Digital Point-of-care Testing Device based on Bioluminescent Pyrophosphate in Real-time and Recombinase-aid Amplification

Digital Point-of-care Testing Device based on Bioluminescent Pyrophosphate in Real-time and Recombinase-aid Amplification | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 21 June 2025 V1 Latest version Share on Digital Point-of-care Testing Device based on Bioluminescent Pyrophosphate in Real-time and Recombinase-aid Amplification Authors : Zhongjie Fei 0000-0002-8219-4448 [email protected] , Bai Juan , Liwei Xu , Siyi Wang , Pengfei Xiao , Dongrui Zhou , Guanxiong Liu , Rongbin Wei , and Ping jiang Authors Info & Affiliations https://doi.org/10.22541/au.175047680.03452264/v1 Published Advanced Intelligent Systems Version of record Peer review timeline 160 views 92 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract The breakout of African swine fever virus have severely impacted food safety and public health . Here, a point-of-care testing method based on solvent-responsive magnetic beads suitable for large-area diagnosis and mutation screening in remote areas was developed to detect it by combining bioluminescenct pyrophosphate in real-time technology and recombinase-aid amplification technology. The combined testing method included selection of different dATP modification structures and DNA polymerases. The method was conducted on plasmids of African swine fever virus at various concentrations. Based on above, the detection device was developed and achieved detection in real-time. The detection limit was around 10 copies, with no cross-reaction of nucleic acid samples from other viruses. Then it was applied on clinical samples and showed good specificity and detection efficiency. Moreover, this method was also compatible with a digital testing method and digital point-of-care testing devices based on bioluminescent pyrophosphate in real-time and recombinase-aid amplification including a digital detection RAA-BART device and a mobile phone shell (based on bionic hydrogel) were developed here. Finally, the sensitive of them were tested and showed a comparable detection limit of single copy. Digital Point-of-care Testing Device based on Bioluminescent Pyrophosphate in Real-time and Recombinase-aid Amplification Short title: Digital Point-of-care Testing Device Zhongjie Fei 1,*,+ , Bai Juan 1,+ , Liwei Xu 1 , Siyi Wang 1 , Pengfeng Xiao 2 , Dongrui Zhou 2 , Guanxiong Liu 3 , Rongbin Wei 4,* , Ping jiang 1,* 1 Key Laboratory of Animal Diseases Diagnostic and Immunology, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, 210095, China. 2 State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering Southeast University, Nanjing, 211102, China. 3 Kadoorie Biological Sciences Building, The University of Hong Kong Shenzhen Institute of Research and Innovation, The University of Hong Kong, Shenzhen, 518057, China. 4 Jiangsu Key Laboratory of Marine Pharmaceutical Compound Screening, College of Pharmacy, Jiangsu Ocean University, Lianyungang 222005, China. + These authors contributed equally to this work. * Corresponding authors: [email protected] (Ping Jiang), [email protected] (Zhongjie Fei), [email protected] (Rongbin Wei). Abstract The breakout of African swine fever virus have severely impacted food safety and public health . Here, a point-of-care testing method based on solvent-responsive magnetic beads suitable for large-area diagnosis and mutation screening in remote areas was developed to detect it by combining bioluminescenct pyrophosphate in real-time technology and recombinase-aid amplification technology. The combined testing method included selection of different dATP modification structures and DNA polymerases. The method was conducted on plasmids of African swine fever virus at various concentrations. Based on above, the detection device was developed and achieved detection in real-time. The detection limit was around 10 copies, with no cross-reaction of nucleic acid samples from other viruses. Then it was applied on clinical samples and showed good specificity and detection efficiency. Moreover, this method was also compatible with a digital testing method and digital point-of-care testing devices based on bioluminescent pyrophosphate in real-time and recombinase-aid amplification including a digital detection RAA-BART device and a mobile phone shell (based on bionic hydrogel) were developed here. Finally, the sensitive of them were tested and showed a comparable detection limit of single copy. Keywords: African swine fever virus, solvent-responsive magnetic beads; bioluminescenct pyrophosphate in real-time; recombinase-aid amplification, digital point-of-care testing device based on bioluminescent pyrophosphate in real-time and recombinase-aid amplification. INTRODUCTION African swine fever virus (ASFV) has become a global challenge to public health 1,2 and food safety 3,4 Multiple subtypes and mutations of ASFV have emerged all the time and pose a huge threat to pork products. 5 Diagnosing wild animal diseases is vastly more complex than diseases suffered by domestic animals. It is critical to identify and manage new pathogens originating from wild animals or infections with no obvious clinical manifestations. Wild animals are well distributed in different provinces of different countries, as well as mountainous areas and so on 6,7 . ASFV I/ASFV II (Genotypes) were found in remote region of China and European 8,9 . In 2023, the Harbin Animal Research Institute even isolated three recombinant strains of African swine fever virus genotype I and genotype II in samples which live attenuated vaccines from genotype II ASFV had no protective effect against the attack of the recombinant virus. These naturally occurring type I and type II ASFVs recombinants have the potential to pose a challenge to the global domestic pig and wild boar 10 . Therefore, it is difficult for conventional qPCR-based detection machines (unportable) to obtain real-time epidemic information. Given these challenges, it is essential to develop a digital point-of-care testing (POCT) device for identification of these highly infectious pathogens as early detection and contact tracing can be instrumental in preventing widespread infection and disease. The presently available detection system cannot concurrently achieve enhanced sensitivity, convenient carry, and simple usage 11-13 . Till date, there have been multiple proposals of ASFV detection strategies 14-17 . However, these procedures are often complicated in nature or require expensive apparatus, and may not produce satisfactory results 18-22 . These factors reduced the application of these methods, with their reduced sensitivity likely the result of the conventional magnetic beads (MBs) used or methods for detecting amplified signals. A complete detection method has three main steps including NA extraction (MBs), NA amplification (RAA) and signal detection (BART). MBs play a important part in extraction owing to their augmented interaction capacity, enhanced diffusion rate, convenient modification 23-25 . NA extraction (conventional MBs) typically involved the induction of dehydration using absorption solvents with a pH of less than 6.5, thus altering the NA molecular structure. This enables the formation of ion bridges between negative charges on the phosphate moieties on the phosphoric acid skeleton and positively charged -COONa + groups, resulting from protonation of -COO - on the MB surface. This protonation is reduced after decreasing salt and addition of desorption buffer (pH~ 8.5), leading to the release of between 60 and 80% of the NA 26-30 . Our examination of a particular class of NA isolation product indicated approximately 70% isolation of NA, which could be increased to approximately 80% by the use of more than three desorption steps (> 3). Solvent-responsive MBs developed by us which could achieve more efficient and sensitive, (one step, approximately 90%) were used here, the -COO- groups on its surface were capable of flipping. It inspiration was from a smart coating using fluorocarbon surfactant (FS) and the “flipping conjecture 31-33 . It was found that the -COO- groups faced inward on the coating surface throughout the ethanol application and drying processes. This configuration on solvent-responsive MBs enabled the efficiently and completely breakdown of protonated structures attached to the -COO- groups by double effect of flipping and deprotonation. Then based on the solvent-responsive MBs 34 , the BART formula is further optimized. The ASFV plasmid were used as sample. It is well known that BART is based on pyrophosphoric acid (PPi). PPi will be released when a nucleotide is incorporated during the polymerization of DNA. However, the BART-based detections had high background signal which affects its application in low abundance samples 35,36 . The theoretical amount of PPi generated (Assuming that one base produces 2 units of PPi) by the amplification of a single copy of DNA template of 300 bases during 20 cycles is 2.10 × 10 −15 mol (i.e., 2 × 2×300 × 2 20 /6 × 10 23 = 2.10 × 10 −15 ), which is higher than the detection limit of ppi, which is 1.56 × 10 −15 mol 37 . By increasing the extension time, a greater amount of PPi can be incorporated, so the detection of a single copy of DNA is theoretically possible by BART and it does not require fluorescence probe and fluorescence detection instrument, simple operation and low cost. In our previous study, BART’s detection limits have increased significantly by using 2-deoxyadenosine-5-(α-thio)-triphosphate (dATPαS, one of dATP derivatives) instead of deoxyadenosine triphosphate (dATP) 38,39 . Here, through synthesizing different dATP derivatives 40 . The mechanism of the weak background signal of the derivative was further investigated, and we screened out the best alternatives to dATP. In terms of amplification, NA isothermal amplification which did not require a thermal cycler was studied. Recombinase aided amplification (RAA) is one of isothermal amplifications which developed recently 41,42 . Under isothermal conditions, the combined action of recombinant enzyme, single chain binding protein and DNA polymerase takes only 20 min at around 40 ℃ 43 . And can be combined with gel electrophoresis, real-time fluorescence and BART. Although our previous success in combining BART technology with loop-mediated isothermal amplification (LAMP) 44 , RAA was chosen here due to it requires fewer primers and easier procedure. Digital PCR (dPCR) is an absolute quantification approach that is used to determine the amount of starting low-concentration DNA template based upon the Poisson distribution 45 . Based on our previous work on digital LAMP-BART 46 , RAA-BART was also compatible with a digital testing method, digital point-of-care testing devices based on bioluminescent pyrophosphate in real-time and recombinase-aid amplification including a digital detection (RAA-BART) device and an iPhone Shell (based on inverse desert beetle-like composite hydrogel) were developed here. Finally, their detection limit were explored and applied to some clinical samples. RESULTS AND DISCUSSION Design and preparation Two factors, usage of conventional MBs and complex NA extraction steps, contribute to reduced efficiency of NA extraction in classical methods of NA isolation. In a previous study 34 , depicted in Fig. 1A, we developed solvent-responsive MBs as a replacement of conventional MBs. Its characterization details were summarized in Fig. S1A and Fig. S1B (SEM image including mapping, FTIR spectra). Through comparing Fig. S1B and Fig. S1D, Fe3O4 typically exhibits a characteristic absorption peak around 580 cm −1 (Fe–O bending) whereas FS peaks at 900 cm−1 (out of plane C-H bending), 1240-1200 cm −1 (C-F stretching), and 3340 cm−1 (O–H stretching) which indicated that Fe3O4 was successfully coated with FS during the responsive MBs synthesis. The following is a theoretical analysis of the advantages of response MBs compared with conventional MBs. In case of conventional MBs, the desorption process reduces the -COO - protonation, and frees NAs from MBs, increasing the solubility of NA in the desorption buffer (pH ~ 8.5) 47,48 . Unfortunately, this process is relatively inefficient, with some NA remaining on the beads and thus reducing the overall rate of extraction. To enhance NAs release, we previously designed solvent-responsive MBs with the flipping conjecture, and achieved higher extraction yields due to the combined desorption effect of the -COO- group flip and reduction of -COO- protonation. Briefly, similar to conventional MBs, the negative charges on -COO- groups on the responsive MB surfaces interacted with the RNA present in the solvent (pH ~ 5.5-6). However, these interactions were reduced by ethanol washing during the flipping and lifting steps, due to a rapid decrease in Na + concentrations resulting in dissocation of -COO - and NA, and thus flipping the -COO - group. This contributed to the destruction of the ion bridge between NAs. Given that NAs are insoluble in ethanol, they attached themselves to the responsive MN surfaces. During the desorption step, the buffer (pH ~ 8.5-9) induces the release of substantial amounts of NA. Of note, the solvent-responsive MBs were super-hydrophobic during desorption, leading to release of the hydrophilic NA. Together, the aforementioned steps greatly increased NA extraction efficacy and yield. For the purposes of the current investigation, we re-synthesized the aforementioned MBs and pristine, the characteristics of which are summarized in Fig. S1C (the saturation magnetization values of both pristine and responsive MBs were 61.8 and 40.7 emu g −1 , respectively, which suggested that responsive MBs had a good magnetic response). Then as depicted in Fig. 1B, all hydrophilic and hydrophobic property alterations were consistent with our previous study 34 . RAA is an isothermal amplification protocol that is a modification of the recombinase polymerase amplification (RPA) protocol (Fig. 1F). The major difference between the two protocols is the sources of recombinase. The recombinase of RPA is derived from T4 bacteriophage; the recombinase of RAA is derived from bacteria or fungi. The RAA protocol utilizes recombinase from numerous sources from bacteria or fungi. And the recombinase derived from the latter also show better temperature adaptability than the former 41,42 . This recombinase forms a strong association with the primer DNA at room temperature before forming polymers. Thus, using both single-stranded binding protein (SSB) and DNA polymerase, rapid NA amplification can be readily carried out at room temperature. The aforementioned RAA is a patented technology developed recently, and it is a robust detection system for use in livestock farms and remote areas. BART is a detection system that utilizes pyrophosphate (PPi) bioluminescence (Fig. 1G). It quantifies NAs in samples by detecting PPi, a by-product of NA amplification. Then as depicted in Fig. 1D (1), using computer simulation, i.e., geometric model generation using solidwork, we designed an NA extraction disk (Fig. 1D2), reagent mixing apparatus (Fig. 1D3) which based on the prediction of RAA-BART mixture and oil droplet composition, as well as corresponding flow rates on various detectors. We next designed the digital RAA-BART detection chip (Fig. 1D (4)) and GENTUBE GE4 System (developed with Gen DX company collaboration Fig 1D (5)). Through loading the app of Gen DX, the results of above could be read on our phones. Furthermore, the temperature of GENTUBE GE4 system could be adjusted by our phone as Fig. 1E shown. Based on above, RAA-BART device was developed. To achieve absolute quantification of detection, a digital RAA-BART detection device and a digital RAA-BART detection mobile phone shell (Fig 1E) were developed. Their structure and actual photographs were depicted in Fig. S3. They were both included a RAA-BART detection chip (Fig. 1D (4)), reagent mixing apparatus and self-made NA extraction and purification disk. The inside of detection chip was negative pressure and through opening RAA-BART chip inlet and Syringe push at the same time, the detection could be automation. Furthermore, combined with the system we have developed in collaboration with Gen DX, a smart detection device that only needs to be the size of a mobile phone could achieve NA extraction and precious detection integration will be developed. Fig. S2 presented our prediction of the association between flow velocity and internal structure of RAA-BART chips. And structure and actual photographs of GENTUBE GE4 System and digital RAA-BART detection device and mobile phone shell is also depicted in Fig. S3. GENTUBE The GE4 System can be coupled by fluorescent-based reaction or BART. Thereafter, to optimize the BART detection system, we constructed various dATP derivatives and established RAA-BART. This detection system was made multiplexing-compatible via use of various fluorophores or probes (Fig. S4). Finally, we applied the digital PCR (dPCR) to the bionic RAA-BART detection system. dPCR is an absolute quantification system that detects low-concentration DNA using Poisson distribution. In dPCR reactions, each droplet of a given sample is treated as an individual microassay sample, thereby applying a high-throughput microfluidic-based approach to any individual sample. In this report, we demonstrated the accuracy of the RAA-BART system to amplify and detect NAs in microfluidic droplets. An NA concentration gradient distributed across a series of droplets was used to assess the dependence of light emission on the starting NA concentration, thereby allowing the user to conduct a quantitative, low-volume, high-throughput assay. Furthermore, using computer simulation (Ansys Fluent), RAA-BART iPhone shell was designed via a bionic inverse desert beetle-like structure to achieve a uniform and high-speed droplet distribution. Optimization of the BART detection protocol Earlier protocols of DNA template analysis using BART as a by-product of LAMP 49 . It had a detection limit of approximately 10 4 copies when we tried to repeat it on our earlier work 44 . Here, the feasibility of single DNA copy detection by BART was demonstrated as discussed below: As depicted in Fig. 2A, during the NA amplification process, individual deoxynucleotide extension simultaneously produces a pyrophosphate (PPi) by-product. Therefore, a pair of DNA double strands produces twice the number of PPi molecules during the extension step. Assuming the presence of only one DNA molecule in the sample, if individual primer extends 300 bases during the amplification phase. The theoretical amount of PPi generated (Assuming that one base produces 2 units of PPi) by the amplification of a single copy of DNA template of 300 bases during 20 cycles is 2.10 × 10 −15 mol (i.e., 2 × 2×300 × 2 20 /6 × 10 23 = 2.10 × 10 −15 ), which is higher than the detection limit of ppi, which is 1.56 × 10 −15 mol 37 . Single DNA molecule can produce around 100 PPi in each cycle, which is relatively easy to detect. In our previous investigation, we identified dATP (marked with a red arrow) as the source of our high background signal (Fig. 2A). This is likely due to the fact that dATP is structurally similar to ATP, and modulates photochemical reactions, which elevates the background signal. In other words, even in the absence of PPi production, four distinct deoxymononucleotides are introduced to the PCR system, which, when exposed to luciferase and luciferin systems, accelerates the luciferase-based conversion of luciferin to oxyluciferin, which, in turn, generates bioluminescence proportional to the dATP content. Constant dATP content in samples can potentially raise baseline of analysis. However, it should not severely impact the detection limit. Moreover, using further analysis, we demonstrated that the dATP content in various amplication products was not constant as dATP often participated in amplification reactions, and the reaction efficacy differed among various amplifications. Generally, elevated amplification reactions indicate less remaining dATP and lower background signal. In contrast, more remaining dATP levels produce greater background signal, thus increasing the challenge of background signal value determination for individual amplification product. This sequence of events explains the relatively high detection limit (10 3 copies) of conventional BART detection, and only at times of sufficiently elevated BART-induced PPi, i.e., when the DNA template quantity is large enough, the resulting fluorescence intensity supersedes the blank background value. However, when the BART-generated PPi is small, i.e., the NA template quantity is small, then the resulting fluorescence intensity does not exceed the blank background value, therefore giving a false negative result. Till now, scientists have developed dozens of dATP derivatives, including dATPαS, with satisfactory results 40 . Based on our knowledge of relevant literature and the computer structure prediction results, we next selected 8 dATP derivatives, namely, A1 dATP, A2 dATP, B1 dATP, B2 dATP, C2 dATP, D1 dATP, D2 dATP and dATPαS (Fig. 2C) for additional evaluation. The dATP derivatives were synthesized by Shanghai Nafu Biotechnology Co., LTD.The ASFV I reference plasmid contained the complete P72 gene sequence. And ASFV II reference plasmid contained the complete P30 gene sequence were used as target. Fig. 2B presents the gel electrophoresis results of RAA and their amplification products. We revealed that although B2 dATP, C2 dATP, D1 dATP, D2 dATP and dATPαS successfully amplified the target fragment, the optimal amplification (i.e., closest to the positive control) was achieved by D2ATP. The reason may be that the group modified on the dATP is relatively simple, making its group composition most similar to the dATP. Fig. 2E illustrated the evaluation of background signals of the aforementioned derivatives. D1 dATP, D2 dATP and dATPαS exhibited the lowest signal value. Along with the aforementioned two test results, D2dATP was screened for subsequent analyses.The reason for this situation is probably the cyclization structure that is modified on the dATP, which nicely prevents it from being recognized as a dATP. Therefore D2 ATP was chosen for next-step BART detection method . Development and optimization of RAA-BART detection methods Then, RAA-BART was developed via RAA coupling to the BART (D2 dATP), and 5 primes were synthesized (targeted to the B646L(P72) fragment of ASFV I for RAA assessment (Fig. 2D). While 1 primes were designed based on CP204L(P30) of ASFV II. The B646L and CP204L fragments of ASFV are highly conserved regions that can delineate between ASF type I and type II subcategories 50-52 . And these fragments are also related to the virulence of AFSV, and their identification is also of great significance for the development of recombinant attenuated vaccines 49 . Designed primer details were summarized in Table 1. The Fig. 2G showed all primes designed here could be well amplified and observed by gel electrophoresis excepted RAA-4. But when they coupled by BART, as depicted in Fig. 2F, only RAA-1 and RAA-2 exhibited satisfactory specificity (less noise signal) and rapid amplification efficiency in RAA-BART. Therefore they were chosen to detect ASFV I and ASFV II respectively. Thereafter, using RAA-BART (i.e., solvent-responsive MBs and self-made NA extraction disk), we examined the ASFV reference plasmids in varying concentrations of NA (0, 0.1, 1, 10, 10 2 - 10 7 copies/μL). The results of RAA-BART/LAMP-BART were read directly on our moblie phones by modified GENTUBE GE4 System (Gen DX company, Fig. 3J). It can freely regulate temperature through temperature regulation chips as Fig. 3L shown. The transfer data could pass from the multiple systems simultaneously to moblie phones through Gen Dx app. Relative to traditional LAMP-BART (dATP, Fig. 3A) 53,54 and LAMP-BART (D2 dATP, Fig. 3B), the RAA-BART exhibited augmented detection limit. To elucidate the optimal formula and RAA-BART reaction conditions, we first examined varying RAA-BART mix formulas and conditions. Notably, the DNA polymerase selection is crucial to the proficiency of RAA-BART-based amplification. Fig. S5 presents the details of different reaction condition optimization and the optimal temperature 44 ℃ for different DNA polymerases’ RAA-BART reaction was determined. As depicted in Fig. 3C-G (D2 dATP), we screened 5 distinct forms of DNA polymerase with augmented enzymatic activity at 37-47 ℃. These included self-made recombinant Bsu DNA polymerase/BA DNA polymerase/Bsu DNA polymerase/ Phi DNA polymerase and Gen DX company-manufactured fusion DNA polymerase. Among them, recombinant Bsu DNA polymerase developed here revealed the fastest amplification effect (Fig. 3G) with good specificity (Fig. 3K). Moreover, based on the results of DNA polymerase molecular docking simulation to D2dATP (Fig. 3I and Table S1), recombinant Bsu DNA again exhibited the best affinity. Hence, we selected this polymerase for subsequent analysis. The detection limit of RAA-BART was around 10 copies, with no cross-reaction of NA samples from other viruses.The optimal RAA-BART formula was determined as follows: 25 μL RAA amplification mixture, 15 μL RAA reaction buffer, 5 μL NA template, 2.5 µl of upstream and downstream primers each, and 6.5 μL ultra-pure water. The bioluminescent (BART) mixture was 60 μL total, and included 17 mM Tris-acetate (pH 8.0), 1.8 mM Mg(Ac)2, 0.5 mM beetle luciferin potassium salt, 7 μM KCl, 9 mM DTT, 6 μM adenosine- 5′-O-phosphosulfate (APS), 1.86 ng/mL luciferase, and 0.25 U/mL ATP sulfurylase. Individual reaction required 25 μL of bioluminescent mixture, however, it was used in excess. The evaluation of the RAA-BART method applied on pork products Based on Nanjing Agricultural University Veterinary Diagnosis Center (China National Accreditation Service for Conformity Assessment), we obtained 12 suspected ASFV fever samples from pig farms to further evaluate the RAA-BART method. The ASFV I reference plasmid and ASFV II reference plasmids were also mixed into the clean serums as positive control for testing. As shown in Figure 4A, the serum and tissue homogenate were the samples for NA extraction and detection. The government standard GB/T 18648-2020 of diagnostic techniques (based on qPCR, tested by QuantStudio 5 PCR) and RAA fluorescent probe technique (tested by GENTUBE GE4 System) were tested as as a comparison. As shown in Figure 4B, RAA fluorescent probe designed here showed good fluorescence in FAM channel. The results of RAA-BART (Figure 4C) matched that of RAA fluorescent probe technique (Figure 4D) and qPCR (Figure 4E). Then ASFV reference plasmids in varying concentrations of NA (1, 5, 10, 20, 40, 60, 100, 200, 400 copies/μL) were tested by RAA-BART and GB/T 18648-2020 of diagnostic techniques to evaluate the quantitative ability of RAA-BART. Although absolute quantification can not be achieved, RAA-BART showed high accuracy (around 90%) when the sample concentration above 10 copies/μL (Figure 4F). To sum up, RAA-BART high accuracy and demonstrated detection efficiency advantages over qPCR. To provide a powerful tool for the point-of care (POCT and absolute quantitative detection of multiple genotypes of ASFV and the monitoring its gene mutations, digital PCR technology was explored to combine RAA-BART here. Design and development of digital POCT devices Based on above study, digital POCT devices based on RAA-BART including a digital detection (RAA-BART) device and an iPhone Shell (based on inverse desert beetle-like composite hydrogel) were developed here. Firstly, using Rhino app, we designed digital RAA-BART detection device, which included a RAA-BART detection chip, a reagent mixing apparatus and self-made NA extraction and purification disk. The designed structure of disk was shown in Fig. 5E which consist of different regions of MBs, lysis, sample, wash buffer 1, wash buffer 2, elution buffer and waste solution. The intelligence of NA extraction was realized through the dual regulation of magnet and air pressure. Then the designed drawings were converted into STL format and imported into the light curing 3D printer for printing. This step was commissioned to Shenzhen Wenext Technology Co., Ltd. to complete with resin (DSM10122). Except for the RAA-BART chip, which was not successfully printed due to accuracy problems, the other parts of the device were completed here. Two forms of reagent mixing apparatus (Fig. 5A1 and 5A3) based on the Fig. 5A2 and 5A4 design drafts were printed successfully. The BART-mix freezed gels were introduced to one apparatus’s light-tight small box whereas the RAA-mix freezed gels were introduced to the other apparatus’s light-tight small box. Upon removal of a single freezed gel from each of the two boxes, we placed them in the middle of the apparatus, then, dissolved them in deionized ultra-pure water. Meanwhile, we extracted NAs from the sample using self-made NA isolation and purification disk. The isolated NA was then placed in the middle of the reagent mixing apparatus, where it formed the RAA-BART-NA reaction mix. At this point, the reagent mixing apparatus middle part was connected to the RAA-BART chip inlet. The printing of the chip pattern and the printing method of the mask were using Coreldraw X7 software then commissioned to Nanjing Micro Blox Technology Co., Ltd. to complete with a high cost. The inlet size of the chip was approximately 8.9 cm×7.0 cm×0.4 cm (Fig. 5B), with a detection are of 20,000 chambers (Fig. 5D). This order of magnitude was further enhanced via dPCR, which has a relatively large detection dynamic range, which, in turn, ensured accuracy of our quantitative results. The employed RAA-BART chip was simple in structure, and consisted of four layers, namely, the glass layer, chamber layer, negative pressure layer and tape layer. Moreover, any introduced liquid could be evenly separated from bottom to top. In addition, we also simulated chip fluidity using a simulation software. In short, following geometric model establishment using solidwork prediction, the model was imported into solidwork system for fluid domain division and boundary layer naming, then it was tested with a red dye (Fig. 5C1). Based on the data on Fig. 5C2 and Video S1, the generated chip exhibited good fluidity. We sealed the glass layer to the chamber layer using plasma as the substrate. The chamber layer resembled a concave cavity, and its sealing with the glass later formed a closed chamber. The reaction chamber shape was cylindrical, with a height (i.e., thickness) of ≈ 138 µm. The negative pressure layer was situated above the chamber layer and was composed of blank PDMS. The negative pressure during the sampling process enabled sample entry into the reaction chamber. Lastly, the tape layer sealed both the inlet and the outlet to guarantee proper sealing prior to injection. Before injection, a needle is used to prick the inlet. This would allow the reaction mix to enter the chip due to negative pressure 55 . Subsequently, we placed mineral oil in another sample addition hole in a self-priming manner, making sure to avoid cross-contamination. Mineral oil introduction required no additional power and distributed the sample evenly at atmospheric pressure. This entire process was separated into four phases: The first phase involved a 30-min degassing via the vacuum pump to discharge the air in the PDMS pores and chamber from the chip. Of note, the chip was in a state of negative pressure (a); Subsequently, we employed a pipette gun to absorb the reagent. We punctured the tape above the injection port, then administered the reaction liquid by inserting the tip of the gun into the injection port. It took a total of 25 s for the reaction liquid to completely fill the chamber and channel. (b); Thereafter, the Mineral Oil (Sigma) was immediately inserted into the gun head. Owing to its reduced density, relative to water, the mineral oil appeared above the reaction liquid and entered the channel along with the reaction liquid. Moreover, the mineral oil completely discharged excess reaction liquid into the channel. (c); Owing to the complete draining of the reaction liquid in the channel, the chamber was separated by mineral oil forming a stand-alone reaction unit with no possibility of cross-talk or contamination. The entire sampling process was over in 4 minutes (d). Utilizing the principle of negative pressure, we subsequently added water from the inlet of the water channel to prevent evaporation. Finally, the chip was placed on the temperature regulation chip for RAA-based amplification. As described above, the injection process did not require an external power source, the injection speed was fast, flow rate was uniform, with no residual reaction liquid remaining in the channel. Lastly, the separation effect between chambers was good, providing a convenient, rapid and stable platform for digital reaction. Then, we prepared a 4-step concentration gradient of 1, 10, 100 and 10000 (copies/μL) of isolated NA for additional analyses. The negative control contained reaction mixture without the target NA. The NA concentrations (copies/μL) were measured in ultrapure water with an ultraviolet (UV) N80-Touch spectrophotometer (Implen, Germany), and the gene copy numbers were determined. Microscopic imaging was performed using the Olympus IX83 (Olympus, Japan) after the reaction. Image J software was used to analyze the bioluminescent micropores images (Fig. 5F), divide the negative and positive thresholds. Poisson distribution principle was used to calculate the NA concentration of the sample to be measured. The bioluminescent intensities of positive and negative compartments were markedly different, the dividing point between negative and positive signal strength was around 6000 and the signal-to-noise ratio was high (Fig. 5G). Besides, through the predication of liquid flow rate on the digital RAA-BART chip under different pressure, the pressure of 280 MPa was most suitable here Ans the results of it were shown in Fig. 5H and Video S2. Finally, it can potentially compute NA copies by counting the theoretical positive and negative droplets (Np and Nn, respectively) for a given assay (λ = −ln(Nn/N)). When the target NA concentrations of 1, 10, 100, 10000 copies/ were introduced to the digital RAA-BART device, the theoretical NA results were 1, 10, 100, and 10000 copies, respectively (if all copies were entered into the reaction). It is important to note that the concentration of nucleic acids in the sample is equal to the number of copies involved in the reaction The specific test results of samples at different concentrations are presented in Table 2. It is important to note that the concentration of NA in the sample is equal to the number of copies involved in the reaction. Take concentration of sample 10 copies/μL as an example, the RAA-BART mix (50 μL) contained 50 μL sample. That meant RAA-BART mix contained 5 copies of NA (NA concentration is 1 copies/μL. We used 10 μL of RAA-BART for digital RAA-BART reaction which meant there were 10 copies in the digital RAA-BART reaction. Here through calculation based on the Poisson distribution formula, we can get the number of copies in the reaction, which is equal to the concentration of NA in the sample. The detection limit of digital RAA-BART device was close to single copy. The accuracy and stability increased with the increase of NA concentration. When the concentration of NA was above 10 copies/μL, the accuracy remained at a consistently high level (above 80%). Development of the Digital digital RAA-BART detection mobile phone shell based on bionic hydrogel Using the aforementioned results to reduce the cost, we next designed a small and readily transportable intelligent digital detection device, the digital RAA-BART detection mobile phone shell, for the simultaneous detection of various subtypes of ASFV. The detection mobile phone shell consisted of a mini RAA-BART detection chip, reagent mixing apparatus and self-made NA extraction and purification disk. The structure and actual photographs of mini RAA-BART detection chip, reagent mixing apparatus and self-made NA extraction and purification disk were shown in Fig S6. We also developed a novel small unit segmentation method, based on a bionic hydrogel modeled after a desert beetle to combat multi-chamber-associated limitations. First, using Rhino app, we designed digital RAA-BART detection mobile phone shell, which included mini a RAA-BART detection chip, a reagent mixing apparatus and self-made NA extraction and purification disk. Then the designed drawings were converted into STL format and imported into the light curing 3D printer for printing. This step was commissioned to Shenzhen Wenext Technology Co., Ltd. to complete with resin (DSM10122). Meantime we prepared the bionic hydrogel. As depicted in Fig. 6A1, Suzhou Kaifa new material Technology Co., LTD modified oleophilic and hydrophobic silica particles with RAA primes of AFSVI/AFSV II (Different genotypes). This allowed the positively charged oleophilic and hydrophobic silica particles to interact with the negatively charged oil (Fig. 6A2) through the reagent mixing apparatuss, one of which plastic in nature (Fig. 6C1), while the other was metal (Fig. 6C2). Subsequently, we introduced the silica particles (containing different primes) to the solution state of the PNIPAAM/PSA hydrogel 56 , followed by a 1-h stirring at 50°C to induce development of PNIPAAM/PSA hydrogel-coated silica particles (Fig. 6E1 ). The SEM of it was shown in Fig 6B. These particles were next placed on the mini RAA-BART detection chip, and the chip was maintained overnight in a 4ºC refrigerator to achieve the solid form of the hydrogel. In the solid state, the hydrogel formed an inverse desert beetle-like composite structure (Fig. 6E2). Dessert beetles are insects that live in the Namib desert. Their back consists of an elaborate structure of alternating hydrophilic bumps and superhydrophobic background (Fig. 6E3). This unique feature allows the Stenocara beetles to extract atmospheric water from fog 57 . Approximately 20 water molecules are captured by these hydrophilic bumps, they congregate to form droplets, then roll down the superhydrophobic region due to gravity once they reach a certain volume. Scientists have conducted extensive studies on this feature of beetles particularly for the application of such water harvesting potential in drought areas. Employing this principle in our design, we prepared the desert beetle’s composite structure with opposite wettability (Fig. 6E3) to capture oil droplets when combined with traditional underwater superoleophobic membranes. This feature allowed us to enhance the separation performance of the oil-in-water emulsions and achieve highly efficient fusion of large and small oil droplets. Moreover, since mineral oil (including silica particles) repels one another, the small oil droplets remained distant from one another, and therefore, did not impact the bioluminescence signal between themselves. Besides, droplets were prepared by double oil-in-water (O/W) structure in reagent mixing apparatus (Fig. 6F). Firstly, the internal oil phase was prepared by a lipid solution made of 4 mg/ml (50% DPhPC and 50% DSPE-PEG2000; Avanti Polar Lipids, Alabama, USA) in cetane and silicone oil AR20 (2:1). The alginate phase consisted of 3% w/v low-viscosity alginate and 48 mg/ml nano-calcium carbonate, adjusted to 0.1 molar ionic strength with sodium chloride. Then, mix the RAA mix, BART mix and NA (extracted by self-made NA extraction and purification disk) in the Reagent mixing apparatus. Lastly, the outer oil phase was mineral oil with 0.5% v/v glacial acetic acid. Then using an inverted optical microscope (Olympus company, Japan) to observe droplet (O/W) in bright field. Images of droplet were analyzed with Image J software to determine the diameters of the oil phase droplets (OD) and the inner water phase droplets (ID) for each sample. The volume fraction of internal phase droplets to oil droplets (Ф) was calculated using the equation: Ф = ID 3 /OD 3 . The size of these droplets were around 100 μm under an inverted optical microscope (CKX41, Olympus company, Japan) as Fig. 6K shown and through the dual function of negative pressure inside the chip and syringe propulsion, the droplets got inside the mini chip to swallow hydrophobic silica particles modified with AFSV I/AFSV II. Then the RAA-BART mix could bind primes to produce bioluminescence as Fig. 6J shown. Besides, mini RAA-BART detection chip was designed with different structures. Based on predication of liquid flow rate different structures under different pressure. Using Ansys Fluent app to simulate the mixing flow of various liquids in different models and observing their flow rates and mixing conditions. Based on reynolds number calculation formula: Re=ρvd/μ. The results showed the model (Fig. 6G) with 0.446m/s. flow rates was best for mixing different solvents and the model of RAA-BART detection chip was determined. Base on above all, digital RAA-BART detection mobile phone shell was developed and its rendered stereogram of the actual photo was shown in Fig 6H which included a mini RAA-BART detection chip, reagent mixing apparatus and self-made NA extraction and purification disk. It could be used to detect two genotypes of AFSV at the same time. The bioluminescent droplet diagrams of the digital RAA-BART (AFSV1) and digital RAA-BART (AFSV2) on the chip. were shown in Fig 6L and Fig 6M respectively while positive and negative bioluminescent intensity threshold diagrams of them were shown in Fig 6I. Finally, it can potentially compute NA copies by counting the theoretical positive and negative droplets (Np and Nn, respectively) for a given assay (λ = −ln(Nn/N)). When the target NA concentrations of 1, 10, 100, 5000 copies were introduced to the digital RAA-BART mobile phone shell, the theoretical NA results were 1, 9, 93, and 4990 copies, respectively. The specific test results of samples at different concentrations are presented in Table 2. It was quite obvious that the detection limit of digital RAA-BART mobile phone shell was close to single copy. The accuracy and stability increased with the increase of NA concentration. When the concentration of NA was above 10 copies/μL, the accuracy remained at a consistently high level (above 75%). As mentioned before, genetic mutations in ASFV have been occurring. the development of digital RAA-BART device and mobile phone shell provided a powerful tool for the rapid and accurate detection of multiple genotypes of ASFV and the monitoring its gene mutations. Moreover, until today, there is a lack of a particularly effective vaccine for ASFV, and this technology also provides strong support for the screening of recombinant vaccines. Overall, although further research is needed in chip preparation and more accurate quantification, all new RAA-BART based technologies developed here had great competitiveness in sensitivity, fast and accurate. Besides, they showed evident advantages on intelligent and easy to carry. ACKNOWLEDGEMENTS Many thanks to Professor Pengfeng Xiao’s research group for providing support on the knowledge and preparation methods CONFLICT OF INTEREST Authors declare that they have no competing interests. FUNDING This work was supported by the China agriculture research system of MOF and MARA (CARS-35); the National Natural Science Foundation of China (61971123); and the startup funding form Nanjing Agricultural University (090-804147). AUTHOR CONTRIBUTIONS Conceptualization: Ping jiang, Juan Bai, Zhongjie Fei, Pengfeng Xiao. Methodology: Ping jiang, Zhongjie Fei, Rongbin Wei, Pengfeng Xiao, Liwei Xu. Investigation: Zhongjie Fei, Rongbin Wei, Dongrui Zhou, Liwei Xu Visualization: Ping Jiang, Zhongjie Fei, Liwei Xu, Siyi Wang, Yibin Yang, Mengli Man. Funding acquisition: Zhongjie Fei, Pengfeng Xiao, Juan Bai. Project administration: Zhongjie Fei, Ping jiang. Supervision: Liwei Xu, Siyi Wang, Yibin Yang, Mengli Man. Writing – original draft: Ping jiang, Zhongjie Fei，Rongbin Wei, Liwei Xu. Writing – review & editing: Zhongjie Fei, Rongbin Wei. DATA AVAILABILITY The original contributions presented in the study are included in the article/Supplementary Materials, further inquiries can be directed to the corresponding author/s. REFERENCES 1 Zhou, Y., Fletcher, N. F., Zhang, N., Hassan, J. & Gilchrist, M. D. Enhancement of antiviral effect of plastic film against SARS-CoV-2: Combining nanomaterials and nanopatterns with scalability for mass manufacturing. Nano Lett 21 , 10149-10156, doi:10.1021/acs.nanolett.1c02266 (2021).2 Kacherovsky, N. et al. Discovery and characterization of spike n-terminal domain-binding aptamers for rapid SARS-CoV-2 detection. Angew Chem Int Ed Engl 60 , 21211-21215, doi:10.1002/anie.202107730 (2021).3 Sánchez-Cordón, P. J., Montoya, M., Reis, A. L. & Dixon, L. K. African swine fever: A re-emerging viral disease threatening the global pig industry. Vet J 233 , 41-48, doi:10.1016/j.tvjl.2017.12.025 (2018).4 Iyer, L. M., Aravind, L. & Koonin, E. V. Common origin of four diverse families of large eukaryotic DNA viruses. J Virol 75 , 11720-11734, doi:10.1128/jvi.75.23.11720-11734.2001 (2001).5 Quembo, C. J., Jori, F., Vosloo, W. & Heath, L. Genetic characterization of African swine fever virus isolates from soft ticks at the wildlife/domestic interface in Mozambique and identification of a novel genotype. Transbound Emerg Dis 65 , 420-431, doi:10.1111/tbed.12700 (2018).6 Mazzamuto, M. V., Schilling, A. K. & Romeo, C. Wildlife disease monitoring: Methods and perspectives. Animals (Basel) 12 , 3032, doi:10.3390/ani12213032 (2022).7 Bengis, R. G. et al. The role of wildlife in emerging and re-emerging zoonoses. Rev Sci Tech 23 , 497-511 (2004).8 Ge, S. et al. Molecular characterization of African swine fever virus, China, 2018. Emerg Infect Dis 24 , 2131-2133, doi:10.3201/eid2411.181274 (2018).9 Bao, J. et al. Genome comparison of African swine fever virus China/2018/AnhuiXCGQ strain and related European p72 Genotype II strains. Transbound Emerg Dis 66 , 1167-1176, doi:10.1111/tbed.13124 (2019).10 Zhao, D. et al. Highly lethal genotype I and II recombinant African swine fever viruses detected in pigs. Nat Commun 14 , 3096, doi:10.1038/s41467-023-38868-w (2023).11 Xinglong, X., Congcong, L., Yang, Q., Yu, Y. & Hui, W. Molecular monitoring of Escherichia coli O157: H7 sterilization rate using qPCR and propidium monoazide treatment. Lett Appl Microbiol 56 , 333-339, doi:10.1111/lam.12052 (2013).12 Nitecki, S. S., Teape, N., Carney, B. F., Slater, J. W. & Brück, W. M. A duplex qPCR for the simultaneous detection of Escherichia coli O157:H7 and Listeria monocytogenes using LNA probes. Lett Appl Microbiol 61 , 20-27, doi:10.1111/lam.12427 (2015).13 Wang, L. et al. Application of an improved loop-mediated isothermal amplification detection of Vibrio parahaemolyticus from various seafood samples. Afr J Microbiol Res 5 , 5765-5771, doi:DOI: 10.5897/AJMR11.1237 (2011).14 Lee, S., Han, T. U. & Kim, J. H. Assessment of nine real-time PCR kits for african swine fever virus approved in republic of Korea. Viruses 16 , 1627, doi:10.3390/v16101627 (2024).15 Igolkin, A. et al. Detection of the first recombinant African swine fever virus (genotypes I and II) in domestic pigs in Russia. Mol Biol Rep 51 , 1011, doi:10.1007/s11033-024-09961-0 (2024).16 Kong, C. et al. Rapid discrimination of African swine fever virus nucleic acid and virions using BenzoNuclease. Gene 928 , 148755, doi:10.1016/j.gene.2024.148755 (2024).17 Wang, J., Wang, J., Geng, Y. & Yuan, W. A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus. Can J Vet Res 81 , 308-312 (2017).18 Metsky, H. C., Freije, C. A., Kosokothoroddsen, T. S. F., Sabeti, P. C. & Myhrvold, C. CRISPR-based COVID-19 surveillance using a genomically-comprehensive machine learning approach. BioRxiv , doi:10.1101/2020.02.26.967026 (2020).19 Lucia, C., Federico, P. B. & Alejandra, G. C. An ultrasensitive, rapid, and portable coronavirus SARS-CoV-2 sequence detection method based on CRISPR-Cas12. BioRxiv , doi:10.1101/2020.02.29.971127 (2020).20 Broughton, J. P. et al. CRISPR-Cas12-based detection of SARS-CoV-2. Nat Biotechnol 38 , 870-874, doi:10.1038/s41587-020-0513-4 (2020).21 Schermer, B. et al. Rapid SARS-CoV-2 testing in primary material based on a novel multiplex RT-LAMP assay. PLoS One 15 , e0238612, doi:10.1371/journal.pone.0238612 (2020).22 Zhang, Z. et al. Printed nanochain-based colorimetric assay for quantitative virus detection. Angew Chem Int Ed Engl 60 , 24234-24240, doi:10.1002/anie.202109985 (2021).23 Malik, Y. S. et al. Emerging novel coronavirus (2019-nCoV)-current scenario, evolutionary perspective based on genome analysis and recent developments. Vet Q 40 , 68-76, doi:10.1080/01652176.2020.1727993 (2020).24 DeAngelis, M. M., Wang, D. G. & Hawkins, T. L. Solid-phase reversible immobilization for the isolation of PCR products. Nucleic Acids Res 23 , 4742-4743, doi:10.1093/nar/23.22.4742 (1995).25 Rohland, N. & Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res 22 , 939-946, doi:10.1101/gr.128124.111 (2012).26 Oblath, E. A., Henley, W. H., Alarie, J. P. & Ramsey, J. M. A microfluidic chip integrating DNA extraction and real-time PCR for the detection of bacteria in saliva. Lab Chip 13 , 1325-1332, doi:10.1039/c3lc40961a (2013).27 Xu, K. et al. Solid-phase extraction of DNA by using a composite prepared from multiwalled carbon nanotubes, chitosan, Fe 3 O 4 and a poly(ethylene glycol)-based deep eutectic solvent. Microchim Acta 184 , 4133-4140 (2017).28 Hu, L. L. et al. Polyethyleneimine-iron phosphate nanocomposite as a promising adsorbent for the isolation of DNA. Talanta 132 , 857-863, doi:10.1016/j.talanta.2014.10.047 (2015).29 Zhang, M. et al. Adsorption of DNA by using polydopamine modified magnetic nanoparticles based on solid-phase extraction. Anal Biochem 579 , 9-17, doi:10.1016/j.ab.2019.05.004 (2019).30 Xu, K. et al. Solid-phase extraction of DNA by using a composite prepared from multiwalled carbon nanotubes, chitosan, Fe 3 O 4 and a poly (ethylene glycol)-based deep eutectic solvent. Microchim Acta 184 , 4133-4140, doi:10.1007/s00604-017-2444-4 (2017).31 Liu, P., Liu, S., Yu, X. & Zhang, Y. Silane-triggered fabrication of stable waterborne superamphiphobic coatings. Chem Eng J 406 , 127153, doi:10.1016/j.cej.2020.127153 (2021).32 Krishnan, S. et al. Comparison of the fouling release properties of hydrophobic fluorinated and hydrophilic PEGylated block copolymer surfaces: Attachment strength of the diatom Navicula and the green alga Ulva. Biomacromolecules 7 , 1449-1462, doi:10.1021/bm0509826 (2006).33 Jiang, C., Xu, S., Zhang, S. & Jia, L. Chitosan functionalized magnetic particle-assisted detection of genetically modified soybeans based on polymerase chain reaction and capillary electrophoresis. Anal Biochem 420 , 20-25, doi:10.1016/j.ab.2011.09.004 (2012).34 Fei, Z. et al. Solvent-responsive magnetic beads for accurate detection of SARS-CoV-2. ACS Appl Mater Interfaces 15 , 4924-4934, doi:10.1021/acsami.2c18684 (2023).35 Imamura, O., Arakawa, H. & Maeda, M. Simple and rapid bioluminescent detection of two verotoxin genes using allele-specific PCR of E. coli O157: H7. Luminescence 18 , 107-112, doi:10.1002/bio.437 (2003).36 Tang, M. J. et al. Rapid and sensitive detection of Listeria monocytogenes by loop-mediated isothermal amplification. Curr Microbiol 63 , 511-516, doi:10.1007/s00284-011-0013-3 (2011).37 Ronaghi, M., Karamohamed, S., Pettersson, B., Uhlén, M. & Nyrén, P. Real-time DNA sequencing using detection of pyrophosphate release. Anal Biochem 242 , 84-89, doi:10.1006/abio.1996.0432 (1996).38 Fei, Z., Zhou, D., Li, N. & Xiao, P. New bioluminescence pyrophosphate assay for high-sensitivity detection of food-borne pathogens. Luminescence 35 , 355-364, doi:10.1002/bio.3734 (2020).39 Fei, Z., Zhou, D., Dai, W. & Xiao, P. Rapid and highly sensitive detection of Escherichia coli O157:H7 in food with loop-mediated isothermal amplification coupled to a new bioluminescent assay. Electrophoresis 41 , 1793-1803, doi:10.1002/elps.202000046 (2020).40 Kajiyama, T., Kuwahara, M., Goto, M. & Kambara, H. Optimization of pyrosequencing reads by superior successive incorporation efficiency of improved 2’-deoxyadenosine-5’-triphosphate analogs. Anal Biochem 416 , 8-17, doi:10.1016/j.ab.2011.04.039 (2011).41 Wang, D., Guo, T., Zheng, S., Shang, Y. & Xu, W. Research progress on the isothermal nucleic acid amplification techniques in rapid detection of microorganisms. Biotechnol Bull 33 , 49-61, doi:10.13560/j.cnki.biotech.bull.1985.2017-0106 (2017).42 Lv, B. et al. Recombinase-aid amplification: a novel technology of in vitro rapid nucleic acid amplification. Sci Sin 40 , 983-988, doi:10.1360/052010-508 (2010).43 Wang, W. et al. Establishment of reverse transcription recombinase-aided amplification-lateral-flow dipstick and real-time fluorescence-based reverse transcription recombinase-aided amplification methods for detection of the Newcastle disease virus in chickens. Poult Sci 99 , 3393-3401, doi:10.1016/j.psj.2020.03.018 (2020).44 Fei, Z., Wei, R., Zhou, D., Li, N. & Xiao, P. A novel bioluminescent approach to the loop-mediated isothermal amplification-based detection of Lactobacillus salivarius in feed samples. J Microbiol Methods 187 , 106209, doi:10.1016/j.mimet.2021.106209 (2021).45 Taylor, S. C., Laperriere, G. & Germain, H. Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data. Sci Rep 7 , 2409, doi:10.1038/s41598-017-02217-x (2017).46 Fei, Z., Wei, R., Cheng, C. & Xiao, P. A novel approach to the bioluminescent detection of the SARS-CoV-2 ORF1ab gene by coupling isothermal RNA reverse transcription amplification with a digital PCR approach. Int J Mol Sci 22 , 1017, doi:10.3390/ijms22031017 (2021).47 Wang, Y., Ma, X., Ding, C. & Jia, L. pH-responsive deoxyribonucleic acid capture/release by polydopamine functionalized magnetic nanoparticles. Anal Chim Acta 862 , 33-40, doi:10.1016/j.aca.2015.01.009 (2015).48 Weng, X. et al. Removal of doxorubicin hydrochloride using Fe 3 O 4 nanoparticles synthesized by euphorbia cochinchinensis extract. Chem Eng J 353 , 482-489, doi:10.1016/j.cej.2018.07.162 (2018).49 Wang, N. et al. Architecture of African swine fever virus and implications for viral assembly. Science 366 , 640-644, doi:10.1126/science.aaz1439 (2019).50 Salas, M. L. & Andrés, G. African swine fever virus morphogenesis. Virus Res 173 , 29-41, doi:10.1016/j.virusres.2012.09.016 (2013).51 Alejo, A., Matamoros, T., Guerra, M. & Andrés, G. A proteomic atlas of the African swine fever virus particle. J Virol 92 , e01293-01218, doi:10.1128/jvi.01293-18 (2018).52 Ilya, T. et al. Development of a real-time recombinase polymerase amplification assay for the rapid detection of african swine fever virus genotype I and II. Pathogens 11 , 439, doi:10.3390/pathogens11040439 (2022).53 Zhang, N. et al. Recent advances in the detection of respiratory virus infection in humans. J Med Virol 92 , 408-417, doi:10.1002/jmv.25674 (2020).54 Kiddle, G. et al. GMO detection using a bioluminescent real time reporter (BART) of loop mediated isothermal amplification (LAMP) suitable for field use. BMC Biotechnol 12 , 15, doi:10.1186/1472-6750-12-15 (2012).55 Motoi, Y. et al. Digital PCR for determination of cytochrome P450 2D6 and sulfotransferase 1A1 gene copy number variations. Drug Discov Ther 11 , 336-341, doi:10.5582/ddt.2017.01057 (2017).56 Fei, Z., Gupta, N., Li, M., Xiao, P. & Hu, X. Toward highly effective loading of DNA in hydrogels for high-density and long-term information storage. Sci Adv 9 , eadg9933, doi:10.1126/sciadv.adg9933 (2023).57 Li, H., Mu, P., Li, J. & Wang, Q. Inverse desert beetle-like ZIF-8/PAN composite nanofibrous membrane for highly efficient separation of oil-in-water emulsions. J Mater Chem A 9 , 4167-4175, doi:10.1039/D0TA08469G (2021). Fig. 1. Design of the proposed digital (RAA-BART) detection device, along with the phone shell and associated component composition. (A) Design and principle of solvent-responsive MBs. The initial state of solvent-responsive MBs, the absorption state of it (blue); the flipping and lifting processes of the responsive MB surface during the interaction (green, in this state, the COO− group started flipping while NA was lifting on the surface of solvent-responsive MBs); DNA release from the surface of solvent-responsive MBs during the desorption step (orange). (B) Hydrophilic and hydrophobic changes of solvent-responsive MBs. (C) The magnetic response of solvent-responsive MBs. D. Design of RAA-BART detection device based on computer simulation (1) including self-made NA extraction disk (2), RAA-BART mixing device (3) RAA-BART detection chip (company designed) and GENTUBE GE4 System. E. Design of digital RAA-BART detection device based on computer simulation including mini NA extraction disk, mini RAA-BART mixing device and digital RAA-BART chip. F. P rinciple of RAA: The recombinase, when it binds to the primer, forms a protein-DNA complex that can search for homologous sequences in double-stranded DNA. Once the primer locates the homologous sequence, a strand exchange reaction occurs to form and initiate NA synthesis, resulting in exponential amplification of the target region on the template. The replaced NA strand binds to SSB to prevent further replacement. In this system, two complementary primers initiate a synthesis event. The entire process is very fast, and amplification products at detectable levels can usually be obtained within ten minutes. Fig. 2. Optimization of BART formula and screen of primes used on RAA-BART detection method. (A) Principle of BART. It is based on pyrophosphate bioluminescence. The red arrow indicates the source of its background signal. (B) Electrophoretic image of RAA using 8 different dATP derivatives (1-8 Corresponding to the number in Fig. C). M means 100 bp marker. (C) Chemical structural formula of 8 different dATP derivatives. (D) The target fragment (B646L) of AFSV gene. (E) The background bioluminescent signal of 8 different dATP derivatives. (F) The RAA-BART results of AFSV based on D2dATP with different primes designed here. (G) Electrophoretic image of RAA based on D2dATP with different primes designed here. M2 means DL2000 while 1-5 means the primes in Table 1 and N means negative control. Fig. 3. RAA-BART optimization based on various DNA polymerases and recombinant Bsu DNA polymerase developed here. The ASFV reference plasmid (target DNA) was used to prepare an 10-step concentration gradient (10 7 , 10 6 ,10 5 , 10 4 , 10 3 , 10 2 , 10, 1, 0.1 and 0 copies/μL) corresponding to numbers 1-10. (A) Results of traditional LAMP-BART. Using Bst DNA polymerase at 65 ℃ . (B) Results of new LAMP-BART. Using Bst DNA polymerase at 65 ℃ . ( C) Results of RAA-BART. Using Phi DNA polymerase at 44 ℃ . ( D) Results of RAA-BART. Using Bsu DNA polymerase at 44 ℃. (E) Results of RAA-BART. Using Fusion DNA polymerase at 44 ℃ . (F) Results of RAA-BART. Using BA DNA polymerase at 44 ℃. (G) Results of RAA-BART. Using recomninant Bsu DNA polymerase at 44 ℃ (H) Standard curves were constructed by graphing time to Tmax against sample concentrations (Copies/μL). I. Prediction map of abov e DNA polymerases (chemical structure) affinity of for NA using aphfoad 3. (J) T he actual photo of GENTUBE GE4 System and the results on the phone. (K) Specific evaluation of RAA-BART. 1 means positive control (NC), 2 means DNA extracted from AFSV isolated by our lab (pig/HLJ/2018). 3-5 means DNA extracted from non-AFSV isolated by our lab. 6 means negative control. (L) The structure of GENTUBE GE4 System. Fig. 4. The evaluation of the RAA-BART method applied on clinical samples. (A) 1 means samples of pig tissue homogenate while 2 means samples of pig serum. (B) 1 means actual photo of RAA fluorescent probe technique (tested by GENTUBE GE4 System) while 2 means RAA fluorescent probe in FAM channel (C) Results of clinical samples detected by RAA-BART (tested by GENTUBE GE4 System). (D) Results of GB/T 18648-2020 of diagnostic techniques (based on qPCR, tested by QuantStudio 5 PCR) (D) Evaluate the quantitative ability of RAA-BART compared to GB/T 18648-2020. Fig. 5. Design and synthesis of the chip and its application on digital RAA-BART device, according to computer simulation. ( A) 1~2 means rendered stereogram of the actual photo of reagent mixing apparatus. 3~4 means design diagrams of reagent mixing apparatus. They can mix the NA (exteacted by self-made NA extraction and purification disk), RAA mix and BART mix. (B) Rendered stereogram of the actual photo of digital RAA-BART chip. (C) The inside of digital RAA-BART chip predicted d by Solidwork. (D) 3D modeling of digital RAA-BART chip designed by Rhino. (E) Work Breakdown Structure (WBS) diagras of self-made NA extraction and purification disk. 1 means Rendered stereogram of the actual photo of while 2 means design diagrams. F. The bioluminescent micropores diagram of the digital RAA-BART on the chip. The NA concentration of sample were 1, 10, 100 and 10000 (copies/μL). (G) Positive and negative bioluminescent intensity threshold diagrams of the digital RAA-BART on the chip. The NA concentration of sample were 1, 10, 100 and 10000 (copies/μL). (H) The predication of liquid flow rate on the digital RAA-BART chip under different pressure. Fig. 6. The design and results of digital RAA-BART detection mobile phone shell. ( A) 1 means design diagrams of olephilic and hydrophobic silica particles modified with AFSV I/AFSV II. 2 means the oli designed here used to coat RAA-BART mix and NA. (B) SEM image of PNIPAM/PSA hydrogel mixed with silica particles. (C) Rendered stereogram of the actual photo of Reagent mixing apparatus made of plastic in nature and metal. (D) Modeling of PNIPAM/PSA hydrogel mixed with silica particles. (E) Procedure of digital digital RAA-BART detection mobile phone shell. Through olephilic and hydrophobic silica particles to divide the oil droplet into equal parts. 1 means PNIPAM/PSA hydrogel mixed with silica particles to form inverse desert beetle-like structure. 2 means PNIPAM/PSA hydrogel mixed with silica particles modified with primes AFSV I/AFSV II. 3 means silica particles modified with primesAFSV I/AFSV II divide the l droplet(O/W) into equal parts under the pressure. (F) The mixture of the RAA mix, BART mix and NA on the mini digital RAA-BART chip. (G) The predication of liquid flow rate on the mini digital RAA-BART chip with different structures under different pressure. Using Ansys Fluent app to simulate the mixing flow of various liquids in different models and observing their flow rates and mixing conditions. (H) Rendered stereogram of the actual photo of digital RAA-BART detection mobile phone shell, which included a mini RAA-BART detection chip, reagent mixing apparatus and self-made NA extraction and purification disk. (I) Positive and negative bioluminescent intensity threshold diagrams of the digital RAA-BART on the chip. The NA concentration of sample ASFV I was 100 copies/μL while sample ASFV II was 10000 copies/μL. (J) Principle of digital digital RAA-BART detection mobile phone shell. Through olephilic and hydrophobic silica particles to divide the oil droplet into equal parts. (K) Microscope images of oil taken by optical microscopy. (L) The bioluminescent droplet diagram of the digital RAA-BART (AFSV1) on the chip. The NA concentration of sample were 10000 copies/μL. (M) The bioluminescent droplet diagram of the digital RAA-BART (AFSV2) on the chip. The NA concentration of sample were 5000 copies/μL Table 1. The details of sequences used in the screening of RAA-BART detection. Name Target (AFSV) Length (bp) Primer Primer Sequence (5’-3’) RAA-1 B646L (P72) 280 F1 ACTCTCACAATATCCAAACAGCAGGTAAAC R1 ATAAAAAGTCCAGGAAATTCATTCACCAAA RAA-3 280 F2 ACTCTCACAATATCCAAACAGCAGGTAAAC R2 ATAAAAAGTCCAGGAAATTCATTCACCAAA RAA-4 208 F3 TTACGTCTTATGTCCAGATACGTTGCGTCCG R3 TATGCAACATTCATGATTTGCACAAGCCGC RAA-5 305 F4 TTCCTTTCACAACATTTTCCCGAGAACTCT R4 ATAAAAAGTCCAGGAAATTCATTCACCAAA RAA-2 CP204L (P30) 140 F12 GATCATCTTCACAAGTTGTGTTTCATGCGGGTAG R12 CGAGCAGATTTCACAATATCATACTTAACAGTAC Table 2. Evaluation of the accuracy of digital RAA-BART device and mobile phone shell. DNA in reaction (copies) Lambda_theoretical (copies) Actual results(copies/μL) λ Np P(0) Np N Copies/μL Accurancy RAA-BART device (N=20000) AFSV I 1 0.00005 1 99.995% 0/1 20000 0/1 50% 10 0.0005 10 99.950% 7/9 20000 9/8 85% 100 0.005 100 99.500% 92/103 20000 92/103 94.5% 10000 0.5 10000 50.000% 9830/9650 20000 9830/9650 97.4% RAA-BART device (N=20000) AFSV II 1 0.00005 1 99.995% 0/0 20000 0/0 0% 10 0.0005 10 99.950% 7/11 20000 7/11 80% 100 0.005 100 99.500% 89/97 20000 89/97 93% 10000 0.5 10000 50.000% 9620/9490 20000 9620/9490 95.6% RAA-BART mobile phone shell (N≈10000) AFSV I 1 0.00010 1 99.990% 1/0 8800 1/0 50% 10 0.00091 9 99.909% 6/9 11030 6/9 80% 100 0.0093 93 99.070% 75/90 10678 75/90 88.7% 5000 0.499 4990 51.400% 5007/4750 10013 4210/4753 95.9% RAA-BART mobile phone shell (N≈10000) AFSV II 1 0.00010 1 99.990% 0/1 9200 0/1 50% 10 0.00102 10 99.900% 0/0 9788 7/8 75% 100 0.0098 98 99.020% 0/0 10200 80/95 87.5% 5000 0.486 4860 51.400% 4210/4753 10289 4210/4753 90.8% N: total chamber/droplet quantity. Np: positive chamber/droplet number. Nn: negative chamber/droplet number. λ: copies per chamber/droplet = −ln(Nn/N) = copies in the reaction/total chambers/droplets. V = Reaction volume (10 μL) /N = 0.0005/0.001 μL. P(0) = Nn/N = e−λ, λ = −ln(Nn/N) = Concentration in reaction × V. Concentration in reaction = [−ln(N/N)]/V. Target RNA concentration = 10 × C Copies/μL . P(0) = Nn/N = e−λ, λ = −ln(Nn/N) = CCopies/mL × V. Information & Authors Information Version history V1 Version 1 21 June 2025 Peer review timeline Published Advanced Intelligent Systems Version of Record 2 Dec 2025 Published Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords bioluminescenct pyrophosphate in real-time digital point-of-care testing device based on bioluminescent pyrophosphate solvent-responsive magnetic beads Authors Affiliations Zhongjie Fei 0000-0002-8219-4448 [email protected] Nanjing Agricultural University College of Veterinary Medicine View all articles by this author Bai Juan Nanjing Agricultural University College of Veterinary Medicine View all articles by this author Liwei Xu Nanjing Agricultural University College of Veterinary Medicine View all articles by this author Siyi Wang Nanjing Agricultural University College of Veterinary Medicine View all articles by this author Pengfei Xiao Southeast University State Key Laboratory of Bioelectronics View all articles by this author Dongrui Zhou Southeast University State Key Laboratory of Bioelectronics View all articles by this author Guanxiong Liu The University of Hong Kong Shenzhen Institute of Research and Innovation View all articles by this author Rongbin Wei Jiangsu Ocean University School of Applied Technology View all articles by this author Ping jiang Nanjing Agricultural University College of Veterinary Medicine View all articles by this author Metrics & Citations Metrics Article Usage 160 views 92 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Zhongjie Fei, Bai Juan, Liwei Xu, et al. Digital Point-of-care Testing Device based on Bioluminescent Pyrophosphate in Real-time and Recombinase-aid Amplification. Authorea . 21 June 2025. DOI: https://doi.org/10.22541/au.175047680.03452264/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.175047680.03452264/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fed9b3decfb58d3',t:'MTc3OTMwMzg1OA=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();