Regulation of Pro-apoptotic and Anti-apoptotic Factors in Obesity-Related Esophageal Adenocarcinoma

preprint OA: closed
Full text JSON View at publisher
Full text 118,894 characters · extracted from preprint-html · click to expand
Regulation of Pro-apoptotic and Anti-apoptotic Factors in Obesity-Related Esophageal Adenocarcinoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Regulation of Pro-apoptotic and Anti-apoptotic Factors in Obesity-Related Esophageal Adenocarcinoma Swati Agrawal, Anna Podber, Megan Gillespie, Nick Dietz, Laura A. Hansen, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4193803/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Oct, 2024 Read the published version in Molecular Biology Reports → Version 1 posted 7 You are reading this latest preprint version Abstract Background: Obesity is a risk factor for esophageal adenocarcinoma (EAC). It is associated with increased levels of free fatty acids (FFA), leading to insulin resistance and increased expression of insulin like growth factor-1 (IGF-1) and diacylglycerol (DAG). The objective of the study is to investigate the role of apoptotic factors in control and EAC tissues in both relation to this signaling pathway in obese and non-obese patients. Methods: We included 23 obese and nonobese patients with EAC or with or without Barrett’s esophagus (BE) after IRB approval. We collected 23 normal, 10 BE, and 19 EAC tissue samples from endoscopy or esophagectomy. The samples were analyzed for the expression levels of pro-apoptotic and anti-apoptotic factors, PKC-d, cIAP2, FLIP, IGF-1, Akt, NF-kB and Ki67 by immunofluorescence and RT-PCR. We compared the expression levels between normal, BE, and EAC tissue using Students’ t-test between two groups. Results: Our results showed decreased gene and protein expression of pro-apoptotic factors (bad, bak and bax) and increased expression of anti-apoptotic factors (bcl-2, Bcl-xL) in BE and EAC compared to normal tissues. There was increased gene and protein expression of PKC-d, cIAP2, FLIP, NF-kB, IGF-1, Akt, and Ki67 in BE and EAC samples compared to normal esophagus. Further, an increased folds changes in mRNA expression of proapoptotic factors, antiapoptotic factors, PKC-δ, IGF-1, Akt, and Ki-67 was associated with obesity. Conclusion : Patients with EAC had increased expression of cIAP2 and FLIP, and PKC-d which is associated with inhibition of apoptosis and possible progression of esophageal adenocarcinoma. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Esophageal cancer ranks eighth in the global cancer incidence and considered to be the sixth most lethal cancer [ 1 , 2 ]. The adenocarcinoma of the esophagus has been on the rise and became the most prevalent subtype in the West [ 3 ]. The rise in esophageal adenocarcinoma (EAC) is attributed largely to the obesity epidemic and reflux disease. Despite recent advances in treatment, the five-year survival rate for EAC remains low at 20.1% [ 4 ]. This growing incidence and persistently low survival rate underscore the need for more research into the molecular pathways of EAC to pave the way for better therapeutic options. Notably, obesity, a risk factor for EAC, has been associated with increased stress-related apoptosis and programmed cell death [ 5 ] [ 4 ] [ 6 ]. Obesity-associated free fatty acids (FFA) changes can lead to increased expression of insulin growth factor-1 (IGF-1) and diacylglycerol (DAG). DAG enhances the expression of protein kinase C δ (PKC-δ), a serine-threonine kinase that acts as a pleiotropic regulator of cell proliferation, differentiation, and survival [ 7 – 9 ]. EAC cells can circumvent apoptosis through an obesity-induced IGF1-DAG-PKC-δ pathway, or independently of the PKC-δ pathway via modifications to downstream regulators. One proposed mechanism of such downstream regulation is believed to be mediated by the cellular inhibitor of apoptosis 2 (cIAP2) and cellular FLICE-inhibitory proteins (c-FLIP). c-FLIPs are considered mediators of anti-apoptotic pathways, inhibiting programmed cell death. Similarly, human IAPs, including cIAP1, cIAP2, and XIAP, regulate apoptosis by negatively regulating ripoptosomes and activating apoptotic and necroptotic cell death responses [ 10 ] [ 11 ]. In esophageal squamous cell cancers, cIAP2 expression is higher in cancerous tissue compared to normal mucosa [ 12 ], suggesting a potential association with cancer progression [ 13 ]. However, the interaction between PKC-δ and downstream signaling involving apoptotic inhibitory proteins (cIAP2 and c-FLIP), which may play a pivotal role in malignant cell proliferation, has not been thoroughly investigated in EAC (Fig. 1 ). The aim of our study is to discern the relationship between PKC-δ and downstream cIAP2 and c-FLIP, and to determine the impact of this relationship on apoptosis in EAC. Material and methods Patient selection This prospective study received approval from the Institutional Review Board (IRB) of Creighton University (IRB No. 1194896). Following IRB approval, informed consent was obtained, and 23 patients were recruited from the surgery clinics at Creighton University Medical Center and CHI Health Immanuel Medical Center. The inclusion criteria encompassed patients aged 19 or older with a clinical diagnosis of esophageal cancer, which was confirmed through endoscopic inspection of the esophagus complemented by esophageal histology. The exclusion criteria ruled out patients aged 18 or younger, those unwilling to participate in the study, and biopsies that did not confirm EAC. During the study, 23 normal tissue samples (from regular esophageal lining), 10 Barrett’s Esophagus samples, and 19 EAC samples were collected, either during esophageal endoscopy or from patients undergoing esophagectomy. Patient weight was recorded either at the time of the endoscopy or surgery. Obesity was defined as a BMI greater than 30 kg/m 2 . Demographics and clinical data were sourced from patient charts. We collected variables such as age, sex, body mass index (BMI), EAC staging, medication usage, smoking and alcohol consumption history, and co-morbid conditions. A power analysis determined the sample size among groups based on BMI, achieving a power (1-β) of 95% and α set at 0.05. The minimum number of samples required in each group to achieve statistical significance between groups was identified as 10. Tissue collection and processing Esophageal tissue biopsies, both from tumor and non-tumor regions, were obtained during endoscopy or surgery. These samples were promptly transported to the Creighton University lab in either formalin, University of Wisconsin solution, or RNA later solution, and they were kept at 4°C. Tissue samples preserved in RNA later were stored at -80°C for RNA isolation. A board-certified pathologist assessed each tissue sample to determine the presence or absence of EAC. For histological analysis, a segment of each esophageal tissue sample was preserved in 10% buffered formalin for 24 hours. Subsequently, the tissue samples underwent processing with the Excelsior ES tissue processor (Thermo Scientific, USA) through various cycles of dehydration in ethanol baths, followed by paraffin baths. The tissues were then embedded in paraffin blocks. Thin tissue sections, measuring 5µm, were cut using a Leica RM 2135 microtome and then mounted on glass slides. These slides were placed in a 72°C oven to melt the paraffin wax, a process that lasted for 20 minutes. Hematoxylin and eosin stain Hematoxylin and Eosin (H&E): staining was performed following the standard protocol in our laboratory. Briefly, the tissue sections on the slides were de-paraffinized, rehydrated in ethanol, rinsed in double-distilled water, and stained with hematoxylin for 45 seconds and with eosin for 30seconds. The stained sections were mounted with a xylene-based mounting medium and a coverslip was placed over the tissue. The stained tissue sections were examined under a light microscope (Leica DM6) and the images were scanned with a scale of 100µm. We stained at least three adjacent sections from each tissue and three images were scanned from each section for analysis. Immunofluorescence assays At the Creighton University laboratory, samples were prepared as per standard protocol for immunofluorescence assays via deparaffinization and rehydration. Antigen retrieval was performed by heating the section in DAKO Target Retrieval solution for 1 hour. Briefly, after antigen retrieval, the slides were cooled down to room temperature and washed with 1X phosphate buffered saline (PBS) three times for 5 minutes each. This was followed by blocking the nonspecific antigens with blocking buffer for one hour at room temperature followed by the incubation with primary antibodies, rabbit anti-Bad (ab45782), rabbit Anti-Bak (ab32371), rabbit Anti- Bax (ab32503), rabbit Anti-Bcl-2 (ab32124), rabbit Anti- Bcl- XL (ab32370), rabbit Anti-PKC-𝛿 (ab182126), rabbit Anti- Akt (ab8805), rabbit Anti-cIAP2 (ab23423), rabbit Anti-IGF1 (ab182408), rabbit Anti-FLIP (ab 8421), and rabbit Anti- NF-κB (ab131109) and rabbit Anti-Ki67 (ab16667) overnight at 4 0 C in a dilution of 1:100. This was followed by PBS wash 3 times 5 minutes each and incubation with donkey anti rabbit Alexa Fluor 488 (green) Invitrogen A32790 Thermo Fisher Scientific conjugated secondary antibodies at 1:500 dilutions for 1 hour at room temperature. The sections were washed with PBS while gently shaking. Nuclear staining was done with 4′,6-diamidino-2-phenylindole (DAPI). The slides were mounted with Antifade Gold reagent containing DAPI (H-1200; Vectashield, Vector labs). The slides were scanned with Nikon inverted fluorescent microscope at 100µm. A minimum of three scanned images from each sample was used to estimate the fluorescence intensity using ImageJ (NIH) software and mean fluorescence intensity (MFI) was analyzed for each protein of interest. The fluorescence intensity measurement and MFI calculations were cross checked by two blinded reviewers. RNA isolation, cDNA preparation, and Real-Time PCR Total RNA was isolated using TRI reagent (T9424, Sigma, St Louis, MO, USA). The yield of total RNA was measured using NanoDrop One (Thermo Fisher Scientific, USA). Further, the cDNA was synthesized using iScript cDNA synthesis kit (1708891 BioRad) and Real-Time PCR (RT-PCR) was performed in triplicate using SYBR Green Master Mix (#1708880, BioRad) using Real Time cycler (Applied Biosystems 7500 Fast Dx Real-Time PCR). The cycling conditions were 5 minutes at 95°C for initial denaturation, 40 cycles of 30seconds at 95°C, 30s at 55–60°C (based on primer annealing temperatures), and 30seconds at 72°C followed by melting curve analysis. The primers for Bad, Bak, Bax, Bcl-2, Bcl-XL, PKC-𝛿, Akt, cIAP2, IGF1, FLIP , and NF-κB were obtained from Integrated DNA Technologies (Coralville, Iowa 52241.USA) and the forward and reverse nucleotide sequences are given in Table 1. Table 1: Forward and reverse nucleotide sequence of the primers used in RT-PCR Gene Direction Sequence Bax Forward 5′-CCCGAGAGGTCTTTTTCCGAG-3′ Reverse 5′-CCAGCCCATGATGGTTCTGAT-3′ Bak Forward 5′-TGCTAGTGCCCTCTCTCTGG-3′ Reverse 5′-GTGGGAATGGGCTCTCACAA-3′ Bcl-2 Forward 5′-TCGCCCTGTGGATGACTGA-3′ Reverse 5′-CAGAGACAGCCAGGAGAAATCA-3′ Bcl-xL Forward 5′-TAAGGCGGATTTGAATCTC-3′ Reverse 5′-ATAATAGGGATGGGCTCAAC-3′ Bad Forward 5'-TAAGAAGGGACTTCCTCGCC-3' Reverse 5'-GTTCCGATCCCACCAGGACT-3' PKC-𝛿 Forward 5′-GCATCTCCACGGAACGAC-3′ Reverse 5′-CCACCTCCACCTTCTCAACT-3′ AkT1 Forward 5′-GGAGGTTTTTGGGCTTGCG-3′ Reverse 5′-CTCTGATGCACCAGCTGACA-3′ cIAP2 Forward 5′-GCTTTTGCTGTGATGGTGGACTC-3′ Reverse 5′-CTTGACGGATGAACTCCTGTCC-3′ IGF1 Forward 5′ACACAATCTGCCTCCCTCATTT3′ Reverse 5′AGTCCCTTCAGGGGCTTTCA3′ FLIP Forward 5′AGTGAGGCGATTTGACCTGCTC3′ Reverse 5′ CCTCACCAATCTCTGCCATCAG3’ NF-κB Forward 5’-GACTACGACCTGAATGCTGTG-3’ Reverse 5’-GTCAAAGATGGGATGAGGAAGG-3’ Ki67 Forward 5’-CTTTGG GTG CGA CTT GAC G-3’ Reverse 5’-GTCGACCCCGCTCCTTTT-3’ β-actin Forward 5’-CCTGGCACCCAGCACAAT-3’ Reverse 5’-GCCGATCCACACGGAGTACT-3’ Statistical Analysis Data is presented as the mean ± SD. Data was analyzed using GraphPad Prism 9. The comparison between two groups for the expression of the protein of interest was performed using One-way ANOVA with Bonferroni’s post-hoc correction. A probability ( p ) value of < 0.05 was accepted as statistically significant. *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001. Results Patient demographics are listed in table and noted to have male predominance. (Table 2) Patient Demographics (n = 23) Mean (range) Age 63 years (48 year − 80 year) Sex 19 males 4 females BMI - mean (range) 27.83 kg/m 2 (19.76–40.5) EAC staging Stage I Stage II% Stage III Stage IV 4% 13% 52 14% Current or Prior BE (%) 43.5% Current Proton Pump Inhibitor use (%) 87% Tobacco use (%) 91.3% Alcohol use (%) 56.5% Hematoxylin and eosin (H&E) staining revealed increased inflammation, fibrosis, moderately differentiated lesions in EAC. (Fig. 1 ) The fold change in mRNA expression of pro-apoptotic factors were decreased while of anti-apoptotic factors were increased in esophageal adenocarcinoma compared to control The RT-qPCR results showed a decreased fold change in mRNA expression of pro-apoptotic markers Bad, Bak and Bax in Barrett’s Esophagus and EAC as compared to the normal esophagus. The fold changes in mRNA expression of Bad and Bak were significantly decreased in BE ( p = 0.003; 0.60 vs 1.13 and p = 0.009; 0.25 vs 0.83) and in EAC ( p = 0.005; 0.63 vs 1.13 and p = 0.008; 0.42 vs 0.83) compared to the normal. Similarly, the fold change in mRNA expression of Bax was also significantly decreased in both BE ( p = 0.005; 0.30 vs 1.02) and EAC ( p = 0.03; 0.62 vs 1.02) compared to normal tissue. There were no significant differences between the fold changes in mRNA expression of Bad, Bak and Bax between BE and EAC ( p = 0.83, p = 0.29 and p = 0.08). (Fig. 2 panel A) The RT-qPCR results showed significantly increased fold change in mRNA expression of anti-apoptotic markers Bcl2 and Bcl-xL respectively in BE ( p = 0.04; 2.97 vs 1.42 and p = 0.13; 1.72 vs 1.41) and EAC ( p = 0.05; 2.91 vs 1.42 and p = 0.10; 1.82 vs 1.41) as compared to the normal esophagus. There were no significant differences between the fold changes in mRNA expression of Bcl2 and BcL-xL between BE and EAC ( p = 0.86; and p = 0.61). (Fig. 2 panel A). Overall, the results showed decreased expression of apoptotic factors and increased expression of anti-apoptosis factors, which impair apoptosis and contributes to BE and EAC carcinogenesis. RT-PCR showed increased mRNA expression of PKC-δ, IGF-1, Akt, NF-κB, cIAP2, FLIP, and Ki67 in BE and EAC compared to normal tissue samples. The qRT-PCR analysis revealed significantly increased folds change in mRNA expression of PKC-δ, IGF-1, Akt, NF-κB, cIAP2, and FLIP and proliferation marker Ki67 in BE and EAC compared to normal tissue. The folds change in mRNA expression of PKC-δ was significantly increased in EAC compared to normal ( p = 0.04; 4.91 vs 3.04) and increased in BE ( p = 0.11; 4.76 vs 3.04). However, there was no significant difference between the BE and EAC ( p = 0.88; 4.76 vs 4.91). (Fig. 2 panel A) The fold change in mRNA expression of IGF-1 was significantly higher in BE ( p = 0.009; 1.02 vs 3.44) and EAC ( p = 0.001; 3.45 vs 1.02) as compared to normal tissues. There was no significant difference between BE and EAC ( p = 0.99; 3.445 vs 3.449). (Fig. 2 panel B) The fold change in mRNA of Akt showed significantly higher expression in BE as compared to normal ( p = 0.03; 1.71 vs 0.99) and EAC ( p = 0.03; 2.34 vs 0.99). There was no significant difference between BE and EAC ( p = 0.17; 1.70 vs 2.34) (Fig. 2 panel B). The fold change in mRNA of NF-κB was significantly increased in BE ( p = 0.02; 3.56 vs 1.75) and EAC ( p = 0.007; 2.62 vs 1.75) as compared to normal while there was no significant difference between BE and EAC ( p = 0.15; 3.56 vs 2.62) (Fig. 2 panel B). The mRNA expression of Ki67 was significantly increased in BE ( p = 0.01; 2.84 vs 1.07) and EAC ( p = 0.0004; 2.49 vs 1.07) as compared to normal tissues. However, there was no significant difference between BE and EAC ( p = 0.46; 2.84 vs 2.49). (Fig. 2 panel B) The folds change in mRNA expression of cIAP2 was significantly increased in EAC ( p = 0.003; 4.37 vs 1.21) but was not significant in BE ( p = 0.19; 1.98 vs 1.21) when compared to the normal tissues. The folds change in mRNA expression was significantly increased between BE and EAC ( p = 0.02; 1.98 vs 4.34). The fold change in mRNA expression for FLIP was significantly increased in BE and ( p = 0.01; 1.75 vs 0.88) EAC ( p = 0.05; 1.78 vs 0.88) when compared to the normal tissues samples while there was no significance difference noted between BE and EAC ( p = 0.96) (Fig. 2 panel B). Immunofluorescence showed decreased immunopositivity for pro-apoptotic mediators Bad, Bak, and Bax while there was increased immunopositivity for anti-apoptotic factors Bcl-2 and Bcl-xL and PKC-δ in EAC. Immunofluorescence showed decreased immunopositivity for proapoptotic factors Bad, Bak and Bax in EAC and BE tissues compared to normal. (Fig. 3 panels A, B, C, D, E, F, G, H, and I). The mean fluorescent intensity (MFI) for Bad was significantly decreased in BE and EAC compared to normal tissue (Fig. 3 panel S) and MFI for Bak and Bax was significantly decreased in EAC compared to normal (Fig. 3 panel S). The decreased immunopositivity of Bad, Bak, and Bax in BE and EAC as compared to normal control suggests that proapoptotic factors are downregulated during EAC tumorigenesis. The immunopositivity of anti-apoptotic factors Bcl-2 and Bcl-xL was increased in EAC as compared to BE and normal esophagus (Fig. 3 panels J, K, L, M, N, and O). The IF of PKC-δ showed increased immunopositivity in EAC as compared to BE and normal (Fig. 3 panels P, Q, and R). The MFI of Bcl-2, Bcl-xL, and PKC-δ was significantly higher in BE and EAC compared to normal tissues (Fig. 3 panel S). Immunofluorescence showed increased immunopositivity for cIAP2, FLIP, IGF-1, Akt, NF-κB, and Ki67 in esophageal adenocarcinoma. Immunopositivity of Akt, IGF-1, NF-κB, and Ki-67 was increased in EAC compared to BE and normal tissue (Fig. 4 panels A, B, C, D, E, F, G, H, I, J, K and L). The MFI of Akt was significantly increased in BE and EAC compared to normal tissue and in EAC compared to BE (Fig. 4 panel S). The MFI for IGF-1 and NF-κB was significantly increased in BE and EAC compared to normal tissue (Fig. 4 panel S) while the MFI for Ki-67 was significantly increased in BE and EAC compared to normal tissue and in EAC compared to BE (Fig. 4 panel S). The immunopositivity for cIAP2 and FLIP was increased in BE and EAC as compared to normal esophagus (Fig. 4 panel M, N, O, P, Q, and R). The MFI for cIAP2 and FLIP was significantly increased in BE and EAC compared to normal tissue (Fig. 4 panel S). These results indicate the association of increased expression of PKC-δ, FLIP, and cIAP2 in EAC as compared to normal and BE. Obesity is associated with an increased folds changes in mRNA expression of proapoptotic factors, antiapoptotic factors, PKC-δ, IGF-1, Akt, and Ki-67 and decreased folds change in cIAP2 and FLIP in normal tissues. RT-PCR analysis revealed that the fold change in mRNA expression of Bad, Bax, and Bcl-2 was significantly elevated in normal tissue samples of the obese group compared to nonobese group ( p = 0.003, p = 0.039, and p = 0.032) respectively. However, it was not significantly increased in Bak and Bcl-xL ( p = 0.16 and p = 0.19) (Fig. 5 panel A). The folds change in mRNA expression of IGF-1, Akt, and Ki-67 was significantly increased ( p = 0.001, p = 0.04, and p = 0.001 respectively) while the expression of NF-kB was not significantly increased ( p = 0.31) in obese compared to non-obese population normal tissue samples. Surprisingly, the folds change in mRNA expression of cIAP2 and FLIP was significantly decreased ( p = 0.008 and p = 0.0008) in obese compared to non-obese normal samples (Fig. 5 panel A). Obesity is associated with decreased expression of proapoptotic genes, cIAP2, and FLIP while increased expression of antiapoptotic genes, PKC-δ, Akt, IGF-1, Ki-67, and NF-κB in EAC tissues. The folds change in mRNA expression of proapoptotic genes Bad, Bak and Bax was significantly decreased ( p = 0.01, p = 0.008 and p = 0.03 respectively) in obese patients with EAC compared to non-obese EAC tissues (Fig. 5 panel B). The fold change in mRNA expression of Bcl-2 was significantly increased in obese EAC ( p = 0.01) patients compared to non-obese EAC. While increased folds change in mRNA expression of Bcl-XL in obese EAC patients was not statistically significant ( p = 0.07). The fold change in mRNA expression of PKC-δ, Akt, IGF-1, and NF-kB was significantly increased ( p = 0.04, p = 0.01, p = 0.05, and p = 0.05 respectively) in obese EAC patients compared to non-obese EAC tissues. Surprisingly, the fold change in mRNA expression of cIAP2 and FLIP were significantly decreased ( p = 0.01 and p = 0.005 respectively) in obese EAC patients as compared non-obese EAC tissues (Fig. 5 panel B). These findings suggest the association of obesity with EAC tumorigenesis. Discussion Obesity has been identified as a significant risk factor for esophageal cancer. Alterations in the expression of anti-apoptotic and pro-apoptotic genes have been proposed as one of the mechanisms [ 14 ]. Our study found increased expression of anti-apoptotic genes (Bcl-2 and Bcl-xL) and upstream apoptosis regulators (cIAP2 and FLIP), along with decreased expression of pro-apoptotic genes (Bad, Bax, and Bak), in both Barrett's esophagus (BE) and esophageal adenocarcinoma (EAC) tissues compared to normal tissues from obese patients. The interplay between pro-apoptotic and anti-apoptotic genes has long been recognized as a crucial aspect of carcinogenesis. Apoptotic signaling plays a vital role in maintaining a balance between cell death and survival, as well as preserving genome integrity. Dysregulation of apoptotic and anti-apoptotic factors stands out as a prominent characteristic of cancer [ 15 ]. The overexpression of anti-apoptotic BCL-2 family proteins is frequently observed in cancer cells [ 16 ]. Moreover, the overexpression of anti-apoptotic proteins has been associated with cancer recurrence, poor prognosis, and resistance to cancer therapeutics [ 17 ]. Our results also revealed increased levels of pro-apoptotic factors and dysregulated apoptosis, particularly in EAC tissues compared to normal tissues. These findings indicate that dysregulated apoptosis could be a significant underlying mechanism in the development and progression of EAC. However, the specific regulation of pro-apoptotic and anti-apoptotic factors, particularly in the context of obesity induced EAC development, remains elusive. Obesity has emerged as a significant risk factor for cancer, with approximately 20% of all cancer cases attributed to excess weight [ 18 ]. It was estimated that around half of cancers in postmenopausal women can be linked to obesity [ 19 ]. Obesity has been associated with several types of cancer, including endometrial cancer, colorectal cancer, postmenopausal breast cancer, prostate cancer, renal cancer, and esophageal adenocarcinoma (EAC). [ 19 , 20 ] In addition to these associations, obesity has been shown to contribute to tumor growth and progression due to increased levels of free fatty acids and dietary lipids [ 22 , 23 ]. The relationship between obesity and changes in apoptotic factors, particularly the overexpression of anti-apoptotic factors and the inhibition of proapoptotic factors, in cases of Barrett's esophagus (BE) and esophageal adenocarcinoma (EAC) among obese patients compared to non-obese individuals indicates the importance of elevated levels of free fatty acids and dietary lipids, as well as the imbalance in apoptotic factors, in the development of obesity-induced BE and EAC [ 24 – 27 ]. The precise biological mechanisms underlying the association between obesity and malignancy remain elusive; however, alterations in the IGF-axis have been proposed as a potential mechanism for carcinogenesis [ 28 – 32 ]. Focal adhesions kinase (FAK) is a nonreceptor-type tyrosine kinase that regulates integrin and growth factor signaling pathways. To investigate this further, Zhao et al treated EAC cell lines with TAE226, a dual inhibitor for IGF and focal adhesion kinase (FAK) [ 33 ]. The treatment of EAC cell lines with TAE226 resulted in the inhibition of cellular proliferation, migration, and adhesion, accompanied by enhanced caspase-mediated apoptosis [ 33 ]. Our study revealed increased levels of IGF-1 in BE and EAC obese tissues, increased expression of Ki-67 (a marker of cell proliferation) in BE and EAC tissues, and decreased proliferation and migration of EAC cells with IGF1 inhibition. These findings suggest a robust relationship between obesity and EAC carcinogenesis and are consistent with the notion that insulin, insulin resistance, and insulin-like growth factor (IGF)-1 play significant roles in cell proliferation, differentiation, and apoptosis, contributing to carcinogenesis. This makes them intriguing targets for cellular studies linking obesity and cancer [ 34 ] as well as for therapeutics. However, the precise molecular mechanisms and downstream signaling pathways involved in this relationship warrant further investigations. Elevated levels of IGF-1 in obesity and the subsequent dysregulation of downstream signaling pathways have been implicated in cancer progression, particularly in squamous cell carcinoma of the esophagus [ 34 ]. Recently, certain downstream cell cycle regulators such as c-FLIP and cIAP2 have been identified in various cancers [ 35 ]. Studies have reported that the downregulation of c-FLIP can restore apoptosis mediated by TRAIL and CD95L, making c-FLIP a promising target for cancer therapy. Combining c-FLIP inhibition with other treatments, such as TRAIL or conventional chemotherapy, could enhance its effectiveness [ 36 , 37 ]. c-FLIP has been identified as a key negative regulator of apoptosis in human cancer cells, and its expression is controlled by several transcription factors, including AP-1 (c-Fos and c-Jun), CREB, SP1, and NF-kB. In our study, we observed increased expression of c-FLIP and cIAP2 in both Barrett's Esophagus (BE) and EAC tissues compared to normal tissues, which was accompanied by decreased expression of pro-apoptotic markers Bax, Bak, and Bad (Figs. 2 , 3 , and 4 ). These findings suggest a negative association between increased c-FLIP and cIAP2 expression and the expression of pro-apoptotic genes. One possible underlying mechanism is the inhibition of caspase-8 mediated apoptosis [ 38 ](Fig. 6 ). It is worth noting that the role of c-FLIP and cIAP2 in esophageal adenocarcinoma patients has not been extensively studied in the literature and investigating the regulatory role of cFLIP and cIAP2 in apoptosis in the context of EAC may be helpful in designing better therapeutics for EAC (35, 39). Protein kinase C (PKC), a family of phospholipid-dependent serine/threonine protein kinases, regulates a wide variety of cellular functions, including cell proliferation, differentiation, and cell death [ 40 ]. Our results showed overexpressed PKC-δ in BE and EAC compared to the normal tissues in obese patients compared to nonobese patients. This suggests that increased PKC-δ which regulates cFLIP and cIAP2 expression through NF-κB, is associated with EAC progression in obesity. Our results are unique since increased PKC-δ expression and its correlation with cFLIP and cIAP2 expression in obesity has not been reported widely in the literature. The secretion of inflammatory cytokines (IL-1, IL-6, and TNF-α) from infiltrated immune cells, mainly macrophages, is associated with obesity [ 41 – 43 ] and may exert control over apoptotic mediators through upstream regulation of cIAP2 and FLIP. In our study, we also investigated the expression of NF-κB, a transcription factor that is activated by cytokines secreted in obesity (Fig. 6 ). Our findings revealed an increased expression of NF-κB in both BE and EAC tissues, along with cFLIP and cIAP2, suggesting that the upregulation of inflammatory cytokines, TNF-α primarily, activates cFLIP and cIAP2. Moreover, TNF-α triggers the activation of caspase-8 and NF-κB [ 44 , 45 ], which subsequently activate apoptosis, cFLIP, and cIAP2 through independent pathways (Fig. 6 ). TNF-α simultaneously stimulates pro-apoptotic and anti-apoptotic signals, and cellular death occurs when the anti-apoptotic signals, mainly mediated by NF-κB activation, are suppressed [ 45 ](Fig. 6 ). However, further in vitro studies are necessary, involving the blocking of complex I [ 46 ] and complex II and stimulation with TNF-α, to provide additional support for the molecular mechanisms involved for EAC tumorigenesis and the histological findings presented in this study. Additionally, besides NF-κB, the stimulation of growth factors or activation of other pathways, such as mitogen-activated protein kinase (MAPK) and the phosphatidylinositol-3 kinase (PI3K)/Akt, can induce the expression of c-FLIP and hinder apoptosis triggered by death receptors [ 47 ]. Notably, our findings revealed a noteworthy upregulation of cytoplasmic kinase Akt expression in the tissues of BE and EAC from obese patients. These results further strengthen the hypothesis that inflammatory signaling activation in obesity regulates apoptosis through the activation of cIAP2 and FLIP. Consequently, targeting cIAP2 and FLIP holds potential as a therapeutic approach for EAC. It is important to acknowledge the limitations of our study, including a small sample size and a lack of in-vitro studies to establish a direct causal relationship between PKC-δ and apoptotic pathways. Nevertheless, our results demonstrate significantly elevated levels of PKC-δ, cIAP2, and FLIP in BE and EAC patients compared to normal esophageal tissues from obese patients pave the way to investigate the role of cIAP2, and FLIP in EAC and therapeutic potential of targeting these molecules. In summary, our study provides evidence of dysregulation in apoptotic factors in BE and EAC associated with obesity. The overexpression of anti-apoptotic factors, suppression of pro-apoptotic factors, and alterations in the IGF axis and PKC-δ suggest potential mechanisms underlying the association between obesity and EAC. Furthermore, the involvement of NF-κB, c-FLIP, and cIAP2 in obesity-associated EAC warrants further investigation. These findings contribute to a better understanding of the molecular pathways involved in obesity-induced esophageal cancer and may offer insights into potential therapeutic targets. Conclusion PKC-δ is significantly overexpressed in BE and EAC tissues. Our results also showed significant association between the expression of apoptotic regulators cIAP2 and FLIP with BE and EAC. Since, dysregulated programmed cell death is associated with carcinogenesis, targeting apoptosis via cIAP2 and FLIP seems to be a promising strategy to attenuate the progression of BE and EAC. Abbreviations Esophageal Adenocarcinoma (EAC), Barrett’s Esophagus (BE), Protein Kinase B (Akt), Cellular Inhibitor of Apoptosis 2 (cIAP2), Protein Kinase C delta (PKC δ), Tumor Necrosis Factor alpha (TNF-α), interleukin (IL), CASP8 and FADD-like apoptosis regulator (cFLIP), insulin like growth factor (IGF)-1, nuclear factor kappa beta (NF-κB), mitogen-activated protein kinase (MAPK), and phosphatidylinositol-3 kinase (PI3K). Declarations Acknowledgment Sampath Poreddy MD. Source of funding This study was supported by the Department of Surgery Creighton University Omaha, NE USA. Competing Interest “The authors have no relevant financial or non-financial interests to disclose.” Conflict of interest The authors have declared no conflict of interest. Ethics approval and consent to participate. This study was approved by the Institutional Review Board (IRB) of Creighton University References Bray F et al (2018) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68(6):394–424 Esophageal cancer: epidemiology, pathogenesis and prevention. Nat Clin Pract Gastroenterol Hepatol, (2008) 5(9): p. 517–526 Runge TM, Abrams JA, Shaheen NJ (2015) Epidemiology of Barrett's Esophagus and Esophageal Adenocarcinoma. Gastroenterol Clin North Am 44(2):203–231 Blucher C, Stadler SC (2017) Obesity and Breast Cancer: Current Insights on the Role of Fatty Acids and Lipid Metabolism in Promoting Breast Cancer Growth and Progression. Front Endocrinol (Lausanne) 8:293 Hotamisligil GS et al (1995) Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and insulin resistance. J Clin Invest 95(5):2409–2415 Pfeffer CM, Singh ATK (2018) Apoptosis: A Target for Anticancer Therapy. Int J Mol Sci, 19(2) Ye J (2013) Mechanisms of insulin resistance in obesity. Front Med 7(1):14–24 Kolczynska K et al (2020) Diacylglycerol-evoked activation of PKC and PKD isoforms in regulation of glucose and lipid metabolism: a review. Lipids Health Dis 19(1):113 Lei Z et al (2018) PKCdelta reveals a tumor promoter function by promoting cell proliferation and migration in somatotropinomas. Int J Clin Exp Pathol 11(1):208–215 Silke J, Meier P (2013) Inhibitor of apoptosis (IAP) proteins-modulators of cell death and inflammation. Cold Spring Harb Perspect Biol, 5(2) Jan R, Chaudhry GE (2019) Understanding Apoptosis and Apoptotic Pathways Targeted Cancer Therapeutics. Adv Pharm Bull 9(2):205–218 Esposito I et al (2007) Overexpression of cellular inhibitor of apoptosis protein 2 is an early event in the progression of pancreatic cancer. J Clin Pathol 60(8):885–895 Safa AR (2013) Roles of c-FLIP in Apoptosis, Necroptosis, and Autophagy. J Carcinog Mutagen, Suppl 6. Hopkins BD, Goncalves MD, Cantley LC (2016) Obes Cancer Mechanisms: Cancer Metabolism J Clin Oncol 34(35):4277–4283 Plati J, Bucur O, Khosravi-Far R (2011) Apoptotic cell signaling in cancer progression and therapy. Integr Biol (Camb) 3(4):279–296 Fulda S (2009) Apoptosis pathways and their therapeutic exploitation in pancreatic cancer. J Cell Mol Med 13(7):1221–1227 Wuilleme-Toumi S et al (2005) Mcl-1 is overexpressed in multiple myeloma and associated with relapse and shorter survival. Leukemia 19(7):1248–1252 Hursting SD et al (2012) Obesity, energy balance, and cancer: new opportunities for prevention. Cancer Prev Res (Phila) 5(11):1260–1272 Bhaskaran K et al (2014) Body-mass index and risk of 22 specific cancers: a population-based cohort study of 5.24 million UK adults. Lancet 384(9945):755–765 Calle EE et al (2003) Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U.S. adults. N Engl J Med 348(17):1625–1638 Ogden CL et al (2014) Prevalence of childhood and adult obesity in the United States, 2011–2012. JAMA 311(8):806–814 Kang YE et al (2016) The Roles of Adipokines, Proinflammatory Cytokines, and Adipose Tissue Macrophages in Obesity-Associated Insulin Resistance in Modest Obesity and Early Metabolic Dysfunction. PLoS ONE 11(4):e0154003 Renovato-Martins M et al (2020) Obese Adipose Tissue Secretion Induces Inflammation in Preadipocytes: Role of Toll-Like Receptor-4. Nutrients, 12(9) Long J, Zhang CJ, Zhu N, Du K, Yin YF, Tan X, Liao DF, Qin L (2018) Lipid metabolism and carcinogenesis, cancer development. Am J Cancer Res 8(5):778–791 Zhang L, Han L, He J, Lv J, Pan R, Lv T (2020) A high serum-free fatty acid level is associated with cancer. J Cancer Res Clin Oncol 146(3):705–710. 10.1007/s00432-019-03095-8 Epub 2019 Nov 26 Deng H, Zhou T, Mo X, Liu C, Yin Y (2019) Low-density lipoprotein promotes lymphatic metastasis of esophageal squamous cell carcinoma and is an adverse prognostic factor. Oncol Lett 17(1):1053–1061. 10.3892/ol.2018.9683 Epub 2018 Nov 9 Jin Y, Yang T, Li D, Ding W (2019) Effect of dietary cholesterol intake on the risk of esophageal cancer: a meta-analysis. J Int Med Res 47(9):4059–4068 Epub 2019 Aug 13 Yu H, Rohan T (2000) Role of the insulin-like growth factor family in cancer development and progression. J Natl Cancer Inst 92(18):1472–1489 Furstenberger G, Senn HJ (2002) Insulin-like growth factors and cancer. Lancet Oncol 3(5):298–302 Grimberg A (2003) Mechanisms by which IGF-I may promote cancer. Cancer Biol Ther 2(6):630–635 Larsson O, Girnita A, Girnita L (2005) Role of insulin-like growth factor 1 receptor signalling in cancer. Br J Cancer 92(12):2097–2101 Samani AA et al (2007) The role of the IGF system in cancer growth and metastasis: overview and recent insights. Endocr Rev 28(1):20–47 Zhao R, Macdonald K, Casson AG (2009) Insulin-like growth factor type I receptor gene expression and obesity in esophageal adenocarcinoma. Mol Carcinog 48(11):982–988 Doyle SL et al (2012) IGF-1 and its receptor in esophageal cancer: association with adenocarcinoma and visceral obesity. Am J Gastroenterol 107(2):196–204 Safa AR, Pollok KE (2011) Targeting the Anti-Apoptotic Protein c-FLIP for Cancer Therapy. Cancers (Basel) 3(2):1639–1671 Lee SJ et al (2011) Berberine sensitizes TRAIL-induced apoptosis through proteasome-mediated downregulation of c-FLIP and Mcl-1 proteins. Int J Oncol 38(2):485–492 Shirley S, Micheau O (2013) Targeting c-FLIP in cancer. Cancer Lett 332(2):141–150 Deveraux QL et al (1998) IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases. EMBO J 17(8):2215–2223 Boice A, Bouchier-Hayes L (2020) Targeting apoptotic caspases in cancer. Biochim Biophys Acta Mol Cell Res 1867(6):118688. 10.1016/j.bbamcr.2020.118688 Epub 2020 Feb 19 Marengo B et al (2011) Protein kinase C: an attractive target for cancer therapy. Cancers (Basel) 3(1):531–567 Shi C et al (2014) IL-6 and TNF-alpha induced obesity-related inflammatory response through transcriptional regulation of miR-146b. J Interferon Cytokine Res 34(5):342–348 Al-Roub A et al (2021) IL-1beta and TNFalpha Cooperativity in Regulating IL-6 Expression in Adipocytes Depends on CREB Binding and H3K14 Acetylation. Cells, 10(11) Cawthorn WP, Sethi JK (2008) TNF-alpha and adipocyte biology. FEBS Lett 582(1):117–131 Wang L, Du F, Wang X (2008) TNF-alpha induces two distinct caspase-8 activation pathways. Cell 133(4):693–703 Hayden MS, Ghosh S (2014) Regulation of NF-kappaB by TNF family cytokines. Semin Immunol 26(3):253–266 Schwabe RF, Luedde T (2018) Apoptosis and necroptosis in the liver: a matter of life and death. Nat Rev Gastroenterol Hepatol 15(12):738–752 Micheau O, Tschopp J (2003) Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell 114(2):181–190 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 12 Oct, 2024 Read the published version in Molecular Biology Reports → Version 1 posted Editorial decision: Revision requested 29 May, 2024 Reviews received at journal 11 Apr, 2024 Reviewers agreed at journal 08 Apr, 2024 Reviewers invited by journal 02 Apr, 2024 Editor assigned by journal 02 Apr, 2024 Submission checks completed at journal 01 Apr, 2024 First submitted to journal 30 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4193803","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":287655226,"identity":"fa20ecc0-b076-4a16-b217-65c79f65296c","order_by":0,"name":"Swati Agrawal","email":"","orcid":"","institution":"Creighton University","correspondingAuthor":false,"prefix":"","firstName":"Swati","middleName":"","lastName":"Agrawal","suffix":""},{"id":287655227,"identity":"e6325e8b-9bbe-47e6-a176-b77e3313b70a","order_by":1,"name":"Anna Podber","email":"","orcid":"","institution":"Creighton University","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"","lastName":"Podber","suffix":""},{"id":287655228,"identity":"77a03313-ba20-4fa6-8f27-a0c6177a54e9","order_by":2,"name":"Megan Gillespie","email":"","orcid":"","institution":"Creighton University","correspondingAuthor":false,"prefix":"","firstName":"Megan","middleName":"","lastName":"Gillespie","suffix":""},{"id":287655229,"identity":"fb2940b0-4a7e-46da-9e5d-0f376b48633f","order_by":3,"name":"Nick Dietz","email":"","orcid":"","institution":"Creighton University","correspondingAuthor":false,"prefix":"","firstName":"Nick","middleName":"","lastName":"Dietz","suffix":""},{"id":287655230,"identity":"857f0225-2351-4cd2-b0a7-0876d1354cb8","order_by":4,"name":"Laura A. Hansen","email":"","orcid":"","institution":"Creighton University","correspondingAuthor":false,"prefix":"","firstName":"Laura","middleName":"A.","lastName":"Hansen","suffix":""},{"id":287655231,"identity":"c7619534-ba60-4dfc-ba35-37dad98b920e","order_by":5,"name":"Kalyana C. Nandipati","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABUklEQVRIie3RwUrDMBgH8JRIdsnoNWXqM2QUdlH0VRoK28VBvQhD0cAgXnReO5z6Cg4vHlsC3aXqtcIO7cWTg4kgVae4rtNLO8+C/V/yJe0vX0gAKFLkD4Y6kCcj40k9LbCaTA3gpN9xllS5MiPbc0KxxlNCFhEdpKSVkKRr2gv8QmolV5DX643WyWm7L629ybI+uInC8G24r1a4Eo5EhqxjJrRj32zaQ8+StkdxzW/olHUeiNZzYPUshwAmSFnAJg+2qMRoSgKECDuShAYGqpSzpKZGQvsQB42LGfmkWLdRKZ6T0nsO0QkT062keZmQsqCYEoSAEaddYA6p2lF7bUUMzH5Qt2S3o2Pi1yFhXGpdm7W13m2G0DvTvR+JXXYemFfP1svqpnroKU/xRKoqMd3x4072lgFYIt8V/FlTZudJnywncJwlYLLg5yJFihT5j/kC3855xsMjS5QAAAAASUVORK5CYII=","orcid":"","institution":"Creighton University","correspondingAuthor":true,"prefix":"","firstName":"Kalyana","middleName":"C.","lastName":"Nandipati","suffix":""}],"badges":[],"createdAt":"2024-03-31 00:29:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4193803/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4193803/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11033-024-09931-6","type":"published","date":"2024-10-12T15:57:25+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":54190787,"identity":"97d4ef7d-58dc-412e-a1b4-15a917700e7b","added_by":"auto","created_at":"2024-04-05 20:29:43","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":272283,"visible":true,"origin":"","legend":"\u003cp\u003eHematoxylin and Eosin staining for normal, Barrett’s, and esophageal adenocarcinoma. Esophagus Biopsy of normal esophagus tissue (panel A) showing unremarkable stratified squamous esophageal mucosa. Esophageal biopsy showing columnar cell epithelium with goblet cell/intestinal metaplasia consistent with Barrett’s esophagus without dysplasia (panel B). Esophageal mass biopsy showing poorly differentiated esophageal adenocarcinoma (panel C). All images were taken at 200x magnification. These are the represented images from a total of 23 normal samples, 10 Barrett’s Esophagus samples, and 19 EAC samples.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4193803/v1/adfa23e29e89dfe7d04f3d9b.png"},{"id":54191185,"identity":"46f25560-4095-4fde-923b-00d74345430e","added_by":"auto","created_at":"2024-04-05 20:37:43","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":178701,"visible":true,"origin":"","legend":"\u003cp\u003eRT-PCR for proapoptotic (Bad, Bak, Bax), antiapoptotic (Bcl-2, Bcl-XL), protein kinase C delta (PKC-δ), cellular inhibitor of apoptosis 2 (cIAP2), FLICE-like inhibitory protein (FLIP), protein kinase B (Akt), insulin like growth factor 1 (IGF-1), proliferation marker Ki67, and nuclear factor kappa beta (NF-κB) in normal, BE, and EAC tissues. Data are presented as the mean ± SD (n=3; biological replicates). *p \u0026lt;0.05, **p\u0026lt;0.01, ***p \u0026lt;0.001 and ****p \u0026lt;0.0001. The data represents a total of 23 normal samples, 10 Barrett’s Esophagus samples, and 19 EAC samples.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4193803/v1/7a93d438e1fde34803f5d1af.png"},{"id":54190786,"identity":"26a0166a-280c-4820-bace-00a07ebedd49","added_by":"auto","created_at":"2024-04-05 20:29:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":902497,"visible":true,"origin":"","legend":"\u003cp\u003eImmunofluorescence staining for Bad, Bak, Bax, Bcl-2, Bcl-xL and PKC-δ in normal, BE, and EAC tissues. Data are presented as the mean ± SD (n=3 biological replicates). *p \u0026lt;0.05, **p\u0026lt;0.01, ***p \u0026lt;0.001 and ****p \u0026lt;0.0001. These are representable images from a total of 23 normal samples, 10 Barrett’s Esophagus samples, and 19 EAC samples.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4193803/v1/0be1a6500b8b806cc65c3daf.png"},{"id":54190784,"identity":"7a5d4492-2d26-4caf-828a-af3de2a3aff9","added_by":"auto","created_at":"2024-04-05 20:29:43","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":872566,"visible":true,"origin":"","legend":"\u003cp\u003eImmunofluorescence for cIAP2, FLIP, IGF-1, Akt, NF-κB, and Ki67 in normal, BE, and EAC tissues.\u003cstrong\u003e \u003c/strong\u003eData are presented as the mean ± SD (n=3 biological replicates). *p \u0026lt;0.05, **p\u0026lt;0.01, ***p \u0026lt;0.001 and ****p \u0026lt;0.0001. These are representable images from a total of 23 normal samples, 10 Barrett’s Esophagus samples, and 19 EAC samples.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4193803/v1/20cbc5550d4a12bf1e91a0aa.png"},{"id":54190789,"identity":"92399af2-044d-4bff-99c7-7794668a63ba","added_by":"auto","created_at":"2024-04-05 20:29:43","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":169412,"visible":true,"origin":"","legend":"\u003cp\u003eRT-PCR for proapoptotic (Bad, Bak, Bax), antiapoptotic (Bcl-2, Bcl-XL), protein kinase C delta (PKC-δ), cellular inhibitor of apoptosis 2 (cIAP2), FLICE-like inhibitory protein (FLIP), protein kinase B (Akt), insulin like growth factor 1 (IGF-1), proliferation marker Ki67, and nuclear factor kappa beta (NF-κB) in normal and EAC tissues of obese and non-obese subjects. Data are presented as the mean ± SD (n=3 biological replicates). *p \u0026lt;0.05, **p\u0026lt;0.01, ***p \u0026lt;0.001 and ****p \u0026lt;0.0001. The data represents a total of 23 normal samples, 10 Barrett’s Esophagus samples, and 19 EAC samples.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4193803/v1/c7e777cc300d184dea0ed07a.png"},{"id":54190788,"identity":"ec08b1f4-9aaa-44b3-8554-9a8e48e07277","added_by":"auto","created_at":"2024-04-05 20:29:43","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":102265,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of the regulation of apoptosis involving cIAP2 and FLIP and their involvement in obesity associated esophageal adenocarcinoma.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4193803/v1/2e705d4739f294c26a8e190d.png"},{"id":66597499,"identity":"576b31e6-504f-4e27-9ced-00a18bd5dc5e","added_by":"auto","created_at":"2024-10-14 16:10:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3036475,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4193803/v1/10fe37fb-e866-44d0-89f9-d31abe1af2f5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Regulation of Pro-apoptotic and Anti-apoptotic Factors in Obesity-Related Esophageal Adenocarcinoma","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEsophageal cancer ranks eighth in the global cancer incidence and considered to be the sixth most lethal cancer [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The adenocarcinoma of the esophagus has been on the rise and became the most prevalent subtype in the West [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The rise in esophageal adenocarcinoma (EAC) is attributed largely to the obesity epidemic and reflux disease. Despite recent advances in treatment, the five-year survival rate for EAC remains low at 20.1% [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This growing incidence and persistently low survival rate underscore the need for more research into the molecular pathways of EAC to pave the way for better therapeutic options. Notably, obesity, a risk factor for EAC, has been associated with increased stress-related apoptosis and programmed cell death [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eObesity-associated free fatty acids (FFA) changes can lead to increased expression of insulin growth factor-1 (IGF-1) and diacylglycerol (DAG). DAG enhances the expression of protein kinase C δ (PKC-δ), a serine-threonine kinase that acts as a pleiotropic regulator of cell proliferation, differentiation, and survival [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. EAC cells can circumvent apoptosis through an obesity-induced IGF1-DAG-PKC-δ pathway, or independently of the PKC-δ pathway via modifications to downstream regulators. One proposed mechanism of such downstream regulation is believed to be mediated by the cellular inhibitor of apoptosis 2 (cIAP2) and cellular FLICE-inhibitory proteins (c-FLIP).\u003c/p\u003e \u003cp\u003ec-FLIPs are considered mediators of anti-apoptotic pathways, inhibiting programmed cell death. Similarly, human IAPs, including cIAP1, cIAP2, and XIAP, regulate apoptosis by negatively regulating ripoptosomes and activating apoptotic and necroptotic cell death responses [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In esophageal squamous cell cancers, cIAP2 expression is higher in cancerous tissue compared to normal mucosa [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], suggesting a potential association with cancer progression [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. However, the interaction between PKC-δ and downstream signaling involving apoptotic inhibitory proteins (cIAP2 and c-FLIP), which may play a pivotal role in malignant cell proliferation, has not been thoroughly investigated in EAC (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The aim of our study is to discern the relationship between PKC-δ and downstream cIAP2 and c-FLIP, and to determine the impact of this relationship on apoptosis in EAC.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003ePatient selection\u003c/h2\u003e\n \u003cp\u003eThis prospective study received approval from the Institutional Review Board (IRB) of Creighton University (IRB No. 1194896). Following IRB approval, informed consent was obtained, and 23 patients were recruited from the surgery clinics at Creighton University Medical Center and CHI Health Immanuel Medical Center. The inclusion criteria encompassed patients aged 19 or older with a clinical diagnosis of esophageal cancer, which was confirmed through endoscopic inspection of the esophagus complemented by esophageal histology. The exclusion criteria ruled out patients aged 18 or younger, those unwilling to participate in the study, and biopsies that did not confirm EAC. During the study, 23 normal tissue samples (from regular esophageal lining), 10 Barrett\u0026rsquo;s Esophagus samples, and 19 EAC samples were collected, either during esophageal endoscopy or from patients undergoing esophagectomy. Patient weight was recorded either at the time of the endoscopy or surgery. Obesity was defined as a BMI greater than 30 kg/m\u003csup\u003e2\u003c/sup\u003e. Demographics and clinical data were sourced from patient charts. We collected variables such as age, sex, body mass index (BMI), EAC staging, medication usage, smoking and alcohol consumption history, and co-morbid conditions. A power analysis determined the sample size among groups based on BMI, achieving a power (1-\u0026beta;) of 95% and \u0026alpha; set at 0.05. The minimum number of samples required in each group to achieve statistical significance between groups was identified as 10.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003eTissue collection and processing\u003c/h2\u003e\n \u003cp\u003eEsophageal tissue biopsies, both from tumor and non-tumor regions, were obtained during endoscopy or surgery. These samples were promptly transported to the Creighton University lab in either formalin, University of Wisconsin solution, or RNA later solution, and they were kept at 4\u0026deg;C. Tissue samples preserved in RNA later were stored at -80\u0026deg;C for RNA isolation. A board-certified pathologist assessed each tissue sample to determine the presence or absence of EAC. For histological analysis, a segment of each esophageal tissue sample was preserved in 10% buffered formalin for 24 hours. Subsequently, the tissue samples underwent processing with the Excelsior ES tissue processor (Thermo Scientific, USA) through various cycles of dehydration in ethanol baths, followed by paraffin baths. The tissues were then embedded in paraffin blocks. Thin tissue sections, measuring 5\u0026micro;m, were cut using a Leica RM 2135 microtome and then mounted on glass slides. These slides were placed in a 72\u0026deg;C oven to melt the paraffin wax, a process that lasted for 20 minutes.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003eHematoxylin and eosin stain\u003c/h2\u003e\n \u003cp\u003eHematoxylin and Eosin (H\u0026amp;E): staining was performed following the standard protocol in our laboratory. Briefly, the tissue sections on the slides were de-paraffinized, rehydrated in ethanol, rinsed in double-distilled water, and stained with hematoxylin for 45 seconds and with eosin for 30seconds. The stained sections were mounted with a xylene-based mounting medium and a coverslip was placed over the tissue. The stained tissue sections were examined under a light microscope (Leica DM6) and the images were scanned with a scale of 100\u0026micro;m. We stained at least three adjacent sections from each tissue and three images were scanned from each section for analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003eImmunofluorescence assays\u003c/h2\u003e\n \u003cp\u003eAt the Creighton University laboratory, samples were prepared as per standard protocol for immunofluorescence assays via deparaffinization and rehydration. Antigen retrieval was performed by heating the section in DAKO Target Retrieval solution for 1 hour. Briefly, after antigen retrieval, the slides were cooled down to room temperature and washed with 1X phosphate buffered saline (PBS) three times for 5 minutes each. This was followed by blocking the nonspecific antigens with blocking buffer for one hour at room temperature followed by the incubation with primary antibodies, rabbit anti-Bad (ab45782), rabbit Anti-Bak (ab32371), rabbit Anti- Bax (ab32503), rabbit Anti-Bcl-2 (ab32124), rabbit Anti- Bcl- XL (ab32370), rabbit Anti-PKC-𝛿 (ab182126), rabbit Anti- Akt (ab8805), rabbit Anti-cIAP2 (ab23423), rabbit Anti-IGF1 (ab182408), rabbit Anti-FLIP (ab 8421), and rabbit Anti- NF-\u0026kappa;B (ab131109) and rabbit Anti-Ki67 (ab16667) overnight at 4\u003csup\u003e0\u003c/sup\u003eC in a dilution of 1:100. This was followed by PBS wash 3 times 5 minutes each and incubation with donkey anti rabbit Alexa Fluor 488 (green) Invitrogen A32790 Thermo Fisher Scientific conjugated secondary antibodies at 1:500 dilutions for 1 hour at room temperature. The sections were washed with PBS while gently shaking. Nuclear staining was done with 4\u0026prime;,6-diamidino-2-phenylindole (DAPI). The slides were mounted with Antifade Gold reagent containing DAPI (H-1200; Vectashield, Vector labs). The slides were scanned with Nikon inverted fluorescent microscope at 100\u0026micro;m. A minimum of three scanned images from each sample was used to estimate the fluorescence intensity using ImageJ (NIH) software and mean fluorescence intensity (MFI) was analyzed for each protein of interest. The fluorescence intensity measurement and MFI calculations were cross checked by two blinded reviewers.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003eRNA isolation, cDNA preparation, and Real-Time PCR\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eTotal RNA was isolated using TRI reagent (T9424, Sigma, St Louis, MO, USA). The yield of total RNA was measured using NanoDrop One (Thermo Fisher Scientific, USA). Further, the cDNA was synthesized using iScript cDNA synthesis kit (1708891 BioRad) and Real-Time PCR (RT-PCR) was performed in triplicate using SYBR Green Master Mix (#1708880, BioRad) using Real Time cycler (Applied Biosystems 7500 Fast Dx Real-Time PCR). The cycling conditions were 5 minutes at 95\u0026deg;C for initial denaturation, 40 cycles of 30seconds at 95\u0026deg;C, 30s at 55\u0026ndash;60\u0026deg;C (based on primer annealing temperatures), and 30seconds at 72\u0026deg;C followed by melting curve analysis. The primers for \u003cem\u003eBad, Bak, Bax, Bcl-2, Bcl-XL, PKC-𝛿, Akt, cIAP2, IGF1, FLIP\u003c/em\u003e, and\u0026nbsp;\u003cem\u003eNF-\u0026kappa;B\u003c/em\u003e were obtained from Integrated DNA Technologies (Coralville, Iowa 52241.USA) and the forward and reverse nucleotide sequences are given in Table 1.\u0026nbsp;\u003cbr\u003eTable 1: Forward and reverse nucleotide sequence of the primers used in RT-PCR\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Taba\" border=\"1\"\u003e\n \u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDirection\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eBax\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-CCCGAGAGGTCTTTTTCCGAG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-CCAGCCCATGATGGTTCTGAT-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eBak\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-TGCTAGTGCCCTCTCTCTGG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-GTGGGAATGGGCTCTCACAA-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eBcl-2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-TCGCCCTGTGGATGACTGA-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-CAGAGACAGCCAGGAGAAATCA-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eBcl-xL\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-TAAGGCGGATTTGAATCTC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-ATAATAGGGATGGGCTCAAC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eBad\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026apos;-TAAGAAGGGACTTCCTCGCC-3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026apos;-GTTCCGATCCCACCAGGACT-3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003ePKC-𝛿\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-GCATCTCCACGGAACGAC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-CCACCTCCACCTTCTCAACT-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eAkT1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-GGAGGTTTTTGGGCTTGCG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-CTCTGATGCACCAGCTGACA-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003ecIAP2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-GCTTTTGCTGTGATGGTGGACTC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;-CTTGACGGATGAACTCCTGTCC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eIGF1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;ACACAATCTGCCTCCCTCATTT3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;AGTCCCTTCAGGGGCTTTCA3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eFLIP\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;AGTGAGGCGATTTGACCTGCTC3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;\u0026nbsp;CCTCACCAATCTCTGCCATCAG3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eNF-\u0026kappa;B\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026rsquo;-GACTACGACCTGAATGCTGTG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026rsquo;-GTCAAAGATGGGATGAGGAAGG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eKi67\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026rsquo;-CTTTGG GTG CGA CTT GAC G-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026rsquo;-GTCGACCCCGCTCCTTTT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026beta;-actin\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026rsquo;-CCTGGCACCCAGCACAAT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026rsquo;-GCCGATCCACACGGAGTACT-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eData is presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Data was analyzed using GraphPad Prism 9. The comparison between two groups for the expression of the protein of interest was performed using One-way ANOVA with Bonferroni\u0026rsquo;s post-hoc correction. A probability (\u003cem\u003ep\u003c/em\u003e) value of \u0026lt;\u0026thinsp;0.05 was accepted as statistically significant. *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001 and ****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003ePatient demographics are listed in table and noted to have male predominance. (Table\u0026nbsp;2)\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabb\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePatient Demographics (n\u0026thinsp;=\u0026thinsp;23)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMean (range)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e63 years (48\u0026nbsp;year \u0026minus;\u0026thinsp;80\u0026nbsp;year)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e19 males\u003c/p\u003e \u003cp\u003e4 females\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBMI - mean (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27.83 kg/m\u003csup\u003e2\u003c/sup\u003e (19.76\u0026ndash;40.5)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEAC staging\u003c/p\u003e \u003cp\u003eStage I\u003c/p\u003e \u003cp\u003eStage II%\u003c/p\u003e \u003cp\u003eStage III\u003c/p\u003e \u003cp\u003eStage IV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4%\u003c/p\u003e \u003cp\u003e13%\u003c/p\u003e \u003cp\u003e52\u003c/p\u003e \u003cp\u003e14%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCurrent or Prior BE (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e43.5%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCurrent Proton Pump Inhibitor use (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e87%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTobacco use (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e91.3%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAlcohol use (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e56.5%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eHematoxylin and eosin (H\u0026amp;E) staining revealed increased inflammation, fibrosis, moderately differentiated lesions in EAC. (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe fold change in mRNA expression of pro-apoptotic factors were decreased while of anti-apoptotic factors were increased in esophageal adenocarcinoma compared to control\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe RT-qPCR results showed a decreased fold change in mRNA expression of pro-apoptotic markers Bad, Bak and Bax in Barrett\u0026rsquo;s Esophagus and EAC as compared to the normal esophagus. The fold changes in mRNA expression of Bad and Bak were significantly decreased in BE (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.003; 0.60 vs 1.13 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.009; 0.25 vs 0.83) and in EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.005; 0.63 vs 1.13 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.008; 0.42 vs 0.83) compared to the normal. Similarly, the fold change in mRNA expression of Bax was also significantly decreased in both BE (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.005; 0.30 vs 1.02) and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.03; 0.62 vs 1.02) compared to normal tissue. There were no significant differences between the fold changes in mRNA expression of Bad, Bak and Bax between BE and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.83, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.29 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.08). (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e panel A)\u003c/p\u003e \u003cp\u003eThe RT-qPCR results showed significantly increased fold change in mRNA expression of anti-apoptotic markers Bcl2 and Bcl-xL respectively in BE (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.04; 2.97 vs 1.42 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.13; 1.72 vs 1.41) and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.05; 2.91 vs 1.42 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.10; 1.82 vs 1.41) as compared to the normal esophagus. There were no significant differences between the fold changes in mRNA expression of Bcl2 and BcL-xL between BE and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.86; and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.61). (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e panel A). Overall, the results showed decreased expression of apoptotic factors and increased expression of anti-apoptosis factors, which impair apoptosis and contributes to BE and EAC carcinogenesis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRT-PCR showed increased mRNA expression of PKC-δ, IGF-1, Akt, NF-κB, cIAP2, FLIP, and Ki67 in BE and EAC compared to normal tissue samples.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe qRT-PCR analysis revealed significantly increased folds change in mRNA expression of PKC-δ, IGF-1, Akt, NF-κB, cIAP2, and FLIP and proliferation marker Ki67 in BE and EAC compared to normal tissue. The folds change in mRNA expression of PKC-δ was significantly increased in EAC compared to normal (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.04; 4.91 vs 3.04) and increased in BE (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.11; 4.76 vs 3.04). However, there was no significant difference between the BE and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.88; 4.76 vs 4.91). (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e panel A)\u003c/p\u003e \u003cp\u003eThe fold change in mRNA expression of IGF-1 was significantly higher in BE (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.009; 1.02 vs 3.44) and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001; 3.45 vs 1.02) as compared to normal tissues. There was no significant difference between BE and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.99; 3.445 vs 3.449). (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e panel B) The fold change in mRNA of Akt showed significantly higher expression in BE as compared to normal (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.03; 1.71 vs 0.99) and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.03; 2.34 vs 0.99). There was no significant difference between BE and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.17; 1.70 vs 2.34) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e panel B). The fold change in mRNA of NF-κB was significantly increased in BE (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.02; 3.56 vs 1.75) and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.007; 2.62 vs 1.75) as compared to normal while there was no significant difference between BE and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.15; 3.56 vs 2.62) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e panel B). The mRNA expression of Ki67 was significantly increased in BE (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01; 2.84 vs 1.07) and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0004; 2.49 vs 1.07) as compared to normal tissues. However, there was no significant difference between BE and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.46; 2.84 vs 2.49). (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e panel B)\u003c/p\u003e \u003cp\u003eThe folds change in mRNA expression of cIAP2 was significantly increased in EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.003; 4.37 vs 1.21) but was not significant in BE (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.19; 1.98 vs 1.21) when compared to the normal tissues. The folds change in mRNA expression was significantly increased between BE and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.02; 1.98 vs 4.34). The fold change in mRNA expression for FLIP was significantly increased in BE and (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01; 1.75 vs 0.88) EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.05; 1.78 vs 0.88) when compared to the normal tissues samples while there was no significance difference noted between BE and EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.96) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e panel B).\u003c/p\u003e \u003cp\u003e \u003cb\u003eImmunofluorescence showed decreased immunopositivity for pro-apoptotic mediators Bad, Bak, and Bax while there was increased immunopositivity for anti-apoptotic factors Bcl-2 and Bcl-xL and PKC-δ in EAC.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eImmunofluorescence showed decreased immunopositivity for proapoptotic factors Bad, Bak and Bax in EAC and BE tissues compared to normal. (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e panels A, B, C, D, E, F, G, H, and I). The mean fluorescent intensity (MFI) for Bad was significantly decreased in BE and EAC compared to normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e panel S) and MFI for Bak and Bax was significantly decreased in EAC compared to normal (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e panel S). The decreased immunopositivity of Bad, Bak, and Bax in BE and EAC as compared to normal control suggests that proapoptotic factors are downregulated during EAC tumorigenesis. The immunopositivity of anti-apoptotic factors Bcl-2 and Bcl-xL was increased in EAC as compared to BE and normal esophagus (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e panels J, K, L, M, N, and O). The IF of PKC-δ showed increased immunopositivity in EAC as compared to BE and normal (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e panels P, Q, and R). The MFI of Bcl-2, Bcl-xL, and PKC-δ was significantly higher in BE and EAC compared to normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e panel S).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eImmunofluorescence showed increased immunopositivity for cIAP2, FLIP, IGF-1, Akt, NF-κB, and Ki67 in esophageal adenocarcinoma.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eImmunopositivity of Akt, IGF-1, NF-κB, and Ki-67 was increased in EAC compared to BE and normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e panels A, B, C, D, E, F, G, H, I, J, K and L). The MFI of Akt was significantly increased in BE and EAC compared to normal tissue and in EAC compared to BE (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e panel S). The MFI for IGF-1 and NF-κB was significantly increased in BE and EAC compared to normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e panel S) while the MFI for Ki-67 was significantly increased in BE and EAC compared to normal tissue and in EAC compared to BE (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e panel S). The immunopositivity for cIAP2 and FLIP was increased in BE and EAC as compared to normal esophagus (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e panel M, N, O, P, Q, and R). The MFI for cIAP2 and FLIP was significantly increased in BE and EAC compared to normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e panel S). These results indicate the association of increased expression of PKC-δ, FLIP, and cIAP2 in EAC as compared to normal and BE.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eObesity is associated with an increased folds changes in mRNA expression of proapoptotic factors, antiapoptotic factors, PKC-δ, IGF-1, Akt, and Ki-67 and decreased folds change in cIAP2 and FLIP in normal tissues.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eRT-PCR analysis revealed that the fold change in mRNA expression of Bad, Bax, and Bcl-2 was significantly elevated in normal tissue samples of the obese group compared to nonobese group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.003, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.039, and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.032) respectively. However, it was not significantly increased in Bak and Bcl-xL (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.16 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.19) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e panel A). The folds change in mRNA expression of IGF-1, Akt, and Ki-67 was significantly increased (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.04, and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001 respectively) while the expression of NF-kB was not significantly increased (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.31) in obese compared to non-obese population normal tissue samples. Surprisingly, the folds change in mRNA expression of cIAP2 and FLIP was significantly decreased (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.008 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0008) in obese compared to non-obese normal samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e panel A).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eObesity is associated with decreased expression of proapoptotic genes, cIAP2, and FLIP while increased expression of antiapoptotic genes, PKC-δ, Akt, IGF-1, Ki-67, and NF-κB in EAC tissues.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe folds change in mRNA expression of proapoptotic genes Bad, Bak and Bax was significantly decreased (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.008 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.03 respectively) in obese patients with EAC compared to non-obese EAC tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e panel B). The fold change in mRNA expression of Bcl-2 was significantly increased in obese EAC (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01) patients compared to non-obese EAC. While increased folds change in mRNA expression of Bcl-XL in obese EAC patients was not statistically significant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.07). The fold change in mRNA expression of PKC-δ, Akt, IGF-1, and NF-kB was significantly increased (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.04, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.05, and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.05 respectively) in obese EAC patients compared to non-obese EAC tissues. Surprisingly, the fold change in mRNA expression of cIAP2 and FLIP were significantly decreased (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.01 and \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.005 respectively) in obese EAC patients as compared non-obese EAC tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e panel B). These findings suggest the association of obesity with EAC tumorigenesis.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eObesity has been identified as a significant risk factor for esophageal cancer. Alterations in the expression of anti-apoptotic and pro-apoptotic genes have been proposed as one of the mechanisms [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Our study found increased expression of anti-apoptotic genes (Bcl-2 and Bcl-xL) and upstream apoptosis regulators (cIAP2 and FLIP), along with decreased expression of pro-apoptotic genes (Bad, Bax, and Bak), in both Barrett's esophagus (BE) and esophageal adenocarcinoma (EAC) tissues compared to normal tissues from obese patients. The interplay between pro-apoptotic and anti-apoptotic genes has long been recognized as a crucial aspect of carcinogenesis. Apoptotic signaling plays a vital role in maintaining a balance between cell death and survival, as well as preserving genome integrity. Dysregulation of apoptotic and anti-apoptotic factors stands out as a prominent characteristic of cancer [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The overexpression of anti-apoptotic BCL-2 family proteins is frequently observed in cancer cells [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Moreover, the overexpression of anti-apoptotic proteins has been associated with cancer recurrence, poor prognosis, and resistance to cancer therapeutics [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Our results also revealed increased levels of pro-apoptotic factors and dysregulated apoptosis, particularly in EAC tissues compared to normal tissues. These findings indicate that dysregulated apoptosis could be a significant underlying mechanism in the development and progression of EAC. However, the specific regulation of pro-apoptotic and anti-apoptotic factors, particularly in the context of obesity induced EAC development, remains elusive.\u003c/p\u003e \u003cp\u003eObesity has emerged as a significant risk factor for cancer, with approximately 20% of all cancer cases attributed to excess weight [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. It was estimated that around half of cancers in postmenopausal women can be linked to obesity [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Obesity has been associated with several types of cancer, including endometrial cancer, colorectal cancer, postmenopausal breast cancer, prostate cancer, renal cancer, and esophageal adenocarcinoma (EAC). [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] In addition to these associations, obesity has been shown to contribute to tumor growth and progression due to increased levels of free fatty acids and dietary lipids [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The relationship between obesity and changes in apoptotic factors, particularly the overexpression of anti-apoptotic factors and the inhibition of proapoptotic factors, in cases of Barrett's esophagus (BE) and esophageal adenocarcinoma (EAC) among obese patients compared to non-obese individuals indicates the importance of elevated levels of free fatty acids and dietary lipids, as well as the imbalance in apoptotic factors, in the development of obesity-induced BE and EAC [\u003cspan additionalcitationids=\"CR25 CR26\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe precise biological mechanisms underlying the association between obesity and malignancy remain elusive; however, alterations in the IGF-axis have been proposed as a potential mechanism for carcinogenesis [\u003cspan additionalcitationids=\"CR29 CR30 CR31\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Focal adhesions kinase (FAK) is a nonreceptor-type tyrosine kinase that regulates integrin and growth factor signaling pathways. To investigate this further, Zhao et al treated EAC cell lines with TAE226, a dual inhibitor for IGF and focal adhesion kinase (FAK) [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The treatment of EAC cell lines with TAE226 resulted in the inhibition of cellular proliferation, migration, and adhesion, accompanied by enhanced caspase-mediated apoptosis [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Our study revealed increased levels of IGF-1 in BE and EAC obese tissues, increased expression of Ki-67 (a marker of cell proliferation) in BE and EAC tissues, and decreased proliferation and migration of EAC cells with IGF1 inhibition. These findings suggest a robust relationship between obesity and EAC carcinogenesis and are consistent with the notion that insulin, insulin resistance, and insulin-like growth factor (IGF)-1 play significant roles in cell proliferation, differentiation, and apoptosis, contributing to carcinogenesis. This makes them intriguing targets for cellular studies linking obesity and cancer [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] as well as for therapeutics. However, the precise molecular mechanisms and downstream signaling pathways involved in this relationship warrant further investigations.\u003c/p\u003e \u003cp\u003eElevated levels of IGF-1 in obesity and the subsequent dysregulation of downstream signaling pathways have been implicated in cancer progression, particularly in squamous cell carcinoma of the esophagus [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Recently, certain downstream cell cycle regulators such as c-FLIP and cIAP2 have been identified in various cancers [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Studies have reported that the downregulation of c-FLIP can restore apoptosis mediated by TRAIL and CD95L, making c-FLIP a promising target for cancer therapy. Combining c-FLIP inhibition with other treatments, such as TRAIL or conventional chemotherapy, could enhance its effectiveness [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. c-FLIP has been identified as a key negative regulator of apoptosis in human cancer cells, and its expression is controlled by several transcription factors, including AP-1 (c-Fos and c-Jun), CREB, SP1, and NF-kB. In our study, we observed increased expression of c-FLIP and cIAP2 in both Barrett's Esophagus (BE) and EAC tissues compared to normal tissues, which was accompanied by decreased expression of pro-apoptotic markers Bax, Bak, and Bad (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). These findings suggest a negative association between increased c-FLIP and cIAP2 expression and the expression of pro-apoptotic genes. One possible underlying mechanism is the inhibition of caspase-8 mediated apoptosis [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e](Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). It is worth noting that the role of c-FLIP and cIAP2 in esophageal adenocarcinoma patients has not been extensively studied in the literature and investigating the regulatory role of cFLIP and cIAP2 in apoptosis in the context of EAC may be helpful in designing better therapeutics for EAC (35, 39).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eProtein kinase C (PKC), a family of phospholipid-dependent serine/threonine protein kinases, regulates a wide variety of cellular functions, including cell proliferation, differentiation, and cell death [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Our results showed overexpressed PKC-δ in BE and EAC compared to the normal tissues in obese patients compared to nonobese patients. This suggests that increased PKC-δ which regulates cFLIP and cIAP2 expression through NF-κB, is associated with EAC progression in obesity. Our results are unique since increased PKC-δ expression and its correlation with cFLIP and cIAP2 expression in obesity has not been reported widely in the literature.\u003c/p\u003e \u003cp\u003eThe secretion of inflammatory cytokines (IL-1, IL-6, and TNF-α) from infiltrated immune cells, mainly macrophages, is associated with obesity [\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] and may exert control over apoptotic mediators through upstream regulation of cIAP2 and FLIP. In our study, we also investigated the expression of NF-κB, a transcription factor that is activated by cytokines secreted in obesity (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Our findings revealed an increased expression of NF-κB in both BE and EAC tissues, along with cFLIP and cIAP2, suggesting that the upregulation of inflammatory cytokines, TNF-α primarily, activates cFLIP and cIAP2. Moreover, TNF-α triggers the activation of caspase-8 and NF-κB [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], which subsequently activate apoptosis, cFLIP, and cIAP2 through independent pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). TNF-α simultaneously stimulates pro-apoptotic and anti-apoptotic signals, and cellular death occurs when the anti-apoptotic signals, mainly mediated by NF-κB activation, are suppressed [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e](Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). However, further in vitro studies are necessary, involving the blocking of complex I [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] and complex II and stimulation with TNF-α, to provide additional support for the molecular mechanisms involved for EAC tumorigenesis and the histological findings presented in this study.\u003c/p\u003e \u003cp\u003eAdditionally, besides NF-κB, the stimulation of growth factors or activation of other pathways, such as mitogen-activated protein kinase (MAPK) and the phosphatidylinositol-3 kinase (PI3K)/Akt, can induce the expression of c-FLIP and hinder apoptosis triggered by death receptors [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Notably, our findings revealed a noteworthy upregulation of cytoplasmic kinase Akt expression in the tissues of BE and EAC from obese patients. These results further strengthen the hypothesis that inflammatory signaling activation in obesity regulates apoptosis through the activation of cIAP2 and FLIP. Consequently, targeting cIAP2 and FLIP holds potential as a therapeutic approach for EAC. It is important to acknowledge the limitations of our study, including a small sample size and a lack of in-vitro studies to establish a direct causal relationship between PKC-δ and apoptotic pathways. Nevertheless, our results demonstrate significantly elevated levels of PKC-δ, cIAP2, and FLIP in BE and EAC patients compared to normal esophageal tissues from obese patients pave the way to investigate the role of cIAP2, and FLIP in EAC and therapeutic potential of targeting these molecules.\u003c/p\u003e \u003cp\u003eIn summary, our study provides evidence of dysregulation in apoptotic factors in BE and EAC associated with obesity. The overexpression of anti-apoptotic factors, suppression of pro-apoptotic factors, and alterations in the IGF axis and PKC-δ suggest potential mechanisms underlying the association between obesity and EAC. Furthermore, the involvement of NF-κB, c-FLIP, and cIAP2 in obesity-associated EAC warrants further investigation. These findings contribute to a better understanding of the molecular pathways involved in obesity-induced esophageal cancer and may offer insights into potential therapeutic targets.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003ePKC-δ is significantly overexpressed in BE and EAC tissues. Our results also showed significant association between the expression of apoptotic regulators cIAP2 and FLIP with BE and EAC. Since, dysregulated programmed cell death is associated with carcinogenesis, targeting apoptosis via cIAP2 and FLIP seems to be a promising strategy to attenuate the progression of BE and EAC.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eEsophageal Adenocarcinoma (EAC), Barrett’s Esophagus (BE), Protein Kinase B (Akt), Cellular Inhibitor of Apoptosis 2 (cIAP2), Protein Kinase C delta (PKC δ), Tumor Necrosis Factor alpha (TNF-α), interleukin (IL), CASP8 and FADD-like apoptosis regulator (cFLIP), insulin like growth factor (IGF)-1, nuclear factor kappa beta (NF-κB), mitogen-activated protein kinase (MAPK), and phosphatidylinositol-3 kinase (PI3K).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSampath Poreddy MD.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSource of funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThis study was supported by the Department of Surgery Creighton University Omaha, NE USA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026ldquo;The authors have no relevant financial or non-financial interests to disclose.\u0026rdquo;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Institutional Review Board (IRB) of Creighton University\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBray F et al (2018) Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 68(6):394\u0026ndash;424\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsophageal cancer: epidemiology, pathogenesis and prevention. Nat Clin Pract Gastroenterol Hepatol, (2008) 5(9): p. 517\u0026ndash;526\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRunge TM, Abrams JA, Shaheen NJ (2015) Epidemiology of Barrett's Esophagus and Esophageal Adenocarcinoma. Gastroenterol Clin North Am 44(2):203\u0026ndash;231\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlucher C, Stadler SC (2017) Obesity and Breast Cancer: Current Insights on the Role of Fatty Acids and Lipid Metabolism in Promoting Breast Cancer Growth and Progression. Front Endocrinol (Lausanne) 8:293\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHotamisligil GS et al (1995) Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and insulin resistance. J Clin Invest 95(5):2409\u0026ndash;2415\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePfeffer CM, Singh ATK (2018) Apoptosis: A Target for Anticancer Therapy. Int J Mol Sci, 19(2)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe J (2013) Mechanisms of insulin resistance in obesity. Front Med 7(1):14\u0026ndash;24\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKolczynska K et al (2020) Diacylglycerol-evoked activation of PKC and PKD isoforms in regulation of glucose and lipid metabolism: a review. Lipids Health Dis 19(1):113\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLei Z et al (2018) PKCdelta reveals a tumor promoter function by promoting cell proliferation and migration in somatotropinomas. Int J Clin Exp Pathol 11(1):208\u0026ndash;215\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilke J, Meier P (2013) Inhibitor of apoptosis (IAP) proteins-modulators of cell death and inflammation. Cold Spring Harb Perspect Biol, 5(2)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJan R, Chaudhry GE (2019) Understanding Apoptosis and Apoptotic Pathways Targeted Cancer Therapeutics. Adv Pharm Bull 9(2):205\u0026ndash;218\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsposito I et al (2007) Overexpression of cellular inhibitor of apoptosis protein 2 is an early event in the progression of pancreatic cancer. J Clin Pathol 60(8):885\u0026ndash;895\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSafa AR (2013) Roles of c-FLIP in Apoptosis, Necroptosis, and Autophagy. J Carcinog Mutagen, Suppl 6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHopkins BD, Goncalves MD, Cantley LC (2016) Obes Cancer Mechanisms: Cancer Metabolism J Clin Oncol 34(35):4277\u0026ndash;4283\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlati J, Bucur O, Khosravi-Far R (2011) Apoptotic cell signaling in cancer progression and therapy. Integr Biol (Camb) 3(4):279\u0026ndash;296\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFulda S (2009) Apoptosis pathways and their therapeutic exploitation in pancreatic cancer. J Cell Mol Med 13(7):1221\u0026ndash;1227\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWuilleme-Toumi S et al (2005) Mcl-1 is overexpressed in multiple myeloma and associated with relapse and shorter survival. Leukemia 19(7):1248\u0026ndash;1252\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHursting SD et al (2012) Obesity, energy balance, and cancer: new opportunities for prevention. Cancer Prev Res (Phila) 5(11):1260\u0026ndash;1272\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhaskaran K et al (2014) Body-mass index and risk of 22 specific cancers: a population-based cohort study of 5.24 million UK adults. Lancet 384(9945):755\u0026ndash;765\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalle EE et al (2003) Overweight, obesity, and mortality from cancer in a prospectively studied cohort of U.S. adults. N Engl J Med 348(17):1625\u0026ndash;1638\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOgden CL et al (2014) Prevalence of childhood and adult obesity in the United States, 2011\u0026ndash;2012. JAMA 311(8):806\u0026ndash;814\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang YE et al (2016) The Roles of Adipokines, Proinflammatory Cytokines, and Adipose Tissue Macrophages in Obesity-Associated Insulin Resistance in Modest Obesity and Early Metabolic Dysfunction. PLoS ONE 11(4):e0154003\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRenovato-Martins M et al (2020) Obese Adipose Tissue Secretion Induces Inflammation in Preadipocytes: Role of Toll-Like Receptor-4. Nutrients, 12(9)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLong J, Zhang CJ, Zhu N, Du K, Yin YF, Tan X, Liao DF, Qin L (2018) Lipid metabolism and carcinogenesis, cancer development. Am J Cancer Res 8(5):778\u0026ndash;791\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Han L, He J, Lv J, Pan R, Lv T (2020) A high serum-free fatty acid level is associated with cancer. J Cancer Res Clin Oncol 146(3):705\u0026ndash;710. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00432-019-03095-8\u003c/span\u003e\u003cspan address=\"10.1007/s00432-019-03095-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003eEpub 2019 Nov 26\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng H, Zhou T, Mo X, Liu C, Yin Y (2019) Low-density lipoprotein promotes lymphatic metastasis of esophageal squamous cell carcinoma and is an adverse prognostic factor. Oncol Lett 17(1):1053\u0026ndash;1061. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ol.2018.9683\u003c/span\u003e\u003cspan address=\"10.3892/ol.2018.9683\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003eEpub 2018 Nov 9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin Y, Yang T, Li D, Ding W (2019) Effect of dietary cholesterol intake on the risk of esophageal cancer: a meta-analysis. J Int Med Res 47(9):4059\u0026ndash;4068 Epub 2019 Aug 13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu H, Rohan T (2000) Role of the insulin-like growth factor family in cancer development and progression. J Natl Cancer Inst 92(18):1472\u0026ndash;1489\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFurstenberger G, Senn HJ (2002) Insulin-like growth factors and cancer. Lancet Oncol 3(5):298\u0026ndash;302\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrimberg A (2003) Mechanisms by which IGF-I may promote cancer. Cancer Biol Ther 2(6):630\u0026ndash;635\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLarsson O, Girnita A, Girnita L (2005) Role of insulin-like growth factor 1 receptor signalling in cancer. Br J Cancer 92(12):2097\u0026ndash;2101\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamani AA et al (2007) The role of the IGF system in cancer growth and metastasis: overview and recent insights. Endocr Rev 28(1):20\u0026ndash;47\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao R, Macdonald K, Casson AG (2009) Insulin-like growth factor type I receptor gene expression and obesity in esophageal adenocarcinoma. Mol Carcinog 48(11):982\u0026ndash;988\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoyle SL et al (2012) IGF-1 and its receptor in esophageal cancer: association with adenocarcinoma and visceral obesity. Am J Gastroenterol 107(2):196\u0026ndash;204\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSafa AR, Pollok KE (2011) Targeting the Anti-Apoptotic Protein c-FLIP for Cancer Therapy. Cancers (Basel) 3(2):1639\u0026ndash;1671\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee SJ et al (2011) Berberine sensitizes TRAIL-induced apoptosis through proteasome-mediated downregulation of c-FLIP and Mcl-1 proteins. Int J Oncol 38(2):485\u0026ndash;492\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShirley S, Micheau O (2013) Targeting c-FLIP in cancer. Cancer Lett 332(2):141\u0026ndash;150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeveraux QL et al (1998) IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases. EMBO J 17(8):2215\u0026ndash;2223\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoice A, Bouchier-Hayes L (2020) Targeting apoptotic caspases in cancer. Biochim Biophys Acta Mol Cell Res 1867(6):118688. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbamcr.2020.118688\u003c/span\u003e\u003cspan address=\"10.1016/j.bbamcr.2020.118688\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003eEpub 2020 Feb 19\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarengo B et al (2011) Protein kinase C: an attractive target for cancer therapy. Cancers (Basel) 3(1):531\u0026ndash;567\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi C et al (2014) IL-6 and TNF-alpha induced obesity-related inflammatory response through transcriptional regulation of miR-146b. J Interferon Cytokine Res 34(5):342\u0026ndash;348\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl-Roub A et al (2021) IL-1beta and TNFalpha Cooperativity in Regulating IL-6 Expression in Adipocytes Depends on CREB Binding and H3K14 Acetylation. Cells, 10(11)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCawthorn WP, Sethi JK (2008) TNF-alpha and adipocyte biology. FEBS Lett 582(1):117\u0026ndash;131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Du F, Wang X (2008) TNF-alpha induces two distinct caspase-8 activation pathways. Cell 133(4):693\u0026ndash;703\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHayden MS, Ghosh S (2014) Regulation of NF-kappaB by TNF family cytokines. Semin Immunol 26(3):253\u0026ndash;266\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchwabe RF, Luedde T (2018) Apoptosis and necroptosis in the liver: a matter of life and death. Nat Rev Gastroenterol Hepatol 15(12):738\u0026ndash;752\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMicheau O, Tschopp J (2003) Induction of TNF receptor I-mediated apoptosis via two sequential signaling complexes. Cell 114(2):181\u0026ndash;190\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4193803/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4193803/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Obesity is a risk factor for esophageal adenocarcinoma (EAC). It is associated with increased levels of free fatty acids (FFA), leading to insulin resistance and increased expression of insulin like growth factor-1 (IGF-1) and diacylglycerol (DAG). The objective of the study is to investigate the role of apoptotic factors in control and EAC tissues in both relation to this signaling pathway in obese and non-obese patients.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e We included 23 obese and nonobese patients with EAC or with or without Barrett’s esophagus (BE) after IRB approval. We collected 23 normal, 10 BE, and 19 EAC tissue samples from endoscopy or esophagectomy. The samples were analyzed for the expression levels of pro-apoptotic and anti-apoptotic factors, PKC-d, cIAP2, FLIP, IGF-1, Akt, NF-kB and Ki67 by immunofluorescence and RT-PCR. We compared the expression levels between normal, BE, and EAC tissue using Students’ \u003cem\u003et-test\u003c/em\u003e between two groups.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eOur results showed decreased gene and protein expression of pro-apoptotic factors (bad, bak and bax) and increased expression of anti-apoptotic factors (bcl-2, Bcl-xL) in BE and EAC compared to normal tissues. There was increased gene and protein expression of PKC-d, cIAP2, FLIP, NF-kB, IGF-1, Akt, and Ki67 in BE and EAC samples compared to normal esophagus. Further, an increased folds changes in mRNA expression of proapoptotic factors, antiapoptotic factors, PKC-δ, IGF-1, Akt, and Ki-67 was associated with obesity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: Patients with EAC had increased expression of cIAP2 and FLIP, and PKC-d which is associated with inhibition of apoptosis and possible progression of esophageal adenocarcinoma.\u003c/p\u003e","manuscriptTitle":"Regulation of Pro-apoptotic and Anti-apoptotic Factors in Obesity-Related Esophageal Adenocarcinoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-05 20:29:38","doi":"10.21203/rs.3.rs-4193803/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-29T08:34:02+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-11T11:35:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"11292d5b-3b2f-408c-9c13-c8fdaeb2866e","date":"2024-04-08T13:10:34+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-02T19:03:04+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-02T13:59:17+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-01T14:01:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2024-03-31T00:25:33+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"96008b50-ac68-4a07-9edf-10bc859753a5","owner":[],"postedDate":"April 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-10-14T16:07:23+00:00","versionOfRecord":{"articleIdentity":"rs-4193803","link":"https://doi.org/10.1007/s11033-024-09931-6","journal":{"identity":"molecular-biology-reports","isVorOnly":false,"title":"Molecular Biology Reports"},"publishedOn":"2024-10-12 15:57:25","publishedOnDateReadable":"October 12th, 2024"},"versionCreatedAt":"2024-04-05 20:29:38","video":"","vorDoi":"10.1007/s11033-024-09931-6","vorDoiUrl":"https://doi.org/10.1007/s11033-024-09931-6","workflowStages":[]},"version":"v1","identity":"rs-4193803","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4193803","identity":"rs-4193803","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00