Histone deacetylase inhibitors Induce Expression of Chromosomally Tagged Variant-Specific Surface Protein Genes in Giardia lamblia

preprint OA: closed
Full text JSON View at publisher

Abstract

Objective: RNA interference and miRNA mediated mechanisms have been proposed to explain the expression of a specific variant of VSP at a time on the surface of Giardia lamblia. Recently, epigenetic mechanisms involving histone acetylations have been proposed to explain the process of antigenic switching in Giardia lamblia. However, due to the limited availability of specific antibodies for all the vsp variants present in the genome, it was difficult to monitor vsp gene switching. In this study, we have used an endogenous tagging method to tag specific vsp genes vsp1267 and vsp9B10A with a sequence encoding hemagglutinin (HA) epitope at the 3’end of the coding sequences without altering the 5’ upstream elements. With this method, we have monitored the expression of the tagged vsp genes in cells treated with histone deacetylase inhibitors using RT-PCR. Results Our results show that vsp1267-3XHA can be induced by treatment with sodium 4-phenylbutyrate, M344 and splitomicin but not by apicidin and Trichostatin A, while vsp9B10A-3XHA expression can be induced by Trichostatin A and splitomicin but not by sodium 4-phenylbutyrate, M344 and apicidin. The induced expression of these variants was not due to growth inhibition. These results support the role of histone acetylations in vsp expression.
Full text 58,153 characters · extracted from preprint-html · click to expand
Histone deacetylase inhibitors Induce Expression of Chromosomally Tagged Variant-Specific Surface Protein Genes in Giardia lamblia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research note Histone deacetylase inhibitors Induce Expression of Chromosomally Tagged Variant-Specific Surface Protein Genes in Giardia lamblia Daniel Roberto Orozco, Srinivas Garlapati This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.2.22303/v2 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Mar, 2020 Read the published version in BMC Research Notes → Version 2 posted 4 You are reading this latest preprint version Show more versions Abstract Objective RNA interference and miRNA mediated mechanisms have been proposed to explain the expression of a specific variant of VSP at a time on the surface of Giardia lamblia. Recently, epigenetic mechanisms involving histone acetylations have been proposed to explain the process of antigenic switching in Giardia lamblia. However, due to the limited availability of specific antibodies for all the vsp variants present in the genome, it was difficult to monitor vsp gene switching. In this study, we have used an endogenous tagging method to tag specific vsp genes vsp1267 and vsp9B10A with a sequence encoding hemagglutinin (HA) epitope at the 3’end of the coding sequences without altering the 5’ upstream elements. With this method, we have monitored the expression of the tagged vsp genes in cells treated with histone deacetylase inhibitors using RT-PCR. Results Our results show that vsp1267-3XHA can be induced by treatment with sodium 4-phenylbutyrate, M344 and splitomicin but not by apicidin and Trichostatin A, while vsp9B10A-3XHA expression can be induced by Trichostatin A and splitomicin but not by sodium 4-phenylbutyrate, M344 and apicidin. The induced expression of these variants was not due to growth inhibition. These results support the role of histone acetylations in vsp expression. Epigenetics & Genomics Giardia lamblia variant specific surface protein endogenous tagging histone deacetylase inhibitors antigenic variation Histone deacetylase inhibitors Figures Figure 1 Figure 2 Figure 3 Introduction Giardia lamblia antigenic variation involves the expression of a single variant-specific surface protein (VSP) on the trophozoite surface from a library of approximately 200 distinct vsp genes [1]. VSPs cover the entire surface of Giardia trophozoites, including the flagella and ventral disk [2]. The dense transmembrane regions of VSPs are speculated to provide a protective barrier to prevent the host immune system from accessing the trophozoite plasma membrane [3]. Although RNAi and miRNA mechanisms that target the coding sequences of vsp transcripts explain how one VSP is expressed at a time [4,5], they do not explain how VSP switching occurs. Epigenetic mechanisms have been proposed to explain the VSP switching in Giardia [3,6,7]. Recently, it was demonstrated that histone deacetylase inhibitor (HDACi) Trichostatin A increases the rate of VSP switching after 5 days of treatment, while sodium butyrate and nicotinamide had minor effects on switching rates [6]. The increase in switching rate was attributed to the increase in the association of H3K9ac, H4K8ac, and H4K16ac with the 5’ upstream sequences of vsp 1267, the specific vsp used in the study. Also, the genes that not are expressed ( vsp910B and vspA6 ) showed a significant decrease in the acetylation of histones associated with the 5’ upstream sequences [6]. However, it was not possible to detect the new VSPs expressed after switching due to a limitation in the availability of monoclonal antibodies for all the 200 possible variants of VSPs [6]. In this study, we have monitored the expression of chromosomally-tagged vsp genes vsp1267 and vsp9B10A in separate cell lines that were treated with histone deacetylase inhibitors. Due to a high degree of sequence similarity of VSPs, monitoring the expression of a specific vsp gene is difficult as it requires monoclonal antibodies that recognize it. However, by tagging a specific vsp gene, it is easy to detect its expression by RT-PCR. In order to ensure our chromosomally integrated construct is reflective of an endogenous vsp , the 5’ end of the vsp gene was unaltered, which is where epigenetic mechanisms generally operate. Our results show that treatment with HDAC inhibitors resulted in the expression of the tagged vsp gene more often than compared to untreated controls. Methods VSP cloning The truncated vsp1267 gene (GL50803_112208) lacking the coding sequences for the first 20 amino acids (Figure 1A) was amplified using the primers 5’-CAC gcggccgc TGGAAATAGTTGTGAAGCTGG -3’ (forward) and 5’-CAC ctcgag CGCCTTCCCCCTGCATATG-3’ (reverse) that contain recognition sequences for restriction enzymes Not I and Xho I , respectively. Similarly, truncated vsp9B10A gene (GL50803_101074) lacking the coding sequences for the first 20 amino acids (Figure 1A) was amplified using the primers 5’-CACgcggccgcAACAGAGCGCGCGCAAGAAGCTC -3’ (forward) and 5’-GTGctcgagCGCCTTGCCTCTGCACATAAAC -3’ (reverse) containing sites for enzymes NotI and XhoI , respectively. The amplified genes were cloned into pGEM-T easy vectors (Promega, Madison WI) and the recombinant plasmids were sequenced. The truncated vsp genes ( vsp1267tr and vsp9B10Atr ) from pGEM-T easy vectors were then cloned into pKS-BSR-3XHA vector [8] upstream of a 3X HA sequence to generate pKS-BSR-vsp1267tr-3XHA and pKS-BSR-vsp9B10Atr-3XHA. Transfection Recombinant plasmids pKS-vsp1267-3XHA and pKS-vsp9B10A-3XHA were linearized using Eco721 restriction enzyme, which cuts once in the coding sequences of truncated vsp genes. The digested plasmids were then transfected into Giardia lamblia WB trophozoites and selected for blastidicin resistance as described previously [8]. To confirm the chromosomal integration and 3XHA tagging of a copy of vsp gene, a forward primer corresponding to the 5’end of the coding sequence of the vsp gene ( vsp1267 primer 5’-ATGTTGTTGATAGCCTTCTATC-3’; vsp9B10A primer 5’-GTGCATATGACTGCCAAACATTGCCCGATTGATAGATTG -3’) and a reverse primer (5’-TCAGGATCCAGCGTAATCTGGTAC-3’) corresponding to the 3XHA tag sequence from the plasmid vector were used to amplify the endogenously tagged vsp genes. Vsp gene expression Total RNA was extracted from untreated and HDAC inhibitor treated cells using TRIzol reagent by following the manufacturer’s instructions (Invitrogen). RNA samples were treated with DNAse I (New England Biolabs) for 30 minutes at 37°C to remove DNA contamination. One mg of treated RNA was used for cDNA synthesis using OneTaq RT-PCR kit (New England Biolabs) by following the manufacturer’s instructions. To amplify full-length transcripts with 3XHA tag, a forward primer that encompasses the entire length of the coding sequence and a reverse primer that corresponds to 3XHA were used. Coding sequences of the full length GleIF4A (GL50803_10255) transcripts were used as an internal control. Effect of HDACi on the growth of Giardia Giardia cell lines were grown to mid-late log phase of growth and were sub-cultured to contain approximately 10 5 cells/mL and treated with HDAC inhibitors apicidin, trichostatin A (TSA), sodium 4-phenylbutyrate (NaPB), M344 and splitomicin (Sigma-Aldrich) at a final concentration of 2mM. Trophozoites were incubated at 37 °C and the growth of parasites were monitored by counting the cells using a hemocytometer after 24 and 48 hours post-treatment. Results Endogenous tagging The plasmid constructs pKS-BSR-vsp1267tr-3XHA and pKS-BSR-9B10Atr-3XHA were linearized with Eco721 and transfected into Giardia cells (Figure 1A). To confirm the integration of the truncated and tagged version of the vsp gene, primers encompassing the entire coding sequence starting from the initiation codon to the stop codon located after the triple HA tag were used (Figure 1B). Amplification of full length HA tagged vsp 1267 of size 1.7Kb (Figure 1C lane 2) and full length HA tagged vsp 9B10 of size 2.2 Kb (Figure 1D, lane 2), indicated proper integration of the 3XHA tagged gene into the chromosome. HDACi induce transcription of endogenously tagged vsp genes To test the hypothesis that inhibition of histone deacetylase activity leads to the expression of vsp genes, trophozoites were incubated with 2µM concentrations of HDAC inhibitors for 24 hours. Total RNA was extracted from Giardia cell lines Glvsp1267-3HA and Glvsp9B10A-3XHA after 24 h post-treatment. Reverse transcription polymerase chain reaction (RT-PCR) was performed to detect for HA-tagged vsp gene expression using a full-length vsp primer and a 3XHA primer (Figure 1B). Additionally, Giardia lamblia eukaryotic translation initiation factor 4A ( GleIF4A ) was used as an internal control. A full length amplicon of size 1.7Kb was detected in Glvsp1267-3XHA cell lines that were treated with M344, NaPB and splitomicin but not in the untreated control (Figure 2A, lanes 5, 7, 11). For M344 and NaPB treatments, full length amplicon of vsp1267-3XHA was detected in 2 out of 3 separate experiments performed on different days. In splitomicin treated cell lines, 8 out of 13 independent experiments detected full length amplicon. In the experiments where the full length amplicons were not detected when treated with M344, NaPB or splitomicin, a smear of amplicons ranging from 0.5 to 1Kb were observed (data not shown). These partial amplicons could represent the intermediates of degraded vsp1267 transcripts. Interestingly, no full length amplicons were detected when the cells were treated with apicidin or TSA (Figure 2A, lanes 3 and 9) and the results were consistent in 7 independent treatments performed on different days. These results agree with the previous reports that showed a decrease in the expression of vsp1267 upon treatment with TSA [4] or no change in expression when treated with apicidin [9]. Both untreated control and HDAC inhibitor treated cells showed a full-length GleIF4A amplicon of 1.2 kb (Figure 2A, lanes, 2,4, 6, 8, 10 and 12). In contrast to vsp1267-3XHA, full length vsp9B10A-3XHA amplicon of 2.2 Kb was detected in Glvsp9B10A cell lines that were treated with splitomycin or trichostatin A (Figure 2B, lanes 9 and 11, respectively) but not in cell lines treated with apicidin, M344 or NaPB (Figure 2B, lanes 3, 5, and 7, respectively). However, a smear of amplicons ranging from 0.5 to 1.5 Kb was observed in untreated control and in Apicidin, M344 or NaPB treated cells but not in cells treated with splitomicin or TSA. These amplicons may represent the intermediates of transcripts degraded by RNAi and/or miRNA mediated mechanisms [4,5]. Both in untreated control and treated cell lines, the expression of the internal control gene GleIF4A was detected (Figure 2B, lanes, 2, 4, 6, 8, 10 and 12). Effect of HDACi on Parasite Growth Replicating trophozoites of Glvsp1267-3XHA cell lines were treated with 2 µM of HDAC inhibitors for up to 48 hours. After 24 hours, no significant growth inhibition was observed in the cell lines treated with all the inhibitors when compared to control (Figure 3). However, after 48 hours of treatment, Apicidin inhibited the parasite growth by 87% (P< 0.001%), while Trichostatin A inhibited the growth by 82.2% (P< 0.001%) when compared to the untreated controls. However, there was no significant decrease in the growth of the parasites when treated with M344, NaPB, or splitomycin, when compared to the untreated controls (Figure 3). These results suggest that the changes in the expression of vsp1267-3XHA (Figure 2A) observed after 24 hours of HDAC inhibitor treatment were not due to cell toxicity. Discussion In this study, we demonstrated that tagging a chromosomal copy of a vsp gene can be used to monitor its expression in the presence of histone deacetylase inhibitors. Since the genes are tagged with 3XHA epitope at the 3’end, the 5’ end is not disrupted [8]. Thus, it maintains the native chromatin environment at the promoter region for the epigenetic mechanisms to operate. Also, tagging the 3’end does not necessarily interfere with the RNAi and miRNA mediated silencing mechanisms as they target the coding sequences of vsp mRNA in Giardia [4,5]. Due to the unavailability of monoclonal antibodies, we were not able to confirm the variant of vsp that is being expressed by Giardia WB cells before generating 3XHA tagged cell lines. Since we did not detect the expression of the tagged vsps ( vsp 1267 and vsp 9B10) in untreated controls, we assume that these cell lines (Gl vsp 1267-3XHA and Gl vsp 9B10-3XHA) are probably expressing a different variant of vsp at the time of treatment with HDAC inhibitors. Although we were able to detect the expression of the tagged vsp transcripts in treated cells, but not an untagged vsp , we cannot yet dismiss the possibility that these cells may have switched the vsp gene from an unknown variant to the tagged vsp . In our experiments, we have detected the expression of tagged vsps in cell lines treated with splitomicin more often than treated with TSA, Apicidin, M344, and NaPB, when compared to untreated controls. Apicidin [10], TSA [11], NaPB [12], and M344 [13] are known to inhibit NAD+ independent histone deacetylases that belong to class I HDACs. A homologue of class I HDAC has been identified in the Giardia genome database and previous reports have indicated that this enzyme can be inhibited by TSA, Apicidin, and NaPB [6,8]. In agreement with the previous reports [6,8], we have observed growth inhibition of the parasites within 48 hours of treatment with TSA and Apicidin. Although M344 and NaPB are known to target the same HDAC I enzyme, they did not inhibit parasite growth even after 48 hours of treatment. These results suggest that growth inhibition by TSA and Apicidin could be due to the inhibition of other essential cellular processes in addition to the inhibition of HDAC I enzyme [8]. Previous reports have indicated that treatment with TSA leads to an increase in the association of H3K9ac, H4K8ac and H4K16ac with the 5’ upstream sequences of expressed vsps [6], as HDAC I enzyme is known to target these acetylated histones. Based on these observations, we speculate that induction of vsp1267-3HA with M344 and NaPB, and vsp9B10A-3XHA with TSA, could be due to hyperacetylaton of these histones associated with the 5’upstream elements. Although vsp1267-3XHA and vsp9B10A-3XHA respond similarly to splitomicin [14] (inhibitor of Class III HDACs) treatment, they differ in their response to NaPB, M344 and TSA (inhibitors of Class I HDACs) treatments. It has been demonstrated that cancer cells display a differential response to apicidin, depsipeptide and TSA, and these differences in response were attributed to inhibitors targeting protein factors other than inhibiting HDAC activity in the cells, such as lowering global levels of histone methylation [15]. Therefore, it is likely that HDAC inhibitors could be targeting other proteins involved in gene expression. Alternatively, the chromatin environment at the promoter elements of vsp1267-3XHA and vsp9B10A-3XHA may be different, resulting in differences in the responses to various HDAC inhibitors. Limitations Although tagging the 3’end allowed us to qualitatively monitor the full-length transcripts using RT-PCR, it is not ideal for accurately estimating the transcript levels using qPCR as it requires amplification of small regions of ~200 nucleotides for in order to accurately estimate transcript levels [16]. Due to RNAi and miRNA mechanisms, short mRNA intermediates are generated and these intermediates could be potentially amplified by RT-qPCR. Abbreviations HA, hemagglutinin; NaPB, Sodium phenylbutyrate; TSA, Trichostatin A; HDAC, histone deacetylase; HDACi, histone deacetylase inhibitors. Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Availability of data and material Not applicable Competing interest All authors declare no conflict of interest. Funding This work was supported by the Research Competitiveness Subprogram grant (LEQSF-2015-17-RD-A-30) from the Louisiana Board of Regents and Institutional Development Award (IDeA) (5P20 GM103424-15) from the National Institutes of General Medical Sciences of the National Institutes of Health. Also this was supported in part by Elizabeth and Haydn Cutler Endowed Professorship in Biotechnology to S.G. Authors contribution ORD and SG conceived the idea and ORD performed the experiments. SG wrote the manuscript. Acknowledgments We thank Suman Tiwari and Victoria McGee for providing technical assistance. References Nash, T. E., Lujan, H. T., Mowatt, M. R., & Conrad, J. T. 2001. Variant-Specific Surface Protein Switching in Giardia lamblia . Infection and Immunity. 2001; 69 (3): 1922-1923. Nash, T. E. Antigenic variation in Giardia . In 2011; (pp. 245-257). Springer, Vienna. Prucca, C. G., Rivero, F. D., & Luján, H. D. Regulation of antigenic variation in Giardia lamblia . Rev. Microbiology. 2011; 65 , 611-630. Prucca, C.G., Slavin, I., Quiroga, R., Elias, E. V., Rivero, F. D., Saura, A., Carranza, P.G., Lujan, H.D. Antigenic variation in Giardia lamblia is regulated by RNA interference. Nature. 2008; 456(7223): 750-754. Saraiya, A.A., Li, W., Wu, J., Chang, C.H., Wang, C. C. The microRNAs in an ancient protest repress the variant-specific surface protein expression by targeting the entire coding sequence. 2014. PLoS Pathog. 10(2):e1003791. Carranza, P.G., Gargantini, P.R., Prucca, C.G., Torri, A., Saura, A., Svard, S., Lujan, H.D. Specific histone modifications play critical roles in the control of encystation and antigenic variation in the early-branching eukaryote Giardia lamblia . Int. J. Biochem. Cell Biol. 2016; Dec 8: 32-43. Lagunas-Rangel, F. A., Bermudez-Cruz, R.M. Epigenetics in the early divergent eukaryotic Giardia duodenalis: An update. Biochimie. 2019; 156:123-128. Gourguechon, S., and Cande, W. Z. Rapid tagging and integration of genes in Giardia intestinalis. Eukaryot. Cell. 2011; 10(1);142-145. Sonda S., Morf L., Bottova I., Baetschmann H., Rehrauer, H., Caflisch A., Hakimi M., Hehl A.B. Epigenetic mechanisms regulate stage differentiation in the minimized protozoan Giardia lamblia. Mol. Microbiol. 2010; 76(1):48-67. Han, J.W., Ahn, S.H., Park, S.H., Wang, S.Y., Bae, G.U., Seo, D.W., Kwon, H., Hong, S., Lee, H.Y., Lee, Y.W., and Lee, H.W. 2000. Apicidin, a histone deacetylase inhibitor, inhibits proliferation of tumor cells via induction of p21WAF1/Cip1 and gelsolin. Cancer Res. 2000; 60(21):6068-6074. Vanhaecke, T., Papeleu, P., Elaut, G., Rogiers, V. 2004. Trichostatin A-like hydroxamate histone deacetylase inhibitors as therapeutic agents: toxicological point of view. Curr. Med. Chem. 2004;11(12):1629-1643. Iannitti, T., and Palmieri, B. 2011. Clinical and experimental applications of sodium phenylbutyrate. 2011. Drugs R.D. 2011;11(3):227-249. Volmar, C.H., Salah-Uddin, H., Janczura, K.J., Halley, P., Lambert, G., Wodrich, A., Manoah, S., Patel, N.H., Sartor, G. C., Mehta, N., Miles, N.T.H., Desse, S., Dorcius, D., Cameron, M.D., Brothers, S.P., Wahlestedt, C. 2017. M344 promotes nonamyloidogenic amyloid precursor protein processing while normalizing Alzheimer’s disease genes and improving memory. Proc. Natl. Acad. Sci. USA. 2017;114(43): E9135-E9144. Bedalov, A., Gatbonton, T., Irvine, W.P., Gottschling, D.E., Simon, J. 2001. Identification of a small molecule inhibitor of Sir2p. Proc. Natl. Acad. Sci. USA. 98, 15113-15118. Chang, J., Varghese, D. S., Gillam, M.C., Peyton, M., Modi, B., Schiltz, R. L., Girard, L., and Martinez, E.D. 2012. Differential responses to cancer cells to HDAC inhibitors trichostatin A and depsipeptide. Br. J. Cancer. 2012;106(1): 116-125. Bustin, S., and Huggett, J. 2017. qPCR primer design revisited. Biomol. Detect. Quantif. 2017;14:19-28. Cite Share Download PDF Status: Published Journal Publication published 11 Mar, 2020 Read the published version in BMC Research Notes → Version 2 posted Editorial decision: Accept 03 Mar, 2020 Editor assigned by journal 27 Feb, 2020 Submission checks completed at journal 26 Feb, 2020 Editor invited by journal 26 Feb, 2020 You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-12878","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research note","associatedPublications":[],"authors":[{"id":380084,"identity":"c22ed2c3-4c0b-4800-8ef1-017b7b7cab51","order_by":1,"name":"Daniel Roberto Orozco","email":"","orcid":"","institution":"University of Louisiana at Monroe","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Daniel","middleName":"Roberto","lastName":"Orozco","suffix":""},{"id":380085,"identity":"9e48afbf-9a0a-4754-8ace-dbab2cf33330","order_by":2,"name":"Srinivas Garlapati","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYHACxgMgko29AcxgbCBGD0ilBBvPAQYStTBIJBCpRd797IMDP3fY1fFJvjE4dIPBRnbDAQJaDM+kGxzsPZMswSadY3A4hyHNmLCWhjSGA7xtzDAthxMJa+l/xnDwb1u9BJvkGZCW/4S1yEukMRzmbTsswSbBA9JygLAWA4lnDIdlzxyXbONJKzicY5BsPJOgLf1pjA/f7qjml28/vPFxToWdbB9BW0AKEHFhQEA52JYGBmJjfBSMglEwCkYsAACyLkZ5TYyJfAAAAABJRU5ErkJggg==","orcid":"","institution":"University of Louisiana at Monroe","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Srinivas","middleName":"","lastName":"Garlapati","suffix":""}],"badges":[],"createdAt":"2020-01-29 16:42:33","currentVersionCode":2,"declarations":"","doi":"10.21203/rs.2.22303/v2","doiUrl":"https://doi.org/10.21203/rs.2.22303/v2","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13104-020-04995-6","type":"published","date":"2020-03-12T02:41:22+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":567850,"identity":"e337b50c-58db-4875-9e96-44a16b43fe74","added_by":"auto","created_at":"2020-02-28 15:06:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":58664,"visible":true,"origin":"","legend":"Tagging of a chromosomal copy of vsp gene with 3XHA epitope using endogenous tagging method. (A) The plasmid construct pKS-BSR-vsptr-3XHA containing blasticidin resistance gene (BSR, highlighted in blue), truncated vsp gene (vsptr, highlighted in red), and three copies of hemagglutinin epitope (3XHA, highlighted in green) were linearized with the restriction enzyme Eco721 and then integrated into Giardia genome by homologous recombination. (B) The forward and reverse primers used for amplifying the full length vsp gene tagged with 3XHA are indicated by arrows. (C) Agarose gel electrophoresis of DNA size maker (lane 1) and the amplicons representing the full length vsp1267 gene tagged with 3XHA in Glvsp1267-3XHA cell lines (lane 2). (D) Agarose gel electrophoresis of DNA size maker (lane 1) and the amplicons representing the full length vsp910BA gene tagged with 3XHA in Glvsp9B10A-3XHA cell lines (lane 2).","description":"","filename":"1.PNG","url":"https://assets-eu.researchsquare.com/files/9e6eca35-37be-40b6-b18b-567017135955/v2/1.PNG"},{"id":567851,"identity":"b7935959-d2e2-4ac3-af5a-569f292c1b13","added_by":"auto","created_at":"2020-02-28 15:06:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":100281,"visible":true,"origin":"","legend":"Induction of vsp gene expression in Giardia trophozoites treated with Histone deacetylase inhibitors. (A) RT-PCR analysis of full length vsp1267-3XHA transcripts in untreated Glvsp1267-3XHA cell lines (lane 1), in cell lines treated with Apcidin (lane 3), M344 (lane 5), NaBP (lane 7), splitomicin (lane 9) and TSA (lane 11). RT-PCR of full length transcripts of GleIF4A (lanes, 2, 4, 6, 8, 10, and 12) was used as an internal control. (B) RT-PCR analysis of full length vsp9B10A-3XHA transcripts in untreated Glvsp9B10A-3XHA cell lines (lane 1), in cell lines treated with Apcidin (lane 3), M344 (lane 5), NaBP (lane 7), splitomicin (lane 9) and TSA (lane 11). RT-PCR of full length transcripts of GleIF4A (lanes, 2, 4, 6, 8, 10, and 12) was used as an internal control.","description":"","filename":"2.PNG","url":"https://assets-eu.researchsquare.com/files/9e6eca35-37be-40b6-b18b-567017135955/v2/2.PNG"},{"id":567852,"identity":"65212251-b19e-4cee-aa98-b1731b4566c8","added_by":"auto","created_at":"2020-02-28 15:06:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":19288,"visible":true,"origin":"","legend":"Effect of Histone deacetylase inhibitors on the growth of Giardia cell lines Glvsp1267-3XHA. The parasite cultures in triplicates were incubated with various HDAC inhibitors at a final concentration of 2M for 48 hours. The cell numbers were counted after 24 and 48 hours of incubation using a hemocytometer. The averages of triplicates were plotted with error bars indicating standard deviation. The significance of the difference between the control and the treated cells was calculated using the pairwise t test.","description":"","filename":"3.PNG","url":"https://assets-eu.researchsquare.com/files/9e6eca35-37be-40b6-b18b-567017135955/v2/3.PNG"},{"id":15666096,"identity":"22ad856b-3f82-44bb-b9fb-ceac29fd395d","added_by":"auto","created_at":"2021-11-18 13:35:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":427441,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-12878/v2/72a72c61-a718-4ea6-b9f8-041f04ad5441.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eHistone deacetylase inhibitors Induce Expression of Chromosomally Tagged Variant-Specific Surface Protein Genes in \u003cem\u003eGiardia lamblia\u003c/em\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cem\u003eGiardia\u003c/em\u003e \u003cem\u003elamblia \u003c/em\u003eantigenic variation involves the expression of a single variant-specific surface protein (VSP) on the trophozoite surface from a library of approximately 200 distinct \u003cem\u003evsp\u003c/em\u003e genes [1]. VSPs cover the entire surface of \u003cem\u003eGiardia\u003c/em\u003e trophozoites, including the flagella and ventral disk [2]. The dense transmembrane regions of VSPs are speculated to provide a protective barrier to prevent the host immune system from accessing the trophozoite plasma membrane [3]. Although RNAi and miRNA mechanisms that target the coding sequences of \u003cem\u003evsp\u003c/em\u003e transcripts explain how one VSP is expressed at a time [4,5], they do not explain how VSP switching occurs. Epigenetic mechanisms have been proposed to explain the VSP switching in \u003cem\u003eGiardia\u003c/em\u003e [3,6,7]. Recently, it was demonstrated that histone deacetylase inhibitor (HDACi) Trichostatin A increases the rate of VSP switching after 5 days of treatment, while sodium butyrate and nicotinamide had minor effects on switching rates [6]. The increase in switching rate was attributed to the increase in the association of H3K9ac, H4K8ac, and H4K16ac with the 5\u0026rsquo; upstream sequences of \u003cem\u003evsp\u003c/em\u003e1267, the specific \u003cem\u003evsp\u003c/em\u003e used in the study. Also, the genes that not are expressed (\u003cem\u003evsp910B\u003c/em\u003e and \u003cem\u003evspA6\u003c/em\u003e) showed a significant decrease in the acetylation of histones associated with the 5\u0026rsquo; upstream sequences [6]. However, it was not possible to detect the new VSPs expressed after switching due to a limitation in the availability of monoclonal antibodies for all the 200 possible variants of VSPs [6].\u003c/p\u003e\n\u003cp\u003eIn this study, we have monitored the expression of chromosomally-tagged \u003cem\u003evsp\u003c/em\u003e genes \u003cem\u003evsp1267\u003c/em\u003e and \u003cem\u003evsp9B10A\u003c/em\u003e in separate cell lines that were treated with histone deacetylase inhibitors.\u0026nbsp; Due to a high degree of sequence similarity of VSPs, monitoring the expression of a specific \u003cem\u003evsp \u003c/em\u003egene is difficult as it requires monoclonal antibodies that recognize it. However, by tagging a specific \u003cem\u003evsp\u003c/em\u003e gene, it is easy to detect its expression by RT-PCR.\u0026nbsp; In order to ensure our chromosomally integrated construct is reflective of an endogenous \u003cem\u003evsp\u003c/em\u003e, the 5\u0026rsquo; end of the \u003cem\u003evsp\u003c/em\u003e gene was unaltered, which is where epigenetic mechanisms generally operate.\u0026nbsp; Our results show that treatment with HDAC inhibitors resulted in the expression of the tagged \u003cem\u003evsp\u003c/em\u003e gene more often than compared to untreated controls.\u0026nbsp;\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eVSP cloning \u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; \u003c/strong\u003eThe truncated \u003cem\u003evsp1267\u003c/em\u003e gene (GL50803_112208) lacking the coding sequences for the first 20 amino acids (Figure 1A) was amplified using the primers 5\u0026rsquo;-CAC\u003cem\u003egcggccgc\u003c/em\u003eTGGAAATAGTTGTGAAGCTGG -3\u0026rsquo; (forward) and 5\u0026rsquo;-CAC\u003cem\u003ectcgag\u003c/em\u003eCGCCTTCCCCCTGCATATG-3\u0026rsquo; (reverse) that contain recognition sequences for restriction enzymes \u003cem\u003eNot I\u003c/em\u003e and \u003cem\u003eXho I\u003c/em\u003e, respectively. Similarly, truncated \u003cem\u003evsp9B10A\u003c/em\u003e gene (GL50803_101074) lacking the coding sequences for the first 20 amino acids (Figure 1A) was amplified using the primers 5\u0026rsquo;-CACgcggccgcAACAGAGCGCGCGCAAGAAGCTC -3\u0026rsquo; (forward) and 5\u0026rsquo;-GTGctcgagCGCCTTGCCTCTGCACATAAAC -3\u0026rsquo; (reverse) containing sites for enzymes \u003cem\u003eNotI\u003c/em\u003e and \u003cem\u003eXhoI\u003c/em\u003e, respectively. The amplified genes were cloned into pGEM-T easy vectors (Promega, Madison WI) and the recombinant plasmids were sequenced. The truncated \u003cem\u003evsp\u003c/em\u003e genes (\u003cem\u003evsp1267tr\u003c/em\u003e and \u003cem\u003evsp9B10Atr\u003c/em\u003e) from pGEM-T easy vectors were then cloned into pKS-BSR-3XHA vector [8] upstream of a 3X HA sequence to generate pKS-BSR-vsp1267tr-3XHA and pKS-BSR-vsp9B10Atr-3XHA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eTransfection \u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRecombinant plasmids pKS-vsp1267-3XHA and pKS-vsp9B10A-3XHA were linearized using \u003cem\u003eEco721 \u003c/em\u003erestriction enzyme, which cuts once in the coding sequences of truncated \u003cem\u003evsp\u003c/em\u003e genes. The digested plasmids were then transfected into \u003cem\u003eGiardia lamblia\u003c/em\u003e WB trophozoites and selected for blastidicin resistance as described previously [8]. To confirm the chromosomal integration and 3XHA tagging of a copy of \u003cem\u003evsp\u003c/em\u003e gene, a forward primer corresponding to the 5\u0026rsquo;end of the coding sequence of the \u003cem\u003evsp\u003c/em\u003e gene (\u003cem\u003evsp1267\u003c/em\u003e primer 5\u0026rsquo;-ATGTTGTTGATAGCCTTCTATC-3\u0026rsquo;; \u003cem\u003evsp9B10A\u003c/em\u003e primer 5\u0026rsquo;-GTGCATATGACTGCCAAACATTGCCCGATTGATAGATTG -3\u0026rsquo;) and a reverse primer (5\u0026rsquo;-TCAGGATCCAGCGTAATCTGGTAC-3\u0026rsquo;) corresponding to the 3XHA tag sequence from the plasmid vector were used to amplify the endogenously tagged \u003cem\u003evsp\u003c/em\u003e genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eVsp gene expression \u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from untreated and HDAC inhibitor treated cells using TRIzol reagent by following the manufacturer\u0026rsquo;s instructions (Invitrogen). RNA samples were treated with DNAse I (New England Biolabs) for 30 minutes at 37\u0026deg;C to remove DNA contamination. One mg of treated RNA was used for cDNA synthesis using OneTaq RT-PCR kit (New England Biolabs) by following the manufacturer\u0026rsquo;s instructions. To amplify full-length transcripts with 3XHA tag, a forward primer that encompasses the entire length of the coding sequence and a reverse primer that corresponds to 3XHA were used. Coding sequences of the full length GleIF4A (GL50803_10255) transcripts were used as an internal control.\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEffect of HDACi on the growth of Giardia \u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGiardia\u003c/em\u003e cell lines were grown to mid-late log phase of growth and were sub-cultured to contain approximately 10\u003csup\u003e5\u003c/sup\u003e cells/mL and treated with HDAC inhibitors apicidin, trichostatin A (TSA), sodium 4-phenylbutyrate (NaPB), M344 and splitomicin (Sigma-Aldrich) at a final concentration of 2mM. Trophozoites were incubated at 37 \u0026deg;C and the growth of parasites were monitored by counting the cells using a hemocytometer after 24 and 48 hours post-treatment.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEndogenous tagging \u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe plasmid constructs pKS-BSR-vsp1267tr-3XHA and pKS-BSR-9B10Atr-3XHA were linearized with \u003cem\u003eEco721\u003c/em\u003e and transfected into \u003cem\u003eGiardia\u003c/em\u003e cells (Figure 1A). To confirm the integration of the truncated and tagged version of the \u003cem\u003evsp\u003c/em\u003e gene, primers encompassing the entire coding sequence starting from the initiation codon to the stop codon located after the triple HA tag were used (Figure 1B).\u0026nbsp; Amplification of full length HA tagged \u003cem\u003evsp\u003c/em\u003e1267 of size 1.7Kb (Figure 1C lane 2) and full length HA tagged \u003cem\u003evsp\u003c/em\u003e9B10 of size 2.2 Kb (Figure 1D, lane 2), indicated proper integration of the 3XHA tagged gene into the chromosome.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eHDACi induce transcription of endogenously tagged vsp genes\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; To test the hypothesis that inhibition of histone deacetylase activity leads to the expression of \u003cem\u003evsp\u003c/em\u003e genes, trophozoites were incubated with 2\u0026micro;M concentrations of HDAC inhibitors for 24 hours.\u0026nbsp; Total RNA was extracted from \u003cem\u003eGiardia \u003c/em\u003ecell lines Glvsp1267-3HA and Glvsp9B10A-3XHA after 24 h post-treatment.\u0026nbsp; Reverse transcription polymerase chain reaction (RT-PCR) was performed to detect for HA-tagged \u003cem\u003evsp\u003c/em\u003e gene expression using a full-length \u003cem\u003evsp\u003c/em\u003e primer and a 3XHA primer (Figure 1B).\u0026nbsp; Additionally, \u003cem\u003eGiardia lamblia\u003c/em\u003e eukaryotic translation initiation factor 4A (\u003cem\u003eGleIF4A\u003c/em\u003e) was used as an internal control. A full length amplicon of size 1.7Kb was detected in Glvsp1267-3XHA cell lines that were treated with M344, NaPB and splitomicin but not in the untreated control (Figure 2A, lanes 5, 7, 11).\u0026nbsp;\u0026nbsp; For M344 and NaPB treatments, full length amplicon of vsp1267-3XHA was detected in 2 out of 3 separate experiments performed on different days. In splitomicin treated cell lines, 8 out of 13 independent experiments detected full length amplicon. In the experiments where the full length amplicons were not detected when treated with M344, NaPB or splitomicin, a smear of amplicons ranging from 0.5 to 1Kb were observed (data not shown). These partial amplicons could represent the intermediates of degraded \u003cem\u003evsp1267\u003c/em\u003e transcripts. Interestingly, no full length amplicons were detected when the cells were treated with apicidin or TSA (Figure 2A, lanes 3 and 9) and the results were consistent in 7 independent treatments performed on different days. These results agree with the previous reports that showed a decrease in the expression of \u003cem\u003evsp1267\u003c/em\u003e upon treatment with TSA [4] or no change in expression when treated with apicidin [9]. \u0026nbsp;Both untreated control and HDAC inhibitor treated cells showed a full-length GleIF4A amplicon of 1.2 kb (Figure 2A, lanes, 2,4, 6, 8, 10 and 12).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn contrast to vsp1267-3XHA, full length vsp9B10A-3XHA amplicon of 2.2 Kb was detected in Glvsp9B10A cell lines that were treated with splitomycin or trichostatin A (Figure 2B, lanes 9 and 11, respectively) but not in cell lines treated with apicidin, M344 or NaPB (Figure 2B, lanes 3, 5, and 7, respectively).\u0026nbsp; However, a smear of amplicons ranging from 0.5 to 1.5 Kb was observed in untreated control and in Apicidin, M344 or NaPB treated cells but not in cells treated with splitomicin or TSA. These amplicons may represent the intermediates of transcripts degraded by RNAi and/or miRNA mediated mechanisms [4,5]. Both in untreated control and treated cell lines, the expression of the internal control gene GleIF4A was detected (Figure 2B, lanes, 2, 4, 6, 8, 10 and 12).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEffect of HDACi on Parasite Growth\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Replicating trophozoites of Glvsp1267-3XHA cell lines were treated with 2 \u0026micro;M of HDAC inhibitors for up to 48 hours. After 24 hours, no significant growth inhibition was observed in the cell lines treated with all the inhibitors when compared to control (Figure 3).\u0026nbsp; However, after 48 hours of treatment, Apicidin inhibited the parasite growth by 87% (P\u0026lt; 0.001%), while Trichostatin A inhibited the growth by 82.2% (P\u0026lt; 0.001%) when compared to the untreated controls. However, there was no significant decrease in the growth of the parasites when treated with M344, NaPB, or splitomycin, when compared to the untreated controls (Figure 3). These results suggest that the changes in the expression of vsp1267-3XHA (Figure 2A) observed after 24 hours of HDAC inhibitor treatment were not due to cell toxicity.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we demonstrated that tagging a chromosomal copy of a \u003cem\u003evsp\u003c/em\u003e gene can be used to monitor its expression in the presence of histone deacetylase inhibitors.\u0026nbsp; Since the genes are tagged with 3XHA epitope at the 3\u0026rsquo;end, the 5\u0026rsquo; end is not disrupted [8]. Thus, it maintains the native chromatin environment at the promoter region for the epigenetic mechanisms to operate. Also, tagging the 3\u0026rsquo;end does not necessarily interfere with the RNAi and miRNA mediated silencing mechanisms as they target the coding sequences of \u003cem\u003evsp\u003c/em\u003e mRNA in \u003cem\u003eGiardia\u003c/em\u003e [4,5].\u003c/p\u003e\n\u003cp\u003eDue to the unavailability of monoclonal antibodies, we were not able to confirm the variant of \u003cem\u003evsp\u003c/em\u003e that is being expressed by \u003cem\u003eGiardia \u003c/em\u003eWB cells before generating 3XHA tagged cell lines.\u0026nbsp; Since we did not detect the expression of the tagged \u003cem\u003evsps\u003c/em\u003e (\u003cem\u003evsp\u003c/em\u003e1267 and \u003cem\u003evsp\u003c/em\u003e9B10) in untreated controls, we assume that these cell lines (Gl\u003cem\u003evsp\u003c/em\u003e1267-3XHA and Gl\u003cem\u003evsp\u003c/em\u003e9B10-3XHA) are probably expressing a different variant of \u003cem\u003evsp\u003c/em\u003e at the time of treatment with HDAC inhibitors. Although we were able to detect the expression of the tagged \u003cem\u003evsp\u003c/em\u003e transcripts in treated cells, but not an untagged \u003cem\u003evsp\u003c/em\u003e, we cannot yet dismiss the possibility that these cells may have switched the \u003cem\u003evsp\u003c/em\u003e gene from an unknown variant to the tagged \u003cem\u003evsp\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eIn our experiments, we have detected the expression of tagged \u003cem\u003evsps\u003c/em\u003e in cell lines treated with splitomicin more often than treated with TSA, Apicidin, M344, and NaPB, when compared to untreated controls.\u0026nbsp; Apicidin [10], TSA [11], NaPB [12], and M344 [13] are known to inhibit NAD+ independent histone deacetylases that belong to class I HDACs. A homologue of class I HDAC has been identified in the \u003cem\u003eGiardia\u003c/em\u003e genome database and previous reports have indicated that this enzyme can be inhibited by TSA, Apicidin, and NaPB [6,8].\u0026nbsp; In agreement with the previous reports [6,8], we have observed growth inhibition of the parasites within 48 hours of treatment with TSA and Apicidin. Although M344 and NaPB are known to target the same HDAC I enzyme, they did not inhibit parasite growth even after 48 hours of treatment. These results suggest that growth inhibition by TSA and Apicidin could be due to the inhibition of other essential cellular processes in addition to the inhibition of HDAC I enzyme [8]. Previous reports have indicated that treatment with TSA leads to an increase in the association of H3K9ac, H4K8ac and H4K16ac with the 5\u0026rsquo; upstream sequences of expressed \u003cem\u003evsps\u003c/em\u003e [6], as HDAC I enzyme is known to target these acetylated histones. Based on these observations, we speculate that induction of \u003cem\u003evsp1267-3HA\u003c/em\u003e with M344 and NaPB, and \u003cem\u003evsp9B10A-3XHA\u003c/em\u003e with TSA, could be due to hyperacetylaton of these histones associated with the 5\u0026rsquo;upstream elements.\u003c/p\u003e\n\u003cp\u003eAlthough \u003cem\u003evsp1267-3XHA\u003c/em\u003e and \u003cem\u003evsp9B10A-3XHA\u003c/em\u003e respond similarly to splitomicin [14] (inhibitor of Class III HDACs) treatment, they differ in their response to NaPB, M344 and TSA (inhibitors of Class I HDACs) treatments. It has been demonstrated that cancer cells display a differential response to apicidin, depsipeptide and TSA, and these differences in response were attributed to inhibitors targeting protein factors other than inhibiting HDAC activity in the cells, such as lowering global levels of histone methylation [15]. Therefore, it is likely that HDAC inhibitors could be targeting other proteins involved in gene expression. Alternatively, the chromatin environment at the promoter elements of vsp1267-3XHA and vsp9B10A-3XHA may be different, resulting in differences in the responses to various HDAC inhibitors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLimitations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAlthough tagging the 3\u0026rsquo;end allowed us to qualitatively monitor the full-length transcripts using RT-PCR, it is not ideal for accurately estimating the transcript levels using qPCR as it requires amplification of small regions of ~200 nucleotides for in order to accurately estimate transcript levels [16]. Due to RNAi and miRNA mechanisms, short mRNA intermediates are generated and these intermediates could be potentially amplified by RT-qPCR.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eHA, hemagglutinin; NaPB, Sodium phenylbutyrate; TSA, Trichostatin A; HDAC, histone deacetylase; HDACi, histone deacetylase inhibitors.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Research Competitiveness Subprogram grant (LEQSF-2015-17-RD-A-30) from the Louisiana Board of Regents and Institutional Development Award (IDeA) (5P20 GM103424-15) from the National Institutes of General Medical Sciences of the National Institutes of Health. Also this was supported in part by Elizabeth and Haydn Cutler Endowed Professorship in Biotechnology to S.G.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eORD and SG conceived the idea and ORD performed the experiments. SG wrote the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Suman Tiwari and Victoria McGee for providing technical assistance.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eNash, T. E., Lujan, H. T., Mowatt, M. R., \u0026amp; Conrad, J. T. 2001. Variant-Specific Surface Protein Switching in \u003cem\u003eGiardia lamblia\u003c/em\u003e.\u0026nbsp;Infection and Immunity.\u0026nbsp;2001; \u003cem\u003e69\u003c/em\u003e(3): 1922-1923.\u003c/li\u003e\n\u003cli\u003eNash, T. E. Antigenic variation in \u003cem\u003eGiardia\u003c/em\u003e. In\u0026nbsp; 2011; (pp. 245-257). Springer, Vienna.\u003c/li\u003e\n\u003cli\u003ePrucca, C. G., Rivero, F. D., \u0026amp; Luj\u0026aacute;n, H. D. Regulation of antigenic variation in \u003cem\u003eGiardia lamblia\u003c/em\u003e.\u0026nbsp; Rev. Microbiology. 2011;\u0026nbsp;\u003cem\u003e65\u003c/em\u003e, 611-630.\u003c/li\u003e\n\u003cli\u003ePrucca, C.G., Slavin, I., Quiroga, R., Elias, E. V., Rivero, F. D., Saura, A., Carranza, P.G., Lujan, H.D. Antigenic variation in Giardia lamblia is regulated by RNA interference. Nature. 2008; 456(7223): 750-754.\u003c/li\u003e\n\u003cli\u003eSaraiya, A.A., Li, W., Wu, J., Chang, C.H., Wang, C. C. The microRNAs in an ancient protest repress the variant-specific surface protein expression by targeting the entire coding sequence. 2014. PLoS Pathog. 10(2):e1003791.\u003c/li\u003e\n\u003cli\u003eCarranza, P.G., Gargantini, P.R., Prucca, C.G., Torri, A., Saura, A., Svard, S., Lujan, H.D. Specific histone modifications play critical roles in the control of encystation and antigenic variation in the early-branching eukaryote \u003cem\u003eGiardia lamblia\u003c/em\u003e. Int. J. Biochem. Cell Biol. 2016; Dec 8: 32-43.\u003c/li\u003e\n\u003cli\u003eLagunas-Rangel, F. A., Bermudez-Cruz, R.M. Epigenetics in the early divergent eukaryotic Giardia duodenalis: An update. Biochimie. 2019; 156:123-128.\u003c/li\u003e\n\u003cli\u003eGourguechon, S., and Cande, W. Z. Rapid tagging and integration of genes in Giardia intestinalis. Eukaryot. Cell. 2011; 10(1);142-145.\u003c/li\u003e\n\u003cli\u003eSonda S., Morf L., Bottova I., Baetschmann H., Rehrauer, H., Caflisch A., Hakimi M., Hehl A.B. Epigenetic mechanisms regulate stage differentiation in the minimized protozoan Giardia lamblia. Mol. Microbiol. 2010; 76(1):48-67.\u003c/li\u003e\n\u003cli\u003eHan, J.W., Ahn, S.H., Park, S.H., Wang, S.Y., Bae, G.U., Seo, D.W., Kwon, H., Hong, S., Lee, H.Y., Lee, Y.W., and Lee, H.W. 2000. Apicidin, a histone deacetylase inhibitor, inhibits proliferation of tumor cells via induction of p21WAF1/Cip1 and gelsolin. Cancer Res. 2000; 60(21):6068-6074.\u003c/li\u003e\n\u003cli\u003eVanhaecke, T., Papeleu, P., Elaut, G., Rogiers, V. 2004. Trichostatin A-like hydroxamate histone deacetylase inhibitors as therapeutic agents: toxicological point of view. Curr. Med. Chem. 2004;11(12):1629-1643.\u003c/li\u003e\n\u003cli\u003eIannitti, T., and Palmieri, B. 2011. Clinical and experimental applications of sodium phenylbutyrate. 2011. Drugs R.D. 2011;11(3):227-249.\u003c/li\u003e\n\u003cli\u003eVolmar, C.H., Salah-Uddin, H., Janczura, K.J., Halley, P., Lambert, G., Wodrich, A., Manoah, S., Patel, N.H., Sartor, G. C., Mehta, N., Miles, N.T.H., Desse, S., Dorcius, D., Cameron, M.D., Brothers, S.P., Wahlestedt, C. 2017. M344 promotes nonamyloidogenic amyloid precursor protein processing while normalizing Alzheimer\u0026rsquo;s disease genes and improving memory. Proc. Natl. Acad. Sci. USA. 2017;114(43): E9135-E9144.\u003c/li\u003e\n\u003cli\u003eBedalov, A., Gatbonton, T., Irvine, W.P., Gottschling, D.E., Simon, J. 2001. Identification of a small molecule inhibitor of Sir2p. Proc. Natl. Acad. Sci. USA. 98, 15113-15118.\u003c/li\u003e\n\u003cli\u003eChang, J., Varghese, D. S., Gillam, M.C., Peyton, M., Modi, B., Schiltz, R. L., Girard, L., and Martinez, E.D. 2012. Differential responses to cancer cells to HDAC inhibitors trichostatin A and depsipeptide. Br. J. Cancer. 2012;106(1): 116-125.\u003c/li\u003e\n\u003cli\u003eBustin, S., and Huggett, J. 2017. qPCR primer design revisited. Biomol. Detect. Quantif. 2017;14:19-28.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-research-notes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"resn","sideBox":"Learn more about [BMC Research Notes](http://bmcresnotes.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/resn/default.aspx","title":"BMC Research Notes","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Giardia lamblia, variant specific surface protein, endogenous tagging, histone deacetylase inhibitors, antigenic variation, Histone deacetylase inhibitors","lastPublishedDoi":"10.21203/rs.2.22303/v2","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.2.22303/v2","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eObjective RNA interference and miRNA mediated mechanisms have been proposed to explain the expression of a specific variant of VSP at a time on the surface of Giardia lamblia. Recently, epigenetic mechanisms involving histone acetylations have been proposed to explain the process of antigenic switching in Giardia lamblia. However, due to the limited availability of specific antibodies for all the vsp variants present in the genome, it was difficult to monitor vsp gene switching. In this study, we have used an endogenous tagging method to tag specific vsp genes vsp1267 and vsp9B10A with a sequence encoding hemagglutinin (HA) epitope at the 3’end of the coding sequences without altering the 5’ upstream elements. With this method, we have monitored the expression of the tagged vsp genes in cells treated with histone deacetylase inhibitors using RT-PCR. \u003c/p\u003e\u003cp\u003eResults Our results show that vsp1267-3XHA can be induced by treatment with sodium 4-phenylbutyrate, M344 and splitomicin but not by apicidin and Trichostatin A, while vsp9B10A-3XHA expression can be induced by Trichostatin A and splitomicin but not by sodium 4-phenylbutyrate, M344 and apicidin. The induced expression of these variants was not due to growth inhibition. These results support the role of histone acetylations in vsp expression.\u003c/p\u003e","manuscriptTitle":"Histone deacetylase inhibitors Induce Expression of Chromosomally Tagged Variant-Specific Surface Protein Genes in Giardia lamblia","msid":"","msnumber":"","nonDraftVersions":[{"code":2,"date":"2020-02-28 15:06:43","doi":"10.21203/rs.2.22303/v2","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accept","date":"2020-03-03T12:00:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2020-02-27T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-02-26T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-02-26T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-research-notes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"resn","sideBox":"Learn more about [BMC Research Notes](http://bmcresnotes.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/resn/default.aspx","title":"BMC Research Notes","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2020-01-30 22:01:31","doi":"10.21203/rs.2.22303/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Minor revision","date":"2020-02-20T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-02-19T12:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"editorAssigned","content":"","date":"2020-01-29T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-01-29T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-01-29T12:00:00+00:00","index":1,"fulltext":""},{"type":"submitted","content":"","date":"2020-01-28T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-01-28T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-01-28T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-research-notes","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"resn","sideBox":"Learn more about [BMC Research Notes](http://bmcresnotes.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/resn/default.aspx","title":"BMC Research Notes","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a76ba6de-4b8c-40e5-b169-643e7078f7e9","owner":[],"postedDate":"February 28th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":54673,"name":"Epigenetics \u0026 Genomics"}],"tags":[],"updatedAt":"2021-08-20T02:41:22+00:00","versionOfRecord":{"articleIdentity":"rs-12878","link":"https://doi.org/10.1186/s13104-020-04995-6","journal":{"identity":"bmc-research-notes","isVorOnly":false,"title":"BMC Research Notes"},"publishedOn":"2020-03-12 02:41:22","publishedOnDateReadable":"March 12th, 2020"},"versionCreatedAt":"2020-02-28 15:06:43","video":"","vorDoi":"10.1186/s13104-020-04995-6","vorDoiUrl":"https://doi.org/10.1186/s13104-020-04995-6","workflowStages":[]},"version":"v2","identity":"rs-12878","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"identity":"rs-12878","version":["v2"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00