Rapid diagnosis of cutaneous leishmaniosis using antibody-conjugated gold Nanoparticles in comparison with molecular and parasitological methods | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Rapid diagnosis of cutaneous leishmaniosis using antibody-conjugated gold Nanoparticles in comparison with molecular and parasitological methods Mahboubeh Hadipour, Sedigheh Saberi, Mehdi Mohebali, Mahshid Shakibapour, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4826738/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Cutaneous leishmaniosis with a broad spectrum of clinical manifestations is caused by the Leishmania parasites. For laboratory diagnosis using parasitological methods, patients’lesion biopsies are either examined under the microscope following appropriate staining or culture in a relevant medium. Although these methods are effective in the early stages of infection, they don’t yield enough sensitivity in chronic cases. Molecular methods usually have a high level of sensitivity and specificity but with the need for lab equipment, they are not suitable for field diagnosis. So, it is important to develop a rapid and point-of-care test to diagnose cutaneous leishmaniasis. Method In this work a lateral flow test for diagnosis of cutaneous leishmaniosis was developed. For evaluation of the test, thirty-eight patient samples with a clinical suggestion of CL were collected and examined using direct microscopy, culture, and PCR and then with the developed lateral flow test. Results Considering Microscopic examination, 28 out of 38 samples were positive and 10 out of 38 were negative. From 28 positive samples, 24, 26, and 26 became positive by cultivation, PCR, and lateral flow test respectively. From negative samples, 1 was positive with the lateral flow test. Considering microscopic results as the gold standard, the sensitivity of %92, %92, and %85 was estimated for lateral flow, molecular, and culture methods respectively. Conclusion The lateral flow test is a very rapid and easy test for diagnosis of cutaneous leishmaniosis especially in rural areas with fewer lab facilities. cutaneous leishmaniosis diagnosis lateral flow Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Cutaneous leishmaniasis is caused by the Leishmania parasites and transmitted to human by the bite of sand fly insects. The disease is endemic in more than 70 countries worldwide and the global number of cases has increased during the past decade. In some patients, cutaneous leishmaniasis remains symptomless however, in the majority of cases the disease presents a range of clinical symptoms. Differential diagnosis is important because some other diseases such as leprosy, skin cancers, tuberculosis, and cutaneous mycoses may show similar manifestations [ 1 ]. Parasitological diagnosis is still the gold standard method for the diagnosis of cutaneous leishmaniasis. In these methods, patients' lesion biopsies are either examined under the microscope following appropriate staining or cultured in a relevant medium. Although parasitological methods are considered as gold standard, in some occasions, especially in chronic cases, they don’t yield enough sensitivity. In this regard, examination of specimens taken from the lesion following Geimsa staining has 50–70% sensitivity for the diagnosis of old world leishmaniasis and 15–30% for the diagnosis of new world ones [ 2 , 3 ]. In the last decades molecular diagnosis of cutaneous leishmaniasis has been developed to overcome the disadvantages of parasitological methods. These methods are performed by PCR-based techniques and they are useful for the diagnosis of cases with low parasite load. Also, molecular methods are highly recommended for the species determination of cutaneous leishmaniasis that may be caused by different species of leishmania [ 4 ]. Due to providing variable sensitivity and specificity, serological tests are usually not used in the diagnosis of cutaneous leishmaniasis. The Montenegro skin test is sometimes used in diagnosis, especially in epidemiological investigations; however, it is not able to distinguish between past and present infections [ 5 , 6 ]. So, it is necessary to find a simple and rapid test for diagnosis of cutaneous leishmaniasis. In this regard development, a simple, specific, and sensitive test for the diagnosis of this disease has been investigated in this work. Materials and methods Study population: In this experimental research, the study population consisted of patients with skin ulcers suspected of cutaneous leishmaniasis referred to Sedighe Tahereh Clinic in Isfahan, Iran in 2021. 38 samples of patients with a clinical suggestion of CL were collected. From each patient, biopsy specimens were taken. Informed consent was obtained from all individual participants included in the study. . A part of each specimen was added to Novy–MacNeal–Nicolle medium (NNN) for microscopic examination and culture, and other parts were added to normal Saline for immunological tests and molecular works. The results of each method were recorded and for estimation of sensitivity and specificity, the results of the direct microscope slide were considered as the golden standard. Preparation of Leishmania amastigotes In this study, we used the Leishmania major parasite (MRHO/IR/75/ER) stocked in the Department of Parasitology, Isfahan Medical School cell bank. The Parasites were washed three times with PBS to remove DMSO and transferred to the Novy–MacNeal–Nicolle medium (NNN) to reach the logarithmic stage and mass production. Then the supernatant was centrifuged and transferred to RPMI medium enriched with 20% FBS at a temperature of 25 ± 1 ° C. Every day, 4–5 cc of fresh medium was added and parasite growth was checked with a light microscope until the number of parasites reached 8 − 6 million per/ml. After 72 hours the parasites were transferred to the RPMI medium with a pH of 5.5 and incubated at 37° C and 5% CO2. These growth conditions mimic a phagolysosome-like environment which can induce differentiation of promastigotes into amastigote forms. They started to transform into amastigote forms, a process that was completed after 48 hours [ 7 ]. Preparation of rabbit anti- leishmania amastigotes antibodies : Amastigotes from parasites were collected from a culture medium, washed three times, and then sonicated and kept as amastigote crude antigens. The prepared antigen was then emulsified in Freund's adjuvant and injected subcutaneously into a rabbit. Boosters were injected every fortnight. Complete Freund's adjuvant was used for the first injection and incomplete one for the boosters. Following the fifth injection, a blood sample was taken from the rabbit and the production of antibodies was evaluated by ELISA test as we published before [ 8 ]. Following approval of antibody production, large blood samples were collected, and centrifuged (5000r for 5 minutes) and the antiserum was stored at -20 centigrade until needed. Antibodies in the serum were purified using the salting out method as we published before [ 9 ]. Preparation of Gold Nanoparticles Gold nanoparticles were prepared according to the Turkevich et al method [Turkevich J, Stevenson P C, and Hillier J 1951 Discuss. Faraday Soc. 11 55]. Briefly, 100µl of HAuCl4 solution (5%) was added into a flask containing 50ml distilled water and the solution was heated to boil, with constant stirring. Then 2ml of sodium citrate (1%) solution was added. The solution was continued to be heated and stirred for 10 min until a deep-red solution was developed. Preparation of Gold Nanoparticle Conjugate Antibody One ml of the gold nanoparticles was added to 50ul of anti- Leishmania amastigote antibodies containing 150 µg/mL protein and mixed for 5 seconds and placed on a shaker at room temperature for 1 hour. After that, the coated gold nanoparticles were blocked by adding 5%(w/v) bovine serum albumin (BSA) and placed at room temperature for 15 min. The mixture was then centrifuged to remove the free antibodies. The precipitated pellet was suspended in 100ul 10mM Phosphate buffer containing 2% bovine serum albumin. This mixture was used to soak the conjugate pad. This conjugate pad was then dried at 37C for two hours. Preparation of lateral flow Strips: Lateral flow strips were purchased from mdimembrane.com, India. Rabbit anti Leishmani a amastigotes antibodies and Goat anti-rabbit antibodies at a concentration of 1mg/ml were used to spot Test Line and Control Line on Nitrocellulose Membrane respectively. The strips were then dried at 40C for two hours. Conjugate, sample, and absorbent pads are placed on a backing plastic card containing a membrane with three overlaps. Every strip was then fixed in a plastic cassette and stored at -4C. PBS containing 0.1% Tween 20 was used as a run buffer. Examination of leishmania skin samples with lateral flow tests. In an Eppendorf test tube 75ul of run buffer was mixed with 25ul of patient sample. The mixture was then shaken and applied to the lateral flow test. After 5 minutes the results were recorded. Observation of a red line in the area of the test line was considered a positive result. Molecular experiments: DNA Extraction The genomic DNA was manually extracted from each sample. For this purpose 300 ml of each sample was transferred to a 1.5 mL Eppendorf tube containing 300 mg of glass beads (0.5 mm in diameter), 300 µl of lysis buffer (100 mM Tris, pH 8; 10 mM EDTA; 100 mM NaCl; 1% sodium dodecyl sulfate; 1% Triton X-100) and 300 µl phenol–chloroform, and three times homogenized for 3 × 60 s at 6,000 rpm by a homogenizer (Bertin Instrument, Precelleys 24). The mixture was centrifuged at 5000 rpm for 5 min. The supernatant was transferred to a new tube mixed with an equal volume of chloroform. Then it was shacked for a few min and centrifuged at 5000 rpm for 5 min. The supernatant was transferred to a new tube and mixed with an equal volume of isopropanol and one-tenth volume of 3 M Sodium acetate (pH 5.2) and incubated at -20℃ for 1 h. Then the sample was centrifuged at 12,000 g for 10 min, the supernatant was isolated and discarded, 500 µL 70% ethanol was added to the sediment, followed by centrifugation at 12,000 g for 10 min. The supernatant was discarded and the pellet was dissolved in 30 ml distilled water and stored at -20℃ as the purified DNA until PCR performance. Primer designing : Primers amplified a 650 bp fragment of the Leishmania parasite located in the small subunit of the ribosomal gene as described by van Eys et al: 5'- GGTTCCTTTCCTGATTTACG − 3', 5'- GGCCGGTAAAGGCCGAATAG- 3' [ 10 ]. The Primers were synthesized by Metabion Company (Germany). PCR PCR was performed in a total volume of 20 µl. Each reaction contained 10 µl of 2X master mix (Ampliqon, Denmark) 0.5 µM of each primer, 5 µl of template DNA, and 3 µl of water. The PCR thermal conditions were 5 min at 95◦C, followed by 35 cycles of 94˚C 20 s, 56˚C 1 min, and 72˚C 45 s; and a final extension at 72˚C for 5 min. Appropriate positive and negative controls were included for each PCR run. The PCR products were electrophoresed on 1.5% agarose gel in TBE (90 Mm Tris, 90 Mm Boric acid, 2 Mm EDTA), and the gels were visualized under a UV transilluminator. Results Production of Anti leishmania amastigote antibodies in rabbits was confirmed by ELISA test. Amastigote lysate antigen was coated in an ELISA plate and probed with ether anti- leishmania antibodies and normal rabbit serum. The mean OD of anti- leishmania antibodies and normal rabbit serum was 2.1 and o.41 respectively. Purification of the antibody was confirmed by electrophoresis. For this purpose, purified antibodies in comparison with the original rabbit serum were subjected to electrophoresis. As Fig. 1 shows the main component of the rabbit serum was albumin, while the main component of purified antibody was Gama globulin. For confirmation of conjugation of gold nanoparticles to antibody, in SDS PAGE, bovine serum albumin, Gold nanoparticles alone, purified antibody, and gold nanoparticles conjugated with antibody were subjected to electrophoresis. As Fig. 2 shows while there is no band for gold nanoparticles alone, a band related to IgG antibodies conjugated to gold nanoparticles is present in lane 4. Lateral Flow test examination: In the developed lateral flow test, anti-amastigote antibody and goat anti-rabbit antibody were immobilized as test and control lines respectively. The conjugate pad was soaked with gold nanoparticles conjugated to anti amastigote antibody and then dried. Finally, the cassettes were assembled for the detection of amastigote antigens. For the experiment, Lysate of amastigotes in buffer and buffer alone were subjected to cassettes of developed lateral flow test. As Fig. 3 shows in the cassette related to the amastigote, test, and control lines appeared after five minutes. However, in the cassette related to the buffer alone, only the control line appeared after five minutes. Results of examination of patient samples with different methods: Using the microscopic technique amastigote form of leishmania parasites was seen in 28 isolates and they were considered as positive cases. In 10 isolates the amastigote form was not detected and they were considered as negative cases. All positive and negative cases were also examined with PCR and lateral flow tests developed in this investigation. PCR of all positive cases except two was also positive and PCR of all negative cases was also negative (Table 1 ). In culture method 24 out of 28 positive samples and 10 out of 10 negative samples showed positive and negative results respectively. Also, 38 clinical samples suspected of cutaneous leishmaniasis were tested with the developed lateral flow test. In 26 cases the test provided positive results and in 9 cases negative results (Table 1 and Fig. 4 ). Considering Microscopic results as the gold standard method, and considering the false positive and negative results (Tables 1 and 2 ), the sensitivity and specificity of culture, PCR, and lateral flow test were calculated and presented in Table 3 . Table 1 Results of Microscopic examination, culture, PCR, and lateral flow test for diagnosis of cutaneous leishmaniasis in clinical samples taken from patients who were suspected of cutaneous leishmaniasis. Method Positive results Negative results Microscopic examination 28 10 Culture 24 10 PCR 26 10 Lateral Flow 26 9 Table 2 True and false positive and negative results of culture, PCR, and lateral flow test Considering Microscopic examination as the gold standard method for diagnosis of cutaneous leishmaniasis in clinical samples. Results Lateral Flow PCR Culture True Positive 26 26 24 False positive 1 0 0 True negative 9 10 10 False negative 2 2 4 Table 3 sensitivity and specificity of culture, PCR, and lateral flow test, considering Microscopic examination as the gold standard method for diagnosis of cutaneous leishmaniasis in clinical samples. Results Lateral flow PCR Culture Sensitivity 92 92 85 Specificity 90 100 100 Discussion Leishmaniasis is a vector-borne parasitic disease that is transmitted via infected female sandflies. It presents a broad spectrum of clinical manifestations which are usually divided into cutaneous leishmaniasis (CL), mucocutaneous leishmaniasis (MCL), and visceral leishmaniasis (VL) [ 11 ]. The disease is present in over 98 countries and is estimated approximately 350 million individuals at risk. The overall prevalence is 12 million cases, with an annual incidence of 2-2.5 million cases of CL. The incidence numbers are likely underestimated in many countries because some instances are unrecognized and reporting is not obligatory [ 1 , 12 ]. The primary diagnosis of the disease is based on epidemiological and clinical signs confirmed by laboratory tests especially direct microscopic examination. Besides parasitological methods, immunological and molecular methods have also been investigated for the diagnosis of this disease. Microscopic examinations and culture have a sensitivity of 85%. Molecular methods reported to have a specificity of about 100% with a sensitivity of 20 to 30% when compared with conventional parasitology diagnosis. However, these methods may not be available in medical laboratories in endemic areas. Serological methods are not usually employed for the diagnosis of CL, because the infection provoked a humoral response weakly and so, the tests are low sensitivity [ 12 , 13 ]. Therefore, nowadays, finding a rapid and sensitive diagnostic test is necessary. Here, we developed a lateral flow method for diagnosis of cutaneous leishmaniasis. The results of this method were then compared with microscopic examination, culture, and molecular method results. Considering Microscopic results as the gold standard method, we reported sensitivity of %92, %92, and %85 for lateral flow, molecular, and culture methods respectively. Also, culture and molecular methods showed a specificity of 100%, however, with lateral flow specificity of 90% was reported. During the last decades, rapid progress was observed in nanotechnology that overcame several limitations in the diagnostics field. Different studies have used specific nanoparticles (NPs) such as gold, quantum dots (QDs), silver, etc. for the development of specific assays including colorimetric, lateral flow, and electrochemical methods, for the detection of Leishmania spp . In biological samples. Nanoparticles have different performance. They can adsorb or bind to various surfaces by electrostatic interactions while binding to other molecules via different surface functional groups simultaneously [ 14 ]. Gold nanoparticles have unique and simply tuned physical and chemical properties. They also were synthesized simply and functionalized with a variety of molecules. So, they have different applications from detection methods to drug delivery in parasitology including diagnosis and treatment of leishmaniasis [ 15 , 16 ]. In an investigation, Welearegay and coworkers synthesized metal Nanoparticle Sensors for the Detection of Cutaneous Leishmaniasis disease in patients' exhaled breath. The test had High accuracy (98.2%), sensitivity (96.4%), and specificity (100%) [ 17 ]. Mehri and colleagues 2020 applied citrate-capped silver NPs as a suitable probe ((Genosenso) for Leishmania spp detection based on fluorescence and UV/Vis [ 18 ]. Anfossi and colleagues developed a method on the technology of lateral flow immunoassay for the rapid diagnosis of canine leishmaniasis in serum samples of animals which can also be developed for other animals. In this device, anti- leishmania antibodies in the serum were detected by using highly specific recombinant antigens of the amastigote form of L. infantum . Also labeled protein A with gold nanoparticles was used as the signal reporter. They reported a diagnostic sensitivity of (98.4%) and a specificity of (98.9%) for this test [ 19 ]. Toubanaki et al. (2016), used a nucleic acid lateral flow that combined with functionalized gold nanoparticles for quick visual detection of Leishmania -specific amplification products. They succeeded in confirming the presence of Leishmania in blood samples of infected dogs. [ 20 ]. Different studies have also shown that Lateral flow biosensors are significant for diagnostic targets as they are, sensitive, specific, rapid, inexpensive, and equipment-free. [ 21 – 23 ]. Finally results of our work revealed that the developed lateral flow test is a convenient test for diagnosis of cutaneous leishmaniasis especially in rural area with less lab facilities. Modification of the test for improvement of sensitivity and specificity of the method is now undergoing. Declarations Conflict of interest: None of the authors has conflict of interests Consent to participate: Informed consent was obtained from all individual participants included in the study Ethics approval: The research proposal of this work was approved with by ethic committee of Isfahan University of medical sciences with scientific code of 199566 and ethical approve number of IR. MUI.MED.REC/1399.1145 Author Contribution H.YD designed and supervised the work, M.M helped as Leishmania consultant, S.Sperformed the Leishmania lab works, M.H performed the lab works and prepared the first draft of the paper, L.A, and M.S participated in collecting the specimens. The final version of the manuscript was approved by all the authors. Acknowledgment: This work was supported by a grant from Isfahan University of Medical Sciences with grant number of 199566 References Reithinger R et al (2007) Cutaneous leishmaniasis. Lancet Infect Dis 7(9):581–596 Goto H, Lindoso JAL (2010) Current diagnosis and treatment of cutaneous and mucocutaneous leishmaniasis. Expert Rev anti-infective therapy 8(4):419–433 Sandoval Pacheco CM et al (2018) Histopathological features of skin lesions in patients affected by non-ulcerated or atypical cutaneous leishmaniasis in Honduras, Central America. Int J Exp Pathol 99(5):249–257 Thakur S, Joshi J, Kaur S (2020) Leishmaniasis diagnosis: an update on the use of parasitological, immunological and molecular methods. J Parasitic Dis 44:253–272 Kar K (1995) Serodiagnosis of leishmaniasis. Crit Rev Microbiol 21(2):123–152 Weigle KA et al (1987) Diagnosis of cutaneous and mucocutaneous leishmaniasis in Colombia: a comparison of seven methods. Am J Trop Med Hyg 36(3):489–496 Sereno D, Lemesre J-L (1997) Axenically cultured amastigote forms as an in vitro model for investigation of antileishmanial agents. Antimicrob Agents Chemother 41(5):972–976 Darani H, Doenhoff M (2009) Anomalous immunogenic properties of serine proteases. Scand J Immunol 70(4):384–388 Darani HY et al (2010) Development of a latex agglutination test as a simple and rapid method for diagnosis of Trichomonas vaginalis infection. Avicenna J Med Biotechnol 2(1):63 Lemrani M et al (2009) PCR detection of Leishmania in skin biopsies. J Infect Developing Ctries 3(02):115–122 Singh S, Sivakumar R (2003) Recent advances in the diagnosis of leishmaniasis. J Postgrad Med 49(1):55–60 de Vries HJ, Reedijk SH, Schallig HD (2015) Cutaneous leishmaniasis: recent developments in diagnosis and management. Am J Clin Dermatol 16:99–109 Torres-Guerrero E et al (2017) Leishmaniasis: Rev F1000Research:6 Kammona O, Tsanaktsidou E (2021) Nanotechnology-aided diagnosis, treatment and prevention of leishmaniasis. Int J Pharm 605:120761 Benelli G (2018) Gold nanoparticles–against parasites and insect vectors. Acta Trop 178:73–80 Farshchi F, Saadati A, Hasanzadeh M (2020) Optimized DNA-based biosensor for monitoring Leishmania infantum in human plasma samples using biomacromolecular interaction: a novel platform for infectious disease diagnosis. Anal Methods 12(39):4759–4768 Welearegay TG et al (2018) Ligand-capped ultrapure metal nanoparticle sensors for the detection of cutaneous leishmaniasis disease in exhaled breath. ACS Sens 3(12):2532–2540 Mehri P et al (2020) An innovative genosensor for the monitoring of Leishmania spp sequence using binding of pDNA to cDNA based on Cit-AgNPs. Heliyon, 6(8) Anfossi L et al (2018) A versatile and sensitive lateral flow immunoassay for the rapid diagnosis of visceral leishmaniasis. Anal Bioanal Chem 410:4123–4134 Toubanaki DK, Athanasiou E, Karagouni E (2016) Gold nanoparticle-based lateral flow biosensor for rapid visual detection of Leishmania-specific DNA amplification products. J Microbiol Methods 127:51–58 Zhou W et al (2014) Aptamer-based biosensors for biomedical diagnostics. Analyst 139(11):2627–2640 Wang Y et al (2018) Multiple cross displacement amplification coupled with nanoparticles-based lateral flow biosensor for detection of Staphylococcus aureus and identification of methicillin-resistant S. aureus. Front Microbiol 9:353773 Jain S et al Are Nanobiosensors Improved Solut Diagnosis Leishmania? Pharm (2021), 13, 491 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4826738","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":334503118,"identity":"96ab97f3-1c1b-4d76-bee8-d075f3fd6045","order_by":0,"name":"Mahboubeh Hadipour","email":"","orcid":"","institution":"Isfahan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mahboubeh","middleName":"","lastName":"Hadipour","suffix":""},{"id":334503120,"identity":"8cffbf01-ee94-406f-896f-e6c737e77378","order_by":1,"name":"Sedigheh Saberi","email":"","orcid":"","institution":"Isfahan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Sedigheh","middleName":"","lastName":"Saberi","suffix":""},{"id":334503121,"identity":"37b0b11d-a145-4b99-9f49-d1f35ae14a71","order_by":2,"name":"Mehdi Mohebali","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mehdi","middleName":"","lastName":"Mohebali","suffix":""},{"id":334503123,"identity":"e01f08c0-a86b-4906-ba33-67c5d206e70e","order_by":3,"name":"Mahshid Shakibapour","email":"","orcid":"","institution":"Isfahan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mahshid","middleName":"","lastName":"Shakibapour","suffix":""},{"id":334503125,"identity":"ecc60316-b859-4506-adaa-e0639c90df29","order_by":4,"name":"Hossein Yousofi Darani","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9UlEQVRIiWNgGAWjYBACgwMg0kaCsQFEJ1QACWbmBiK0pMG0nAFpYcSvRRIsncYAUcbYBibxa+Fn7zH+8CHBQrZ/9uFnDx7Oq43mbwdq+VGxDacWNp4zZpIzEiSMZ5xLMzdI3HY8d8ZhxgbGnjO3cWuRyDFj5v0hkdhwhsFMInHbsdwGoBZmxja8Wow/8yRIJM4/w/5NInHOsdz5RGgxkAZp2XCGB2hLQ03uBoJaeI6Vgf2y8QxPmUTCsQO5G4FaDuL1C3vzZmCI1cnOO8O+TfJHTV3uvPOHDz74UYFbCzo4DCYPEK0eCOpIUTwKRsEoGAUjBAAA1ItaX1iPj5cAAAAASUVORK5CYII=","orcid":"","institution":"Isfahan University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Hossein","middleName":"Yousofi","lastName":"Darani","suffix":""},{"id":334503126,"identity":"82982db6-f166-469f-8158-73f02a862715","order_by":5,"name":"Latife Abdellahi","email":"","orcid":"","institution":"Isfahan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Latife","middleName":"","lastName":"Abdellahi","suffix":""}],"badges":[],"createdAt":"2024-07-30 07:56:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4826738/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4826738/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":64006146,"identity":"771b46a8-0f59-4032-8a08-e778c3970e25","added_by":"auto","created_at":"2024-09-04 21:46:59","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":95770,"visible":true,"origin":"","legend":"\u003cp\u003eElectrophoresis diagram of Sebia device to confirm antibody purification. The lefts side stands for electrophoresis of the rabbit serum and the right side for purified antibody against \u003cem\u003eleishmania\u003c/em\u003eamastigote.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4826738/v1/12a77abc3a3135d96635880a.png"},{"id":64007107,"identity":"40375d84-e9ec-4562-9d56-2e3e10bca17e","added_by":"auto","created_at":"2024-09-04 21:54:59","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":38572,"visible":true,"origin":"","legend":"\u003cp\u003eSDS-PAGE of bovine serum albumin (1) Gold nanoparticles alone (2), purified antibody (3), and gold nanoparticles conjugated with antibody (4)\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4826738/v1/caf6a7d1f0b5534751c51b73.png"},{"id":64006148,"identity":"c47a4f49-d176-411c-acd5-9d588a461a4c","added_by":"auto","created_at":"2024-09-04 21:47:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":26565,"visible":true,"origin":"","legend":"\u003cp\u003eLateral flow test for diagnosis of \u003cem\u003eLeishmania\u003c/em\u003e amastigote antigens. The above cassettes related to the positive test (left) and negative control (right) were run with Lysate of amastigotes in buffer (left) and buffer alone (right). The test line developed only in the cassette run with amastigote antigen.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4826738/v1/b1b44fe823b3623383b97531.png"},{"id":64006149,"identity":"c4ffcef1-e0e1-4c9a-a6af-46816d1c7ff0","added_by":"auto","created_at":"2024-09-04 21:47:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":74053,"visible":true,"origin":"","legend":"\u003cp\u003elateral flow test positive (1-4) and negative (5, 6) results for diagnosis of cutaneous leishmaniasis in clinical samples.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4826738/v1/2db21d5a89e90a3ab27d52cb.png"},{"id":64110291,"identity":"cabd28c0-3362-4151-966e-666a3b5798a8","added_by":"auto","created_at":"2024-09-07 07:20:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":760430,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4826738/v1/a55a860a-ea9e-4864-82a7-ff433362997f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Rapid diagnosis of cutaneous leishmaniosis using antibody-conjugated gold Nanoparticles in comparison with molecular and parasitological methods","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCutaneous leishmaniasis is caused by the \u003cem\u003eLeishmania\u003c/em\u003e parasites and transmitted to human by the bite of sand fly insects. The disease is endemic in more than 70 countries worldwide and the global number of cases has increased during the past decade. In some patients, cutaneous leishmaniasis remains symptomless however, in the majority of cases the disease presents a range of clinical symptoms. Differential diagnosis is important because some other diseases such as leprosy, skin cancers, tuberculosis, and cutaneous mycoses may show similar manifestations [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eParasitological diagnosis is still the gold standard method for the diagnosis of cutaneous leishmaniasis. In these methods, patients' lesion biopsies are either examined under the microscope following appropriate staining or cultured in a relevant medium. Although parasitological methods are considered as gold standard, in some occasions, especially in chronic cases, they don\u0026rsquo;t yield enough sensitivity. In this regard, examination of specimens taken from the lesion following Geimsa staining has 50\u0026ndash;70% sensitivity for the diagnosis of old world leishmaniasis and 15\u0026ndash;30% for the diagnosis of new world ones [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the last decades molecular diagnosis of cutaneous leishmaniasis has been developed to overcome the disadvantages of parasitological methods. These methods are performed by PCR-based techniques and they are useful for the diagnosis of cases with low parasite load. Also, molecular methods are highly recommended for the species determination of cutaneous leishmaniasis that may be caused by different species of \u003cem\u003eleishmania\u003c/em\u003e [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDue to providing variable sensitivity and specificity, serological tests are usually not used in the diagnosis of cutaneous leishmaniasis. The Montenegro skin test is sometimes used in diagnosis, especially in epidemiological investigations; however, it is not able to distinguish between past and present infections [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSo, it is necessary to find a simple and rapid test for diagnosis of cutaneous leishmaniasis. In this regard development, a simple, specific, and sensitive test for the diagnosis of this disease has been investigated in this work.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy population:\u003c/h2\u003e \u003cp\u003eIn this experimental research, the study population consisted of patients with skin ulcers suspected of cutaneous leishmaniasis referred to Sedighe Tahereh Clinic in Isfahan, Iran in 2021. 38 samples of patients with a clinical suggestion of CL were collected. From each patient, biopsy specimens were taken. Informed consent was obtained from all individual participants included in the study.\u003c/p\u003e \u003cp\u003e. A part of each specimen was added to Novy\u0026ndash;MacNeal\u0026ndash;Nicolle medium (NNN) for microscopic examination and culture, and other parts were added to normal Saline for immunological tests and molecular works. The results of each method were recorded and for estimation of sensitivity and specificity, the results of the direct microscope slide were considered as the golden standard.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePreparation of\u003c/b\u003e \u003cb\u003eLeishmania\u003c/b\u003e \u003cb\u003eamastigotes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn this study, we used the \u003cem\u003eLeishmania\u003c/em\u003e major parasite (MRHO/IR/75/ER) stocked in the Department of Parasitology, Isfahan Medical School cell bank. The Parasites were washed three times with PBS to remove DMSO and transferred to the Novy\u0026ndash;MacNeal\u0026ndash;Nicolle medium (NNN) to reach the logarithmic stage and mass production. Then the supernatant was centrifuged and transferred to RPMI medium enriched with 20% FBS at a temperature of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;1 \u0026deg; C. Every day, 4\u0026ndash;5 cc of fresh medium was added and parasite growth was checked with a light microscope until the number of parasites reached 8\u0026thinsp;\u0026minus;\u0026thinsp;6\u0026nbsp;million per/ml. After 72 hours the parasites were transferred to the RPMI medium with a pH of 5.5 and incubated at 37\u0026deg; C and 5% CO2. These growth conditions mimic a phagolysosome-like environment which can induce differentiation of promastigotes into amastigote forms. They started to transform into amastigote forms, a process that was completed after 48 hours [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003ePreparation of rabbit anti-\u003c/b\u003e \u003cb\u003eleishmania\u003c/b\u003e \u003cb\u003eamastigotes antibodies\u003c/b\u003e:\u003c/p\u003e \u003cp\u003eAmastigotes from parasites were collected from a culture medium, washed three times, and then sonicated and kept as amastigote crude antigens. The prepared antigen was then emulsified in Freund's adjuvant and injected subcutaneously into a rabbit. Boosters were injected every fortnight. Complete Freund's adjuvant was used for the first injection and incomplete one for the boosters. Following the fifth injection, a blood sample was taken from the rabbit and the production of antibodies was evaluated by ELISA test as we published before [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Following approval of antibody production, large blood samples were collected, and centrifuged (5000r for 5 minutes) and the antiserum was stored at -20 centigrade until needed. Antibodies in the serum were purified using the salting out method as we published before [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of Gold Nanoparticles\u003c/h2\u003e \u003cp\u003eGold nanoparticles were prepared according to the Turkevich et al method [Turkevich J, Stevenson P C, and Hillier J 1951 Discuss. Faraday Soc. 11 55]. Briefly, 100\u0026micro;l of HAuCl4 solution (5%) was added into a flask containing 50ml distilled water and the solution was heated to boil, with constant stirring. Then 2ml of sodium citrate (1%) solution was added. The solution was continued to be heated and stirred for 10 min until a deep-red solution was developed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of Gold Nanoparticle Conjugate Antibody\u003c/h2\u003e \u003cp\u003eOne ml of the gold nanoparticles was added to 50ul of anti-\u003cem\u003eLeishmania\u003c/em\u003e amastigote antibodies containing 150 \u0026micro;g/mL protein and mixed for 5 seconds and placed on a shaker at room temperature for 1 hour. After that, the coated gold nanoparticles were blocked by adding 5%(w/v) bovine serum albumin (BSA) and placed at room temperature for 15 min. The mixture was then centrifuged to remove the free antibodies. The precipitated pellet was suspended in 100ul 10mM Phosphate buffer containing 2% bovine serum albumin. This mixture was used to soak the conjugate pad. This conjugate pad was then dried at 37C for two hours.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of lateral flow Strips:\u003c/h2\u003e \u003cp\u003eLateral flow strips were purchased from mdimembrane.com, India. Rabbit anti \u003cem\u003eLeishmani\u003c/em\u003ea amastigotes antibodies and Goat anti-rabbit antibodies at a concentration of 1mg/ml were used to spot Test Line and Control Line on Nitrocellulose Membrane respectively. The strips were then dried at 40C for two hours. Conjugate, sample, and absorbent pads are placed on a backing plastic card containing a membrane with three overlaps. Every strip was then fixed in a plastic cassette and stored at -4C. PBS containing 0.1% Tween 20 was used as a run buffer.\u003c/p\u003e \u003cp\u003eExamination of \u003cem\u003eleishmania\u003c/em\u003e skin samples with lateral flow tests.\u003c/p\u003e \u003cp\u003eIn an Eppendorf test tube 75ul of run buffer was mixed with 25ul of patient sample. The mixture was then shaken and applied to the lateral flow test. After 5 minutes the results were recorded. Observation of a red line in the area of the test line was considered a positive result.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMolecular experiments:\u003c/h2\u003e \u003cp\u003e \u003cstrong\u003eDNA Extraction\u003c/strong\u003e \u003cp\u003eThe genomic DNA was manually extracted from each sample. For this purpose 300 ml of each sample was transferred to a 1.5 mL Eppendorf tube containing 300 mg of glass beads (0.5 mm in diameter), 300 \u0026micro;l of lysis buffer (100 mM Tris, pH 8; 10 mM EDTA; 100 mM NaCl; 1% sodium dodecyl sulfate; 1% Triton X-100) and 300 \u0026micro;l phenol\u0026ndash;chloroform, and three times homogenized for 3 \u0026times; 60 s at 6,000 rpm by a homogenizer (Bertin Instrument, Precelleys 24). The mixture was centrifuged at 5000 rpm for 5 min. The supernatant was transferred to a new tube mixed with an equal volume of chloroform. Then it was shacked for a few min and centrifuged at 5000 rpm for 5 min. The supernatant was transferred to a new tube and mixed with an equal volume of isopropanol and one-tenth volume of 3 M Sodium acetate (pH 5.2) and incubated at -20℃ for 1 h. Then the sample was centrifuged at 12,000 g for 10 min, the supernatant was isolated and discarded, 500 \u0026micro;L 70% ethanol was added to the sediment, followed by centrifugation at 12,000 g for 10 min. The supernatant was discarded and the pellet was dissolved in 30 ml distilled water and stored at -20℃ as the purified DNA until PCR performance.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePrimer designing\u003c/b\u003e: Primers amplified a 650 bp fragment of the \u003cem\u003eLeishmania\u003c/em\u003e parasite located in the small subunit of the ribosomal gene as described by van Eys et al: 5'- GGTTCCTTTCCTGATTTACG \u0026minus;\u0026thinsp;3', 5'- GGCCGGTAAAGGCCGAATAG- 3' [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The Primers were synthesized by Metabion Company (Germany).\u003c/p\u003e \u003cp\u003e \u003cstrong\u003ePCR\u003c/strong\u003e \u003cp\u003ePCR was performed in a total volume of 20 \u0026micro;l. Each reaction contained 10 \u0026micro;l of 2X master mix (Ampliqon, Denmark) 0.5 \u0026micro;M of each primer, 5 \u0026micro;l of template DNA, and 3 \u0026micro;l of water. The PCR thermal conditions were 5 min at 95◦C, followed by 35 cycles of 94˚C 20 s, 56˚C 1 min, and 72˚C 45 s; and a final extension at 72˚C for 5 min. Appropriate positive and negative controls were included for each PCR run. The PCR products were electrophoresed on 1.5% agarose gel in TBE (90 Mm Tris, 90 Mm Boric acid, 2 Mm EDTA), and the gels were visualized under a UV transilluminator.\u003c/p\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eProduction of Anti \u003cem\u003eleishmania\u003c/em\u003e amastigote antibodies in rabbits was confirmed by ELISA test. Amastigote lysate antigen was coated in an ELISA plate and probed with ether anti-\u003cem\u003eleishmania\u003c/em\u003e antibodies and normal rabbit serum. The mean OD of anti-\u003cem\u003eleishmania\u003c/em\u003e antibodies and normal rabbit serum was 2.1 and o.41 respectively.\u003c/p\u003e \u003cp\u003ePurification of the antibody was confirmed by electrophoresis. For this purpose, purified antibodies in comparison with the original rabbit serum were subjected to electrophoresis. As Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows the main component of the rabbit serum was albumin, while the main component of purified antibody was Gama globulin.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFor confirmation of conjugation of gold nanoparticles to antibody, in SDS PAGE, bovine serum albumin, Gold nanoparticles alone, purified antibody, and gold nanoparticles conjugated with antibody were subjected to electrophoresis. As Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e shows while there is no band for gold nanoparticles alone, a band related to IgG antibodies conjugated to gold nanoparticles is present in lane 4.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eLateral Flow test examination:\u003c/h2\u003e \u003cp\u003eIn the developed lateral flow test, anti-amastigote antibody and goat anti-rabbit antibody were immobilized as test and control lines respectively. The conjugate pad was soaked with gold nanoparticles conjugated to anti amastigote antibody and then dried. Finally, the cassettes were assembled for the detection of amastigote antigens.\u003c/p\u003e \u003cp\u003eFor the experiment, Lysate of amastigotes in buffer and buffer alone were subjected to cassettes of developed lateral flow test. As Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e shows in the cassette related to the amastigote, test, and control lines appeared after five minutes. However, in the cassette related to the buffer alone, only the control line appeared after five minutes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eResults of examination of patient samples with different methods:\u003c/h2\u003e \u003cp\u003eUsing the microscopic technique amastigote form of \u003cem\u003eleishmania\u003c/em\u003e parasites was seen in 28 isolates and they were considered as positive cases. In 10 isolates the amastigote form was not detected and they were considered as negative cases. All positive and negative cases were also examined with PCR and lateral flow tests developed in this investigation. PCR of all positive cases except two was also positive and PCR of all negative cases was also negative (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In culture method 24 out of 28 positive samples and 10 out of 10 negative samples showed positive and negative results respectively. Also, 38 clinical samples suspected of cutaneous leishmaniasis were tested with the developed lateral flow test. In 26 cases the test provided positive results and in 9 cases negative results (Table\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eConsidering Microscopic results as the gold standard method, and considering the false positive and negative results (Tables\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), the sensitivity and specificity of culture, PCR, and lateral flow test were calculated and presented in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eResults of Microscopic examination, culture, PCR, and lateral flow test for diagnosis of cutaneous leishmaniasis in clinical samples taken from patients who were suspected of cutaneous leishmaniasis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethod\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePositive results\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNegative results\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMicroscopic examination\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCulture\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLateral Flow\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTrue and false positive and negative results of culture, PCR, and lateral flow test Considering Microscopic examination as the gold standard method for diagnosis of cutaneous leishmaniasis in clinical samples.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eResults\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLateral Flow\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCulture\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTrue Positive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFalse positive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTrue negative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFalse negative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003esensitivity and specificity of culture, PCR, and lateral flow test, considering Microscopic examination as the gold standard method for diagnosis of cutaneous leishmaniasis in clinical samples.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eResults\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLateral flow\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCulture\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSensitivity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecificity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eLeishmaniasis is a vector-borne parasitic disease that is transmitted via infected female sandflies. It presents a broad spectrum of clinical manifestations which are usually divided into cutaneous leishmaniasis (CL), mucocutaneous leishmaniasis (MCL), and visceral leishmaniasis (VL) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The disease is present in over 98 countries and is estimated approximately 350\u0026nbsp;million individuals at risk. The overall prevalence is 12\u0026nbsp;million cases, with an annual incidence of 2-2.5\u0026nbsp;million cases of CL. The incidence numbers are likely underestimated in many countries because some instances are unrecognized and reporting is not obligatory [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe primary diagnosis of the disease is based on epidemiological and clinical signs confirmed by laboratory tests especially direct microscopic examination. Besides parasitological methods, immunological and molecular methods have also been investigated for the diagnosis of this disease. Microscopic examinations and culture have a sensitivity of 85%. Molecular methods reported to have a specificity of about 100% with a sensitivity of 20 to 30% when compared with conventional parasitology diagnosis. However, these methods may not be available in medical laboratories in endemic areas. Serological methods are not usually employed for the diagnosis of CL, because the infection provoked a humoral response weakly and so, the tests are low sensitivity [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTherefore, nowadays, finding a rapid and sensitive diagnostic test is necessary. Here, we developed a lateral flow method for diagnosis of cutaneous leishmaniasis. The results of this method were then compared with microscopic examination, culture, and molecular method results. Considering Microscopic results as the gold standard method, we reported sensitivity of %92, %92, and %85 for lateral flow, molecular, and culture methods respectively. Also, culture and molecular methods showed a specificity of 100%, however, with lateral flow specificity of 90% was reported.\u003c/p\u003e \u003cp\u003eDuring the last decades, rapid progress was observed in nanotechnology that overcame several limitations in the diagnostics field. Different studies have used specific nanoparticles (NPs) such as gold, quantum dots (QDs), silver, etc. for the development of specific assays including colorimetric, lateral flow, and electrochemical methods, for the detection of \u003cem\u003eLeishmania spp\u003c/em\u003e. In biological samples. Nanoparticles have different performance. They can adsorb or bind to various surfaces by electrostatic interactions while binding to other molecules via different surface functional groups simultaneously [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Gold nanoparticles have unique and simply tuned physical and chemical properties. They also were synthesized simply and functionalized with a variety of molecules. So, they have different applications from detection methods to drug delivery in parasitology including diagnosis and treatment of leishmaniasis [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn an investigation, Welearegay and coworkers synthesized metal Nanoparticle Sensors for the Detection of Cutaneous Leishmaniasis disease in patients' exhaled breath. The test had High accuracy (98.2%), sensitivity (96.4%), and specificity (100%) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Mehri and colleagues 2020 applied citrate-capped silver NPs as a suitable probe ((Genosenso) for \u003cem\u003eLeishmania spp\u003c/em\u003e detection based on fluorescence and UV/Vis [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Anfossi and colleagues developed a method on the technology of lateral flow immunoassay for the rapid diagnosis of canine leishmaniasis in serum samples of animals which can also be developed for other animals. In this device, anti-\u003cem\u003eleishmania\u003c/em\u003e antibodies in the serum were detected by using highly specific recombinant antigens of the amastigote form of \u003cem\u003eL. infantum\u003c/em\u003e. Also labeled protein A with gold nanoparticles was used as the signal reporter. They reported a diagnostic sensitivity of (98.4%) and a specificity of (98.9%) for this test [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Toubanaki et al. (2016), used a nucleic acid lateral flow that combined with functionalized gold nanoparticles for quick visual detection of \u003cem\u003eLeishmania\u003c/em\u003e-specific amplification products. They succeeded in confirming the presence of \u003cem\u003eLeishmania\u003c/em\u003e in blood samples of infected dogs. [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Different studies have also shown that Lateral flow biosensors are significant for diagnostic targets as they are, sensitive, specific, rapid, inexpensive, and equipment-free. [\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Finally results of our work revealed that the developed lateral flow test is a convenient test for diagnosis of cutaneous leishmaniasis especially in rural area with less lab facilities. Modification of the test for improvement of sensitivity and specificity of the method is now undergoing.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflict of interest:\u003c/h2\u003e \u003cp\u003eNone of the authors has conflict of interests\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent to participate:\u003c/strong\u003e \u003cp\u003eInformed consent was obtained from all individual participants included in the study\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eEthics approval:\u003c/strong\u003e \u003cp\u003e The research proposal of this work was approved with by ethic committee of Isfahan University of medical sciences with scientific code of 199566 and ethical approve number of IR. MUI.MED.REC/1399.1145\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eH.YD designed and supervised the work, M.M helped as Leishmania consultant, S.Sperformed the Leishmania lab works, M.H performed the lab works and prepared the first draft of the paper, L.A, and M.S participated in collecting the specimens. The final version of the manuscript was approved by all the authors.\u003c/p\u003e\u003ch2\u003eAcknowledgment:\u003c/h2\u003e \u003cp\u003eThis work was supported by a grant from Isfahan University of Medical Sciences with grant number of 199566\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eReithinger R et al (2007) Cutaneous leishmaniasis. Lancet Infect Dis 7(9):581\u0026ndash;596\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoto H, Lindoso JAL (2010) Current diagnosis and treatment of cutaneous and mucocutaneous leishmaniasis. Expert Rev anti-infective therapy 8(4):419\u0026ndash;433\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSandoval Pacheco CM et al (2018) Histopathological features of skin lesions in patients affected by non-ulcerated or atypical cutaneous leishmaniasis in Honduras, Central America. Int J Exp Pathol 99(5):249\u0026ndash;257\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThakur S, Joshi J, Kaur S (2020) Leishmaniasis diagnosis: an update on the use of parasitological, immunological and molecular methods. J Parasitic Dis 44:253\u0026ndash;272\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKar K (1995) Serodiagnosis of leishmaniasis. Crit Rev Microbiol 21(2):123\u0026ndash;152\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeigle KA et al (1987) Diagnosis of cutaneous and mucocutaneous leishmaniasis in Colombia: a comparison of seven methods. Am J Trop Med Hyg 36(3):489\u0026ndash;496\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSereno D, Lemesre J-L (1997) Axenically cultured amastigote forms as an in vitro model for investigation of antileishmanial agents. Antimicrob Agents Chemother 41(5):972\u0026ndash;976\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDarani H, Doenhoff M (2009) Anomalous immunogenic properties of serine proteases. Scand J Immunol 70(4):384\u0026ndash;388\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDarani HY et al (2010) Development of a latex agglutination test as a simple and rapid method for diagnosis of Trichomonas vaginalis infection. Avicenna J Med Biotechnol 2(1):63\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLemrani M et al (2009) PCR detection of Leishmania in skin biopsies. J Infect Developing Ctries 3(02):115\u0026ndash;122\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh S, Sivakumar R (2003) Recent advances in the diagnosis of leishmaniasis. J Postgrad Med 49(1):55\u0026ndash;60\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Vries HJ, Reedijk SH, Schallig HD (2015) Cutaneous leishmaniasis: recent developments in diagnosis and management. Am J Clin Dermatol 16:99\u0026ndash;109\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTorres-Guerrero E et al (2017) Leishmaniasis: Rev F1000Research:6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKammona O, Tsanaktsidou E (2021) Nanotechnology-aided diagnosis, treatment and prevention of leishmaniasis. Int J Pharm 605:120761\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBenelli G (2018) Gold nanoparticles\u0026ndash;against parasites and insect vectors. Acta Trop 178:73\u0026ndash;80\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarshchi F, Saadati A, Hasanzadeh M (2020) Optimized DNA-based biosensor for monitoring Leishmania infantum in human plasma samples using biomacromolecular interaction: a novel platform for infectious disease diagnosis. Anal Methods 12(39):4759\u0026ndash;4768\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWelearegay TG et al (2018) Ligand-capped ultrapure metal nanoparticle sensors for the detection of cutaneous leishmaniasis disease in exhaled breath. ACS Sens 3(12):2532\u0026ndash;2540\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMehri P et al (2020) An innovative genosensor for the monitoring of Leishmania spp sequence using binding of pDNA to cDNA based on Cit-AgNPs. Heliyon, 6(8)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnfossi L et al (2018) A versatile and sensitive lateral flow immunoassay for the rapid diagnosis of visceral leishmaniasis. Anal Bioanal Chem 410:4123\u0026ndash;4134\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToubanaki DK, Athanasiou E, Karagouni E (2016) Gold nanoparticle-based lateral flow biosensor for rapid visual detection of Leishmania-specific DNA amplification products. J Microbiol Methods 127:51\u0026ndash;58\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou W et al (2014) Aptamer-based biosensors for biomedical diagnostics. Analyst 139(11):2627\u0026ndash;2640\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y et al (2018) Multiple cross displacement amplification coupled with nanoparticles-based lateral flow biosensor for detection of Staphylococcus aureus and identification of methicillin-resistant S. aureus. Front Microbiol 9:353773\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJain S et al Are Nanobiosensors Improved Solut Diagnosis Leishmania? Pharm (2021), 13, 491\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"cutaneous leishmaniosis, diagnosis, lateral flow","lastPublishedDoi":"10.21203/rs.3.rs-4826738/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4826738/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eCutaneous leishmaniosis with a broad spectrum of clinical manifestations is caused by the \u003cem\u003eLeishmania\u003c/em\u003e parasites. For laboratory diagnosis using parasitological methods, patients\u0026rsquo;lesion biopsies are either examined under the microscope following appropriate staining or culture in a relevant medium. Although these methods are effective in the early stages of infection, they don\u0026rsquo;t yield enough sensitivity in chronic cases. Molecular methods usually have a high level of sensitivity and specificity but with the need for lab equipment, they are not suitable for field diagnosis. So, it is important to develop a rapid and point-of-care test to diagnose cutaneous leishmaniasis.\u003c/p\u003e\u003ch2\u003eMethod\u003c/h2\u003e \u003cp\u003eIn this work a lateral flow test for diagnosis of cutaneous leishmaniosis was developed. For evaluation of the test, thirty-eight patient samples with a clinical suggestion of CL were collected and examined using direct microscopy, culture, and PCR and then with the developed lateral flow test.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eConsidering Microscopic examination, 28 out of 38 samples were positive and 10 out of 38 were negative. From 28 positive samples, 24, 26, and 26 became positive by cultivation, PCR, and lateral flow test respectively. From negative samples, 1 was positive with the lateral flow test. Considering microscopic results as the gold standard, the sensitivity of %92, %92, and %85 was estimated for lateral flow, molecular, and culture methods respectively.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe lateral flow test is a very rapid and easy test for diagnosis of cutaneous leishmaniosis especially in rural areas with fewer lab facilities.\u003c/p\u003e","manuscriptTitle":"Rapid diagnosis of cutaneous leishmaniosis using antibody-conjugated gold Nanoparticles in comparison with molecular and parasitological methods","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-04 21:46:55","doi":"10.21203/rs.3.rs-4826738/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e2bc722b-74e9-4dcc-ae3a-c1525f9182d3","owner":[],"postedDate":"September 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-09-07T07:12:22+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-04 21:46:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4826738","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4826738","identity":"rs-4826738","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.