , 14 ]. The observed phylogenetic congruence between hosts and symbionts further supports coevolution, with evidence of parallel diversification and lineage-specific symbiont differentiation within the Australian radiation. Interestingly, while Stammerula is distributed across multiple geographic regions, its presence in endemic Australian Tephritini suggests that the ancient acquisition of this symbiont occurred prior to the occupation of Australia and the diversification of these lineages. Subsequent allopatric speciation events, coupled with host-plant specialization, may have contributed to the diversification of both host insects and their symbionts. Nevertheless, the detection of identical symbiont sequences in distantly related Australian species highlights the potential role of occasional horizontal transfer, possibly facilitated by ecological factors such as shared host plants. This pattern mirrors what has been described in other insect–bacteria systems and reinforces the notion that stable, long-term coevolution can coexist with occasional horizontal transmission events, jointly shaping the evolutionary history of insect–microbe associations [ 49 , 50 ]. Future research expanding these analyses to underexplored regions and Tephritini species, particularly in Africa and South America will be crucial to fully understand the evolutionary history and biogeographic patterns of this insect-symbiont association. Declarations Funding The present work was partially supported by the DOR project, University of Padova (Mazzon DOR2271053/22). Author Contribution IC and LM conceived the study. IMS and IC performed the experiments and data analysis; IC and MR provided the insect specimens. LM prepared figures; LM, MR and DH supervised the work; LM, IC and IMS wrote main manuscript text with input from all authors. Acknowledgement We thank Paden Wilson and Nindethana, Greening Australia’s Native Seed Centre for access to their native seed production facility where we collected flower heads and flies. Furthermore, we thank Chaminda Alakakoon and Carl Ramirez for assistance with collections across the Sydney region. We also gratefully acknowledge the partial support of the Ing. Aldo Gini Foundation. Data Availability All sequence data supporting the conclusions of this study are available in GenBank (NCBI). Accession numbers for each sequence are provided within the manuscript. References Foote RH, Blanc FL, Norrbom AL (1993) Handbook of the Fruit Flies (Diptera: Tephritidae) of America North of Mexico. Comstock Publishing Associates, Ithaca White IM (2006) Taxonomy of the Dacina (Diptera: Tephritidae) of Africa and the Middle East Zwolfer H (1983) Life systems and strategies of resource exploitation in tephritids. In R. Cavalloro (Ed.), Fruit flies of economic importance. Proceedings of the CEC/IOBC International Symposium, Athens, Greece, 16–19 November 1982 (pp. 16–30). Rotterdam, Netherlands: A.A. Balkema Korneyev VA (1999) Phylogenetic relationships among higher groups of Tephritidae. In: Aluja M, Norrbom AL (eds) Fruit Flies (Tephritidae): Phylogeny and Evolution of Behavior. CRC, pp 73–114. https://doi.org/10.1201/9781420074468-10 Headrick DH, Goeden RD (1998) The biology of nonfrugivorous tephritid fruit flies. Ann Rev Entomol 43(1):217–241. https://doi.org/10.1146/annurev.ento.43.1.217 Norrbom AL, Carroll LE, Freidberg A (1999) Status of knowledge. Fruit fly expert identification system and systematic information database, 9, 9–47 Harris P (1989) The use of Tephritidae for the biological control of weeds. Biocontrol News Inform 10(1):7–16 Turner CE (2020) Tephritidae in the biological control of weeds. Fruit fly pests. CRC, pp 157–164 Petri L (1909) Ricerche sopra i batteri intestinali della mosca olearia. Tipografia nazionale di G. Bertero, Roma Capuzzo C, Firrao G, Mazzon L, Squartini A, Girolami V (2005) Candidatus Erwinia dacicola’, a coevolved symbiotic bacterium of the olive fly Bactrocera oleae (Gmelin). Int J Syst Evol Microbiol 55:1641–1647. https://doi.org/10.1099/ijs.0.63653-0 Ben-Yosef M, Pasternak Z, Jurkevitch E, Yuval B (2015) Symbiotic bacteria enable olive fly larvae to overcome host defences. Royal Soc open Sci 2(7):150170. https://doi.org/10.1098/rsos.150170 Mazzon L, Piscedda A, Simonato M, Martinez-Sañudo I, Squartini A, Girolami V (2008) Presence of specific symbiotic bacteria in flies of the subfamily Tephritinae (Diptera Tephritidae) and their phylogenetic relationships: proposal of ‘ Candidatus Stammerula tephritidis’. Int J Syst Evol MicroBiol 58(6):1277–1287. https://doi.org/10.1099/ijs.0.65287-0 Barbehenn RV, Constabel CP (2011) Tannins in plants–herbivore interactions. Phytochemistry 72(13):1551–1565. https://doi.org/10.1016/j.phytochem.2011.01.040 Viale E, Martinez-Sañudo I, Brown JM, Simonato M, Girolami V, Squartini A, Bressan A, Faccoli M, Mazzon L (2015) Pattern of association between endemic Hawaiian fruit flies (Diptera, Tephritidae) and their symbiotic bacteria: Evidence of cospeciation events and proposal of Candidatus Stammerula trupaneae. Mol Phylogenet Evol 90:67–79. https://doi.org/10.1016/j.ympev.2015.04.025 Stammer HJ (1929) Die bakteriensymbiose der trypetiden (Diptera). Z für Morphologie und Ökologie der Tiere 14:481–523 Mazzon L, Martinez-Sañudo I, Simonato M, Squartini A, Savio C, Girolami V (2010) Phylogenetic relationships between flies of the Tephritinae subfamily (Diptera, Tephritidae) and their symbiotic bacteria. Mol Phylogenet Evol 56(1):312–326. https://doi.org/10.1016/j.ympev.2010.02.016 Gillespie RG, Roderick GK (2002) Arthropods on islands: colonization, speciation, and conservation. Ann Rev Entomol 47(1):595–632. https://doi.org/10.1146/annurev.ento.47.091201.145244 Vijverberg K, Kuperus P, Breeuwer JAJ, Bachmann K (2000) Incipient adaptive radiation of New Zealand and Australian Microseris (Asteraceae): an amplified fragment length polymorphism (AFLP) study. J Evol Biol 13(6):997–1008. https://doi.org/10.1046/j.1420-9101.2000.00241.x Scanlon JD, Lee MS, Archer M (2003) Mid-Tertiary elapid snakes (Squamata, Colubroidea) from Riversleigh, northern Australia: early steps in a continent-wide adaptive radiation. Geobios 36(5):573–601. https://doi.org/10.1016/S0016-6995(03)00056-1 Wellman CH, Berry CM, Davies NS, Lindemann FJ, Marshall JE, Wyatt A (2022) Low tropical diversity during the adaptive radiation of early land plants. Nat Plants 8(2):104–109. https://doi.org/10.1038/s41477-021-01067-w Hardy DE, Drew RAI (1996) Revision of the Australian Tephritini (Diptera: Tephritidae). Invertebrate Syst 10(2):213–405. https://doi.org/10.1071/IT9960213 Mazzon L, Martinez-Sañudo I, Savio C, Simonato M, Squartini A (2011) Stammerula and other symbiotic bacteria within the fruit flies inhabiting Asteraceae flowerheads. Manipulative tenants: bacteria associated with arthropods. CRC Press Taylor & Francis, pp 89–111 Hancock DL (2014) A new Australian species of Austrotephritis Hancock & Drew (Diptera: Tephritidae: Tephritinae). Australian Entomol 41(2):115–124. https://search.informit.org/doi/ 10.3316/informit.336726240212798 Xiong B, Kocher TD (1991) Comparison of mitochondrial DNA sequences of seven morphospecies of black flies (Diptera: Simuliidae). Genome 34(2):306–311. https://doi.org/10.1139/g91-050 Han HY, McPheron BA (1997) Molecular phylogenetic study of Tephritidae (Insecta: Diptera) using partial sequences of the mitochondrial 16S ribosomal DNA. Mol Phylogenet Evol 7(1):17–32. https://doi.org/10.1006/mpev.1996.0370 Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 87(6):651–701. https://doi.org/10.1093/aesa/87.6.651 Simon C, Buckley TR, Frati F, Stewart JB, Beckenbach AT (2006) Incorporating molecular evolution into phylogenetic analysis, and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Annu Rev Ecol Syst 37:545–579. https://doi.org/10.1146/annurev.ecolsys.37.091305.110018 Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697–703. https://doi.org/10.1128/jb.173.2.697-703.1991 Kumar S, Stecher G, Suleski M, Sanderford M, Sharma S, Tamura K (2024) MEGA12: Molecular Evolutionary Genetic Analysis version 12 for adaptive and green computing. Mol Biol Evol 41(12):msae263. https://doi.org/10.1093/molbev/msae263 Kalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat Methods 14:587–589. https://doi.org/10.1038/nmeth.4285 Rambaut A (2018) FigTree v.1.4.4-1. http://tree.bio.ed.ac.uk/software/figtree/ Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Von Haeseler A, Lanfear R (2020) IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol Biol Evol 37:1530–1534. https://doi.org/10.1093/molbev/msaa015 Conow C, Fielder D, Ovadia Y, Libeskind-Hadas R (2010) Jane: a new tool for the cophylogeny reconstruction problem. Algorithms Mol Biology 5(1):16. https://doi.org/10.1186/1748-7188-5-16 Balbuena JA, Míguez-Lozano R, Blasco-Costa I (2013) PACo: A novel procrustes application to cophylogenetic analysis. PLoS ONE 8(4):e61048. https://doi.org/10.1371/journal.pone.0061048 R Core Team (2023) *R: A language and environment for statistical computing*. R Foundation for Statistical Computing. https://www.r-project.org Mendlová M, Desdevises Y, Civáñová K, Pariselle A, Šimková A (2012) Monogeneans of West African cichlid fish: evolution and cophylogenetic interactions. PLoS ONE 7:e37268. https://doi.org/10.1371/journal.pone.0037268 Legendre P, Anderson MJ (1999) Distance-based redundancy analysis: Testing multispecies responses in multifactorial ecological experiments. Ecol Monogr 69(1):1–24. https://doi.org/10.1890/0012-9615(1999)069 [0001:DBRATM]2.0.CO;2 Peres-Neto PR, Jackson DA (2001) How well do multivariate data sets match? The advantages of a Procrustean superimposition approach over the Mantel test. Oecologia 129:169–178. https://doi.org/10.1007/s004420100720 Hutchinson MC, Cagua EF, Balbuena JA, Stouffer DB, Poisot T (2017) paco: implementing Procrustean Approach to Cophylogeny in R. Methods Ecol Evol 8(8):932–940. https://doi.org/10.1111/2041-210X.12736 Merz B (1999) Phylogeny of the Palearctic and Afrotropical genera of the Tephritis group (Tephritinae: Tephritini). Chapter 24. In: Aluja M, Norrbom AL (eds) Fruit Flies (Tephritidae): phylogeny and evolution of behavior. CRC, Boca Raton, Florida, pp 629–669 Hancock DL, Hamacek EL, Lloyd AC, Elson-Harris MM (2000) The distribution and host plants of fruit flies (Diptera: Tephritidae) in Australia. Queensland Department of Primary Industries Information Series Q199067, Brisbane David KJ, Hancock DL, Salini S, Gracy RG, Sachin K (2020) Taxonomic notes on the genus Campiglossa Rondani (Diptera, Tephritidae, Tephritinae, Tephritini) in India, with description of three new species. ZooKeys 977:75–100. https://doi.org/10.3897/zookeys.977.57875 Von Dohlen CD, Spaulding U, Patch KB, Weglarz KM, Foottit RG, Havill NP, Burke GR (2017) Dynamic acquisition and loss of dual-obligate symbionts in the plant-sap-feeding Adelgidae (Hemiptera: Sternorrhyncha: Aphidoidea). Front Microbiol 8:1037. https://doi.org/10.3389/fmicb.2017.01037 Smith WA, Oakeson KF, Johnson KP, Reed DL, Carter T, Smith KL, Koga R, Fukatsu T, Dale C (2013) Phylogenetic analysis of symbionts in feather-feeding lice of the genus Columbicola: evidence for repeated symbiont replacements. BMC Evol Biol 13(1):109. https://doi.org/10.1186/1471-2148-13-109 Van Laere A, Van Den Ende W (2002) Inulin metabolism in dicots: chicory as a model system. Plant Cell Environ 25(6):803–813. https://doi.org/10.1046/j.1365-3040.2002.00865.x Chi Z, Chi Z, Zhang T, Liu G, Yue L (2009) Inulinase-expressing microorganisms and applications of inulinases. Appl Microbiol Biotechnol 82(2):211–220. https://doi.org/10.1007/s00253-008-1827-1 Douglas AE (1998) Nutritional interactions in insect-microbial symbioses: aphids and their symbiotic bacteria Buchnera . Ann Rev Entomol 43(1):17–37. https://doi.org/10.1146/annurev.ento.43.1.17 Engel P, Moran NA (2013) The gut microbiota of insects–diversity in structure and function. FEMS Microbiol Rev 37(5):699–735. https://doi.org/10.1111/1574-6976.12025 Hosokawa T, Kikuchi Y, Nikoh N, Shimada M, Fukatsu T (2006) Strict host-symbiont co-speciation and reductive genome evolution in insect gut bacteria. PLoS Biol 4(10):e337. https://doi.org/10.1371/journal.pbio.0040337 Sudakaran S, Kost C, Kaltenpoth M (2017) Symbiont acquisition and replacement as a source of ecological innovation. Trends Microbiol 25(5):375–390. https://doi.org/10.1016/j.tim.2017.02.014 Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.docx Cite Share Download PDF Status: Published Journal Publication published 08 Jan, 2026 Read the published version in Microbial Ecology → Version 1 posted Editorial decision: Revision requested 13 Nov, 2025 Reviews received at journal 13 Nov, 2025 Reviews received at journal 11 Nov, 2025 Reviews received at journal 10 Nov, 2025 Reviews received at journal 05 Nov, 2025 Reviews received at journal 04 Nov, 2025 Reviewers agreed at journal 16 Oct, 2025 Reviewers agreed at journal 15 Oct, 2025 Reviewers agreed at journal 15 Oct, 2025 Reviewers agreed at journal 15 Oct, 2025 Reviewers agreed at journal 14 Oct, 2025 Reviewers agreed at journal 14 Oct, 2025 Reviewers invited by journal 14 Oct, 2025 Editor assigned by journal 14 Oct, 2025 Submission checks completed at journal 14 Oct, 2025 First submitted to journal 08 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7808998","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":531268866,"identity":"1cea301d-31b2-497d-b34d-f394eed301ae","order_by":0,"name":"Ivana Carofano","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYBACNgST8QGQsGFgYGZgkGAwIEoLM0hZGkwLHj1oWg6DmRIMeKzhk0h+9uAHg528eXsz4+eCivOJ29l5D95gKPiD22ESaeaGPQzJhnPOHGaWnnHmduLOZr5kC3wOY+M5YCbBw3CAcYZE/gFp3rbbiRsO85jh9Qsbz/Fvkn8YDtjPkEhm/s3bdo4ILew9ZtJAWxKBWtiAthwgSkuZtIxBcvIMnsNs1jxnko03HAb6JcHAGKcW+Wb2bZJvKuxsZ7A3M9/mqbCT3XD+7MEbH/7I4dQCAaiu4GFgSCCgAR3wkKh+FIyCUTAKhjsAABFrRrIpBWHkAAAAAElFTkSuQmCC","orcid":"","institution":"University of Padua","correspondingAuthor":true,"prefix":"","firstName":"Ivana","middleName":"","lastName":"Carofano","suffix":""},{"id":531268867,"identity":"bece1523-6e85-48a9-b801-8786514f4d63","order_by":1,"name":"Isabel Martinez-Sañudo","email":"","orcid":"","institution":"University of Padua","correspondingAuthor":false,"prefix":"","firstName":"Isabel","middleName":"","lastName":"Martinez-Sañudo","suffix":""},{"id":531268868,"identity":"7e4ec1fa-223b-4f5f-aa0b-30551ee439a1","order_by":2,"name":"Markus Riegler","email":"","orcid":"","institution":"Western Sydney University","correspondingAuthor":false,"prefix":"","firstName":"Markus","middleName":"","lastName":"Riegler","suffix":""},{"id":531268869,"identity":"eea41f3f-1841-435d-92e7-c18ce41b82cb","order_by":3,"name":"David L. Hancock","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"David","middleName":"L.","lastName":"Hancock","suffix":""},{"id":531268870,"identity":"6033969f-3bb7-45fd-b5c9-7ca2e27c09cb","order_by":4,"name":"Jennifer L. Morrow","email":"","orcid":"","institution":"Western Sydney University","correspondingAuthor":false,"prefix":"","firstName":"Jennifer","middleName":"L.","lastName":"Morrow","suffix":""},{"id":531268871,"identity":"f175c8cf-a863-4cbf-85a3-45475005f22b","order_by":5,"name":"Luca Mazzon","email":"","orcid":"","institution":"University of Padua","correspondingAuthor":false,"prefix":"","firstName":"Luca","middleName":"","lastName":"Mazzon","suffix":""}],"badges":[],"createdAt":"2025-10-08 14:38:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7808998/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7808998/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00248-025-02686-y","type":"published","date":"2026-01-08T15:57:37+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":94587712,"identity":"f0e7a0a6-4d36-471d-b2c7-f28a8331588c","added_by":"auto","created_at":"2025-10-28 18:18:35","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5939278,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/04f10281a4a1bcf2aa1ecfec.docx"},{"id":94588032,"identity":"cb4214f8-9b76-4b81-b41d-dbe5653821e1","added_by":"auto","created_at":"2025-10-28 18:18:57","extension":"json","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7976,"visible":true,"origin":"","legend":"","description":"","filename":"8eb1ec733edf406d9fae931632aa09a6.json","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/5a84a7f172e57f4b1e4d400e.json"},{"id":94588437,"identity":"f551b992-dd91-4033-9d64-1ce108bb85dd","added_by":"auto","created_at":"2025-10-28 18:19:21","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":815298,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/1d66dbc84397bec171469496.docx"},{"id":94588456,"identity":"076ce316-e7d5-406e-aeb6-578d394399d9","added_by":"auto","created_at":"2025-10-28 18:19:23","extension":"xml","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":144174,"visible":true,"origin":"","legend":"","description":"","filename":"8eb1ec733edf406d9fae931632aa09a61enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/a312c75ffcd25dcf2cec8ede.xml"},{"id":94587926,"identity":"56c0d86b-5f9b-4932-987c-c9b5567210d1","added_by":"auto","created_at":"2025-10-28 18:18:53","extension":"eps","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2411994,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.eps","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/eeed29461c7d43f5a73cdbd2.eps"},{"id":94587931,"identity":"84f2b87c-4e2b-4940-baed-328c5f65279f","added_by":"auto","created_at":"2025-10-28 18:18:53","extension":"eps","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2062246,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.eps","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/a427ad0a6ccb8f16b8a7884e.eps"},{"id":94588007,"identity":"bc418881-61cd-4129-a65d-749968801f0f","added_by":"auto","created_at":"2025-10-28 18:18:55","extension":"eps","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1708410,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.eps","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/49d2012a949dc783d3c6bc54.eps"},{"id":94588070,"identity":"74c9bd5d-6ca3-47ac-a7d2-d024621d070e","added_by":"auto","created_at":"2025-10-28 18:18:57","extension":"eps","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1599930,"visible":true,"origin":"","legend":"","description":"","filename":"FigS1.eps","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/f2579aeb18280420b71e3d02.eps"},{"id":94587950,"identity":"3fcff313-229e-4912-98b0-a9cd20606198","added_by":"auto","created_at":"2025-10-28 18:18:54","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":313823,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/2176473371c62347a76379ed.png"},{"id":94587540,"identity":"6a3c0402-edde-41e5-9bb1-eccc73f81632","added_by":"auto","created_at":"2025-10-28 18:18:21","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":240804,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/79070e6750452147f66ef4d6.png"},{"id":94588485,"identity":"8aede24d-1f18-43d2-aa4c-f34590d36789","added_by":"auto","created_at":"2025-10-28 18:19:25","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":179913,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/7f51cf14ebc80d224d11de80.png"},{"id":94587705,"identity":"ad2741c1-739c-496c-a42e-8b87dd0da259","added_by":"auto","created_at":"2025-10-28 18:18:34","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":143515,"visible":true,"origin":"","legend":"","description":"","filename":"8eb1ec733edf406d9fae931632aa09a61structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/ca37e645ff8c4df0cb2d75bb.xml"},{"id":94587713,"identity":"7ef18795-f475-481a-9cec-85c7370d0d15","added_by":"auto","created_at":"2025-10-28 18:18:35","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":159558,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/c155dd250d8f499bb3f2f81d.html"},{"id":94588102,"identity":"049200b4-812b-412f-8d45-08512b88c736","added_by":"auto","created_at":"2025-10-28 18:19:00","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":725517,"visible":true,"origin":"","legend":"\u003cp\u003eLateral habitus of the analysed Tephritini species: A) \u003cem\u003eCampiglossa sororcula\u003c/em\u003e ♂, B) \u003cem\u003eSpathulina acroleuca\u003c/em\u003e♀, C) \u003cem\u003eParaspathulina apicomacula\u003c/em\u003e ♀, D) \u003cem\u003eAustrotephritis fuscata\u003c/em\u003e ♂, E) \u003cem\u003eAustrotephritis pelia\u003c/em\u003e ♂, F) \u003cem\u003eAustrotephritis poenia\u003c/em\u003e ♀, G)\u003cem\u003e Trupanea prolata\u003c/em\u003e ♀, H) \u003cem\u003eSphenella ruficeps\u003c/em\u003e ♂. The scale bar represents 1 mm.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/710015e5e6f83614461f2e53.jpeg"},{"id":94596133,"identity":"7b77fdd3-02fe-4dcb-b038-66863861aa45","added_by":"auto","created_at":"2025-10-28 18:38:54","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":892984,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic reconstruction of the symbionts of Tephritini inferred with Maximum Likelihood (ML) analyses of the bacterial 16S rRNA gene. Symbionts of Tephritini species collected in Australia (both endemic and non-endemic species) are highlighted in blue. The values above the branches are the result of the SH-aLRT (above 80 are considered strongly supported) and ultrafast bootstrap support (above 95 are considered strongly supported).\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/07f9477e0cde7c71d6c1fcfb.jpeg"},{"id":94587321,"identity":"b1858bf8-ef70-4ba1-b821-f34745e39349","added_by":"auto","created_at":"2025-10-28 18:18:05","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":784493,"visible":true,"origin":"","legend":"\u003cp\u003eTanglegram linking the inferred phylogeny of Tephritini hosts and their symbiotic bacteria. Connecting lines illustrate host-symbiont associations. The topology shows the best ML trees based on the concatenated mitochondrial data set (partial 16S rRNA gene and the COI-tRNA-COII gene region) for the Tephritinae species and the bacterial 16S rRNA gene of their symbionts.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/4cbdbe8d68c6f2f89f90e4a6.jpeg"},{"id":100069523,"identity":"50f11060-8ca6-4fba-a72a-5e3a0060d6bb","added_by":"auto","created_at":"2026-01-12 16:14:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3362112,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/af1c6df4-58cd-445f-a165-2a9bb10a14c0.pdf"},{"id":94588426,"identity":"cba8d6ee-22c2-46e4-811d-cccfc70a64e3","added_by":"auto","created_at":"2025-10-28 18:19:20","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":815298,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-7808998/v1/eebabe35ac42cfd6e522ed03.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Detection of a conserved bacterial symbiosis in non-frugivorous Australian fruit flies (Diptera, Tephritidae, Tephritinae) supports its widespread association","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe Tephritidae, commonly known as the true fruit flies, is a large family of Diptera, with approximately 4,300 described species worldwide in almost 500 genera. It includes some of the most biologically interesting and economically important fly species [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Within this family, the subfamily Tephritinae is considered the most specialized lineage. Its larvae predominantly infest flowerheads of Asteraceae and tephritines are therefore classified as non-frugivorous species, as their larval food consists of plant parts other than fleshy fruits [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This subfamily includes at least 203 genera and 1,847 species distributed across all biogeographic regions, with the greatest species diversity occurring in the tropics [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. While generally not considered pestiferous, several Tephritinae species have been introduced as classical biological control agents against Asteraceae weeds in different regions of the world [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSeveral species within the Tephritidae are known to harbour symbiotic bacteria which help support their fitness. The first described primary and heritable bacterial symbiosis of insects was that of the olive fly \u003cem\u003eBactrocera oleae\u003c/em\u003e (Rossi) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], which harbours the bacterium \u003cem\u003eCandidatus\u003c/em\u003e Erwinia dacicola (hereafter \u003cem\u003eErwinia dacicola\u003c/em\u003e), an obligate symbiont involved in detoxifying olive polyphenols [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. A primary symbiosis has also been identified in the subfamily Tephritinae, particularly in species belonging to the tribe Tephritini [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. This tribe is the largest and most widespread among all Tephritinae [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The ecological success and evolutionary radiation of the Tephritini may have been facilitated by the establishment of stable bacterial symbioses. These symbionts may play a key role in rendering the tissues of Asteraceae digestible, as these tissues are rich in polyphenols and defensive compounds known to hinder insect digestion [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eStudies on various Palearctic genera and species of Tephritini have consistently revealed species-specific bacterial symbionts belonging to a monophyletic clade within the Enterobacteriaceae, for which the name \u003cem\u003eCandidatus\u003c/em\u003e Stammerula has been proposed (hereafter \u003cem\u003eStammerula\u003c/em\u003e). Within this clade, for the monophyletic and well-supported subclade represented by symbionts of species in the genus \u003cem\u003eTephritis\u003c/em\u003e Latreille, the name \u003cem\u003eStammerula tephritidis\u003c/em\u003e was proposed [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Subsequently, in a study conducted across the Hawaiian Islands on more than 25 endemic species of Tephritini, the presence of symbionts belonging to the genus \u003cem\u003eStammerula\u003c/em\u003e was confirmed. The Hawaiian symbionts grouped with those of palearctic \u003cem\u003eTrupanea\u003c/em\u003e Schrank species in a supported subclade showing an average divergence in the 16S rRNA gene of 1%. Based on this, the designation \u003cem\u003eStammerula trupaneae\u003c/em\u003e was proposed [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe identification of distinct yet closely related bacterial symbionts in flies of different genera and distributed across multiple biogeographic regions supports the hypothesis that symbiotic cospeciation within the Tephritini involved codivergence events after an ancient acquisition. These bacteria, located in specialized structures in the midgut outside the peritrophic membrane, are vertically transmitted and show high specificity even among closely related tephritid species, suggesting a stable association with their hosts [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIt is noteworthy that the presence of symbiotic \u003cem\u003eStammerula\u003c/em\u003e bacteria appears to be clearly connected to the tribe Tephritini, which, among the fly species investigated to date, represents a monophyletic and well-supported group of symbiotic bacteria. However, knowledge about the geographic distribution of \u003cem\u003eStammerula\u003c/em\u003e symbionts in the Tephritini tribe remains limited and fragmented.\u003c/p\u003e\u003cp\u003eDue to its isolation and geological history, Australia provides an ideal setting for evolutionary studies [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Indeed, Australia is well known for having experienced radiations of plants and animals [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Expanding the study to include Australian Tephritini represents an intriguing opportunity to gain new insights into the evolution of symbioses within the tribe and to test the hypothesis of a global distribution of \u003cem\u003eStammerula\u003c/em\u003e bacteria as symbionts of Tephritini. To expand the knowledge about the evolutionary history of the bacterial symbiosis in this group of tephritid flies, the present study aimed to investigate the presence and phylogenetic identity of bacterial symbionts associated with Australian Tephritini species, and to analyse the phylogenetic relationships between symbionts and hosts across Australian species and species of other biogeographic regions (palearctic: Europe; oceanic: Hawaii).\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eInsect sampling and identification\u003c/h2\u003e\u003cp\u003eA total of 33 specimens belonging to eight Tephritini species from seven genera were collected in the Sydney region, New South Wales, Australia (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The Tephritini fauna of Australia includes 77 species from 23 genera [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSpecimens were obtained either by collecting them directly on Asteraceae host plants in the field using an aspirator or by rearing them from infested flower heads. For the latter method, infested flower heads were placed into mesh bags and kept in the laboratory until adult emergence. Following the methodology described by Mazzon [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], the newly emerged adults were then transferred to net cages and maintained for at least 7 days under room conditions, fed with a 50% sucrose solution, before being stored in absolute ethanol at -80\u0026deg;C until DNA extraction.\u003c/p\u003e\u003cp\u003eAll adult samples were identified using morphological identification keys [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. For the molecular analyses, flies were dissected to extract the intestinal tract hosting symbionts, following the procedure described by Mazzon [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eCollection details for the Australian Tephritini specimens and their host plants including the number of sequenced specimens (n; biological replicates). GenBank accession numbers are provided for insect mitochondrial fragments COI\u0026ndash;tRNA\u0026ndash;COII and 16S rRNA and bacterial symbiont 16S rRNA fragments obtained in this study. Each accession number corresponds to a distinct haplotype (host or symbiont, respectively). Species that are represented with more than one row include different mitochondrial haplotypes and/or bacterial 16 rRNA gene sequences. Distribution status of each species is indicated by letters in parentheses: (E) endemic to Australia, (W) widespread (in and outside Australia). *\u003cem\u003eAustrotephritis poenia\u003c/em\u003e specimens collected from \u003cem\u003eSchoenia filifolia\u003c/em\u003e and \u003cem\u003ePodolepis jaceoides\u003c/em\u003e are not distinguished separately in this dataset.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTaxon and distribution\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003en\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eHost plant\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eCoordinates\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e\u003cp\u003eGenBank accessions\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eInsect: COI-COII\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eInsect:\u003c/p\u003e\u003cp\u003e16S rRNA\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eSymbiont: 16S rRNA\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCampiglossa sororcula\u003c/em\u003e (W)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eBidens pilosa\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33.61 S 150.75 E\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442354\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePV364013\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePV363879\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePV364014\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAustrotephritis poenia\u003c/em\u003e (E)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eSchoenia filifolia\u003c/em\u003e and \u003cem\u003ePodolepis jaceoides*\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33.61 S 150.75 E\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442358\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePV364008\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePV363870\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33.61 S 150.75 E\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442360\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePV363869\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33.61 S 150.75 E\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442359\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSpathulina acroleuca\u003c/em\u003e (W)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eCalotis lappulacea\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33.61 S 150.75 E\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442363\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePV364018\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePV363886\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePV364020\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAustrotephritis fuscata\u003c/em\u003e (E)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eXerochrysum bracteatum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33.62 S 150.75 E\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442344\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePV363998\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePV363874\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePV363875\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAustrotephritis pelia\u003c/em\u003e (E)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eChrysocephalum apiculatum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e34.07 S 150.76 E\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442352\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePV364003\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePV363864\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSphenella ruficeps\u003c/em\u003e (E)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eSenecio minimus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e38.83 S 146.13 E\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442365\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePV364022\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePV363891\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTrupanea prolata\u003c/em\u003e (E)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eSenecio madagascariensis\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33.62 S 150.75 E\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442366\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePV364023\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePV363892\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442369\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eParaspathulina apicomacula\u003c/em\u003e (E)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eVittadinia cuneata\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33.62 S 150.75 E\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442361\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003ePV364016\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePV363884\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003e\u0026ldquo;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePV442362\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eInsect host analyses: DNA extraction, amplification and sequencing\u003c/h3\u003e\n\u003cp\u003eDNA was extracted from the insect's guts using the Qiagen DNeasy Blood \u0026amp; Tissue kit (Qiagen, Hilden, Germany), following the manufacturer's instructions. The total DNA was quantified using the Qubit Fluorometer with the dsDNA High-Sensitivity Assay Kit (ThermoFisher Scientific, Life Technologies).\u003c/p\u003e\u003cp\u003eTwo fragments of the mitochondrial genome of the fly specimens were amplified: the 16S rRNA gene and a fragment encompassing the 3\u0026rsquo; region of the cytochrome oxidase subunit I (COI), tRNA-Leu and the 5\u0026rsquo; region of cytochrome oxidase subunit II (COII). Since not all primer pairs were equally effective across species, multiple combinations were tested (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers used in the polymerase chain and sequencing reactions for the 16S rRNA and the COI-tRNALeu-COII genes.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTarget gene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence 5\u0026prime;\u0026rarr;3\u0026prime;\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSource\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003e16S rRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLR-J-12883\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTCCGGTTTGAACTCAGATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTV-N-14202\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGCATTTCATTTACATTGAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDFI2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGATTTATAGGGTCTTCTCGTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGATGTACCGGAAGGTGTATCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLRN13398\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGCCTGTTTAACAAAAACAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eN1-J12261 m\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTACTTCGTAAGAAATTGTTTGAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e\u003cp\u003eCOI-tRNALeu-COII\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eC1-J-2195\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTGATTTTTTGGTCATCCAGAAGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTKN3796\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACTATAAAATGGTTTAAGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eC1-J-2183\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAACATTTATTTTGATTTTTTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTL2-N-3014\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCATTGCACTAATCTGCCATATTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eThe PCR reactions were performed in a 20 \u0026micro;l volume containing 4 \u0026micro;l of 5x colourless GoTaq Flexi Buffer (Promega), 2 mM MgCl, 100 \u0026micro;M dNTPs, 1 \u0026micro;l of each primer at 10 mM, 1U of GoTaq Flexi DNA polymerase (Promega) and 2 \u0026micro;l of extracted DNA. The standard thermal profile for the amplification of the 16S rRNA gene was: hold for 5 minutes at 96\u0026deg;C, 35 cycles of 96\u0026deg;C for 50 s, an annealing step ranging between 52\u0026deg;C and 60\u0026deg;C for 50 s, 72\u0026deg;C for 1 minute, and extension for 5 minutes at 72\u0026deg;C. For the COI-tRNA-Leu-COII amplification, the following thermocycling profile was used: hold for 5 minutes at 96\u0026deg;C, 35 cycles of 96\u0026deg;C for 1 minute, an annealing step ranging between 50\u0026deg;C and 60\u0026deg;C for 1 minute, 72\u0026deg;C for 2 minutes and extension for 5 minutes at 72\u0026deg;C. The annealing temperature was adjusted according to the insect species, ranging from 52\u0026deg;C for specimens showing efficient amplification at lower temperatures to 60\u0026deg;C for those requiring a higher temperature. The amplified products were examined by gel electrophoresis on 1% agarose gel. PCR-amplified products were purified with a mix of exonuclease and antarctic phosphatase (New England Biolabs) and sequenced at the BMR Genomics service at Padova, Italy. All fly sequences were deposited in GenBank (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eSymbiont analyses: bacterial DNA extraction, amplification and sequencing\u003c/h3\u003e\n\u003cp\u003eA fragment of the bacterial 16S rRNA gene was amplified for the same DNA extracts used for the amplification of the mitochondrial gene fragments using the universal primers fD1 (forward: 5\u0026rsquo;-AGAGTTTGATCCTGGCTCAG-3\u0026rsquo;) and rP1 (reverse: 5\u0026rsquo;-ACGGTTACCTTGTTACGACTT-3\u0026rsquo;) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The PCR master mix had the same composition as used for the fly mitochondrial gene amplification. The cycling program for the bacterial 16S rRNA gene included an initial denaturation at 95\u0026deg;C for 2 minutes, 35 cycles at 96\u0026deg;C for 30 s, 56\u0026deg;C for 30 s, 72\u0026deg;C for 90 s and a final extension at 72\u0026deg;C for 10 minutes. PCR products were purified and sequenced as carried out for the fly mitochondrial genes. All bacterial symbiont sequences were deposited in GenBank (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003ePhylogenetic analyses of the fly species\u003c/h3\u003e\n\u003cp\u003eThe fly mitochondrial sequences were examined and aligned using MEGA 12 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Low-quality regions at the beginning and end of each sequence were trimmed and low-quality sequences were not included in the analysis. The protein coding sequences were translated with Transeq (EMBOSS: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ebi.ac.uk/Tools/emboss/transeq/index.html\u003c/span\u003e\u003cspan address=\"http://www.ebi.ac.uk/Tools/emboss/transeq/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e)\u003c/span\u003e to identify any nuclear mitochondrial pseudogenes. Identical insect sequences associated with the same symbiont were removed prior to constructing the final phylogenetic tree, in order to avoid redundancy in the dataset. Sequences of fifteen Hawaiian tephritid species [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] and fifteen European tephritid species [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] were included in the analyses as references (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Maximum likelihood (ML) phylogenetic analyses were inferred with IQ-TREE v.2.3.6, using the best fitting evolutionary model [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Branch support in ML trees was assessed with 100 bootstrap replicates. The trees were viewed with FigTree v.1.4.5 [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003ePhylogenetic analyses of the bacterial symbionts\u003c/h3\u003e\n\u003cp\u003eThe bacterial 16S rRNA gene sequences were aligned using MEGA 12 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. For the phylogenetic analyses, redundant haplotypes were represented with a single sequence. A set of 39 symbiont sequences from GenBank (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) was included as reference. Phylogenetic trees were inferred using maximum likelihood (ML) implemented in the software IQ-TREE version 2.3.6 [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The optimal substitution model for the dataset was determined using IQ-TREE.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eHost-symbiont cophylogenetic analyses\u003c/h2\u003e\u003cp\u003eFor the examination of the congruence between the fly and bacterial symbiont phylogenies two methods were used: a tree-based method, executed in Jane 4.0 [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] and a distance-based method, PACo [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] implemented in R [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Cophylogenetic analyses were conducted using a reduced data set including all the Australian species and some representative species from Europe and Hawaii.\u003c/p\u003e\u003cp\u003eJane 4.0 compares host and symbiont tree topologies using a combination of a genetic algorithm and a dynamic programming approach that runs in polynomial time. This method allows the software to optimally map the parasite tree onto the host tree by assigning costs to different evolutionary events. In addition, this program supports multihost parasites and multiparasite hosts. Five types of events are included in the analyses: cospeciation, duplication, failure to diverge, loss and duplication with host switch, and each event can be set [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In this study two models with different event cost schemes were evaluated: setting 1 assuming no cost for cospeciation and cost\u0026thinsp;=\u0026thinsp;1 for all other events (cospeciation\u0026thinsp;=\u0026thinsp;0, duplication\u0026thinsp;=\u0026thinsp;1, duplication \u0026amp; host switch\u0026thinsp;=\u0026thinsp;2, loss\u0026thinsp;=\u0026thinsp;1, failure to diverge\u0026thinsp;=\u0026thinsp;1); setting 2 assuming cost\u0026thinsp;=\u0026thinsp;1 for all events (cospeciation\u0026thinsp;=\u0026thinsp;1, duplication\u0026thinsp;=\u0026thinsp;1, duplication \u0026amp; host switch\u0026thinsp;=\u0026thinsp;2, loss\u0026thinsp;=\u0026thinsp;1, failure to diverge\u0026thinsp;=\u0026thinsp;1). The parameters of the genetic algorithm were 500 generations and a population size of 100.\u003c/p\u003e\u003cp\u003ePACo was used to assess the null hypothesis of random association between host and symbiont phylogenies. This system estimates the phylogenetic congruence by comparing patristic distance matrices derived from the phylogenetic trees of the hosts and symbionts and projecting them into a common Euclidean space following methods described by Legendre \u0026amp; Anderson [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] and Peres-Neto \u0026amp; Jackson [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The analysis was performed in RStudio environment using the paco package [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] operating 10,000 permutations to evaluate the significance of the global fit and of individual host\u0026ndash;symbiont associations.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eSequencing of flies and their endosymbionts\u003c/h2\u003e\u003cp\u003eA total of 33 specimens belonging to eight species across six genera of Australian Tephritini were collected. The sample set included one species each of the genera \u003cem\u003eCampiglossa\u003c/em\u003e Rondani \u003cem\u003eSphenella\u003c/em\u003e Robineau-Dwsvoidy, \u003cem\u003eSpathulina\u003c/em\u003e Rondani, \u003cem\u003eParaspathulina\u003c/em\u003e Hardy \u0026amp; Drew and \u003cem\u003eTrupanea\u003c/em\u003e, and three species of the genus \u003cem\u003eAustrotephritis\u003c/em\u003e Hancock \u0026amp; Drew (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Approximately 925 bp and 1329 bp were obtained for the partial mitochondrial 16S rRNA and COI-tRNALeu-COII genes, respectively. The sequences were concatenated to create a merged dataset of approximately 2257 bp for each of 21 individuals that successfully amplified (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe amplification and sequencing of the bacterial 16S rRNA gene from the midgut contents of all the 33 specimens enabled the recovery of an average of 1279 bp. A distinctive bacterial sequence was retrieved for each of six out of the eight species examined. In contrast, two species, \u003cem\u003eTrupanea prolata\u003c/em\u003e Hardy \u0026amp; Drew and \u003cem\u003eSpathulina Acroleuca\u003c/em\u003e (Schiner), shared identical bacterial sequences.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003ePhylogeny of Australian Tephritini\u003c/h2\u003e\u003cp\u003eAfter low-quality trimming, sequences of the COI-tRNALeu-COII fragment were translated with Transeq, and the presence of any nuclear mitochondrial pseudogenes was excluded. Phylogenetic analyses were conducted on the concatenated dataset using the ML method, employing the General Time Reversible model with empirical base frequencies, a proportion of invariant sites, and a gamma-distributed rate variation across four categories (GTR\u0026thinsp;+\u0026thinsp;F\u0026thinsp;+\u0026thinsp;I\u0026thinsp;+\u0026thinsp;G4), which was selected as the best-fitting model of nucleotide evolution determined by IQ-TREE. The phylogeny of the united data recovered different high-supported clades (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn particular, the phylogenetic results showed that all Tephritini species included in the dataset clustered together in a well-supported monophyletic clade (UFBoot/SH-aLRT: 98.2/100) (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The endemic \u003cem\u003eT. prolata\u003c/em\u003e grouped within the \u003cem\u003eTephritis\u003c/em\u003e group sensu [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], specifically within the genus \u003cem\u003eTrupanea\u003c/em\u003e, which included species from both Europe and Hawaii (UFBoot/SH-aLRT: 99.8/100). In the same way, the endemic \u003cem\u003eS. rucifeps\u003c/em\u003e clustered with the European \u003cem\u003eS. marginata\u003c/em\u003e, and \u003cem\u003eCampiglossa sororcula\u003c/em\u003e was included in the \u003cem\u003eCampiglossa\u003c/em\u003e group clade.\u003c/p\u003e\u003cp\u003eThe widespread \u003cem\u003eSpathulina acroleuca\u003c/em\u003e and the endemic Australian species, \u003cem\u003eParaspathulina apicomacula\u003c/em\u003e Hardy \u0026amp; Drew, \u003cem\u003eAustrotephritis poenia\u003c/em\u003e, \u003cem\u003eA. pelia\u003c/em\u003e (Schiner) and \u003cem\u003eA. fuscata\u003c/em\u003e clustered together in a supported clade (UFBoot/SH-aLRT: 85.8/91) (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSome species, for which multiple specimens were analysed, exhibited different mitochondrial haplotypes. In detail, two haplotypes were found for \u003cem\u003eA. pelia\u003c/em\u003e (pairwise distance: 0.0004), \u003cem\u003eP. apicomacula\u003c/em\u003e (pairwise distance: 0.0009) and \u003cem\u003eT. prolata\u003c/em\u003e (pairwise distance: 0.0004), while three haplotypes for \u003cem\u003eA. poenia\u003c/em\u003e (pairwise distance: 0.0009) (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eIdentity and phylogeny of endosymbionts\u003c/h2\u003e\u003cp\u003eBLAST analyses revealed 98\u0026ndash;99% identity between almost all bacterial sequences analysed with \u003cem\u003eStammerula\u003c/em\u003e sequences, previously retrieved from European and Hawaiian Tephritini. The only exception was the bacterial sequence of \u003cem\u003eCampiglossa\u003c/em\u003e (\u003cem\u003e=\u0026thinsp;Dioxyna\u003c/em\u003e) \u003cem\u003esororcula\u003c/em\u003e (Wiedemann), a geographically widespread species (Micronesian Islands and tropical and subtropical regions), which showed a lower percentage of identity to \u003cem\u003eStammerula\u003c/em\u003e (96.12%) and a higher similarity (99.14%) to the symbiont of the Palaearctic \u003cem\u003eC.\u003c/em\u003e (\u003cem\u003e=\u0026thinsp;Dioxyna\u003c/em\u003e) \u003cem\u003ebidentis\u003c/em\u003e (Robineau-Desvoidy).\u003c/p\u003e\u003cp\u003ePhylogenetic reconstruction was performed using the ML method based on the GTR\u0026thinsp;+\u0026thinsp;F\u0026thinsp;+\u0026thinsp;I\u0026thinsp;+\u0026thinsp;G4 model of evolution as suggested by IQ-TREE. The phylogenetic tree included \u003cem\u003eStammerula\u003c/em\u003e symbionts of European [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] and Hawaiian [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] Tephritini species.\u003c/p\u003e\u003cp\u003eThe bacteria associated with seven of the eight Australian Tephritini species examined clustered in the well-supported and monophyletic clade (UFBoot/SH-aLRT: 98.5/100) corresponding to \u003cem\u003eStammerula\u003c/em\u003e sp. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe symbiont of the species \u003cem\u003eC.\u003c/em\u003e (\u003cem\u003e=\u0026thinsp;Dioxyna\u003c/em\u003e) \u003cem\u003esororcula\u003c/em\u003e represented the only exception among the Australian Tephritini. It clustered within the \u003cem\u003eErwinia\u003c/em\u003e group clade (UFBoot/SH-aLRT: 99.7/97). According to previous findings on some European \u003cem\u003eCampiglossa\u003c/em\u003e species, it differed from \u003cem\u003eStammerula\u003c/em\u003e sp. and was related to \u003cem\u003eErwinia dacicola\u003c/em\u003e and the free-living \u003cem\u003eE. persicina.\u003c/em\u003e Specifically, the symbionts of \u003cem\u003eC.\u003c/em\u003e (\u003cem\u003e=\u0026thinsp;Dioxyna\u003c/em\u003e) \u003cem\u003esororcula\u003c/em\u003e exhibited strong similarity to those of the European \u003cem\u003eC.\u003c/em\u003e (\u003cem\u003e=\u0026thinsp;Dioxyna\u003c/em\u003e) \u003cem\u003ebidentis\u003c/em\u003e and \u003cem\u003eC. guttella\u003c/em\u003e (Rondani) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eWithin the \u003cem\u003eStammerula\u003c/em\u003e sp. clade, the bacterial symbiont of \u003cem\u003eSphenella ruficeps\u003c/em\u003e (Macquart) was closely related to that of the European \u003cem\u003eS. marginata\u003c/em\u003e (Fallen) (UFBoot/SH-aLRT: 98.4/100). In the same \u003cem\u003eStammerula\u003c/em\u003e clade, the bacterial symbionts of the geographically widespread \u003cem\u003eSpathulina acroleuca\u003c/em\u003e (Micronesian Islands, Japan, Africa, Asia to Australia, New Caledonia, Philippines, Fiji and Taiwan) and the Australian endemic genera \u003cem\u003eAustrotephritis\u003c/em\u003e and \u003cem\u003eParaspathulina\u003c/em\u003e, investigated here for the first time, grouped together in a subclade that is not fully resolved due to limited sequence divergence (UFBoot/SH-aLRT: 80.2/37). In addition, two distinct bacterial sequences were detected in the species \u003cem\u003eA. fuscata\u003c/em\u003e (Maquart) and \u003cem\u003eA. poenia\u003c/em\u003e (Walker) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eInterestingly, all five samples of the endemic species \u003cem\u003eTrupanea prolata\u003c/em\u003e appeared to share the same bacterial symbiont as the widespread \u003cem\u003eS. acroleuca\u003c/em\u003e, and did not cluster with \u003cem\u003eStammerula trupaneae\u003c/em\u003e, previously detected in \u003cem\u003eTrupanea\u003c/em\u003e species from Europe and Hawaii (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eCoevolutionary analyses\u003c/h2\u003e\u003cp\u003eTo assess the coevolution between the flies and their bacterial symbionts, all haplotypes of the Australian species were analysed together with the corresponding bacterial symbiont sequences. Additionally, the dataset included \u003cem\u003eTrupanea arboreae\u003c/em\u003e Hardy as a representative of the \u003cem\u003eTrupanea\u003c/em\u003e genus from Hawaii, \u003cem\u003eT. stellata\u003c/em\u003e (Fuesslin) as the European representative of the same genus, and \u003cem\u003eSphenella marginata\u003c/em\u003e and \u003cem\u003eCampiglossa bidentis\u003c/em\u003e as European representatives of their respective genera. \u003cem\u003eBactrocera oleae\u003c/em\u003e and its symbiont \u003cem\u003eE. dacicola\u003c/em\u003e were also included as outgroups. In four cases, there were multiple host haplotypes for a symbiont lineage and in one case there were two symbiont haplotypes for one host lineage (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eBoth the tree-based method (Jane 4.0) and the distance-based method, (PACo) indicated a significant signal of cophylogeny between the hosts and their associated bacteria. For the tree-based method, two commonly used event cost models were applied. Four failure-to-diverge and five co-speciation events were detected for both the first (0, 1, 1, 2, 1) and the second (1, 1, 1, 2, 1) settings. The reconciliation analysis showed a significantly higher number of cospeciation events than expected by chance (\u003cem\u003ep\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u003c/em\u003e), indicating a notable congruence between the host and symbiont trees (Figure S2). Examples of possible reconstructions are shown in Figure S3. For instance, the analyses suggested that species of the endemic genus \u003cem\u003eAustrotephritis\u003c/em\u003e have cospeciated with their symbionts. A host switch was identified for the symbionts of \u003cem\u003eT. prolata\u003c/em\u003e and \u003cem\u003eS. acroleuca\u003c/em\u003e (Figure S3).\u003c/p\u003e\u003cp\u003ePACo analysis evaluates the congruence between host and symbiont phylogenies by comparing their respective patristic distance matrices, using a Procrustean approach. To test the global fit, this method quantified the contribution of each individual host-symbiont association and identified a significant congruence between insect hosts and their associated symbiotic bacteria (\u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.0003). However, residual analysis revealed that not all associations contributed equally to the global fit. While several links showed very low residuals, indicating strong phylogenetic congruence, others exhibited higher levels of incongruence, suggesting variable degrees of cophylogenetic structure across associations. Notably, 13 out of 19 links showed extremely low residual values (PACo residual\u0026thinsp;\u0026lt;\u0026thinsp;0.001), highlighting their potential role in driving the observed global congruence.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study represents the first investigation of symbiotic bacteria in non-frugivorous Australian tephritid flies belonging to the tribe Tephritini, as well as the first genetic characterization and phylogenetic placement of some of these Australian Tephritini (i.\u003cem\u003ee Paraspathulina apicomacula\u003c/em\u003e, \u003cem\u003eAustrotephritis fuscata\u003c/em\u003e, \u003cem\u003eA. poenia\u003c/em\u003e, \u003cem\u003eA. pelia\u003c/em\u003e, \u003cem\u003eTrupanea prolata\u003c/em\u003e and \u003cem\u003eSphenella ruficeps\u003c/em\u003e). The sampled diversity in our study represents approximately 30% of Australia\u0026rsquo;s known Tephritini genera, providing a robust basis for interpreting the phylogenetic patterns observed. The results reveal the presence of bacterial symbionts strictly associated with the analysed fly species, according to previous studies on Palearctic and endemic Hawaiian Tephritini species, which described these obligate and vertically transmitted symbionts [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOne of the most relevant findings of this study is that the bacterial symbionts of seven of the eight examined species belonging to the genera \u003cem\u003eAustrotephritis\u003c/em\u003e, \u003cem\u003eSpathulina\u003c/em\u003e, \u003cem\u003eParaspathulina\u003c/em\u003e, \u003cem\u003eTrupanea\u003c/em\u003e and \u003cem\u003eSphenella\u003c/em\u003e consistently clustered within the monophyletic clade of \u003cem\u003eStammerula\u003c/em\u003e. This same clade has previously been detected in Tephritini from the Palearctic (Europe) and Oceanic (Hawaii) biogeographic regions [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] reinforcing the hypothesis that \u003cem\u003eStammerula\u003c/em\u003e represents a widespread and evolutionarily conserved symbiotic lineage across the tribe.\u003c/p\u003e\u003cp\u003eOur cophylogenetic analyses provide strong evidence for a significant evolutionary association between the tribe Tephritini and their bacterial symbionts, consistent with the hypothesis of long-term codivergence. Both the tree-based approach (Jane 4.0) and the distance-based method (PACo) detected a statistically significant signal of coevolution, supporting the view that the phylogenetic histories of hosts and their symbionts are not independent. Nevertheless, a few host-switching events were detected, suggesting that, while codivergence has been the dominant process shaping these associations, occasional host shifts have also contributed to their evolutionary history.\u003c/p\u003e\u003cp\u003ePACo analysis revealed a highly significant global fit between host and symbiont phylogenies (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0003). Thirteen out of 19 associations showed extremely low residual values (residual\u0026thinsp;\u0026lt;\u0026thinsp;0.001), indicating strong phylogenetic congruence. These robust associations involved Australian species of \u003cem\u003eAustrotephritis\u003c/em\u003e, \u003cem\u003eTrupanea\u003c/em\u003e and \u003cem\u003eParaspathulina\u003c/em\u003e, highlighting their key role in shaping the overall cophylogenetic structure. In contrast, associations with higher residuals suggest episodes of evolutionary decoupling, likely due to occasional host switches, symbiont replacements, or events of loss and reacquisition.\u003c/p\u003e\u003cp\u003eIn line with these findings, tree-based reconciliation analysis using Jane 4.0 indicated that cospeciation is recurrent over evolutionary time. Specifically, the number of observed cospeciation events was significantly higher than expected by chance (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), supporting a non-random pattern of congruence between host and symbiont trees. This was particularly evident in species of the endemic Australian genus \u003cem\u003eAustrotephritis\u003c/em\u003e, for which a clear pattern of codivergence was observed, further suggesting that tight host\u0026ndash;symbiont specificity characterizes these lineages.\u003c/p\u003e\u003cp\u003eThe host-switch event involved a symbiont lineage shared by \u003cem\u003eTrupanea prolata\u003c/em\u003e and \u003cem\u003eSpathulina acroleuca\u003c/em\u003e, pointing to isolated instances of occasional horizontal transmission, as previously reported for other Tephritini species [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In this specific case, the \u003cem\u003eStammerula\u003c/em\u003e symbiont carried by \u003cem\u003eT. prolata\u003c/em\u003e was found to be genetically identical to that associated with \u003cem\u003eS. acroleuca\u003c/em\u003e across all analysed individuals. This may indicate that \u003cem\u003eT. prolata\u003c/em\u003e has lost its original symbiont and subsequently acquired the symbiont of \u003cem\u003eS. acroleuca\u003c/em\u003e. Indeed, this \u003cem\u003eStammerula\u003c/em\u003e lineage is phylogenetically distant from those previously identified in the Palearctic \u003cem\u003eTrupanea\u003c/em\u003e genus and Hawaiian species (pairwise distance: 0.03), suggesting a replacement event (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e; Figure S3). The deviation from strict vertical transmission might be explained by the sharing of the host plant \u003cem\u003eCalotis lappulacea\u003c/em\u003e. This endemic Australian Asteraceae has been recorded as a host for \u003cem\u003eT. prolata\u003c/em\u003e [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], but it may also act as a suitable resource for \u003cem\u003eS. acroleuca\u003c/em\u003e due to its broad ecological range at least for adult visitation (Hancock, pers. comm.) offering a plausible pathway for symbiont exchange. The extracellular nature of this symbiont could also have favoured this exchange. In adult flies the symbiotic bacteria are in a protected environment, within specialized crypts located between the peritrophic membrane and the midgut epithelium, while in larvae they reside in intestinal blind sacs [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] which lack the protection of the peritrophic membrane. Thus, they are more exposed to potential replacement. In addition, vertical transmission via egg surface contamination [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], together with host plant-sharing behaviour among Tephritini species, may further facilitate horizontal transfer and disrupt strict maternal transmission [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAnother intriguing result concerns \u003cem\u003eC. sororcula\u003c/em\u003e, a species originally described from Tenerife and the Canary Islands [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] and subsequently found to be widespread globally. Interestingly, as previously observed in other Palearctic \u003cem\u003eCampiglossa\u003c/em\u003e species (\u003cem\u003eC. guttella\u003c/em\u003e and \u003cem\u003eC. bidentis\u003c/em\u003e), its symbiont clusters within the \u003cem\u003eErwinia\u003c/em\u003e genus clade [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], showing approximately 99% sequence identity with \u003cem\u003eErwinia persicina\u003c/em\u003e. This finding supports the hypothesis that species within the genus \u003cem\u003eCampiglossa\u003c/em\u003e may have lost their ancestral \u003cem\u003eStammerula\u003c/em\u003e symbionts at some point during their evolutionary history and acquired \u003cem\u003eErwinia\u003c/em\u003e instead. The only known exception to this pattern remains the Palearctic \u003cem\u003eC. doronici\u003c/em\u003e (Loew), which still harbours \u003cem\u003eStammerula\u003c/em\u003e. This potential symbiont replacement highlights the dynamic nature of host\u0026ndash;microbe associations, even within closely related taxa, and suggests that ecological or physiological factors may have driven such a transition.\u003c/p\u003e\u003cp\u003eWhen considering the endemic Australian Tephritini genera, the observed cophylogenetic patterns support the hypothesis of a long-term coevolutionary history between these flies and their associated symbionts, \u003cem\u003eStammerula\u003c/em\u003e. The monophyletic clustering of both hosts and symbionts suggests that these associations originated from a common ancestral lineage.\u003c/p\u003e\u003cp\u003eThis scenario is consistent with the broader biogeographical and evolutionary framework of the Tephritini tribe, where ancient acquisition of \u003cem\u003eStammerula\u003c/em\u003e likely occurred in a common ancestor, followed by parallel diversification of hosts and symbionts. Together, these findings are consistent with a mosaic coevolutionary process, characterized by cospeciating events, localized adaptations, and occasional losses or replacements of symbionts in certain host lineages. Such patterns, well-documented in insular Tephritini radiations, such as those in the Hawaiian Islands [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], further support the role of host-symbiont coevolution as a driver of diversification in Australian Tephritini. While our findings support the hypothesis of symbiotic cospeciation within the Tephritini, an alternative hypothesis of repeated, independent acquisitions of closely related bacterial symbionts by different host species (phylogenetic tracking) should also be considered. In several insect-bacterial symbiont associations, what initially appeared as cospeciation has later been interpreted as repeated, independent acquisition of closely related bacterial lineages by host species. For example, repeated acquisition events have been documented in adelgids [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] and feather lice [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. In this scenario, closely related Tephritini species could have independently acquired similar bacterial symbionts adapted to their ecological niches. This perspective does not exclude cospeciation overall but highlights that some observed congruence between host and symbiont phylogenies could result from recurrent acquisitions of pre-adapted symbionts. Expanding taxon sampling and including genomic data from the symbionts could help distinguish between cospeciation and phylogenetic tracking in Tephritini.\u003c/p\u003e\u003cp\u003eThe stable presence of \u003cem\u003eStammerula\u003c/em\u003e within the tribe, including Australian Tephritini, suggests a consolidated symbiotic specialization, potentially linked to a larval diet based on Asteraceae. In Australia, species with known biology are mostly associated with Asteraceae and (in some species of \u003cem\u003eOedaspis\u003c/em\u003e Loew in tribe Dithrycini) Goodeniaceae, with the latter sharing with Asteraceae the presence of inulin [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. This polysaccharide, together with polyphenols and other secondary metabolites, represents one of the non-digestible carbohydrates commonly found in Asteraceae tissues, and may have driven the evolution of a functional symbiotic association in Tephritini. Future studies should investigate whether the presence of bacterial symbionts enables Tephritini to exploit such host plants. Numerous microorganisms are known to produce inulinases, enzymes classified as hydrolases that specifically cleave the β-2,1 linkages of inulin, hydrolysing it into fructose and glucose [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAlthough there is currently no direct evidence of inulinase production by insect symbionts, several studies have shown that microbial communities in insect guts provide enzymes for the digestion of complex polysaccharides, such as cellulose, xylan and starch, which are essential for adaptation to plant-based diets [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. While inulin itself has not yet been directly investigated in this context, it is plausible that \u003cem\u003eStammerula\u003c/em\u003e in Tephritini may provide inulinase activity, thus facilitating the exploitation of plants rich in this fructan. The stable presence of symbionts in Tephritini may therefore reflect an evolutionary adaptation to a diet rich in structurally complex compounds such as inulin.\u003c/p\u003e\u003cp\u003eHowever, in addition to species within the tribe Tephritini, there are other tribes of the subfamily Tephritinae, such as Myopitini, Terelliini and Xiphosiini, that are also known to develop in flower heads or stems of Asteraceae [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], but for which no specific primary symbionts have been described to date [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. This suggests that additional biological factors must be considered in explaining the role of \u003cem\u003eStammerula\u003c/em\u003e in Tephritini, beyond a simple association with Asteraceae as larval hosts.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOverall, this study provides new insights into the symbiotic associations and evolutionary dynamics of Australian endemic Tephritini. All investigated species, with the exception of the genus \u003cem\u003eCampiglossa\u003c/em\u003e, harboured specific bacterial symbionts belonging to the genus \u003cem\u003eStammerula\u003c/em\u003e, consistent with previous evidence describing this symbiont as a widespread and host-specific bacterial symbiont within the Tephritini tribe [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The observed phylogenetic congruence between hosts and symbionts further supports coevolution, with evidence of parallel diversification and lineage-specific symbiont differentiation within the Australian radiation.\u003c/p\u003e\u003cp\u003eInterestingly, while \u003cem\u003eStammerula\u003c/em\u003e is distributed across multiple geographic regions, its presence in endemic Australian Tephritini suggests that the ancient acquisition of this symbiont occurred prior to the occupation of Australia and the diversification of these lineages. Subsequent allopatric speciation events, coupled with host-plant specialization, may have contributed to the diversification of both host insects and their symbionts.\u003c/p\u003e\u003cp\u003eNevertheless, the detection of identical symbiont sequences in distantly related Australian species highlights the potential role of occasional horizontal transfer, possibly facilitated by ecological factors such as shared host plants. This pattern mirrors what has been described in other insect\u0026ndash;bacteria systems and reinforces the notion that stable, long-term coevolution can coexist with occasional horizontal transmission events, jointly shaping the evolutionary history of insect\u0026ndash;microbe associations [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eFuture research expanding these analyses to underexplored regions and Tephritini species, particularly in Africa and South America will be crucial to fully understand the evolutionary history and biogeographic patterns of this insect-symbiont association.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThe present work was partially supported by the DOR project, University of Padova (Mazzon DOR2271053/22).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eIC and LM conceived the study. IMS and IC performed the experiments and data analysis; IC and MR provided the insect specimens. LM prepared figures; LM, MR and DH supervised the work; LM, IC and IMS wrote main manuscript text with input from all authors.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe thank Paden Wilson and Nindethana, Greening Australia\u0026rsquo;s Native Seed Centre for access to their native seed production facility where we collected flower heads and flies. Furthermore, we thank Chaminda Alakakoon and Carl Ramirez for assistance with collections across the Sydney region. We also gratefully acknowledge the partial support of the Ing. Aldo Gini Foundation.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll sequence data supporting the conclusions of this study are available in GenBank (NCBI). Accession numbers for each sequence are provided within the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFoote RH, Blanc FL, Norrbom AL (1993) Handbook of the Fruit Flies (Diptera: Tephritidae) of America North of Mexico. Comstock Publishing Associates, Ithaca\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWhite IM (2006) Taxonomy of the Dacina (Diptera: Tephritidae) of Africa and the Middle East\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZwolfer H (1983) Life systems and strategies of resource exploitation in tephritids. In R. Cavalloro (Ed.), \u003cem\u003eFruit flies of economic importance. Proceedings of the CEC/IOBC International Symposium, Athens, Greece, 16\u0026ndash;19 November 1982\u003c/em\u003e (pp. 16\u0026ndash;30). Rotterdam, Netherlands: A.A. Balkema\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKorneyev VA (1999) Phylogenetic relationships among higher groups of Tephritidae. In: Aluja M, Norrbom AL (eds) Fruit Flies (Tephritidae): Phylogeny and Evolution of Behavior. CRC, pp 73\u0026ndash;114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1201/9781420074468-10\u003c/span\u003e\u003cspan address=\"10.1201/9781420074468-10\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHeadrick DH, Goeden RD (1998) The biology of nonfrugivorous tephritid fruit flies. Ann Rev Entomol 43(1):217\u0026ndash;241. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev.ento.43.1.217\u003c/span\u003e\u003cspan address=\"10.1146/annurev.ento.43.1.217\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNorrbom AL, Carroll LE, Freidberg A (1999) Status of knowledge. Fruit fly expert identification system and systematic information database, 9, 9\u0026ndash;47\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHarris P (1989) The use of Tephritidae for the biological control of weeds. Biocontrol News Inform 10(1):7\u0026ndash;16\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTurner CE (2020) Tephritidae in the biological control of weeds. Fruit fly pests. CRC, pp 157\u0026ndash;164\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePetri L (1909) Ricerche sopra i batteri intestinali della mosca olearia. Tipografia nazionale di G. Bertero, Roma\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCapuzzo C, Firrao G, Mazzon L, Squartini A, Girolami V (2005) \u003cem\u003eCandidatus\u003c/em\u003e Erwinia dacicola\u0026rsquo;, a coevolved symbiotic bacterium of the olive fly \u003cem\u003eBactrocera oleae\u003c/em\u003e (Gmelin). Int J Syst Evol Microbiol 55:1641\u0026ndash;1647. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1099/ijs.0.63653-0\u003c/span\u003e\u003cspan address=\"10.1099/ijs.0.63653-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBen-Yosef M, Pasternak Z, Jurkevitch E, Yuval B (2015) Symbiotic bacteria enable olive fly larvae to overcome host defences. Royal Soc open Sci 2(7):150170. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1098/rsos.150170\u003c/span\u003e\u003cspan address=\"10.1098/rsos.150170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMazzon L, Piscedda A, Simonato M, Martinez-Sa\u0026ntilde;udo I, Squartini A, Girolami V (2008) Presence of specific symbiotic bacteria in flies of the subfamily Tephritinae (Diptera Tephritidae) and their phylogenetic relationships: proposal of \u0026lsquo;\u003cem\u003eCandidatus\u003c/em\u003e Stammerula tephritidis\u0026rsquo;. Int J Syst Evol MicroBiol 58(6):1277\u0026ndash;1287. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1099/ijs.0.65287-0\u003c/span\u003e\u003cspan address=\"10.1099/ijs.0.65287-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBarbehenn RV, Constabel CP (2011) Tannins in plants\u0026ndash;herbivore interactions. Phytochemistry 72(13):1551\u0026ndash;1565. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phytochem.2011.01.040\u003c/span\u003e\u003cspan address=\"10.1016/j.phytochem.2011.01.040\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eViale E, Martinez-Sa\u0026ntilde;udo I, Brown JM, Simonato M, Girolami V, Squartini A, Bressan A, Faccoli M, Mazzon L (2015) Pattern of association between endemic Hawaiian fruit flies (Diptera, Tephritidae) and their symbiotic bacteria: Evidence of cospeciation events and proposal of \u003cem\u003eCandidatus\u003c/em\u003e Stammerula trupaneae. Mol Phylogenet Evol 90:67\u0026ndash;79. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ympev.2015.04.025\u003c/span\u003e\u003cspan address=\"10.1016/j.ympev.2015.04.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStammer HJ (1929) Die bakteriensymbiose der trypetiden (Diptera). Z f\u0026uuml;r Morphologie und \u0026Ouml;kologie der Tiere 14:481\u0026ndash;523\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMazzon L, Martinez-Sa\u0026ntilde;udo I, Simonato M, Squartini A, Savio C, Girolami V (2010) Phylogenetic relationships between flies of the Tephritinae subfamily (Diptera, Tephritidae) and their symbiotic bacteria. Mol Phylogenet Evol 56(1):312\u0026ndash;326. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ympev.2010.02.016\u003c/span\u003e\u003cspan address=\"10.1016/j.ympev.2010.02.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGillespie RG, Roderick GK (2002) Arthropods on islands: colonization, speciation, and conservation. Ann Rev Entomol 47(1):595\u0026ndash;632. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev.ento.47.091201.145244\u003c/span\u003e\u003cspan address=\"10.1146/annurev.ento.47.091201.145244\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVijverberg K, Kuperus P, Breeuwer JAJ, Bachmann K (2000) Incipient adaptive radiation of New Zealand and Australian Microseris (Asteraceae): an amplified fragment length polymorphism (AFLP) study. J Evol Biol 13(6):997\u0026ndash;1008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1420-9101.2000.00241.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1420-9101.2000.00241.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eScanlon JD, Lee MS, Archer M (2003) Mid-Tertiary elapid snakes (Squamata, Colubroidea) from Riversleigh, northern Australia: early steps in a continent-wide adaptive radiation. Geobios 36(5):573\u0026ndash;601. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0016-6995(03)00056-1\u003c/span\u003e\u003cspan address=\"10.1016/S0016-6995(03)00056-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWellman CH, Berry CM, Davies NS, Lindemann FJ, Marshall JE, Wyatt A (2022) Low tropical diversity during the adaptive radiation of early land plants. Nat Plants 8(2):104\u0026ndash;109. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41477-021-01067-w\u003c/span\u003e\u003cspan address=\"10.1038/s41477-021-01067-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHardy DE, Drew RAI (1996) Revision of the Australian Tephritini (Diptera: Tephritidae). Invertebrate Syst 10(2):213\u0026ndash;405. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1071/IT9960213\u003c/span\u003e\u003cspan address=\"10.1071/IT9960213\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMazzon L, Martinez-Sa\u0026ntilde;udo I, Savio C, Simonato M, Squartini A (2011) Stammerula and other symbiotic bacteria within the fruit flies inhabiting Asteraceae flowerheads. Manipulative tenants: bacteria associated with arthropods. CRC Press Taylor \u0026amp; Francis, pp 89\u0026ndash;111\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHancock DL (2014) A new Australian species of \u003cem\u003eAustrotephritis\u003c/em\u003e Hancock \u0026amp; Drew (Diptera: Tephritidae: Tephritinae). Australian Entomol 41(2):115\u0026ndash;124. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://search.informit.org/doi/\u003c/span\u003e\u003cspan address=\"https://search.informit.org/doi/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3316/informit.336726240212798\u003c/span\u003e\u003cspan address=\"10.3316/informit.336726240212798\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiong B, Kocher TD (1991) Comparison of mitochondrial DNA sequences of seven morphospecies of black flies (Diptera: Simuliidae). Genome 34(2):306\u0026ndash;311. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1139/g91-050\u003c/span\u003e\u003cspan address=\"10.1139/g91-050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHan HY, McPheron BA (1997) Molecular phylogenetic study of Tephritidae (Insecta: Diptera) using partial sequences of the mitochondrial 16S ribosomal DNA. Mol Phylogenet Evol 7(1):17\u0026ndash;32. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/mpev.1996.0370\u003c/span\u003e\u003cspan address=\"10.1006/mpev.1996.0370\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSimon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 87(6):651\u0026ndash;701. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aesa/87.6.651\u003c/span\u003e\u003cspan address=\"10.1093/aesa/87.6.651\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSimon C, Buckley TR, Frati F, Stewart JB, Beckenbach AT (2006) Incorporating molecular evolution into phylogenetic analysis, and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Annu Rev Ecol Syst 37:545\u0026ndash;579. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev.ecolsys.37.091305.110018\u003c/span\u003e\u003cspan address=\"10.1146/annurev.ecolsys.37.091305.110018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWeisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697\u0026ndash;703. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/jb.173.2.697-703.1991\u003c/span\u003e\u003cspan address=\"10.1128/jb.173.2.697-703.1991\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKumar S, Stecher G, Suleski M, Sanderford M, Sharma S, Tamura K (2024) MEGA12: Molecular Evolutionary Genetic Analysis version 12 for adaptive and green computing. Mol Biol Evol 41(12):msae263. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msae263\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msae263\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat Methods 14:587\u0026ndash;589. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nmeth.4285\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.4285\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRambaut A (2018) FigTree v.1.4.4-1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://tree.bio.ed.ac.uk/software/figtree/\u003c/span\u003e\u003cspan address=\"http://tree.bio.ed.ac.uk/software/figtree/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMinh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Von Haeseler A, Lanfear R (2020) IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol Biol Evol 37:1530\u0026ndash;1534. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msaa015\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msaa015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eConow C, Fielder D, Ovadia Y, Libeskind-Hadas R (2010) Jane: a new tool for the cophylogeny reconstruction problem. Algorithms Mol Biology 5(1):16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1748-7188-5-16\u003c/span\u003e\u003cspan address=\"10.1186/1748-7188-5-16\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBalbuena JA, M\u0026iacute;guez-Lozano R, Blasco-Costa I (2013) PACo: A novel procrustes application to cophylogenetic analysis. PLoS ONE 8(4):e61048. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0061048\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0061048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR Core Team (2023) *R: A language and environment for statistical computing*. R Foundation for Statistical Computing. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.r-project.org\u003c/span\u003e\u003cspan address=\"https://www.r-project.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMendlov\u0026aacute; M, Desdevises Y, Civ\u0026aacute;\u0026ntilde;ov\u0026aacute; K, Pariselle A, Šimkov\u0026aacute; A (2012) Monogeneans of West African cichlid fish: evolution and cophylogenetic interactions. PLoS ONE 7:e37268. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0037268\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0037268\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLegendre P, Anderson MJ (1999) Distance-based redundancy analysis: Testing multispecies responses in multifactorial ecological experiments. Ecol Monogr 69(1):1\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1890/0012-9615(1999)069\u003c/span\u003e\u003cspan address=\"10.1890/0012-9615(1999)069\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e[0001:DBRATM]2.0.CO;2\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeres-Neto PR, Jackson DA (2001) How well do multivariate data sets match? The advantages of a Procrustean superimposition approach over the Mantel test. Oecologia 129:169\u0026ndash;178. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s004420100720\u003c/span\u003e\u003cspan address=\"10.1007/s004420100720\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHutchinson MC, Cagua EF, Balbuena JA, Stouffer DB, Poisot T (2017) paco: implementing Procrustean Approach to Cophylogeny in R. Methods Ecol Evol 8(8):932\u0026ndash;940. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/2041-210X.12736\u003c/span\u003e\u003cspan address=\"10.1111/2041-210X.12736\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMerz B (1999) Phylogeny of the Palearctic and Afrotropical genera of the Tephritis group (Tephritinae: Tephritini). Chapter 24. In: Aluja M, Norrbom AL (eds) Fruit Flies (Tephritidae): phylogeny and evolution of behavior. CRC, Boca Raton, Florida, pp 629\u0026ndash;669\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHancock DL, Hamacek EL, Lloyd AC, Elson-Harris MM (2000) The distribution and host plants of fruit flies (Diptera: Tephritidae) in Australia. Queensland Department of Primary Industries Information Series Q199067, Brisbane\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDavid KJ, Hancock DL, Salini S, Gracy RG, Sachin K (2020) Taxonomic notes on the genus \u003cem\u003eCampiglossa\u003c/em\u003e Rondani (Diptera, Tephritidae, Tephritinae, Tephritini) in India, with description of three new species. ZooKeys 977:75\u0026ndash;100. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3897/zookeys.977.57875\u003c/span\u003e\u003cspan address=\"10.3897/zookeys.977.57875\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVon Dohlen CD, Spaulding U, Patch KB, Weglarz KM, Foottit RG, Havill NP, Burke GR (2017) Dynamic acquisition and loss of dual-obligate symbionts in the plant-sap-feeding Adelgidae (Hemiptera: Sternorrhyncha: Aphidoidea). Front Microbiol 8:1037. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2017.01037\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2017.01037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSmith WA, Oakeson KF, Johnson KP, Reed DL, Carter T, Smith KL, Koga R, Fukatsu T, Dale C (2013) Phylogenetic analysis of symbionts in feather-feeding lice of the genus Columbicola: evidence for repeated symbiont replacements. BMC Evol Biol 13(1):109. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2148-13-109\u003c/span\u003e\u003cspan address=\"10.1186/1471-2148-13-109\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Laere A, Van Den Ende W (2002) Inulin metabolism in dicots: chicory as a model system. Plant Cell Environ 25(6):803\u0026ndash;813. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-3040.2002.00865.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-3040.2002.00865.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChi Z, Chi Z, Zhang T, Liu G, Yue L (2009) Inulinase-expressing microorganisms and applications of inulinases. Appl Microbiol Biotechnol 82(2):211\u0026ndash;220. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00253-008-1827-1\u003c/span\u003e\u003cspan address=\"10.1007/s00253-008-1827-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDouglas AE (1998) Nutritional interactions in insect-microbial symbioses: aphids and their symbiotic bacteria \u003cem\u003eBuchnera\u003c/em\u003e. Ann Rev Entomol 43(1):17\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev.ento.43.1.17\u003c/span\u003e\u003cspan address=\"10.1146/annurev.ento.43.1.17\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEngel P, Moran NA (2013) The gut microbiota of insects\u0026ndash;diversity in structure and function. FEMS Microbiol Rev 37(5):699\u0026ndash;735. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1574-6976.12025\u003c/span\u003e\u003cspan address=\"10.1111/1574-6976.12025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHosokawa T, Kikuchi Y, Nikoh N, Shimada M, Fukatsu T (2006) Strict host-symbiont co-speciation and reductive genome evolution in insect gut bacteria. PLoS Biol 4(10):e337. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pbio.0040337\u003c/span\u003e\u003cspan address=\"10.1371/journal.pbio.0040337\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSudakaran S, Kost C, Kaltenpoth M (2017) Symbiont acquisition and replacement as a source of ecological innovation. Trends Microbiol 25(5):375\u0026ndash;390. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tim.2017.02.014\u003c/span\u003e\u003cspan address=\"10.1016/j.tim.2017.02.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"microbial-ecology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"meco","sideBox":"Learn more about [Microbial Ecology](https://www.springer.com/journal/248)","snPcode":"248","submissionUrl":"https://submission.nature.com/new-submission/248/3","title":"Microbial Ecology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Symbiosis, Fruit flies, Bacteria, Coevolution, Host switch, Asteraceae","lastPublishedDoi":"10.21203/rs.3.rs-7808998/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7808998/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSeveral insect lineages, including some fruit flies, have evolved mutualistic associations with primary symbiotic bacteria. Some species of Tephritinae, the most specialized subfamily of fruit flies (Diptera, Tephritidae) predominantly infesting flowerheads of Asteraceae, harbour co-evolved, vertically transmitted and non-culturable bacterial symbionts in their midgut, known as \u003cem\u003eCandidatus\u003c/em\u003e Stammerula spp. (Enterobacteriaceae). While such associations have previously been reported in the Palearctic and Hawaiian Archipelago, their occurrence in Australasia had not been investigated.\u003c/p\u003e\u003cp\u003eIn this study, eight Australian species from six genera belonging to the Tephritini tribe were analysed using bacterial (16S rRNA gene) and mitochondrial (16S rRNA and COI\u0026ndash;tRNALeu\u0026ndash;COII genes) markers. We detected the presence of specific symbiotic bacteria in all sampled species. Phylogenetic analyses showed that, with one exception, all Australian symbionts clustered in a well-supported monophyletic clade with \u003cem\u003eStammerula\u003c/em\u003e detected in Palearctic and Hawaiian Tephritini. Distinct \u003cem\u003eStammerula\u003c/em\u003e lineages were identified in several taxa, while two species, \u003cem\u003eTrupanea prolata\u003c/em\u003e and \u003cem\u003eSpathulina acroleuca\u003c/em\u003e shared identical symbiont sequences and the same host plant. Notably, Australian and Palearctic \u003cem\u003eSphenella\u003c/em\u003e spp. harboured closely related symbionts. The cophylogenetic analysis revealed a substantial congruence between host and symbiont tree, supporting a history of cospeciation and suggesting biogeographic links between Australasian and Palearctic taxa. Overall, the results expand the geographic knowledge of Tephritini-\u003cem\u003eStammerula\u003c/em\u003e association and highlight a global pattern of co-diversification.\u003c/p\u003e","manuscriptTitle":"Detection of a conserved bacterial symbiosis in non-frugivorous Australian fruit flies (Diptera, Tephritidae, Tephritinae) supports its widespread association","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-28 16:39:15","doi":"10.21203/rs.3.rs-7808998/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-14T00:54:04+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-13T05:03:01+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-12T01:36:16+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-10T09:49:29+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-05T05:20:25+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-04T19:32:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"307158698986457908200417082508147835244","date":"2025-10-16T23:15:37+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"247319377604164709964508153038556752094","date":"2025-10-16T02:19:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"128852463557391767424011316872534736823","date":"2025-10-15T06:34:47+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"148777434174440984066078416189329633347","date":"2025-10-15T04:33:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"328831923445608921432168351545175290035","date":"2025-10-14T17:29:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"218776577582162525359089487443945563870","date":"2025-10-14T15:19:23+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-14T14:54:54+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-14T05:12:05+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-14T05:12:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Microbial Ecology","date":"2025-10-08T14:23:28+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"microbial-ecology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"meco","sideBox":"Learn more about [Microbial Ecology](https://www.springer.com/journal/248)","snPcode":"248","submissionUrl":"https://submission.nature.com/new-submission/248/3","title":"Microbial Ecology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"45383555-9c85-45e5-8bdd-528274c56fff","owner":[],"postedDate":"October 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-01-12T16:07:18+00:00","versionOfRecord":{"articleIdentity":"rs-7808998","link":"https://doi.org/10.1007/s00248-025-02686-y","journal":{"identity":"microbial-ecology","isVorOnly":false,"title":"Microbial Ecology"},"publishedOn":"2026-01-08 15:57:37","publishedOnDateReadable":"January 8th, 2026"},"versionCreatedAt":"2025-10-28 16:39:15","video":"","vorDoi":"10.1007/s00248-025-02686-y","vorDoiUrl":"https://doi.org/10.1007/s00248-025-02686-y","workflowStages":[]},"version":"v1","identity":"rs-7808998","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7808998","identity":"rs-7808998","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.