Identification and characterization of human skeletal stem cell-like cells derived from infrapatellar fat pad

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-19

Adipose tissue, particularly the infrapatellar fat pad, can be a source of human skeletal stem cell-like cells with self-renewal and differentiation potential for regenerative medicine.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

Abstract

Abstract Background Skeletal stem cells (SSCs) have attracted extensive attention for their crucial role in bone accrual and therapeutical values. The substantial unmet cellular need of regenerative medicine and tissue engineering calls for identification of a novel source for human SSC isolation, or even skeletal stem cell-like cells (SSCLCs). Methods hSSCLCs were isolated through enzyme-digestion and fluorescent-activated cell sorting (FACS) from human tissues including placenta, cord blood, Wharton’s Jelly and various adipose depots. Proportion of hSSCLCs in all those tissues were compared through flow cytometry. For adipose tissue, immunofluorescent staining was also employed to substantiate our flow results. In vitro CFU-F assay, chondrogenic and osteogenic assays were performed to assess self-renewal and multipotency for differentiation of hSSCLCs. Transcriptomic profiling of adipose-derived hSSCLCs was achieved through scRNA-seq. Results Here, we illustrated that adipose tissues contain a satisfying abundancy of hSSCLCs, especially infrapatellar fat pad (IPFP), but not fetal tissues. Moreover, we discovered IPFP-derived hSSCLCs display intact self-renewal and a marked elevation in chondrogenic and osteogenic differentiation. Transcriptomically comparing IPFP-hSSCLCs and dorsal adipose depot (DSAT)-derived hSSCLCs through scRNA-seq, we further demonstrated IPFP-hSSCLCs are less differentiated but more motivated in expressing transcriptomes related to chondrogenic and osteogenic differentiation. Conclusion Our study first identified adipose tissue as an alternative but encouraging source for isolating hSSCLCs with intact SSC properties which might be promising in treating diseases related to bone and/or cartilage defects.
Full text 121,138 characters · extracted from preprint-html · click to expand
Identification and characterization of human skeletal stem cell-like cells derived from infrapatellar fat pad | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification and characterization of human skeletal stem cell-like cells derived from infrapatellar fat pad Yan Xu, Jinrui Xun, Zan Li, Wenqiang Lou, Xin Shi, Xinzhu Qiu, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2356002/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Skeletal stem cells (SSCs) have attracted extensive attention for their crucial role in bone accrual and therapeutical values. The substantial unmet cellular need of regenerative medicine and tissue engineering calls for identification of a novel source for human SSC isolation, or even skeletal stem cell-like cells (SSCLCs). Methods hSSCLCs were isolated through enzyme-digestion and fluorescent-activated cell sorting (FACS) from human tissues including placenta, cord blood, Wharton’s Jelly and various adipose depots. Proportion of hSSCLCs in all those tissues were compared through flow cytometry. For adipose tissue, immunofluorescent staining was also employed to substantiate our flow results. In vitro CFU-F assay, chondrogenic and osteogenic assays were performed to assess self-renewal and multipotency for differentiation of hSSCLCs. Transcriptomic profiling of adipose-derived hSSCLCs was achieved through scRNA-seq. Results Here, we illustrated that adipose tissues contain a satisfying abundancy of hSSCLCs, especially infrapatellar fat pad (IPFP), but not fetal tissues. Moreover, we discovered IPFP-derived hSSCLCs display intact self-renewal and a marked elevation in chondrogenic and osteogenic differentiation. Transcriptomically comparing IPFP-hSSCLCs and dorsal adipose depot (DSAT)-derived hSSCLCs through scRNA-seq, we further demonstrated IPFP-hSSCLCs are less differentiated but more motivated in expressing transcriptomes related to chondrogenic and osteogenic differentiation. Conclusion Our study first identified adipose tissue as an alternative but encouraging source for isolating hSSCLCs with intact SSC properties which might be promising in treating diseases related to bone and/or cartilage defects. Skeletal stem cells (SSCs) skeletal stem cell-like cells (SSCLCs) Infrapatellar fat pad (IPFP) Adipose tissue Regenerative medicine Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Albeit rapid progress in developing stem cell therapies have been jointly made by researchers and clinical workers, limitations and concerns in clinical process including unclarified indications, unspecified dosing, potential of tumorigenesis and, specifically, lacking the source of stem cell strongly blockade expanding practical usage of stem cell therapies [ 1 , 2 ] . Moreover, lacking knowledge of stem cell properties can lead to undesired outcomes in tissue repair. For instance, it had been limited in current regenerative therapies taking advantage of mesenchymal stromal cells (MSCs), for treating osteoarthritis due to MSC-derived cartilage failed to structurally and biomechanically mimic the characteristics of native articular cartilage [ 3 , 4 ] . It is of great interest for regenerative medicine to advance the understanding on intrinsic physiological activities and uncover a satisfying sourceful tissue for isolation of therapeutical stem cells, even stem-cell like cells. Tissue-residing stem cell came into sight along with their bona-fide lineage commitment and motivated biological activities [ 5 – 7 ] . Among which skeletal stem cells (SSCs) represent a crucial population for their essential role in both bone accrual and regeneration, as well as cartilaginous process. SSCs had been meticulously defined through a combined cluster of surface markers and rigorous transplant assay for assessment of their self-renewal capacity [ 8 – 10 ] . Rodent studies further convinced abnormalities of SSCs is closely related to various disease process such as aging-related bone loss and osteoarthritis [ 11 , 12 ] . Thus, it is of great interest for researchers to strengthen the comprehension of SSCs in treating skeletal disorders. And the discovery of available tissue sources to harvest SSCs might be favorable for researchers and clinical workers to regenerate tissues that mostly mimic the physiological properties of native organs in treating skeletal diseases. However, it should not be overlooked that SSC only consists a small amount of bone cells (less than ~ 0.1‰ of total bone cells) with apparent anatomical signatures which implied isolation of SSCs simply from bone marrow, growth plate and periosteum can be more complicated [ 12 – 14 ] . All those issues strongly restricted the practical translation of fundamental discovery of SSCs into real clinical usage. This eventually leads researchers to explore a suitable source of SSCs, or even SSC-like cells (SSCLCs), that can be easy to collect. It had been widely appreciated that non-skeletal organs also contain substantial amounts of mesenchymal stem and progenitor cells. Among all those tissues adipose tissue and maternal tissue predominantly drew researchers’ attention for their accessibility in clinical practices. Adipose tissues were considered as one of the most abundant sources of MSCs, namely adipose-derived stromal cells (ASCs). These cells not only duplicated self-renew and differentiation capacity of bone marrow-derived MSCs (BMSCs), but also exhibited strong ancillary functions in supporting physiological behavior of other cells [ 15 – 17 ] . In addition to adipose tissue, umbilical cord, Warton’s Jelly and placenta had also been confirmed as crucial sources of MSCs and fundamentally proved to be valuable in treating multiple diseases [ 18 – 22 ] . Thus, it is plausible for us to assume these tissues are also major sources for skeletal stem-cell like cells (SSCLCs) in future usage of tissue regeneration. Here, following previous strategies in defining human SSCs, we took advantage of flow-cytometry activated cell sorting (FACS) to explore the existence of human SSCLCs (hSSCLCs) in non-skeletal organs including umbilical cord blood, Wharton’s Jelly, placenta and adipose tissues from different anatomical sites. We discovered a relatively high enrichment of hSSCLCs in adipose tissue, especially infrapatellar fat pad (IPFP). Furthermore, we assessed the stemness of hSSCLCs from anatomically diversed adipose depots and discovered IPFP-derived hSSCLCs contain augmented osteogenic and chondrogenic differentiation activities. Eventually, through single-cell RNA sequencing (scRNA-Seq), we transcriptomically defined the differences between IPFP-derived and dorsal subcutaneous adipose tissue (DSAT)-derived hSSCLCs. And we confirmed hSSCLCs from IPFP-hSSCLCs are less differentiated but more motivated in osteogenesis and chondrogenesis. To sum up, we first isolated, identified, and interpreted the existence of hSSCLCs in non-skeletal organs. And we successfully elucidated their capacity in regenerating bony and cartilaginous tissues through in vitro assays. Our study implied adipose tissue as a reliable source of hSSCLCs in future administration of multiple diseases associated with bone and/or cartilage defects. Materials And Methods Ethics statement We conducted research in accordance with the Declaration of Helsinki (1964) and this study was approved by the Ethics Committee of Xiangya Hospital, Central South University (institutional review board equivalent) (202201012). Written informed consent was signed and obtained from all participants involved in the study. Umbilical cord blood, Wharton’s Jelly and placenta samples were obtained post-delivery from Xiangya hospital. Adipose tissues were collected from patients undergoing surgical treatment undergoing lumbar canal stenosis (DSAT), femoral neck fracture (GSAT), meniscal injury (IPFP) and digestive diseases (ASAT). The harvesting procedure had no impact on the surgery. Cell Isolation Isolation of single cell suspension was performed based on previously validated protocols [ 23 – 25 ] . In brief, human tissues were minced into small pieces, washed two to three times with ice-cold Hanks Solution, and digested for about 1h at 37°C. For maternal tissues, the enzyme mix consists 3‰ (w/v) hyaluronidase and collagenase II in HANK’s balanced salt solution (Sigma, USA). For adipose tissues, the enzyme mix consists 0.25% (w/v) collagenase I (Worthington, USA) and 1% Dispase II (Roche, Swiss) in HANK’s balanced salt solution (Sigma, USA). The digestion was stopped by adding the same volume of culture medium (DMEM 4.5 g/L glucose, 10% FCS) and tissue lysates were filtered through a 70-µm nylon mesh. Filtered cell suspensions were then centrifuged at 500 x g for 5 minutes. Cell pellets were then subjected to FACS for isolation of hSSCLCs. Fluorescence Activated Cell Sorting (Facs) hSSCLCs were isolated through FACS following previously reported protocols [ 10 , 13 ] . hSSCLCs should express podoplanin (PDPN), NT5E (CD73), and CD164 as their positive surface markers but lacking PTPRC (CD45), GYPA (CD235a), PECAM1 (CD31), and MCAM (CD146), which are consistent to previous study conducted by Chan et al [ 10 ] . After isolation, prepared single-cell suspensions were washed once with ice-cold Flow Cytometry Staining Buffer (Thermofisher scientific, USA) followed by incubation with Fc blocking buffer containing Hu BD Fc Block NALE FC1.3216 (1:200 dilution, BD PharMingen Serotec, USA) for 15 minutes. Protected from light, cells were then incubated for 15 minutes on ice with a mixture of following antibodies in Flow Cytometry Staining Buffer: anti-CD45 Percp/cy5.5, anti-CD235 Percp/cy5.5, anti-CD31 Percp/cy5.5, anti-CD146 PE/cy7, anti-PDPN APC, anti-CD90 APC/cy7, anti-CD73 FITC, and anti-CD164 PE (all primary antibodies were obtained from Biolegend, USA). Finally, cells were washed twice, re-suspended in Flow Cytometry Staining Buffer before FACS. FACS was performed with a BD FACS Aria™ III Sorter (Becton-Dickinson Biosciences, USA). UltraComp eBeads™ (01-2222-42, Invitrogen) were used to set initial compensation and Fluorescence minus one (FMO) controls were used for additional compensation and to assess background levels of each stain. Gating strategies were then established based on internal FMO controls to separate positive and negative populations for each cell surface marker. Collected data were further analyzed through FlowJo (Ver 10.1) Immunofluorescent Staining Of Adipose Tissues Immunofluorescent staining of human adipose tissues was performed as previously described [ 26 ] . In brief, adipose tissues were fixed with 4% paraformaldehyde, washed twice in ice-cold PBS, incubated in 15% (w/v) sucrose in PBS solution at 4℃ overnight and embedded in OCT (Sakura, Japan). The specimens were then sectioned into 10µm slides. Cryosectioned slides were blocked by donkey sera, followed by primary antibodies incubation overnight at 4°C. Next day, slides were stained with Alexa Fluor conjugated secondary antibodies including Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488) (Abcam, ab150077), Donkey Anti-Mouse IgG H&L (Alexa Fluor® 594) (Abcam, ab150108) and Donkey Anti-Mouse IgG H&L (Alexa Fluor® 594) (ab150108) at room temperature for an hour. Nuclear staining was performed with DAPI (BD Bioscience) before mounted with Aquatex (Millipore, USA). Fluorescent microscopy was performed through Zeiss LSM 780 (Zeiss, Germany). This study employed the following primary antibodies for immunofluorescent staining: Anti-Podoplanin/gp36 antibody [18H5] - BSA and Azide free (Abcam, ab10288), Human 5'-Nucleotidase/CD73 Antibody (Bio-Techne, AF5795), and Rabbit Anti-CD164 antibody (Bioss, bs-12688R). In Vitro Culture Of Hssclcs Sorted hSSCLCs were cultured in 75 cm 2 culture dishes (Nunclon, Thermo Scientific, Waltham, MA, USA) at a density of 5 × 10 5 cells/dish in a standard CO 2 incubator (37°C, 5% CO 2 ). The culture medium, comprised of DMEM supplemented with 10% human platelet lysate (Sigma-Aldrich, USA), 100 U/ml penicillin, and 0.1 mg/ml streptomycin (1% pen-strep; Life Technologies, Burlington, Canada), was refreshed every three days. Cells were passaged until 80% confluence. When reaching passage 3, hSSCLCs were used for downstream differentiation assays. Chondrogenic Differentiation And Alcian Blue (Ab) Staining Chondrogenic differentiation induction of hSSCLCs was performed taking advantage of a commercial kit (HyCyte™ hASC Chondrogenic Differentiation Media, HyCyte Biosciences, China) following manufacturer’s instructions. Briefly, hSSCLCs at passage 3 were digested and resuspended at a density of 2.0×10 7 cells/mL. Pipettes were adopted to drop 20 µL of the cell suspension to the center of 24-well plates. After being cultured in a standard CO 2 incubator (37°C, 5% CO 2 ) for 3h, hSSCLCs were adherent to the bottom of the plates. 1mL chondrogenesis media was added to each well and replaced every three days. After 21 days of chondrogenic differentiation induction, hSSCLCs were rinsed with PBS and fixed with 4% paraformaldehyde at RT for 30 min. Samples were then washed once with PBS, and stained with Alcian Blue (HyCyte Biosciences, China) for 30 min at RT before proceeding to imaging. Osteogenic Differentiation Induction And Alizarin Red S (Ars) Staining Osteogenic differentiation induction of hSSCLCs was operated utilizing a commercial kit (HyCyte™ hASC Osteogenic Differentiation Media, HyCyte Biosciences, China) and following the manufacturer’s instructions. For osteogenic induction, hSSCLCs at passage 3 were seeded onto 12-well plates coated with 0.1% gelatin at a density of 2.0×10 4 cells/well, and cultured in a standard CO 2 incubator (37°C, 5% CO 2 ). After the hSSCLCs were 70–80% confluent, culture media was replaced by osteogenesis media, and the osteogenesis media was refreshed every three days. After 21 days of chondrogenic or osteogenic differentiation induction, hSSCLCs were rinsed with PBS and fixed with 4% paraformaldehyde at RT for 30 min. Samples were then washed once with PBS, and stained with Alizarin Red S staining solution (HyCyte Biosciences, China) for 30 min at RT before proceeding for imaging. Reverse Transcription-quantitative Polymerase Chain Reaction (Rt-qpcr) After chondrogenic or osteogenic induction for 3 days and 7 days, the total RNA of hSSCLCs was extracted through the classic TRIzol protocol [ 27 ] . 2µg total RNA of each sample was used for cDNA synthesis taking advantage of GoScript™ Reverse Transcription Kit (A5001, Promega, USA). The qRT-PCR was performed with GoTaq®qPCR Master Mix (A6001, Promega, USA) according to the manufacturer’s instructions. Target gene expression relative to GAPDH was calculated by the 2 −ΔΔCT method. Detailed information of related primers is shown in Table 1 . Table 1 Primer sequences used for qRT-PCR analysis ID Gene Forward Primer Reverse primer 1 RUNX2 TGGTTACTGTCATGGCGGGTA TCTCAGATCGTTGAACCTTGCTA 2 BGLAP GGCGCTACCTGTATCAATGG GTGGTCAGCCAACTCGTCA 3 SPP1 CTCCATTGACTCGAACGACTC CAGGTCTGCGAAACTTCTTAGAT 4 SOX9 AGCGAACGCACATCAAGAC CTGTAGGCGATCTGTTGGGG 5 COL2A1 TGGACGATCAGGCGAAACC GCTGCGGATGCTCTCAATCT 6 ACAN CCCCTGCTATTTCATCGACCC GACACACGGCTCCACTTGAT 7 GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG Western Blotting Western blotting Protein isolation and Western blotting were performed as previously described [ 28 ] . After 3 days and 7 days of chondrogenic or osteogenic induction, respectively, cells were lysed in RIPA buffer (R10010, Solarbio, China)for the collection of total protein. BCA assay kit (Thermo Fisher, USA) was applied to determine the protein concentration. After 5 minutes of denaturing at 95 ℃, 5 mg total protein of each sample was loaded in each lane in standard polyacrylamide gels. After electrophoresis, the protein was transferred to a PVDF membrane (Millipore). Blocking and antibody binding were conducted in Tris-buffered saline-Tween buffer with 5% nonfat skimmed milk. The primary antibodies used were recombinant Anti-SOX9 antibody (ab185230, Abcam) and Anti-RUNX2 antibody (ab76956, Abcam) and secondary antibodies were Goat anti-Mouse HRP and Goat anti‐Rabbit HRP respectively. The bands were visualized with the ECL plus kit (P0018, Beyotime, China). Single-cell Rna Sequencing For ScRNA-seq, dorsal subcutaneous adipose tissue (DSAT) and IPFP were harvested from 3 patients each for library preparation. The library was generated using 10x Genomics Single-Cell V2 Library Construction (Genenergy, Shanghai, China), and sequenced using the Illumina NextSeq 500 Sequencing System, after which the raw reads were analyzed using the Cell Ranger Single Cell Software Suite [ 29 ] and R package Seurat [ 30 ] . The number of unique molecule identifier (UMI) counts and genes were examined to identify outliers. Dimensionality reduction was done with principal component analysis (PCA), and then UMAP was used for the visualization of the clusters. The Find Conserved Markers function in the Seurat package [ 30 ] was used to identify the marker genes and differentially expressed genes (DEGs). Gene Ontology (GO) analysis was significantly enriched according to the DEG results with a false discovery rate ≤ 0.05. For unsupervised exploration of stemness, CytoTRACE [ 31 ] was used to compare differentiation states. Statistical analysis Quantitative data are presented as means ± sd (standard deviation). Statistical analyses were performed using Prism 8.2 software (GraphPad). One-way ANOVA followed by a Tukey's multiple comparison test was used to evaluate the difference of hSSCLC percentage among tissues or adipose tissue from different sites and the difference of chondrogenic differentiation assay and osteogenic differentiation assay. Details for statistical analyses, including replicate numbers, are illustrated in the figure legends. Analysis and visualization of flow cytometry data were performed using FlowJo (v10.0.7). Results Comparison of hSSCLC amounts in different tissues The source for isolating a high abundance of hSSCLCs requires easy accessibility from clinical practices.Previous studies on MSCs claimed that umbilical cord and placenta enriched a satisfying amount of human MSCs [ 32 , 33 ] . Also, human adipose tissue had also been reported for its abundant amounts of MSCs in regenerative medicine [ 16 , 34 ] . We assumed those tissues harbor a cell population whose biological behavior is similar to hSSCs in bone, namely hSSCLCs, that might be valuable for regenerative medicine. To explore the existence of hSSCLCs in non-skeletal tissues, we harvested placenta, Wharton's jelly from human umbilical cord, cord blood, and abdominal subcutaneous adipose tissue for further analysis ( Fig. 1 ) . Through flow cytometry, we unexpectedly observed hSSCLCs rarely exist in the Wharton's jelly and cord blood, accompanies by a relatively low abundancy of hSSCLCs in the placenta ( Fig. 2 A-B ) . To our surprise, hSSCLCs are enriched in the abdominal subcutaneous adipose tissue compared to maternal tissues ( Fig. 2 A-B ) , which highlights adipose tissue as a better source of hSSCLCs. Anatomical Variation Revealed Ipfp As A Delightful Source Of Adipose-derived Hssclcs Albeit acknowledged adipose tissue as a more reliable tissue to acquire hSSCLCs, anatomical variety along with the physiological diversity of adipose tissues also raised questions on defining the most suitable source of hSSCLCs from human fat depots [ 35 ] . Adipose tissues that could be accessible during regular surgical approaches such as liposuction, arthroscopy and joint replacement specifically attract our attention such as. dorsal subcutaneous adipose tissue (DSAT), abdominal subcutaneous adipose tissue (ASAT), and gluteal subcutaneous adipose tissue (GSAT), as well as infrapatellar fat pad (IPFP). We then anticipate to compare hSSCLC abundancies in fat depots mentioned above to anatomically define a suitable fat source of hSSCLC isolation. Utilizing our previous gating strategies, we observed hSSCLCs are predominantly enriched in IPFP whereas the percentages of hSSCLCs in DSAT, ASAT and GSAT are significantly lower (30%~50% relative to IPFP-isolated hSSCLCs) ( Fig. 3 A-B ) . We’ve also conducted immunofluorescence to confirm the distribution of adipose-derived hSSCLCs. Consistent to flow cytometry analysis, the ratio of hSSCLCs, represented by triple-positive cells (CD164+, green; PDPN+, red; CD73+, carnation), were significantly higher in IPFP compared to DSAT, ASAT and GSAT ( Fig. 3 C-D ) . These results suggest that among those human adipose tissues we examined, IPFP is a satisfying source for isolating hSSCLCs. Self-renewal Capacity Of Adipose-derived Hssclcs From Different Locations We then sought to investigate whether functional diversity exists in hSSCLCs isolated from different sites of adipose tissue. With the assistance of FACS, we isolated hSSCLCs and cultured them in vitro for downstream analysis. Adherent cells in round- or spindle-shape could be observed on the 5th -7th day after primary culture ( Fig. 4 A, upper) . In passage 3, cells isolated from different sites exhibited a homogenous spindle-shaped morphology ( Fig. 4 A, lower) . Consequently, we conducted colony-forming unit (CFU) assay to determine the clonogenicity of hSSCLCs. After 21 days of culture, all 4 groups of adipose-derived hSSCLCs showed similar clonogenicity compared to ASC groups ( Fig. 4 B-C ). Furthermore, CCK8 indicated a similar proliferative capacity of hSSCLCs and ASCs at 3–5 days ( Fig. 4 D ) . Collectively, these results suggested the capacity of self-renewal in adipose-derived hSSCLCs is similar to ASCs, which indicates hSSCLCs as a promising source for regenerative medicine. And these results lead us to explore whether their differentiation potentials differ from each others. Chondrogenic And Osteogenic Potential Of Adipose-derived Hssclcs From Different Donor Sites Taking advantage of adipose-derived stromal cells (ASCs), previous studies confirmed anatomical locations have crucial impacts on their differentiation capabilities [ 36 ] . Since we are interested in exploring the potential of hSSCLCs on repairing skeletal and cartilaginous defects, we managed to assess the chondrogenic and osteogenic potencies of differentiated hSSCLCs. To explore the chondrogenic potential of hSSCLCs from different depots, we analyzed the expression level of representative transcriptomes which are crucial in chondrogenesis including aggrecan ( ACAN ), collagen type II ( COL2A1 ), and SRY-box transcription factor 9 ( SOX9 ). Through qRT-PCR, after 3 days and 7 days of chondrogenic induction of hSSCLCs, the expression level of ACAN , COL2A1 , and SOX9 were drastically increased in hSSCLCs groups compared with unsorted ASCs ( Fig. 5 A ) . Notably, through proliferation capacity not significantly varied, the highest level of chondrogenic transcriptomes was detected in IPFP-derived hSSCLCs which suggested an enhanced chondrogenic differentiation potency compared with hSSCLCs in all other groups. And these differences were even more remarkable after 7-day differentiation induction ( Fig. 5 A ) . To further assess the chondrogenic potential of hSSCLCs at protein level, western blot (WB) was conducted after 3 days and 7 days of chondrogenic induction. Similarly, compared with the control group, the hSSCLCs groups showed higher protein expression levels of SOX9 while IPFP-derived hSSCLCs showed the highest expression level ( Fig. 5 B ) . In addition, Alcian Blue (AB) staining results implied the hSSCLCs from IPFP outperformed in matrix synthesis among all groups ( Fig. 5 C ) , which were consistent with our previous results. For osteogenic potential of hSSCLCs, the expression levels of representative osteogenic genes including RUNX family transcription factor 2 ( RUNX2 ), Bone Gamma-Carboxyglutamate Protein ( BGLAP ), and Secreted Phosphoprotein 1 ( SPP1 ) were examined via qRT-PCR. After 3 days and 7 days of osteogenesis induction, RUNX2 , BGLAP , and SPP1 mRNA of hSSCLCs groups were significantly higher compared to the unsorted ASCs group (Fig. 5 D). Similar to chondrogenic genes, expression levels of osteogenic transcriptomes in IPFP-hSSCLCs was the highest among all hSSCLCs groups ( Fig. 5 D ) . Furthermore, we also conducted immunoblotting to identify the protein expression of RUNX2 after osteogenic-differentiation induction. We confirmed an elevation of RUNX2 synthesis in hSSCLCs group compared to ASCs and IPFP-hSSCLCs synthesized most RUNX2 during osteogenic differentiation ( Fig. 5 E ) . These results suggested significant variances in osteogenesis among hSSCLCs from diverse anatomical sites. Additionally, Alizarin Red S (ARS) staining was performed to examine the synthesis of extracellular matrix and calcium deposition during osteogenic differentiation. Consistent with previous results, among all hSSCLCs we’ve examined, IPFP-hSSCLCs contain the best capacity in osteogenesis after differentiation induction (Fig. 5 E). All these results verified the osteogenic differentiation potential among hSSCLCs varied determined by anatomical characteristics. More importantly, such motivated manner of IPFP-hSSCLCs in participating in osteogenesis and chondrogenesis greatly revealed their clinical significance that these cells may act as a promising cellular source in regenerating cartilage and bone. Single-cell RNA sequencing profiled transcriptomic differences between IPFP- and DSAT-derived hSSCLCs To gain mechanistic insight on why IPFP-hSSCLCs are more active in chondrogenesis and osteogenesis, we performed single-cell RNA sequencing (scRNA-seq) on stromal vascular fraction of adipose tissues, isolated hSSCLCs populations and transcriptomically compared the differences of hSSCLCs from DSAT and IPFP. Whole adipose stromal vascular fraction from DSAT and IPFP were clustered into several populations (Fig. 6A) . Initially, we discovered a majority of hSSCLC population defined as previously described triple-positive cells located within ASPC population (Fig. 6B-C) . To separate hSSCLCs from ASPCs, we further visualized ASPCs into 3 subsets and determined positive cell surface markers that hSSCLCs expressed to anchor hSSCLC subset (Fig. 6D) . hSSCLCs defined through our analysis were consistent with the previously reported immunophenotype [CD45(PTPRC)-CD235a- TIE2-CD31(PECAM1)- PDPN+CD146(MCAM)-CD73(NT5E)+CD164+] (Fig. 6E) [9, 10] . Correspondent with our previous results, the comparison between ASPC proportion from different depots revealed a higher percentage of hSSCLCs in IPFP compared to DSAT (Fig. 6F-G) . CytoTRACE was consequently employed to hierearchically evaluate the differentiation level of each subpopulation in ASPCs. And we confirmed hSSCLCs sits at the apex of the differentiation hierarchy among all these 3 subsets from ASPCs (Fig. 6H) . Lastly, we compared transcriptomic differences between IPFP- and DSAT-derived hSSCLCs. Gene Ontology (GO) analysis on the top 50 differential genes (DEGs) revealed IPFP- and DSAT-hSSCLCs favor different biological processes (Fig. 6I) . In line with our in vitro differentiation assays (Fig. 5) , transcriptomes related to cartilage development, extracellular matrix organization, extracellular structure organization as well as tissue remodeling, ossification were primarily enriched in IPFP-hSSCLCs compared to hSSCLCs from DSAT (Fig. 6I) . This addressed the proximal mechanism why IPFP-hSSCLCs harbor augmented osteogenic and chondrogenic capacities compared to other adipose-derived hSSCLCs. Intriguingly, analyzed by CytoTRACE, IPFP-hSSCLCs are less differentiated compared with DSAT-hSSCLCs (Fig. 6J) . It is likely that IPFP cells retained their stemness in a cycling-promoting context which might attribute to the increased differentiation capability into bony and cartilaginous tissues observed in our previous experiments. Finally, chondroblast and osteoblast differentiation scoring of hSSCLCs from IPFP and DSAT confirmed higher chondroblast and osteoblast differentiation potential of IPFP-hSSCLCs (Fig. 6K-L) . Taken together, scRNA-Seq analysis revealed that IPFP-hSSCLCs are a promising cellular source for their improved chondrogenic and osteogenic abilities in future translational usage. Discussion Proper functioning of SSCs in murine studies confirmed regenerative value of SSCs in recovery of skeletal disorders. Crucially involved in fracture healing, SSCs proliferate, participate in endochondral ossification and eventually commit into osteoblastic lineage cells to establish bony callus for the reunion of fracture sites [ 6 , 9 , 10 ] . Additionally, motivated SSCs were actively engaged in the healing process of articular repairing [ 12 ] . However, limitations such as skeletal abundancy of SSCs may largely prohibit their translational value in clinical usage. As stem cell therapy in treating skeletal disorders emerged encouraging [ 37 , 38 ] , it is of particular interest to discover a promising source of hSSC, or hSSCLC isolation for translational studies and even clinical practice. Here, we first identified the enrichment of hSSCLCs in non-skeletal tissue, specifically human adipose tissue, and functionally confirmed their physiological activities in self-renewal, multifaceted in contributing to osteogenesis and chondrogenesis. These activities largely mimicked the properties of SSCs albeit most assays were performed in vitro. Anatomical diversity of adipose tissues also leads to physiological and functional variations. As one of the two majority types of adipose tissue, white adipose tissues (WATs) primarily locate in subcutaneous, intraperitoneal, mesenteric and joint cavities [ 39 , 40 ] . In addition, it had also been proved that anatomic divergence leads to diversed functioning of cells that resides in those tissues [ 41 ] . Take MSCs as an example, previous studies on differentiation capacities of ASCs revealed a depot-dependent specificity of the osteogenic and adipogenic potential [ 42 , 43 ] . In accordance with this, we revealed a population of IPFP-derived hSSCLCs exhibited enhanced osteogenic and chondrogenic preference compared to other adipose-derived hSSCLCs. Indicating this particular type of adipose tissue might be a favorable choice for isolating hSSCLCs with highly motivated activities in developing regenerative therapies or for the usage of tissue engineering. These evidences suggested a context-specificity manner that contribute to the proliferation and differentiation pattern of tissue-residing cells located in varied donor sites of adipose tissue. To address this, we explored both osteo- and chodro-anabolic potency of hSSCLCs derived from different anatomical locations and defined their discrepancies in differentiation. More importantly, we’ve also transcriptomically profiled IPFP- and DSAT-hSSCLCs, as a representative for non-IPFP-derived hSSCLCs. scRNA-seq results showing more IPFP-hSSCLCs sits at the apex of differentiation hierarchy. At the same time, IPFP-derived hSSCLCs are more favorable in contributing to chondrogenesis and osteogenesis whereas DSAT-hSSCLCs largely express transcriptomes that are less relevant to cartilage development and bone formation. Suggesting IPFP-hSSCLCs as a promising cellular source for preclinical studies on the development of stem cell therapy in managing diseases associated with bone and/or cartilage defects. Although the strongest osteogenic and chondrogenic capability were detected in IPFP-hSSCLCs, it does not preclude the therapeutical value of other adipose-derived hSSCLCs. Both biopsy and liposuction can generate numerous accessible hSSCLCs since previously study on ASC isolation implied less than 20mL dispersed human adipose tissue can satisfyingly harvest enough MSCs that cover a 12-well-plate culturing [ 23 ] . From our results, it is surprising to detect a relatively equivalent ratio of hSSCLCs in adipose tissues, especially IPFP-hSSCLCs (~ 80% relative to previous study), compared with hSSC abundancy reported in proliferative and hypertrophic zone of human skeletal sample [ 10 ] . To some extent, non-IPFP-hSSCLCs from adipose tissue exhibited similar proliferative activities compared to IPFP-hSSCLCs and exhibited capacity in chondrogenic and osteogenic differentiation though these activities are not as substantial as IPFP-hSSCLCs do. Following a stricted but well-established protocol, it is plausible for researchers to persue an ideal solution by simply increasing the total events of cells that may satisfyingly isolate more hSSCLCs to meet the tremendous requirement for preclinical studies. Thus, though less enriched in non-IPFP adipose depots, hSSCLCs derived from other adipose depots should not be neglected as a compensatory source for isolation of hSSCLCs. Such as applying scaffold in accordance with finely isolated stem cells and ancillary cytokines to enhance their differentiation capacities through conscientiously managing tissue-engineered products might be an encouraging method to achieve regenerating tissues with native characteristics. Conclusion In summary, this study first identified human adipose tissue as a promising source of hSSCLCs and clarified preclinical values through identifying their differentiation capacities in vitro. We anticipate that this will support further studies on utilizing non-skeletal SSCLCs in regenerative medicine and/or tissue engineering. Moreover, this study might provide crucial guidance for future studies aiming to explore novel tissue sources for SSCs in non-skeletal organs. Declarations Acknowledgements We would like to thank professor Hui Xie and other staff from Movement System Injury and Repair Research Center, Xiangya Hospital, Central South University, Changsha, China, for their kind assistance during the experiments. Funding This work was supported by the Key Program of the National Natural Science Foundation of China (No. 8227091646 and No. 81730068 to HL), the National Natural Science Foundation of China (NO. 8223000760 to HL, No. 81972034 and No. 92068104 to RX), the Research and Development Program in Key Areas of Hunan Province (NO. 2020SK2077 to HL) and the Science and Technology Major Project of Changsha (No. kh2102015 to HL). Availability of data and materials All data generated or analyzed during this study are included in this article. Single cell RNA-Sequencing datasets GSE225820 could be archieved on GEO database. The link is: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE225820. And the secure token is czqfcigynlcxlul. Dataset access will be immediately opened upon request after the manuscript is accepted. Ethics approval and consent to participate All studies were conducted in compliance with the Declaration of Helsinki (1964). For clarification of the ethics approval, detailed informations are listed below. Title of the approved project: Development and functional research of a triphasic-biomimetic scaffold for ACL reconstruction. Name of the institutional: Medical Ethics Committee of Xiangya Hospital Central South University. Approval number: 202201012. Date of approval: January 20 th , 2022. Written informed consents were signed and obtained from all donors before collecting umbilical cord blood, Wharton’s Jelly, placenta and adipose tissues. All tissue harvesting procedure had no impact on the surgery. Consent for publication Not applicable. Competing interests The authors declare no competing financial interests. Authors’ contributions H.L. and RX. designed experiments. H.L, R.X. and Z.L wrote the manuscript. Y.X. and J.X. performed experiments. X.S. and X.Q. collected and analyzed the data. W.L., T.Z., Y.C. N.L. and J.H. assisted in the experiments. Yan Xu, Jinrui Xun and Zan Li contributed equally to this work. References Nguyen PK, Rhee JW, Wu JC. Adult Stem Cell Therapy and Heart Failure, 2000 to 2016: A Systematic Review. JAMA CARDIOL. 2016;1(7):831-41. Choumerianou DM, Dimitriou H, Kalmanti M. Stem cells: promises versus limitations. Tissue Eng Part B Rev. 2008;14(1):53-60. Kalamegam G, Memic A, Budd E, Abbas M, Mobasheri A. A Comprehensive Review of Stem Cells for Cartilage Regeneration in Osteoarthritis. ADV EXP MED BIOL. 2018;1089:23-36. Bianco P, Robey PG. Skeletal stem cells. DEVELOPMENT. 2015;142(6):1023-7. Matsiko A, Levingstone TJ, O'Brien FJ. Advanced Strategies for Articular Cartilage Defect Repair. Materials (Basel). 2013;6(2):637-68. Ambrosi TH, Longaker MT, Chan CKF. A Revised Perspective of Skeletal Stem Cell Biology. FRONT CELL DEV BIOL. 2019;7:189. Sipp D, Robey PG, Turner L. Clear up this stem-cell mess. NATURE. 2018;561(7724):455-7. Chan CK, Lindau P, Jiang W, Chen JY, Zhang LF, Chen CC, et al. Clonal precursor of bone, cartilage, and hematopoietic niche stromal cells. Proc Natl Acad Sci U S A. 2013;110(31):12643-8. Charles, Eun, James, Lo D, McArdle A, Sinha R, et al. Identification and Specification of the Mouse Skeletal Stem Cell. CELL. 2015;160(1-2):285-98. Chan CKF, Gulati GS, Sinha R, Tompkins JV, Lopez M, Carter AC, et al. Identification of the Human Skeletal Stem Cell. CELL. 2018;175(1):43-56.e21. Ambrosi TH, Scialdone A, Graja A, Gohlke S, Jank AM, Bocian C, et al. Adipocyte Accumulation in the Bone Marrow during Obesity and Aging Impairs Stem Cell-Based Hematopoietic and Bone Regeneration. CELL STEM CELL. 2017;20(6):771-84.e6. Murphy MP, Koepke LS, Lopez MT, Tong X, Ambrosi TH, Gulati GS, et al. Articular cartilage regeneration by activated skeletal stem cells. NAT MED. 2020;26(10):1583-92. Debnath S, Yallowitz AR, McCormick J, Lalani S, Zhang T, Xu R, et al. Discovery of a periosteal stem cell mediating intramembranous bone formation. NATURE. 2018;562(7725):133-9. Mizuhashi K, Ono W, Matsushita Y, Sakagami N, Takahashi A, Saunders TL, et al. Resting zone of the growth plate houses a unique class of skeletal stem cells. NATURE. 2018;563(7730):254-8. Hong P, Yang H, Wu Y, Li K, Tang Z. The functions and clinical application potential of exosomes derived from adipose mesenchymal stem cells: a comprehensive review. STEM CELL RES THER. 2019;10(1):242. Zhou W, Lin J, Zhao K, Jin K, He Q, Hu Y, et al. Single-Cell Profiles and Clinically Useful Properties of Human Mesenchymal Stem Cells of Adipose and Bone Marrow Origin. Am J Sports Med. 2019;47(7):1722-33. Chen C, Zhang T, Liu F, Qu J, Chen Y, Fan S, et al. Effect of Low-Intensity Pulsed Ultrasound After Autologous Adipose-Derived Stromal Cell Transplantation for Bone-Tendon Healing in a Rabbit Model. Am J Sports Med. 2019;47(4):942-53. Reyhani S, Abbaspanah B, Mousavi SH. Umbilical cord-derived mesenchymal stem cells in neurodegenerative disorders: from literature to clinical practice. REGEN MED. 2020;15(4):1561-78. Brown C, McKee C, Bakshi S, Walker K, Hakman E, Halassy S, et al. Mesenchymal stem cells: Cell therapy and regeneration potential. J Tissue Eng Regen Med. 2019;13(9):1738-55. Zhang C, Zhang C, Xu Y, Li C, Cao Y, Li P. Exosomes derived from human placenta-derived mesenchymal stem cells improve neurologic function by promoting angiogenesis after spinal cord injury. NEUROSCI LETT. 2020;739:135399. Miki T. Stem cell characteristics and the therapeutic potential of amniotic epithelial cells. AM J REPROD IMMUNOL. 2018;80(4):e13003. Marino L, Castaldi MA, Rosamilio R, Ragni E, Vitolo R, Fulgione C, et al. Mesenchymal Stem Cells from the Wharton's Jelly of the Human Umbilical Cord: Biological Properties and Therapeutic Potential. INT J STEM CELLS. 2019;12(2):218-26. Balducci L, Alessandri G. Isolation, Expansion, and Immortalization of Human Adipose-Derived Mesenchymal Stromal Cells from Biopsies and Liposuction Specimens. Methods Mol Biol. 2016;1416:259-74. Beeravolu N, McKee C, Alamri A, Mikhael S, Brown C, Perez-Cruet M, et al. Isolation and Characterization of Mesenchymal Stromal Cells from Human Umbilical Cord and Fetal Placenta. J Vis Exp. 2017(122). Chatzistamatiou TK, Papassavas AC, Michalopoulos E, Gamaloutsos C, Mallis P, Gontika I, et al. Optimizing isolation culture and freezing methods to preserve Wharton's jelly's mesenchymal stem cell (MSC) properties: an MSC banking protocol validation for the Hellenic Cord Blood Bank. TRANSFUSION. 2014;54(12):3108-20. Xiao H, Zhang T, Li C, Cao Y, Wang L, Chen H, et al. Mechanical stimulation promotes enthesis injury repair by mobilizing Prrx1(+) cells via ciliary TGF-β signaling. ELIFE. 2022;11. Cheng D, Yan X, Qiu G, Zhang J, Wang H, Feng T, et al. Contraction of basal filopodia controls periodic feather branching via Notch and FGF signaling. NAT COMMUN. 2018;9(1):1345. Girardi F, Taleb A, Ebrahimi M, Datye A, Gamage DG, Peccate C, et al. TGFβ signaling curbs cell fusion and muscle regeneration. NAT COMMUN. 2021;12(1):750. Zheng GX, Lau BT, Schnall-Levin M, Jarosz M, Bell JM, Hindson CM, et al. Haplotyping germline and cancer genomes with high-throughput linked-read sequencing. NAT BIOTECHNOL. 2016;34(3):303-11. Butler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. NAT BIOTECHNOL. 2018;36(5):411-20. Gulati GS, Sikandar SS, Wesche DJ, Manjunath A, Bharadwaj A, Berger MJ, et al. Single-cell transcriptional diversity is a hallmark of developmental potential. SCIENCE. 2020;367(6476):405-11. Ding DC, Shyu WC, Lin SZ. Mesenchymal stem cells. CELL TRANSPLANT. 2011;20(1):5-14. Li B, Zhang Q, Sun J, Lai D. Human amniotic epithelial cells improve fertility in an intrauterine adhesion mouse model. STEM CELL RES THER. 2019;10(1):257. Chan TM, Chen JY, Ho LI, Lin HP, Hsueh KW, Liu DD, et al. ADSC therapy in neurodegenerative disorders. CELL TRANSPLANT. 2014;23(4-5):549-57. Zwick RK, Guerrero-Juarez CF, Horsley V, Plikus MV. Anatomical, Physiological, and Functional Diversity of Adipose Tissue. CELL METAB. 2018;27(1):68-83. Hendawy H, Kaneda M, Metwally E, Shimada K, Tanaka T, Tanaka R. A Comparative Study of the Effect of Anatomical Site on Multiple Differentiation of Adipose-Derived Stem Cells in Rats. CELLS-BASEL. 2021;10(9). He L, He T, Xing J, Zhou Q, Fan L, Liu C, et al. Bone marrow mesenchymal stem cell-derived exosomes protect cartilage damage and relieve knee osteoarthritis pain in a rat model of osteoarthritis. STEM CELL RES THER. 2020;11(1):276. Zhang R, Ma J, Han J, Zhang W, Ma J. Mesenchymal stem cell related therapies for cartilage lesions and osteoarthritis. AM J TRANSL RES. 2019;11(10):6275-89. Frontini A, Cinti S. Distribution and development of brown adipocytes in the murine and human adipose organ. CELL METAB. 2010;11(4):253-6. Rosen ED, Spiegelman BM. What we talk about when we talk about fat. CELL. 2014;156(1-2):20-44. Reumann MK, Linnemann C, Aspera-Werz RH, Arnold S, Held M, Seeliger C, et al. Donor Site Location Is Critical for Proliferation, Stem Cell Capacity, and Osteogenic Differentiation of Adipose Mesenchymal Stem/Stromal Cells: Implications for Bone Tissue Engineering. INT J MOL SCI. 2018;19(7). Levi B, James AW, Glotzbach JP, Wan DC, Commons GW, Longaker MT. Depot-specific variation in the osteogenic and adipogenic potential of human adipose-derived stromal cells. PLAST RECONSTR SURG. 2010;126(3):822-34. Russo V, Yu C, Belliveau P, Hamilton A, Flynn LE. Comparison of human adipose-derived stem cells isolated from subcutaneous, omental, and intrathoracic adipose tissue depots for regenerative applications. Stem Cells Transl Med. 2014;3(2):206-17. Supplementary Files Supplementaryfigure1.docx WBrawuncropped.pptx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2356002","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":182594536,"identity":"e4644a3e-2ba7-4eaa-a0a5-78f75c5adac0","order_by":0,"name":"Yan Xu","email":"","orcid":"","institution":"Xiangya Hospital Central South University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Xu","suffix":""},{"id":182594537,"identity":"13e946a0-5581-478f-9d08-83ebd2e5404c","order_by":1,"name":"Jinrui Xun","email":"","orcid":"","institution":"Xiangya Hospital Central South University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jinrui","middleName":"","lastName":"Xun","suffix":""},{"id":182594538,"identity":"238aaacc-6685-40a2-9174-205748fc1ecf","order_by":2,"name":"Zan Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIie3QIWsDMRTA8fcIJCZQG9XPUDi4mbJ9kJqEwbmDyoiJlEFqrsy2Zv0Kq5ldjkBrDmoHNadOTbSualvaudHrMTeRvwzvR3gPIBb7h7FHoFADcJw+HWp9eiLEXCXcByIB+qRwyaA6E+wg7ockbC5TcSbQRRhraqmHamZkpp32o940kKN+bSeE3wxklamFcet3V2X53KPBotq1kjvCqVDWq9VkYncHO8xNIARtO+GENUJ9fqk3T+i4tCJfdhNIhTIuQUsplOGXl27CUyHX930sOBGnXVaBlNd24b1NI/YPtxyXH7gPF8uft76sj7qdXM79cT4Wi8Viv/oGBDhca2lQAS0AAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-4873-4471","institution":"Xiangya Hospital, Central South University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Zan","middleName":"","lastName":"Li","suffix":""},{"id":182594539,"identity":"589ba916-aa92-42f3-9778-f5543a2f7be0","order_by":3,"name":"Wenqiang Lou","email":"","orcid":"","institution":"Xiangya Hospital Central South University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wenqiang","middleName":"","lastName":"Lou","suffix":""},{"id":182594540,"identity":"9bca7d69-73dd-4bc6-9b19-5786a7a4eaa9","order_by":4,"name":"Xin Shi","email":"","orcid":"","institution":"Xiangya Hospital Central South University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Shi","suffix":""},{"id":182594541,"identity":"51eb3886-4244-4ce5-9b60-a1bf65a909a2","order_by":5,"name":"Xinzhu Qiu","email":"","orcid":"","institution":"Xiangya Hospital Central South University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xinzhu","middleName":"","lastName":"Qiu","suffix":""},{"id":182594542,"identity":"f900679b-aadb-4d01-8275-56e0dcaf41bb","order_by":6,"name":"Tao Zhang","email":"","orcid":"","institution":"Xiangya Hospital Central South University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Zhang","suffix":""},{"id":182594543,"identity":"7009ff56-7026-4fa6-876f-07aa6b98de93","order_by":7,"name":"Cao Yong","email":"","orcid":"","institution":"Xiangya Hospital Central South University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Cao","middleName":"","lastName":"Yong","suffix":""},{"id":182594544,"identity":"5c629e38-cb49-45cb-aa3a-a9b86f7a0cd2","order_by":8,"name":"Na Li","email":"","orcid":"","institution":"Xiamen University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Li","suffix":""},{"id":182594545,"identity":"a51ee28f-e0ab-4326-8124-8c1cd201faa2","order_by":9,"name":"Jianzhong Hu","email":"","orcid":"","institution":"Xiangya Hospital Central South University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jianzhong","middleName":"","lastName":"Hu","suffix":""},{"id":182594546,"identity":"50b4bb92-9d14-49eb-80cd-2eaa43005ed8","order_by":10,"name":"Ren Xu","email":"","orcid":"","institution":"Xiamen University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ren","middleName":"","lastName":"Xu","suffix":""},{"id":182594547,"identity":"f037250f-efd1-47ae-ac87-a3a7837fac11","order_by":11,"name":"Hongbin Lu","email":"","orcid":"https://orcid.org/0000-0001-7749-3593","institution":"Xiangya Hospital Central South University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hongbin","middleName":"","lastName":"Lu","suffix":""}],"badges":[],"createdAt":"2022-12-08 03:41:04","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2356002/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2356002/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":34381154,"identity":"36ff0980-b9bc-4313-9821-dd80c95d9ad8","added_by":"auto","created_at":"2023-03-16 20:59:23","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":100688,"visible":true,"origin":"","legend":"\u003cp\u003eFlowchart depicting the experimental design.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-2356002/v1/ede2b73fe553639d80c4dab4.png"},{"id":34380064,"identity":"4c5ba1e6-ff34-4a44-a849-16d53be3b059","added_by":"auto","created_at":"2023-03-16 20:51:23","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":545420,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of hSSCLCs in different tissues. (A)Flow cytometry analysis of hSSCLCs abundancy from different tissues and (B)bar graph showing highest percentage of hSSCLCs in adipose tissue whereas cord blood, Wharton’s Jelly contain few hSSCLCs and placenta-hSSCLCs were significant lower. Results were presented as mean ± SEM, n=3. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-2356002/v1/3a19b350ae1782235d8ce92f.png"},{"id":34381151,"identity":"a98c41cf-7321-47ca-97a7-81c739552080","added_by":"auto","created_at":"2023-03-16 20:59:23","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":229717,"visible":true,"origin":"","legend":"\u003cp\u003eAnatomical variation revealed IPFP as a delightful source of adipose-derived hSSCLCs. (A-B) Flow cytometry results showing that the adipose-derived hSSCLC amounts varied with donor sites, n=3. (C-D)\u003cstrong\u003e \u003c/strong\u003eRepresentative immunofluorescence images of adipose-derived hSSCLCs from donor sites. The hSSCLCs were represented with cells commonly positive for three markers (CD164, PDPN, and CD73). Among ASAT, GSAT, DSAT, and IPFP, most hSSCLCs were contained in IPFP, n=4. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-2356002/v1/ed174b4a9540eb8d8200a29b.png"},{"id":34380065,"identity":"c6045cfc-a9ae-4cad-9d68-1317a8008b9e","added_by":"auto","created_at":"2023-03-16 20:51:23","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":867044,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of self-renewal capacity of adipose-derived hSSCLCs from different depots (A) Morphology of adipose-derived hSSCLCs isolated from different donor sites. (B) Colony-forming unit assay of the isolated cells after 21 days of culture. (C) Statistics of CFU assay, n=4. (D) The proliferation capacities of hSSCLCs isolated from different anatomic sites and ASCs were assessed by the CCK-8 assay. Four samples were measured for each time point. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-2356002/v1/16c932140eac31a3ea35b476.png"},{"id":34380069,"identity":"d6601f77-8956-4c67-98c2-9d8a2cd0d3e7","added_by":"auto","created_at":"2023-03-16 20:51:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":212547,"visible":true,"origin":"","legend":"\u003cp\u003eChondrogenic and osteogenic potential in adipose-derived hSSCLCs from different donor sites. Uncropped immunoblotting results are displayed in Supplementary Figure 1. (A) Relative mRNA expression of \u003cem\u003eSOX9\u003c/em\u003e, \u003cem\u003eCOL2A1\u003c/em\u003e and \u003cem\u003eACAN\u003c/em\u003e of differentiated ASC and hSSCLCs examined by qRT-PCR. (n=3) (B) Relative protein expression level of SOX9 in differentiated ASC and hSSCLCs examined by WB (top) and quantification (bottom). (n=3) (C) The comparison of glycosaminoglycan (GAG) levels evaluated by Alcian Blue (AB) staining (top) and quantification (bottom). (D) Relative mRNA expression of \u003cem\u003eRUNX2\u003c/em\u003e, \u003cem\u003eBGLAP\u003c/em\u003e, and \u003cem\u003eSPP1\u003c/em\u003e of differentiated ASC and hSSCLCs examined by qRT-PCR. (n=3) (E) Relative protein expression of RUNX2 in differentiated ASC and hSSCLCs examined by WB (top) and quantification (bottom). (n=3) (F) Calcium deposits comparison evaluated by Alizarin Red staining (top) and quantification (bottom). (n=3) *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-2356002/v1/142996b69b52f166225f6c8d.png"},{"id":34381549,"identity":"5798e2c3-ae84-4ef5-800f-f7c621e710d2","added_by":"auto","created_at":"2023-03-16 21:07:23","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":390683,"visible":true,"origin":"","legend":"\u003cp\u003eSingle-cell RNA sequencing revealed transcriptomic differences between IPFP- and DSAT-derived hSSCLCs. (A) Uniform Manifold Approximation and Projection for Dimension Reduction (UMAP) representation of cell types by ScRNA-seq color-coded for the indicated cell type. ASPC, adipose stem and progenitor cells; NK, natural-killer cell. (B) Violin plot showing expression of marker gene for each cell type. (C) Density plots showing expression of the markers used to define hSSCLCs. (D) Subclustering of ASPCs into 3 phenotypes, as indicated by the color-coded legend. (E) Violin plots of the markers used to define hSSCLCs. (F) UMAP panels stratified ASPC subclusters of IPFP vs DSAT. (G) The relative contribution of each ASPC cell phenotype in IPFP vs DSAT. (H) The predicted cell differentiation state scoring of each ASPC cell phenotype in IPFP vs DSAT estimated by CytoTRACE. (I) Gene ontology analysis of the top 50 differential expressed genes (DEGs) between hSSCLCs from IPFP and BSAT. (J) The predicted cell differentiation state scoring of hSSCLCs from IPFP and DSAT estimated by CytoTRACE. (K) The chondroblastic differentiation scores of hSSCLCs from IPFP and DSAT. (L) The osteoblastic differentiation scores of hSSCLCs from IPFP and DSAT.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-2356002/v1/50278e3bd9bff704df1e653b.png"},{"id":35437222,"identity":"f1725f26-adf8-438c-8ccb-c2bca2ac17fa","added_by":"auto","created_at":"2023-04-07 08:49:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3173397,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2356002/v1/6611caac-1cc7-4386-9571-f2010092791d.pdf"},{"id":34381153,"identity":"d46d515b-18ca-4988-9ea9-df640c9a1c7f","added_by":"auto","created_at":"2023-03-16 20:59:23","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":789177,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfigure1.docx","url":"https://assets-eu.researchsquare.com/files/rs-2356002/v1/c818170ef6086331c25fd6a3.docx"},{"id":34380071,"identity":"b00b62f0-f91f-4560-b18c-df80361c6e21","added_by":"auto","created_at":"2023-03-16 20:51:23","extension":"pptx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1119084,"visible":true,"origin":"","legend":"","description":"","filename":"WBrawuncropped.pptx","url":"https://assets-eu.researchsquare.com/files/rs-2356002/v1/e660996c01df663e4d483712.pptx"}],"financialInterests":"","formattedTitle":"Identification and characterization of human skeletal stem cell-like cells derived from infrapatellar fat pad","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAlbeit rapid progress in developing stem cell therapies have been jointly made by researchers and clinical workers, limitations and concerns in clinical process including unclarified indications, unspecified dosing, potential of tumorigenesis and, specifically, lacking the source of stem cell strongly blockade expanding practical usage of stem cell therapies\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Moreover, lacking knowledge of stem cell properties can lead to undesired outcomes in tissue repair. For instance, it had been limited in current regenerative therapies taking advantage of mesenchymal stromal cells (MSCs), for treating osteoarthritis due to MSC-derived cartilage failed to structurally and biomechanically mimic the characteristics of native articular cartilage\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. It is of great interest for regenerative medicine to advance the understanding on intrinsic physiological activities and uncover a satisfying sourceful tissue for isolation of therapeutical stem cells, even stem-cell like cells.\u003c/p\u003e \u003cp\u003eTissue-residing stem cell came into sight along with their bona-fide lineage commitment and motivated biological activities\u003csup\u003e[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Among which skeletal stem cells (SSCs) represent a crucial population for their essential role in both bone accrual and regeneration, as well as cartilaginous process. SSCs had been meticulously defined through a combined cluster of surface markers and rigorous transplant assay for assessment of their self-renewal capacity\u003csup\u003e[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Rodent studies further convinced abnormalities of SSCs is closely related to various disease process such as aging-related bone loss and osteoarthritis\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Thus, it is of great interest for researchers to strengthen the comprehension of SSCs in treating skeletal disorders. And the discovery of available tissue sources to harvest SSCs might be favorable for researchers and clinical workers to regenerate tissues that mostly mimic the physiological properties of native organs in treating skeletal diseases. However, it should not be overlooked that SSC only consists a small amount of bone cells (less than ~\u0026thinsp;0.1\u0026permil; of total bone cells) with apparent anatomical signatures which implied isolation of SSCs simply from bone marrow, growth plate and periosteum can be more complicated\u003csup\u003e[\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. All those issues strongly restricted the practical translation of fundamental discovery of SSCs into real clinical usage. This eventually leads researchers to explore a suitable source of SSCs, or even SSC-like cells (SSCLCs), that can be easy to collect.\u003c/p\u003e \u003cp\u003eIt had been widely appreciated that non-skeletal organs also contain substantial amounts of mesenchymal stem and progenitor cells. Among all those tissues adipose tissue and maternal tissue predominantly drew researchers\u0026rsquo; attention for their accessibility in clinical practices. Adipose tissues were considered as one of the most abundant sources of MSCs, namely adipose-derived stromal cells (ASCs). These cells not only duplicated self-renew and differentiation capacity of bone marrow-derived MSCs (BMSCs), but also exhibited strong ancillary functions in supporting physiological behavior of other cells\u003csup\u003e[\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. In addition to adipose tissue, umbilical cord, Warton\u0026rsquo;s Jelly and placenta had also been confirmed as crucial sources of MSCs and fundamentally proved to be valuable in treating multiple diseases\u003csup\u003e[\u003cspan additionalcitationids=\"CR19 CR20 CR21\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Thus, it is plausible for us to assume these tissues are also major sources for skeletal stem-cell like cells (SSCLCs) in future usage of tissue regeneration.\u003c/p\u003e \u003cp\u003eHere, following previous strategies in defining human SSCs, we took advantage of flow-cytometry activated cell sorting (FACS) to explore the existence of human SSCLCs (hSSCLCs) in non-skeletal organs including umbilical cord blood, Wharton\u0026rsquo;s Jelly, placenta and adipose tissues from different anatomical sites. We discovered a relatively high enrichment of hSSCLCs in adipose tissue, especially infrapatellar fat pad (IPFP). Furthermore, we assessed the stemness of hSSCLCs from anatomically diversed adipose depots and discovered IPFP-derived hSSCLCs contain augmented osteogenic and chondrogenic differentiation activities. Eventually, through single-cell RNA sequencing (scRNA-Seq), we transcriptomically defined the differences between IPFP-derived and dorsal subcutaneous adipose tissue (DSAT)-derived hSSCLCs. And we confirmed hSSCLCs from IPFP-hSSCLCs are less differentiated but more motivated in osteogenesis and chondrogenesis. To sum up, we first isolated, identified, and interpreted the existence of hSSCLCs in non-skeletal organs. And we successfully elucidated their capacity in regenerating bony and cartilaginous tissues through in vitro assays. Our study implied adipose tissue as a reliable source of hSSCLCs in future administration of multiple diseases associated with bone and/or cartilage defects.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEthics statement\u003c/h2\u003e \u003cp\u003e We conducted research in accordance with the Declaration of Helsinki (1964) and this study was approved by the Ethics Committee of Xiangya Hospital, Central South University (institutional review board equivalent) (202201012).\u003c/p\u003e \u003cp\u003e Written informed consent was signed and obtained from all participants involved in the study. Umbilical cord blood, Wharton\u0026rsquo;s Jelly and placenta samples were obtained post-delivery from Xiangya hospital. Adipose tissues were collected from patients undergoing surgical treatment undergoing lumbar canal stenosis (DSAT), femoral neck fracture (GSAT), meniscal injury (IPFP) and digestive diseases (ASAT). The harvesting procedure had no impact on the surgery.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCell Isolation\u003c/h3\u003e\n\u003cp\u003eIsolation of single cell suspension was performed based on previously validated protocols\u003csup\u003e[\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. In brief, human tissues were minced into small pieces, washed two to three times with ice-cold Hanks Solution, and digested for about 1h at 37\u0026deg;C. For maternal tissues, the enzyme mix consists 3\u0026permil; (w/v) hyaluronidase and collagenase II in HANK\u0026rsquo;s balanced salt solution (Sigma, USA). For adipose tissues, the enzyme mix consists 0.25% (w/v) collagenase I (Worthington, USA) and 1% Dispase II (Roche, Swiss) in HANK\u0026rsquo;s balanced salt solution (Sigma, USA). The digestion was stopped by adding the same volume of culture medium (DMEM 4.5 g/L glucose, 10% FCS) and tissue lysates were filtered through a 70-\u0026micro;m nylon mesh. Filtered cell suspensions were then centrifuged at 500 x g for 5 minutes. Cell pellets were then subjected to FACS for isolation of hSSCLCs.\u003c/p\u003e\n\u003ch3\u003eFluorescence Activated Cell Sorting (Facs)\u003c/h3\u003e\n\u003cp\u003ehSSCLCs were isolated through FACS following previously reported protocols\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. hSSCLCs should express podoplanin (PDPN), NT5E (CD73), and CD164 as their positive surface markers but lacking PTPRC (CD45), GYPA (CD235a), PECAM1 (CD31), and MCAM (CD146), which are consistent to previous study conducted by Chan et al \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAfter isolation, prepared single-cell suspensions were washed once with ice-cold Flow Cytometry Staining Buffer (Thermofisher scientific, USA) followed by incubation with Fc blocking buffer containing Hu BD Fc Block NALE FC1.3216 (1:200 dilution, BD PharMingen Serotec, USA) for 15 minutes. Protected from light, cells were then incubated for 15 minutes on ice with a mixture of following antibodies in Flow Cytometry Staining Buffer: anti-CD45 Percp/cy5.5, anti-CD235 Percp/cy5.5, anti-CD31 Percp/cy5.5, anti-CD146 PE/cy7, anti-PDPN APC, anti-CD90 APC/cy7, anti-CD73 FITC, and anti-CD164 PE (all primary antibodies were obtained from Biolegend, USA). Finally, cells were washed twice, re-suspended in Flow Cytometry Staining Buffer before FACS. FACS was performed with a BD FACS Aria\u0026trade; III Sorter (Becton-Dickinson Biosciences, USA). UltraComp eBeads\u0026trade; (01-2222-42, Invitrogen) were used to set initial compensation and Fluorescence minus one (FMO) controls were used for additional compensation and to assess background levels of each stain. Gating strategies were then established based on internal FMO controls to separate positive and negative populations for each cell surface marker. Collected data were further analyzed through FlowJo (Ver 10.1)\u003c/p\u003e\n\u003ch3\u003eImmunofluorescent Staining Of Adipose Tissues\u003c/h3\u003e\n\u003cp\u003eImmunofluorescent staining of human adipose tissues was performed as previously described\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. In brief, adipose tissues were fixed with 4% paraformaldehyde, washed twice in ice-cold PBS, incubated in 15% (w/v) sucrose in PBS solution at 4℃ overnight and embedded in OCT (Sakura, Japan). The specimens were then sectioned into 10\u0026micro;m slides. Cryosectioned slides were blocked by donkey sera, followed by primary antibodies incubation overnight at 4\u0026deg;C. Next day, slides were stained with Alexa Fluor conjugated secondary antibodies including Goat Anti-Rabbit IgG H\u0026amp;L (Alexa Fluor\u0026reg; 488) (Abcam, ab150077), Donkey Anti-Mouse IgG H\u0026amp;L (Alexa Fluor\u0026reg; 594) (Abcam, ab150108) and Donkey Anti-Mouse IgG H\u0026amp;L (Alexa Fluor\u0026reg; 594) (ab150108) at room temperature for an hour. Nuclear staining was performed with DAPI (BD Bioscience) before mounted with Aquatex (Millipore, USA). Fluorescent microscopy was performed through Zeiss LSM 780 (Zeiss, Germany).\u003c/p\u003e \u003cp\u003eThis study employed the following primary antibodies for immunofluorescent staining: Anti-Podoplanin/gp36 antibody [18H5] - BSA and Azide free (Abcam, ab10288), Human 5'-Nucleotidase/CD73 Antibody (Bio-Techne, AF5795), and Rabbit Anti-CD164 antibody (Bioss, bs-12688R).\u003c/p\u003e\n\u003ch3\u003eIn Vitro Culture Of Hssclcs\u003c/h3\u003e\n\u003cp\u003eSorted hSSCLCs were cultured in 75 cm\u003csup\u003e2\u003c/sup\u003e culture dishes (Nunclon, Thermo Scientific, Waltham, MA, USA) at a density of 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/dish in a standard CO\u003csub\u003e2\u003c/sub\u003e incubator (37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e). The culture medium, comprised of DMEM supplemented with 10% human platelet lysate (Sigma-Aldrich, USA), 100 U/ml penicillin, and 0.1 mg/ml streptomycin (1% pen-strep; Life Technologies, Burlington, Canada), was refreshed every three days. Cells were passaged until 80% confluence. When reaching passage 3, hSSCLCs were used for downstream differentiation assays.\u003c/p\u003e\n\u003ch3\u003eChondrogenic Differentiation And Alcian Blue (Ab) Staining\u003c/h3\u003e\n\u003cp\u003eChondrogenic differentiation induction of hSSCLCs was performed taking advantage of a commercial kit (HyCyte\u0026trade; hASC Chondrogenic Differentiation Media, HyCyte Biosciences, China) following manufacturer\u0026rsquo;s instructions. Briefly, hSSCLCs at passage 3 were digested and resuspended at a density of 2.0\u0026times;10\u003csup\u003e7\u003c/sup\u003e cells/mL. Pipettes were adopted to drop 20 \u0026micro;L of the cell suspension to the center of 24-well plates. After being cultured in a standard CO\u003csub\u003e2\u003c/sub\u003e incubator (37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e) for 3h, hSSCLCs were adherent to the bottom of the plates. 1mL chondrogenesis media was added to each well and replaced every three days. After 21 days of chondrogenic differentiation induction, hSSCLCs were rinsed with PBS and fixed with 4% paraformaldehyde at RT for 30 min. Samples were then washed once with PBS, and stained with Alcian Blue (HyCyte Biosciences, China) for 30 min at RT before proceeding to imaging.\u003c/p\u003e\n\u003ch3\u003eOsteogenic Differentiation Induction And Alizarin Red S (Ars) Staining\u003c/h3\u003e\n\u003cp\u003eOsteogenic differentiation induction of hSSCLCs was operated utilizing a commercial kit (HyCyte\u0026trade; hASC Osteogenic Differentiation Media, HyCyte Biosciences, China) and following the manufacturer\u0026rsquo;s instructions. For osteogenic induction, hSSCLCs at passage 3 were seeded onto 12-well plates coated with 0.1% gelatin at a density of 2.0\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/well, and cultured in a standard CO\u003csub\u003e2\u003c/sub\u003e incubator (37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e). After the hSSCLCs were 70\u0026ndash;80% confluent, culture media was replaced by osteogenesis media, and the osteogenesis media was refreshed every three days. After 21 days of chondrogenic or osteogenic differentiation induction, hSSCLCs were rinsed with PBS and fixed with 4% paraformaldehyde at RT for 30 min. Samples were then washed once with PBS, and stained with Alizarin Red S staining solution (HyCyte Biosciences, China) for 30 min at RT before proceeding for imaging.\u003c/p\u003e\n\u003ch3\u003eReverse Transcription-quantitative Polymerase Chain Reaction (Rt-qpcr)\u003c/h3\u003e\n\u003cp\u003eAfter chondrogenic or osteogenic induction for 3 days and 7 days, the total RNA of hSSCLCs was extracted through the classic TRIzol protocol\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. 2\u0026micro;g total RNA of each sample was used for cDNA synthesis taking advantage of GoScript\u0026trade; Reverse Transcription Kit (A5001, Promega, USA). The qRT-PCR was performed with GoTaq\u0026reg;qPCR Master Mix (A6001, Promega, USA) according to the manufacturer\u0026rsquo;s instructions. Target gene expression relative to \u003cem\u003eGAPDH\u003c/em\u003e was calculated by the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method. Detailed information of related primers is shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used for qRT-PCR analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eRUNX2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTTACTGTCATGGCGGGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCTCAGATCGTTGAACCTTGCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBGLAP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCGCTACCTGTATCAATGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGTGGTCAGCCAACTCGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSPP1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCATTGACTCGAACGACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAGGTCTGCGAAACTTCTTAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSOX9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCGAACGCACATCAAGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTGTAGGCGATCTGTTGGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCOL2A1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGACGATCAGGCGAAACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTGCGGATGCTCTCAATCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eACAN\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCCTGCTATTTCATCGACCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGACACACGGCTCCACTTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGCGAGATCCCTCCAAAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGCTGTTGTCATACTTCTCATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eWestern Blotting\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eWestern blotting\u003c/div\u003e \u003cp\u003eProtein isolation and Western blotting were performed as previously described\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. After 3 days and 7 days of chondrogenic or osteogenic induction, respectively, cells were lysed in RIPA buffer (R10010, Solarbio, China)for the collection of total protein. BCA assay kit (Thermo Fisher, USA) was applied to determine the protein concentration. After 5 minutes of denaturing at 95 ℃, 5 mg total protein of each sample was loaded in each lane in standard polyacrylamide gels. After electrophoresis, the protein was transferred to a PVDF membrane (Millipore). Blocking and antibody binding were conducted in Tris-buffered saline-Tween buffer with 5% nonfat skimmed milk. The primary antibodies used were recombinant Anti-SOX9 antibody (ab185230, Abcam) and Anti-RUNX2 antibody (ab76956, Abcam) and secondary antibodies were Goat anti-Mouse HRP and Goat anti‐Rabbit HRP respectively. The bands were visualized with the ECL plus kit (P0018, Beyotime, China).\u003c/p\u003e\n\u003ch3\u003eSingle-cell Rna Sequencing\u003c/h3\u003e\n\u003cp\u003eFor ScRNA-seq, dorsal subcutaneous adipose tissue (DSAT) and IPFP were harvested from 3 patients each for library preparation. The library was generated using 10x Genomics Single-Cell V2 Library Construction (Genenergy, Shanghai, China), and sequenced using the Illumina NextSeq 500 Sequencing System, after which the raw reads were analyzed using the Cell Ranger Single Cell Software Suite\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e and R package Seurat\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. The number of unique molecule identifier (UMI) counts and genes were examined to identify outliers. Dimensionality reduction was done with principal component analysis (PCA), and then UMAP was used for the visualization of the clusters. The Find Conserved Markers function in the Seurat package\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e was used to identify the marker genes and differentially expressed genes (DEGs). Gene Ontology (GO) analysis was significantly enriched according to the DEG results with a false discovery rate\u0026thinsp;\u0026le;\u0026thinsp;0.05. For unsupervised exploration of stemness, CytoTRACE\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e was used to compare differentiation states.\u003c/p\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eQuantitative data are presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;sd (standard deviation). Statistical analyses were performed using Prism 8.2 software (GraphPad). One-way ANOVA followed by a Tukey's multiple comparison test was used to evaluate the difference of hSSCLC percentage among tissues or adipose tissue from different sites and the difference of chondrogenic differentiation assay and osteogenic differentiation assay. Details for statistical analyses, including replicate numbers, are illustrated in the figure legends. Analysis and visualization of flow cytometry data were performed using FlowJo (v10.0.7).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eComparison of hSSCLC amounts in different tissues\u003c/h2\u003e \u003cp\u003eThe source for isolating a high abundance of hSSCLCs requires easy accessibility from clinical practices.Previous studies on MSCs claimed that umbilical cord and placenta enriched a satisfying amount of human MSCs\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Also, human adipose tissue had also been reported for its abundant amounts of MSCs in regenerative medicine\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. We assumed those tissues harbor a cell population whose biological behavior is similar to hSSCs in bone, namely hSSCLCs, that might be valuable for regenerative medicine. To explore the existence of hSSCLCs in non-skeletal tissues, we harvested placenta, Wharton's jelly from human umbilical cord, cord blood, and abdominal subcutaneous adipose tissue for further analysis \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Through flow cytometry, we unexpectedly observed hSSCLCs rarely exist in the Wharton's jelly and cord blood, accompanies by a relatively low abundancy of hSSCLCs in the placenta \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-B\u003cb\u003e)\u003c/b\u003e. To our surprise, hSSCLCs are enriched in the abdominal subcutaneous adipose tissue compared to maternal tissues \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-B\u003cb\u003e)\u003c/b\u003e, which highlights adipose tissue as a better source of hSSCLCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAnatomical Variation Revealed Ipfp As A Delightful Source Of Adipose-derived Hssclcs\u003c/h3\u003e\n\u003cp\u003eAlbeit acknowledged adipose tissue as a more reliable tissue to acquire hSSCLCs, anatomical variety along with the physiological diversity of adipose tissues also raised questions on defining the most suitable source of hSSCLCs from human fat depots\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Adipose tissues that could be accessible during regular surgical approaches such as liposuction, arthroscopy and joint replacement specifically attract our attention such as. dorsal subcutaneous adipose tissue (DSAT), abdominal subcutaneous adipose tissue (ASAT), and gluteal subcutaneous adipose tissue (GSAT), as well as infrapatellar fat pad (IPFP). We then anticipate to compare hSSCLC abundancies in fat depots mentioned above to anatomically define a suitable fat source of hSSCLC isolation. Utilizing our previous gating strategies, we observed hSSCLCs are predominantly enriched in IPFP whereas the percentages of hSSCLCs in DSAT, ASAT and GSAT are significantly lower (30%~50% relative to IPFP-isolated hSSCLCs) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B\u003cb\u003e)\u003c/b\u003e. We\u0026rsquo;ve also conducted immunofluorescence to confirm the distribution of adipose-derived hSSCLCs. Consistent to flow cytometry analysis, the ratio of hSSCLCs, represented by triple-positive cells (CD164+, green; PDPN+, red; CD73+, carnation), were significantly higher in IPFP compared to DSAT, ASAT and GSAT \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D\u003cb\u003e)\u003c/b\u003e. These results suggest that among those human adipose tissues we examined, IPFP is a satisfying source for isolating hSSCLCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eSelf-renewal Capacity Of Adipose-derived Hssclcs From Different Locations\u003c/h3\u003e\n\u003cp\u003eWe then sought to investigate whether functional diversity exists in hSSCLCs isolated from different sites of adipose tissue. With the assistance of FACS, we isolated hSSCLCs and cultured them in vitro for downstream analysis. Adherent cells in round- or spindle-shape could be observed on the 5th -7th day after primary culture \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, \u003cb\u003eupper)\u003c/b\u003e. In passage 3, cells isolated from different sites exhibited a homogenous spindle-shaped morphology \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, \u003cb\u003elower)\u003c/b\u003e. Consequently, we conducted colony-forming unit (CFU) assay to determine the clonogenicity of hSSCLCs. After 21 days of culture, all 4 groups of adipose-derived hSSCLCs showed similar clonogenicity compared to ASC groups \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-C\u003cb\u003e).\u003c/b\u003e Furthermore, CCK8 indicated a similar proliferative capacity of hSSCLCs and ASCs at 3\u0026ndash;5 days \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. Collectively, these results suggested the capacity of self-renewal in adipose-derived hSSCLCs is similar to ASCs, which indicates hSSCLCs as a promising source for regenerative medicine. And these results lead us to explore whether their differentiation potentials differ from each others.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eChondrogenic And Osteogenic Potential Of Adipose-derived Hssclcs From Different Donor Sites\u003c/h3\u003e\n\u003cp\u003eTaking advantage of adipose-derived stromal cells (ASCs), previous studies confirmed anatomical locations have crucial impacts on their differentiation capabilities \u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. Since we are interested in exploring the potential of hSSCLCs on repairing skeletal and cartilaginous defects, we managed to assess the chondrogenic and osteogenic potencies of differentiated hSSCLCs. To explore the chondrogenic potential of hSSCLCs from different depots, we analyzed the expression level of representative transcriptomes which are crucial in chondrogenesis including aggrecan (\u003cem\u003eACAN\u003c/em\u003e), collagen type II (\u003cem\u003eCOL2A1\u003c/em\u003e), and SRY-box transcription factor 9 (\u003cem\u003eSOX9\u003c/em\u003e). Through qRT-PCR, after 3 days and 7 days of chondrogenic induction of hSSCLCs, the expression level of \u003cem\u003eACAN\u003c/em\u003e, \u003cem\u003eCOL2A1\u003c/em\u003e, and \u003cem\u003eSOX9\u003c/em\u003e were drastically increased in hSSCLCs groups compared with unsorted ASCs \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. Notably, through proliferation capacity not significantly varied, the highest level of chondrogenic transcriptomes was detected in IPFP-derived hSSCLCs which suggested an enhanced chondrogenic differentiation potency compared with hSSCLCs in all other groups. And these differences were even more remarkable after 7-day differentiation induction \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. To further assess the chondrogenic potential of hSSCLCs at protein level, western blot (WB) was conducted after 3 days and 7 days of chondrogenic induction. Similarly, compared with the control group, the hSSCLCs groups showed higher protein expression levels of SOX9 while IPFP-derived hSSCLCs showed the highest expression level \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. In addition, Alcian Blue (AB) staining results implied the hSSCLCs from IPFP outperformed in matrix synthesis among all groups \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e, which were consistent with our previous results.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFor osteogenic potential of hSSCLCs, the expression levels of representative osteogenic genes including RUNX family transcription factor 2 (\u003cem\u003eRUNX2\u003c/em\u003e), Bone Gamma-Carboxyglutamate Protein (\u003cem\u003eBGLAP\u003c/em\u003e), and Secreted Phosphoprotein 1 (\u003cem\u003eSPP1\u003c/em\u003e) were examined via qRT-PCR. After 3 days and 7 days of osteogenesis induction, \u003cem\u003eRUNX2\u003c/em\u003e, \u003cem\u003eBGLAP\u003c/em\u003e, and \u003cem\u003eSPP1\u003c/em\u003e mRNA of hSSCLCs groups were significantly higher compared to the unsorted ASCs group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Similar to chondrogenic genes, expression levels of osteogenic transcriptomes in IPFP-hSSCLCs was the highest among all hSSCLCs groups \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. Furthermore, we also conducted immunoblotting to identify the protein expression of RUNX2 after osteogenic-differentiation induction. We confirmed an elevation of RUNX2 synthesis in hSSCLCs group compared to ASCs and IPFP-hSSCLCs synthesized most RUNX2 during osteogenic differentiation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e. These results suggested significant variances in osteogenesis among hSSCLCs from diverse anatomical sites. Additionally, Alizarin Red S (ARS) staining was performed to examine the synthesis of extracellular matrix and calcium deposition during osteogenic differentiation. Consistent with previous results, among all hSSCLCs we\u0026rsquo;ve examined, IPFP-hSSCLCs contain the best capacity in osteogenesis after differentiation induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). All these results verified the osteogenic differentiation potential among hSSCLCs varied determined by anatomical characteristics. More importantly, such motivated manner of IPFP-hSSCLCs in participating in osteogenesis and chondrogenesis greatly revealed their clinical significance that these cells may act as a promising cellular source in regenerating cartilage and bone.\u003c/p\u003e \u003cp\u003e\u003cstrong\u003eSingle-cell RNA sequencing profiled transcriptomic differences between IPFP- and DSAT-derived hSSCLCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo gain mechanistic insight on why IPFP-hSSCLCs are more active in chondrogenesis and osteogenesis, we performed single-cell RNA sequencing (scRNA-seq) on stromal vascular fraction of adipose tissues, isolated\u0026nbsp;hSSCLCs populations and transcriptomically compared the differences of hSSCLCs\u0026nbsp;from DSAT and IPFP.\u0026nbsp;Whole adipose stromal vascular fraction from DSAT and IPFP were clustered into several populations\u0026nbsp;\u003cstrong\u003e(Fig. 6A)\u003c/strong\u003e. Initially, we discovered a majority of hSSCLC population defined as previously described triple-positive cells located within ASPC population\u0026nbsp;\u003cstrong\u003e(Fig. 6B-C)\u003c/strong\u003e. To separate hSSCLCs from ASPCs, we further visualized ASPCs into 3 subsets and determined positive cell surface markers that hSSCLCs expressed to anchor hSSCLC subset\u003cstrong\u003e\u0026nbsp;(Fig. 6D)\u003c/strong\u003e. hSSCLCs defined through our analysis were consistent with the previously reported immunophenotype [CD45(PTPRC)-CD235a- TIE2-CD31(PECAM1)- PDPN+CD146(MCAM)-CD73(NT5E)+CD164+]\u0026nbsp;\u003cstrong\u003e\u0026nbsp;(Fig. 6E)\u003c/strong\u003e \u003csup\u003e[9, 10]\u003c/sup\u003e. \u0026nbsp; Correspondent with our previous results, the comparison between ASPC proportion from different depots revealed a higher percentage of hSSCLCs in IPFP compared to DSAT\u0026nbsp;\u003cstrong\u003e(Fig. 6F-G)\u003c/strong\u003e. CytoTRACE was consequently employed to hierearchically evaluate the differentiation level of each subpopulation in ASPCs. And we confirmed hSSCLCs sits at the apex of the differentiation hierarchy among all these 3 subsets from ASPCs\u003cstrong\u003e\u0026nbsp;(Fig. 6H)\u003c/strong\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLastly, we compared transcriptomic differences between IPFP- and DSAT-derived hSSCLCs. Gene Ontology (GO) analysis on the top 50\u0026nbsp;differential genes (DEGs)\u0026nbsp;revealed IPFP- and DSAT-hSSCLCs favor different biological processes\u0026nbsp;\u003cstrong\u003e(Fig. 6I)\u003c/strong\u003e. In line with our in vitro differentiation assays\u0026nbsp;\u003cstrong\u003e(Fig. 5)\u003c/strong\u003e, transcriptomes related to cartilage development, extracellular matrix organization, extracellular structure organization as well as tissue remodeling, ossification were primarily enriched in IPFP-hSSCLCs compared to hSSCLCs from DSAT\u0026nbsp;\u003cstrong\u003e(Fig. 6I)\u003c/strong\u003e. This addressed the proximal mechanism why IPFP-hSSCLCs harbor augmented osteogenic and chondrogenic capacities compared to other adipose-derived hSSCLCs. Intriguingly, analyzed by CytoTRACE, IPFP-hSSCLCs are less differentiated compared with DSAT-hSSCLCs\u0026nbsp;\u003cstrong\u003e(Fig. 6J)\u003c/strong\u003e. It is likely that IPFP cells retained their stemness in a cycling-promoting context which might attribute to the increased differentiation capability into bony and cartilaginous tissues observed in our previous experiments. Finally,\u0026nbsp;chondroblast and osteoblast differentiation scoring of hSSCLCs from IPFP and DSAT confirmed higher chondroblast and osteoblast differentiation potential of IPFP-hSSCLCs \u003cstrong\u003e(Fig. 6K-L)\u003c/strong\u003e. Taken together, scRNA-Seq analysis revealed that IPFP-hSSCLCs are a promising cellular source for their improved chondrogenic and osteogenic abilities in future translational usage.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eProper functioning of SSCs in murine studies confirmed regenerative value of SSCs in recovery of skeletal disorders. Crucially involved in fracture healing, SSCs proliferate, participate in endochondral ossification and eventually commit into osteoblastic lineage cells to establish bony callus for the reunion of fracture sites\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Additionally, motivated SSCs were actively engaged in the healing process of articular repairing\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. However, limitations such as skeletal abundancy of SSCs may largely prohibit their translational value in clinical usage. As stem cell therapy in treating skeletal disorders emerged encouraging\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e, it is of particular interest to discover a promising source of hSSC, or hSSCLC isolation for translational studies and even clinical practice. Here, we first identified the enrichment of hSSCLCs in non-skeletal tissue, specifically human adipose tissue, and functionally confirmed their physiological activities in self-renewal, multifaceted in contributing to osteogenesis and chondrogenesis. These activities largely mimicked the properties of SSCs albeit most assays were performed in vitro.\u003c/p\u003e \u003cp\u003eAnatomical diversity of adipose tissues also leads to physiological and functional variations. As one of the two majority types of adipose tissue, white adipose tissues (WATs) primarily locate in subcutaneous, intraperitoneal, mesenteric and joint cavities\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. In addition, it had also been proved that anatomic divergence leads to diversed functioning of cells that resides in those tissues\u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. Take MSCs as an example, previous studies on differentiation capacities of ASCs revealed a depot-dependent specificity of the osteogenic and adipogenic potential\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e. In accordance with this, we revealed a population of IPFP-derived hSSCLCs exhibited enhanced osteogenic and chondrogenic preference compared to other adipose-derived hSSCLCs. Indicating this particular type of adipose tissue might be a favorable choice for isolating hSSCLCs with highly motivated activities in developing regenerative therapies or for the usage of tissue engineering. These evidences suggested a context-specificity manner that contribute to the proliferation and differentiation pattern of tissue-residing cells located in varied donor sites of adipose tissue. To address this, we explored both osteo- and chodro-anabolic potency of hSSCLCs derived from different anatomical locations and defined their discrepancies in differentiation. More importantly, we\u0026rsquo;ve also transcriptomically profiled IPFP- and DSAT-hSSCLCs, as a representative for non-IPFP-derived hSSCLCs. scRNA-seq results showing more IPFP-hSSCLCs sits at the apex of differentiation hierarchy. At the same time, IPFP-derived hSSCLCs are more favorable in contributing to chondrogenesis and osteogenesis whereas DSAT-hSSCLCs largely express transcriptomes that are less relevant to cartilage development and bone formation. Suggesting IPFP-hSSCLCs as a promising cellular source for preclinical studies on the development of stem cell therapy in managing diseases associated with bone and/or cartilage defects.\u003c/p\u003e \u003cp\u003eAlthough the strongest osteogenic and chondrogenic capability were detected in IPFP-hSSCLCs, it does not preclude the therapeutical value of other adipose-derived hSSCLCs. Both biopsy and liposuction can generate numerous accessible hSSCLCs since previously study on ASC isolation implied less than 20mL dispersed human adipose tissue can satisfyingly harvest enough MSCs that cover a 12-well-plate culturing\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. From our results, it is surprising to detect a relatively equivalent ratio of hSSCLCs in adipose tissues, especially IPFP-hSSCLCs (~\u0026thinsp;80% relative to previous study), compared with hSSC abundancy reported in proliferative and hypertrophic zone of human skeletal sample\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. To some extent, non-IPFP-hSSCLCs from adipose tissue exhibited similar proliferative activities compared to IPFP-hSSCLCs and exhibited capacity in chondrogenic and osteogenic differentiation though these activities are not as substantial as IPFP-hSSCLCs do. Following a stricted but well-established protocol, it is plausible for researchers to persue an ideal solution by simply increasing the total events of cells that may satisfyingly isolate more hSSCLCs to meet the tremendous requirement for preclinical studies. Thus, though less enriched in non-IPFP adipose depots, hSSCLCs derived from other adipose depots should not be neglected as a compensatory source for isolation of hSSCLCs. Such as applying scaffold in accordance with finely isolated stem cells and ancillary cytokines to enhance their differentiation capacities through conscientiously managing tissue-engineered products might be an encouraging method to achieve regenerating tissues with native characteristics.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, this study first identified human adipose tissue as a promising source of hSSCLCs and clarified preclinical values through identifying their differentiation capacities in vitro. We anticipate that this will support further studies on utilizing non-skeletal SSCLCs in regenerative medicine and/or tissue engineering. Moreover, this study might provide crucial guidance for future studies aiming to explore novel tissue sources for SSCs in non-skeletal organs.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; We would like to thank professor Hui Xie and other staff from Movement System Injury and Repair Research Center, Xiangya Hospital, Central South University, Changsha, China, for their kind assistance during the experiments.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Key Program of the National Natural Science Foundation of China (No. 8227091646 and No. 81730068 to HL), the National Natural Science Foundation of China (NO. 8223000760 to HL, No. 81972034 and No. 92068104 to RX), the Research and Development Program in Key Areas of Hunan Province (NO. 2020SK2077 to HL) and the Science and Technology Major Project of Changsha (No. kh2102015 to HL).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; All data generated or analyzed during this study are included in this article. Single cell RNA-Sequencing datasets GSE225820 could be archieved on GEO database. The link is: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE225820. And the secure token is czqfcigynlcxlul. Dataset access will be immediately opened upon request after the manuscript is accepted.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll studies were conducted in compliance with the Declaration of Helsinki (1964). For clarification of the ethics approval, detailed informations are listed below.\u003c/p\u003e\n\u003cp\u003eTitle of the approved project: Development and functional research of a triphasic-biomimetic scaffold for ACL reconstruction.\u003c/p\u003e\n\u003cp\u003eName of the institutional: Medical Ethics Committee of Xiangya Hospital Central South University.\u003c/p\u003e\n\u003cp\u003eApproval number: 202201012.\u003c/p\u003e\n\u003cp\u003eDate of approval: January 20\u003csup\u003eth\u003c/sup\u003e, 2022.\u003c/p\u003e\n\u003cp\u003eWritten informed consents were signed and obtained from all donors before collecting umbilical cord blood, Wharton\u0026rsquo;s Jelly, placenta and adipose tissues. All tissue harvesting procedure had no impact on the surgery.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Not applicable.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing financial interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH.L. and RX. designed experiments. H.L, R.X. and Z.L wrote the manuscript. Y.X. and J.X. performed experiments. X.S. and X.Q. collected and analyzed the data. W.L., T.Z., Y.C. N.L. and J.H. assisted in the experiments.\u0026nbsp;Yan Xu, Jinrui Xun and Zan Li contributed equally to this work.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eNguyen PK, Rhee JW, Wu JC. Adult Stem Cell Therapy and Heart Failure, 2000 to 2016: A Systematic Review. JAMA CARDIOL. 2016;1(7):831-41.\u003c/li\u003e\n\u003cli\u003eChoumerianou DM, Dimitriou H, Kalmanti M. Stem cells: promises versus limitations. Tissue Eng Part B Rev. 2008;14(1):53-60.\u003c/li\u003e\n\u003cli\u003eKalamegam G, Memic A, Budd E, Abbas M, Mobasheri A. A Comprehensive Review of Stem Cells for Cartilage Regeneration in Osteoarthritis. ADV EXP MED BIOL. 2018;1089:23-36.\u003c/li\u003e\n\u003cli\u003eBianco P, Robey PG. Skeletal stem cells. DEVELOPMENT. 2015;142(6):1023-7.\u003c/li\u003e\n\u003cli\u003eMatsiko A, Levingstone TJ, O\u0026apos;Brien FJ. Advanced Strategies for Articular Cartilage Defect Repair. Materials (Basel). 2013;6(2):637-68.\u003c/li\u003e\n\u003cli\u003eAmbrosi TH, Longaker MT, Chan CKF. A Revised Perspective of Skeletal Stem Cell Biology. FRONT CELL DEV BIOL. 2019;7:189.\u003c/li\u003e\n\u003cli\u003eSipp D, Robey PG, Turner L. Clear up this stem-cell mess. NATURE. 2018;561(7724):455-7.\u003c/li\u003e\n\u003cli\u003eChan CK, Lindau P, Jiang W, Chen JY, Zhang LF, Chen CC, et al. Clonal precursor of bone, cartilage, and hematopoietic niche stromal cells. Proc Natl Acad Sci U S A. 2013;110(31):12643-8.\u003c/li\u003e\n\u003cli\u003eCharles, Eun, James, Lo D, McArdle A, Sinha R, et al. Identification and Specification of the Mouse Skeletal Stem Cell. CELL. 2015;160(1-2):285-98.\u003c/li\u003e\n\u003cli\u003eChan CKF, Gulati GS, Sinha R, Tompkins JV, Lopez M, Carter AC, et al. Identification of the Human Skeletal Stem Cell. CELL. 2018;175(1):43-56.e21.\u003c/li\u003e\n\u003cli\u003eAmbrosi TH, Scialdone A, Graja A, Gohlke S, Jank AM, Bocian C, et al. Adipocyte Accumulation in the Bone Marrow during Obesity and Aging Impairs Stem Cell-Based Hematopoietic and Bone Regeneration. CELL STEM CELL. 2017;20(6):771-84.e6.\u003c/li\u003e\n\u003cli\u003eMurphy MP, Koepke LS, Lopez MT, Tong X, Ambrosi TH, Gulati GS, et al. Articular cartilage regeneration by activated skeletal stem cells. NAT MED. 2020;26(10):1583-92.\u003c/li\u003e\n\u003cli\u003eDebnath S, Yallowitz AR, McCormick J, Lalani S, Zhang T, Xu R, et al. Discovery of a periosteal stem cell mediating intramembranous bone formation. NATURE. 2018;562(7725):133-9.\u003c/li\u003e\n\u003cli\u003eMizuhashi K, Ono W, Matsushita Y, Sakagami N, Takahashi A, Saunders TL, et al. Resting zone of the growth plate houses a unique class of skeletal stem cells. NATURE. 2018;563(7730):254-8.\u003c/li\u003e\n\u003cli\u003eHong P, Yang H, Wu Y, Li K, Tang Z. The functions and clinical application potential of exosomes derived from adipose mesenchymal stem cells: a comprehensive review. STEM CELL RES THER. 2019;10(1):242.\u003c/li\u003e\n\u003cli\u003eZhou W, Lin J, Zhao K, Jin K, He Q, Hu Y, et al. Single-Cell Profiles and Clinically Useful Properties of Human Mesenchymal Stem Cells of Adipose and Bone Marrow Origin. Am J Sports Med. 2019;47(7):1722-33.\u003c/li\u003e\n\u003cli\u003eChen C, Zhang T, Liu F, Qu J, Chen Y, Fan S, et al. Effect of Low-Intensity Pulsed Ultrasound After Autologous Adipose-Derived Stromal Cell Transplantation for Bone-Tendon Healing in a Rabbit Model. Am J Sports Med. 2019;47(4):942-53.\u003c/li\u003e\n\u003cli\u003eReyhani S, Abbaspanah B, Mousavi SH. Umbilical cord-derived mesenchymal stem cells in neurodegenerative disorders: from literature to clinical practice. REGEN MED. 2020;15(4):1561-78.\u003c/li\u003e\n\u003cli\u003eBrown C, McKee C, Bakshi S, Walker K, Hakman E, Halassy S, et al. Mesenchymal stem cells: Cell therapy and regeneration potential. J Tissue Eng Regen Med. 2019;13(9):1738-55.\u003c/li\u003e\n\u003cli\u003eZhang C, Zhang C, Xu Y, Li C, Cao Y, Li P. Exosomes derived from human placenta-derived mesenchymal stem cells improve neurologic function by promoting angiogenesis after spinal cord injury. NEUROSCI LETT. 2020;739:135399.\u003c/li\u003e\n\u003cli\u003eMiki T. Stem cell characteristics and the therapeutic potential of amniotic epithelial cells. AM J REPROD IMMUNOL. 2018;80(4):e13003.\u003c/li\u003e\n\u003cli\u003eMarino L, Castaldi MA, Rosamilio R, Ragni E, Vitolo R, Fulgione C, et al. Mesenchymal Stem Cells from the Wharton\u0026apos;s Jelly of the Human Umbilical Cord: Biological Properties and Therapeutic Potential. INT J STEM CELLS. 2019;12(2):218-26.\u003c/li\u003e\n\u003cli\u003eBalducci L, Alessandri G. Isolation, Expansion, and Immortalization of Human Adipose-Derived Mesenchymal Stromal Cells from Biopsies and Liposuction Specimens. Methods Mol Biol. 2016;1416:259-74.\u003c/li\u003e\n\u003cli\u003eBeeravolu N, McKee C, Alamri A, Mikhael S, Brown C, Perez-Cruet M, et al. Isolation and Characterization of Mesenchymal Stromal Cells from Human Umbilical Cord and Fetal Placenta. J Vis Exp. 2017(122).\u003c/li\u003e\n\u003cli\u003eChatzistamatiou TK, Papassavas AC, Michalopoulos E, Gamaloutsos C, Mallis P, Gontika I, et al. Optimizing isolation culture and freezing methods to preserve Wharton\u0026apos;s jelly\u0026apos;s mesenchymal stem cell (MSC) properties: an MSC banking protocol validation for the Hellenic Cord Blood Bank. TRANSFUSION. 2014;54(12):3108-20.\u003c/li\u003e\n\u003cli\u003eXiao H, Zhang T, Li C, Cao Y, Wang L, Chen H, et al. Mechanical stimulation promotes enthesis injury repair by mobilizing Prrx1(+) cells via ciliary TGF-\u0026beta; signaling. ELIFE. 2022;11.\u003c/li\u003e\n\u003cli\u003eCheng D, Yan X, Qiu G, Zhang J, Wang H, Feng T, et al. Contraction of basal filopodia controls periodic feather branching via Notch and FGF signaling. NAT COMMUN. 2018;9(1):1345.\u003c/li\u003e\n\u003cli\u003eGirardi F, Taleb A, Ebrahimi M, Datye A, Gamage DG, Peccate C, et al. TGF\u0026beta; signaling curbs cell fusion and muscle regeneration. NAT COMMUN. 2021;12(1):750.\u003c/li\u003e\n\u003cli\u003eZheng GX, Lau BT, Schnall-Levin M, Jarosz M, Bell JM, Hindson CM, et al. Haplotyping germline and cancer genomes with high-throughput linked-read sequencing. NAT BIOTECHNOL. 2016;34(3):303-11.\u003c/li\u003e\n\u003cli\u003eButler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. NAT BIOTECHNOL. 2018;36(5):411-20.\u003c/li\u003e\n\u003cli\u003eGulati GS, Sikandar SS, Wesche DJ, Manjunath A, Bharadwaj A, Berger MJ, et al. Single-cell transcriptional diversity is a hallmark of developmental potential. SCIENCE. 2020;367(6476):405-11.\u003c/li\u003e\n\u003cli\u003eDing DC, Shyu WC, Lin SZ. Mesenchymal stem cells. CELL TRANSPLANT. 2011;20(1):5-14.\u003c/li\u003e\n\u003cli\u003eLi B, Zhang Q, Sun J, Lai D. Human amniotic epithelial cells improve fertility in an intrauterine adhesion mouse model. STEM CELL RES THER. 2019;10(1):257.\u003c/li\u003e\n\u003cli\u003eChan TM, Chen JY, Ho LI, Lin HP, Hsueh KW, Liu DD, et al. ADSC therapy in neurodegenerative disorders. CELL TRANSPLANT. 2014;23(4-5):549-57.\u003c/li\u003e\n\u003cli\u003eZwick RK, Guerrero-Juarez CF, Horsley V, Plikus MV. Anatomical, Physiological, and Functional Diversity of Adipose Tissue. CELL METAB. 2018;27(1):68-83.\u003c/li\u003e\n\u003cli\u003eHendawy H, Kaneda M, Metwally E, Shimada K, Tanaka T, Tanaka R. A Comparative Study of the Effect of Anatomical Site on Multiple Differentiation of Adipose-Derived Stem Cells in Rats. CELLS-BASEL. 2021;10(9).\u003c/li\u003e\n\u003cli\u003eHe L, He T, Xing J, Zhou Q, Fan L, Liu C, et al. Bone marrow mesenchymal stem cell-derived exosomes protect cartilage damage and relieve knee osteoarthritis pain in a rat model of osteoarthritis. STEM CELL RES THER. 2020;11(1):276.\u003c/li\u003e\n\u003cli\u003eZhang R, Ma J, Han J, Zhang W, Ma J. Mesenchymal stem cell related therapies for cartilage lesions and osteoarthritis. AM J TRANSL RES. 2019;11(10):6275-89.\u003c/li\u003e\n\u003cli\u003eFrontini A, Cinti S. Distribution and development of brown adipocytes in the murine and human adipose organ. CELL METAB. 2010;11(4):253-6.\u003c/li\u003e\n\u003cli\u003eRosen ED, Spiegelman BM. What we talk about when we talk about fat. CELL. 2014;156(1-2):20-44.\u003c/li\u003e\n\u003cli\u003eReumann MK, Linnemann C, Aspera-Werz RH, Arnold S, Held M, Seeliger C, et al. Donor Site Location Is Critical for Proliferation, Stem Cell Capacity, and Osteogenic Differentiation of Adipose Mesenchymal Stem/Stromal Cells: Implications for Bone Tissue Engineering. INT J MOL SCI. 2018;19(7).\u003c/li\u003e\n\u003cli\u003eLevi B, James AW, Glotzbach JP, Wan DC, Commons GW, Longaker MT. Depot-specific variation in the osteogenic and adipogenic potential of human adipose-derived stromal cells. PLAST RECONSTR SURG. 2010;126(3):822-34.\u003c/li\u003e\n\u003cli\u003eRusso V, Yu C, Belliveau P, Hamilton A, Flynn LE. Comparison of human adipose-derived stem cells isolated from subcutaneous, omental, and intrathoracic adipose tissue depots for regenerative applications. Stem Cells Transl Med. 2014;3(2):206-17.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Skeletal stem cells (SSCs), skeletal stem cell-like cells (SSCLCs), Infrapatellar fat pad (IPFP), Adipose tissue, Regenerative medicine","lastPublishedDoi":"10.21203/rs.3.rs-2356002/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2356002/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eSkeletal stem cells (SSCs) have attracted extensive attention for their crucial role in bone accrual and therapeutical values. The substantial unmet cellular need of regenerative medicine and tissue engineering calls for identification of a novel source for human SSC isolation, or even skeletal stem cell-like cells (SSCLCs).\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003ehSSCLCs were isolated through enzyme-digestion and fluorescent-activated cell sorting (FACS) from human tissues including placenta, cord blood, Wharton\u0026rsquo;s Jelly and various adipose depots. Proportion of hSSCLCs in all those tissues were compared through flow cytometry. For adipose tissue, immunofluorescent staining was also employed to substantiate our flow results. In vitro CFU-F assay, chondrogenic and osteogenic assays were performed to assess self-renewal and multipotency for differentiation of hSSCLCs. Transcriptomic profiling of adipose-derived hSSCLCs was achieved through scRNA-seq.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eHere, we illustrated that adipose tissues contain a satisfying abundancy of hSSCLCs, especially infrapatellar fat pad (IPFP), but not fetal tissues. Moreover, we discovered IPFP-derived hSSCLCs display intact self-renewal and a marked elevation in chondrogenic and osteogenic differentiation. Transcriptomically comparing IPFP-hSSCLCs and dorsal adipose depot (DSAT)-derived hSSCLCs through scRNA-seq, we further demonstrated IPFP-hSSCLCs are less differentiated but more motivated in expressing transcriptomes related to chondrogenic and osteogenic differentiation.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur study first identified adipose tissue as an alternative but encouraging source for isolating hSSCLCs with intact SSC properties which might be promising in treating diseases related to bone and/or cartilage defects.\u003c/p\u003e","manuscriptTitle":"Identification and characterization of human skeletal stem cell-like cells derived from infrapatellar fat pad","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-03-16 20:51:18","doi":"10.21203/rs.3.rs-2356002/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fb7df554-94f9-4c7e-b9d5-8704d126ea5e","owner":[],"postedDate":"March 16th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-04-07T08:48:53+00:00","versionOfRecord":[],"versionCreatedAt":"2023-03-16 20:51:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2356002","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2356002","identity":"rs-2356002","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00