Montelukast altered BDNF and CHRNA7 gene expression... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/14-963" }, "headline": "Montelukast altered BDNF and CHRNA7 gene expression were associated with behavioral changes in rats.", "datePublished": "2025-09-22T16:24:31", "dateModified": "2025-09-22T16:24:31", "author": [ { "@type": "Person", "name": "Karar Haider" }, { "@type": "Person", "name": "Yassir Mustafa Kamal Al Mulla Hummadi" }, { "@type": "Person", "name": "Rihab Muhamad Guaim" }, { "@type": "Person", "name": "Mutaz Ahmeid" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Montelukast is a pharmaceutical agent predominantly used for the management of asthma and allergic rhinitis. It fulfils its role by antagonizing the cysteinyl leukotriene receptor type 1, hence inhibiting the effects of inflammatory leukotrienes such as LTD4. Nonetheless, like to other pharmaceuticals, montelukast is associated with possible adverse effects. Prevalent symptoms include cephalalgia, abdominal discomfort, and influenza-like manifestations. In few instances, it has been linked to changes in mood, agitation, and sleep disruptions, particularly in youngsters. Objective to assess the potential psychotropic effects of montelukast by measuring changes in cortisol levels, examining genes involved in neurotransmission and neuroplasticity, and observing behavioral tests in treated animals. Methods Thirty-five albino male rats weighing 150-200 milligrams the rats were categorized into five groups, with seven individuals in each group. Group II received reserpine as the positive control, while montelukast was administered at doses of 5 mg/kg for group III, 10 mg/kg for group IV, and 20 mg/kg for group V. The negative control group I was treated with a solvent combination of DMSO and acetic acid. Results reduction in cortisol levels, downregulation of BDNF and chrna7 genes, and significant alterations in behavioral assessments in the reserpine and montelukast groups in a dose-dependent manner. Conclusion Animals treated with montelukast exhibit significant alterations in behavior and biomarker levels, suggesting potential psychological changes induced by the medication. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/14-963/v1", "name": "Montelukast altered BDNF and CHRNA7 gene expression were associated..." } } ] } Home Browse Montelukast altered BDNF and CHRNA7 gene expression were associated... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Haider K, Al Mulla Hummadi YMK, Muhamad Guaim R and Ahmeid M. Montelukast altered BDNF and CHRNA7 gene expression were associated with behavioral changes in rats. [version 1; peer review: awaiting peer review] . F1000Research 2025, 14 :963 ( https://doi.org/10.12688/f1000research.169688.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Montelukast altered BDNF and CHRNA7 gene expression were associated with behavioral changes in rats. [version 1; peer review: awaiting peer review] Karar Haider https://orcid.org/0009-0001-6775-1613 1 , Yassir Mustafa Kamal Al Mulla Hummadi https://orcid.org/0000-0002-7543-2807 1 , Rihab Muhamad Guaim 1 , Mutaz Ahmeid https://orcid.org/0000-0001-5126-9665 2 Karar Haider https://orcid.org/0009-0001-6775-1613 1 , Yassir Mustafa Kamal Al Mulla Hummadi https://orcid.org/0000-0002-7543-2807 1 , Rihab Muhamad Guaim 1 , Mutaz Ahmeid https://orcid.org/0000-0001-5126-9665 2 PUBLISHED 22 Sep 2025 Author details Author details 1 Pharmacology & toxicology, Mustansiriyah University College of Pharmacy, Baghdad, Baghdad Governorate, Iraq 2 clinical chemistry, Ibn Sina Medical College, Baghdad, Baghdad, Iraq Karar Haider Roles: Conceptualization, Data Curation, Funding Acquisition, Investigation, Methodology, Resources, Software, Writing – Original Draft Preparation Yassir Mustafa Kamal Al Mulla Hummadi Roles: Conceptualization, Supervision, Validation, Visualization, Writing – Review & Editing Rihab Muhamad Guaim Roles: Writing – Review & Editing Mutaz Ahmeid Roles: Supervision, Visualization, Writing – Review & Editing OPEN PEER REVIEW REVIEWER STATUS AWAITING PEER REVIEW This article is included in the Cell & Molecular Biology gateway. Abstract Background Montelukast is a pharmaceutical agent predominantly used for the management of asthma and allergic rhinitis. It fulfils its role by antagonizing the cysteinyl leukotriene receptor type 1, hence inhibiting the effects of inflammatory leukotrienes such as LTD4. Nonetheless, like to other pharmaceuticals, montelukast is associated with possible adverse effects. Prevalent symptoms include cephalalgia, abdominal discomfort, and influenza-like manifestations. In few instances, it has been linked to changes in mood, agitation, and sleep disruptions, particularly in youngsters. Objective to assess the potential psychotropic effects of montelukast by measuring changes in cortisol levels, examining genes involved in neurotransmission and neuroplasticity, and observing behavioral tests in treated animals. Methods Thirty-five albino male rats weighing 150-200 milligrams the rats were categorized into five groups, with seven individuals in each group. Group II received reserpine as the positive control, while montelukast was administered at doses of 5 mg/kg for group III, 10 mg/kg for group IV, and 20 mg/kg for group V. The negative control group I was treated with a solvent combination of DMSO and acetic acid. Results reduction in cortisol levels, downregulation of BDNF and chrna7 genes, and significant alterations in behavioral assessments in the reserpine and montelukast groups in a dose-dependent manner. Conclusion Animals treated with montelukast exhibit significant alterations in behavior and biomarker levels, suggesting potential psychological changes induced by the medication. READ ALL READ LESS Keywords Montelukast, Reserpine, BDNF, CHRNA7, Forced swimming test, Elevated plus maze test, neuropsychotropic Corresponding Author(s) Karar Haider ( [email protected] ) Close Corresponding author: Karar Haider Competing interests: No competing interests were disclosed. Grant information: The author(s) declared that no grants were involved in supporting this work. Copyright: © 2025 Haider K et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Haider K, Al Mulla Hummadi YMK, Muhamad Guaim R and Ahmeid M. Montelukast altered BDNF and CHRNA7 gene expression were associated with behavioral changes in rats. [version 1; peer review: awaiting peer review] . F1000Research 2025, 14 :963 ( https://doi.org/10.12688/f1000research.169688.1 ) First published: 22 Sep 2025, 14 :963 ( https://doi.org/10.12688/f1000research.169688.1 ) Latest published: 22 Sep 2025, 14 :963 ( https://doi.org/10.12688/f1000research.169688.1 ) Introduction The medicines that may induce depression or contribute to depressive symptoms are prevalent. Annually, there is a monetary report about substances that induce effects comparable to depression. 1 These medicines may directly influence neurotransmitter concentration in the central nervous system or may induce adverse effects such as drowsiness, appetite suppression, pain, exhaustion, and other effects that might lead to the onset of depression. The primary sickness may also increase these consequences. 2 Reserpine, used as a standard pharmacological agent to produce a depression model, is a pharmaceutical rarely employed in current hypertension therapy and is recognized as possibly inducing psychological issues. 3 Montelukast, which functions by inhibiting the activity of leukotriene D4 in the lungs, 4 is used in the treatment of millions of patients globally. 5 In 2008, the Food and Drug Administration warned of a probable link between leukotriene-modifying medicines and suicidality. 6 According to a study that focusing on the mechanism that lead to neuropsychiatric events of montelukast by studying the metabolic pathway of montelukast in mice they found, that montelukast can cause alteration in the biosynthesis of steroid and neurotransmitter in the prefrontal cortex of the brain as well as The routes of branched-chain amino acids (leucine, isoleucine, and valine) which are crucial for the synthesis of neurotransmitters such as dopamine, adrenaline, noradrenaline, histamine, and serotonin (5-hydroxytryptamine, 5-HT), 7 also Corticosterone, the predominant glucocorticoid in mice, similar to cortisol in humans, 8 was observed to be upregulated in the brain of mice which is similar to that found in the human. Elevated cortisol levels have been noted in patients with depression, and the elevated corticosterone levels in treated mice indicate that those exposed to montelukast are more susceptible to exhibiting depression-like symptoms. Moreover, hyper-activation of the HPA axis elevates levels of corticosterone, serotonin, and histamine. 9 BDNF is the member of the nerve growth factor (NGF) family that is expressed the most. Other members of this family include NGF, neurotrophin-3, and neurotrophin-4, 10 Postmortem studies indicate that BDNF levels are diminished in the cerebral cortex of individuals with depression and those who have committed suicide’s, 11 The upregulation or downregulation of the BDND gene indicates brain injury and causes alterations in mental state. Cholinergic Receptor Nicotinic Alpha 7 Subunit CHRNA7 gene encode A7 nAChR, 12 Interestingly, it has been demonstrated that the release of several neurotransmitters, including the release of noradrenaline, serotonin, GABA, glutamate, and dopamine, is promoted by the activated a-7 nicotinic acetylcholine receptor (a7 nAChR) via the increased permeability to cations, particularly Ca(2+), 13 Research indicates that nAChRs exhibit aberrant functionality in mental disorders. 12 Method Statement of ethical principles All animal operations adhered to the ARRIVE criteria and the preclinical ARRIVE Essential 10 checklist 14 and received approval from the Animal Ethics Committee of Mustansiriyah University, Baghdad, Iraq (Approval No: [54]). Rats were anesthetized by intraperitoneal administration of ketamine (100 mg/kg, 10%, Alfasan, Holland) and xylazine (10 mg/kg, 20 mg/ml, Kepro, Holland). Euthanasia was conducted at the conclusion of the experiment by an overdose of ketamine/xylazine, 15 in accordance with the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020). All measures were taken to reduce animal suffering. Study design Materials used in this study include Reserpine (Sigma/Germany, cas.no 50-55-5), and Montelukast powder from (Sigma/Germany, cas.no158966-92-8), solvent Dimethyl sulfoxide and acetic acid from (Mumbai–India), and corn oil from (Sigma Aldrich-Germany, Cat. No. C8267), distilled water from (pioneer, Iraq), xylazine vial (20 mg/ml) from (Kepro, Holland), Ketamine vial (10%) from (Alfasan, Holland, cat.no, V/NRP/97/0547) hematoxylin and eosin from (Sigma, Germany. For this experimental animal study, thirty-five albino male rats weighting (150-200mg), rats were housed in spacious, cozy cages after being acquired from the animal house Iraqi Centre for Cancer and Medical Genetics Research (ICCMGR)/of Mustansiriyah University. They were permitted to acclimatize for 21 days in a regulated environment. there was a light schedule with 12 hours of light and 12 hours of darkness, the temperature was kept at 25 ± 1°C, and the humidity was kept between 40 and 50%. They have unlimited access to food and drink ad libitum. Rats were then divided into five groups at randomly. Each group contain seven rats. I. Group 1 (n = 7): Negative control group, rats received a mixture of distilled water, 5% glacial acetic acid, corn oil, and 5% Dimethyl sulfoxide (DMSO ) was given orally for 14 days. II. Group 2 (n = 7): The positive control, rats were administered a dose of reserpine at a concentration of 0.2 mg/kg of body weight intraperitoneally once daily for 14 days. 16 III. Group 3(n = 7): rats orally administered dose of montelukast at a concentration of 5 mg/kg for 14 days. IV. Group 4(n = 7): rats orally administered dose of montelukast at a concentration of 10 mg/kg for 14 days. V. Group 5(n = 7): rats orally administered dose of montelukast at a concentration of 20 mg/kg for 14 days. Preparation of drug and doses For preparing 0.2 mg/kg reserpine we first prepared a working solution of 1mg reserpine that dissolved in 5 ml of diluted glacial acetic acid, the glacial acetic acid in 5% concentration, the procedure done in a glass tube and mixed thoroughly by vortex until completely dissolved to get a final concentration of 0.2 mg/1ml of reserpine concentration from which about (0.2 ml to 0.175) was injected intraperitonially. 17 To obtain a 5% DMSO concentration, five milligrams of montelukast were added to a laboratory glass. A small amount of DMSO was then added, and the mixture was stirred until the montelukast was completely dissolved. Corn oil was then used as a diluent and a vehicle of administration, and 5 mg/ml of montelukast solution was administered orally. 18 The dosage was divided based on the weighting of the animals, and each group is represented in Table 1 . Table 1. Montelukast per dose group and their corresponding volume of administration. Group of animals The volume of a drug administration Group III (5 mg/kg) 0.2 ml Group IV (10 mg/kg) 0.4 ml GROUP V (20 mg/kg) 0.8 ml Sample collection At the day 14, rats were permitted to fast for 12 hours, and under anesthesia with ketamine and xylazine injections intraperitoneal at 100 and 10 mg/kg, respectively, At the day 14 blood samples were extracted from the apex of the heart (left ventricle) using a 5 ml syringe, gauge 23, placed in gel tubes, and allowed to clot for 15 minutes at room temperature. Subsequently, they were subjected to centrifugation for 15 minutes at 3000 RPM. The obtained serum was aliquoted into Eppendorf tubes (1.5 ml). They were preserved at −20°C to quantify blood levels of cortisol. Tissue collection Upon completion of the experiment (on day 14), following euthanasia, the skull was dissected, and the brains of seven rats from each group were extracted and rinsed with cold phosphate-buffered saline (PBS, pH 7.4) to eliminate residual blood and debris. Subsequently, the tissue was dried using filter paper, divided into two segments for histopathological examination and PCR analysis, and weighed using a sensitive balance. For histological examination, samples were kept in 10% neutral buffered formalin (Euroclone-Italy) to safeguard the tissue architecture against autolysis. For PCR analysis, 50-100 mg of brain tissue was combined with 1 ml of TRIzol (TransGen Biotech, cat. no. ER501-01) solution in an Eppendorf tube and then frozen for future use. Gene expression analysis RNA was isolated from a tissue sample using the RNA extraction kit methodology. 50-100 mg of hippocampal brain tissue was promptly added to 1ml of TRIzol solution, then kept in the deepfreeze tell the day of examination. To quantify the expression of BDNF PRM (F: TGGCTGACACTTTTGAGCAC, R: CAAAGGCACTTGACTGCTGA) and chrna7 PRM (F: TGCAGTGAATGGAAGTTTGC, R: GGACACAGCCTCCACAAAGT) genes via the real-time quantitative polymerase chain reaction (RT-PCR) technique. This procedure included the separation of brain tissue, total RNA extraction by TRIzol and subsequent Complementary DNA (cDNA) synthesis, along with genomic DNA removal, was performed using TransScript ® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China, cat. no. AT311-02). 19 A total of 20 μL of cDNA was amplified using real-time PCR, including 10 μL of Perfect Start Green qPCR Super Mix (TransGen Biotech, Beijing, China; cat. no. AQ601), 20 1 μL of primers derived from forward and reverse solutions, 4 μL of cDNA, and 4 μL of nuclease-free water. 21 The finished solution was subjected to heat reaction in the RT-PCR apparatus. Table 2 and Table 3 presents the thermal cycling methodology along with the appropriate melting point for each primer as specified by the manufacturer’s guidelines Table 2. Thermal cycle conditions of RT-qPCR for BDNF mRNA expression evaluation. Temperature Time/Sec. Cycle Stage 1 Denaturation 94 55 1 Stage 2 Denaturation 94 10 42 Annealing 58 15 Extension* 72 20 Stage 3 Dissociation 55-95 1 1 Table 3. Thermal cycle conditions of RT-qPCR for CHRNA7 mRNA expression evaluation. Temperature Time/Sec. Cycle Stage 1 Denaturation 94 55 1 Stage 2 Denaturation 94 11 45 Annealing 56 20 Extension* 72 20 Stage 3 Dissociation 55-95 1 1 . CALCULATION: The cycle threshold (CT) of the target genes was standardized against that of the internal control gene. The disparity in cycle threshold (Ct) values between the β-actin (internal control gene) and the target genes, BDNF and CHRNA7, was determined using the following equation 28: ΔCT ( test ) = CT ( target , test ) − CT ( ref , test ) The calibrator was selected from the control samples, and the DCT of the calibrator was computed using the following equation: ΔCT ( calibrator ) = CT ( target , calibrator ) – CT ( ref , calibrator ) The DCT of the test samples was normalized to the DCT of the calibrator:DD CT was calculated according to the following equation ΔΔCT = ( ΔCT test ) – ΔCT ( calibrator ) Finally, the expression ratio was calculated according to the formula: 22 2 − ΔΔCT = normalized expression ratio . Behavioral test Elevated plus maze test (EPM): The maze has four arms, two non-consecutive open arms measuring 30 cm in length and 5 cm in width, and two closed arms that form a central zone measuring 5 cm by 5 cm. The EPM was positioned 60 cm above the floor in the center of the room. The mouse was positioned in one of the open arms, orientated away from the center, and allowed to roam freely for five minutes. All sessions were documented with a camera positioned above the EPM, and the duration spent in the arms and center of the maze was quantified. Open arms and central regions are classified as anxiety zones. 23 Force swimming test: The animal finds itself in a cylindrical water container from which it cannot escape. Most animals will try to flee by means of vigorous swimming. The animal is said to have given up when it stops swimming and floats on the water’s surface. An animal that quits up quite fast is said to be exhibiting traits related to human despair. Animals are maintained in water for five minutes for each during which we determine their movement and stop times. 24 Results Effect of montelukast on gene expression depending on real time reverse transcriptase poly chain reaction (QRT-PCR): Gene expression analysis revealed differential regulation of CHRNA7 and BDNF genes across treatment groups details are presented in Table 4 . The CHRNA7 gene showed variable expression patterns, with the control group exhibiting a mean fold change of 4.85 ± 3.42 as shown in Figure 1 . Montelukast treatment at 20 mg/kg resulted in the lowest CHRNA7 expression (1.56 ± 1.05fold change). BDNF gene expression was relatively stable across groups, with slight variations observed Table 4. Gene expression analysis (Mean ± SD). Gene G1 (Control) G2 (Reserpine) G3 (MTK 5 mg/kg) G4 (MTK 10 mg/kg) G5 (MTK 20 mg/kg) F-statistic p-value CHRNA7 (Fold change) 4.85 ± 3.42 2.65 ± 1.46 2.98 ± 2.12 2.87 ± 0.74 1.56 ± 1.05 3.71 <0.05 BDNF (Fold change) 2.39 ± 1.48 1.16 ± 0.47 1.72 ± 0.74 1.83 ± 0.66 1.36 ± 0.91 2.13 0.105 Figure 1. Relative gene expression levels of CHRNA7 (A) and BDNF mRNA (B) normalized to β-actin housekeeping gene. Data presented as fold change relative to control group (mean). n = 7 per group. Behavioral phenotypes across groups This section provides a detailed characterization of the behavioral profiles observed in each experimental group. The parameters assessed, indicative of general activity, despair-like behavior (in a forced swim test context), and anxiety-related responses (an elevated plus maze), are sourced from thorough examination of Swimming Time, Immobility Time, Open Arms Time, and Closed Arms Time allows for a comprehensive understanding of the behavioral state of each group details are presented in Table 8 . Table 5. Tukey-Kramer test for all pairwise comparisons of Forced Swimming Test in treatment groups. Parameter G1 (Control) G2 (Reserpine) G3 (MTK 5 mg/kg) G4 (MTK 10 mg/kg) G5 (MTK 20 mg/kg) F-statistic p-value Swimming Time (s) 231.86 ± 14.92 153.57 ± 14.41 213.57 ± 14.03 204.86 ± 8.57 187.00 ± 8.51 48.72 <0.001 Immobility Time (s) 68.14 ± 14.92 146.57 ± 14.19 86.43 ± 14.03 95.14 ± 8.57 113.00 ± 8.51 48.89 <0.001 Table 6. Tukey-Kramer test for all pairwise comparisons of Forced Swimming Test in treatment groups. Swimming Time (s) Immobility Time (s) Factor n Mean SD Different (P < 0.05) from factor nr Mean SD Different (P < 0.05) from factor nr (1) G1 7 231.8571 14.9156 (2)(4)(5) 68.1429 14.9156 (2)(4)(5) (2) G2 7 153.5714 14.4090 (1)(3)(4)(5) 146.5714 14.1875 (1)(3)(4)(5) (3) G3 7 213.5714 14.0340 (2)(5) 86.4286 14.0340 (2)(5) (4) G4 7 204.8571 8.5718 (1)(2) 95.1429 8.5718 (1)(2) (5) G5 7 187.0000 8.5049 (1)(2)(3) 113.0000 8.5049 (1)(2)(3) Table 7. Elevated Plus Maze Test Results (Mean ± SD). Parameter G1 (Control) G2 (Reserpine) G3 (MTK 5 mg/kg) G4 (MTK 10 mg/kg) G5 (MTK 20 mg/kg) F-statistic p-value Closed Arm Time (s) 94.29 ± 8.75 202.29 ± 16.76 165.14 ± 12.72 189.00 ± 18.53 197.14 ± 14.88 62.43 <0.001 Open Arm Time (s) 205.71 ± 8.75 97.71 ± 16.76 134.86 ± 12.72 111.00 ± 18.53 102.86 ± 14.88 62.43 <0.001 Table 8. Pairwise comparisons of Behavioral test results across treatment groups in elevated plus maze test. Factor n Open Arm Mean Open Arm SD Different (P < 0.05) Closed Arm Mean Closed Arm SD Different (P < 0.05) (1) G1 7 205.710 8.750 (2)(5) 94.290 8.750 (2)(5) (2) G2 7 97.710 16.760 (1)(3)(4)(5) 202.290 16.760 (1)(3)(4)(5) (3) G3 7 134.860 12.720 (2)(5) 165.140 12.720 (2)(5) (4) G4 7 111.000 18.530 (2)(5) 189.000 18.530 (2)(5) (5) G5 7 102.860 14.880 (1)(2)(3)(4) 197.140 14.880 (1)(2)(3)(4) Forced Swimming Test: Montelukast treatment showed dose-dependent effects, with the highest dose (20 mg/kg) producing the most pronounced reduction in swimming time (187.00 ± 8.51 s) details are presented in Figure 2 , Table 5 and Table 6 . Figure 2. Forced Swimming Test Results (Mean ± SEM) across treatment groups. Elevated Plus Maze Test Montelukast treatment showed a dose-dependent increase in closed time, with the 20 mg/kg dose group spending 197.14 ± 14.88 s in open arms details are presented in Table 7 , Figure 3 and Figure 4 . Figure 3. Open arms time seconds (Mean ± SEM) across treatment groups. Figure 4. Closed arms time seconds (Mean ± SEM) across treatment groups. Biochemical parameters Cortisol levels were measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit (Cloud-Clone Corp., cat. no. CEA462Ge). Cortisol levels were markedly elevated in both reserpine (62.91 ± 9.27 ng/ml) and high-dose montelukast groups (91.12 ± 3.12 ng/ml) compared to control (11.57 ± 0.26 ng/ml) details are presented in Table 9 and Figure 5 . Table 9. Cortisol Levels (Mean ± SD). Parameter G1 (Control) G2 (Reserpine) G3 (MTK 5 mg/kg) G4 (MTK 10 mg/kg) G5 (MTK 20 mg/kg) F-statistic p-value Cortisol (ng/ml) 11.57 ± 0.26 62.91 ± 9.27 16.19 ± 1.95 45.32 ± 5.14 91.12 ± 3.12 389.42 <0.001 Figure 5. Cortisol (Mean ± SEM) across treatment groups. Histopathological study The control group exhibited a normal morphology of neurons and glial cells across the molecular layer, external granular layer, external pyramidal layer, inner granular layer, inner pyramidal layer, ganglionic layer, and multiform layer ( Figure 6 ). In contrast, the Reserpine-treated group displayed numerous vacuoles of varying sizes (indicative of demyelination), accompanied by degeneration and necrosis of glial cells, while the neurons maintained a normal appearance of pyramidal neuron types. The montelukast-treated groups at dosages of 5 mg/kg and 10mg/kg demonstrated normal meningeal diameter and normal morphology of neurons and glial cells throughout all cerebral cortical layers. However, the group treated with 20 mg/kg exhibited mild congestion of the meningeal blood vessels, along with congestion and perivascular edema of cerebral cortical blood vessels, while the glial cells and neurons across all cortical layers retained a normal appearance. details are presented in Figures 6 – 10 . Figure 6. Cerebral cortex (Control) shows: normal appearance of the meningeal piamater (arrow). Figure 7. Section of cerebral cortex (Control positive) shows: many varies size cortical vacuoles (arrows) associated with necrosis with atrophy and marked demyelination (arrows). H&E stain 100x. Figure 8. Cerebral cortex (MTK5 mg/kg) shows: normal appearance of the meningeal piamater (black arrow), neurons and glial cells within neurons of molecular (m), external granular (eg) & external pyramidal (ep). H&E stain 100x. Figure 9. Cerebral cortex (MTK10 mg/kg) shows: normal appearance molecular layer (m), external granular neuron (eg) & external pyramidal layers (ep). H&E stain 100x. Figure 10. Cerebral cortex (MTK20 mg/kg) shows: mild congestion of the meningeal blood vessel (Red arrow), and congestion with perivascular edema (Black arrows) & normal glial cells & neurons in molecular (m), external granular (eg) & external pyramidal (ep). H&E stain 100x. Statistical analysis Analyses were performed in SPSS v26 and GraphPad Prism v9 (Excel 2021 for data verification/graphics). Data are reported as mean ± SD in tables and mean ± SEM in figures. Two-tailed tests were used with α = 0.05; exact p values are given where possible, and figures use p < 0.05, p < 0.01, p < 0.001. Assumptions were examined by Shapiro–Wilk tests and Q–Q plots (normality) and Levene’s test (homogeneity). Group differences in behavioral outcomes (Forced Swimming Test; Elevated Plus Maze) and biochemical measures (dopamine, serotonin, norepinephrine, BDNF, cortisol) were tested by one-way ANOVA with Tukey HSD (or Tukey–Kramer) for pairwise comparisons. When comparisons were planned only versus the negative control, Dunnett’s test was applied. If variances were unequal, Welch’s ANOVA with Games–Howell post-hoc tests was used; for non-normal data, Kruskal–Wallis with Dunn’s tests (Bonferroni-adjusted) replaced parametric methods. Gene expression was analyzed on ΔCq values (normalized to β-actin) using one-way ANOVA or the above non-parametric/heteroscedastic alternatives as required. For presentation, fold changes relative to control were computed by the 2^–ΔΔCq method; inference relied on ΔCq, with 95% confidence intervals provided. Dose–response across montelukast groups (5, 10, 20 mg/kg) was evaluated using linear orthogonal polynomial contrasts within ANOVA, reporting slope, 95% CI, and η 2 p; Associations between behavioral and biochemical variables were assessed with Pearson correlations. Determinants of behavioral outcomes were examined using multiple linear regression with immobility time and Elevated Plus Maze indices as dependent variables and neurotransmitters, BDNF, cortisol, and treatment group/dose as predictors. All analyses were complete-case. Discussion Montelukast is a widely used pharmaceutical; in 2022, it ranked as the seventeenth most frequently prescribed drug in the United States, with over 29 million prescriptions issued, 25 Montelukast is used for a number of conditions including asthma, exercise induced bronchospasm, allergic rhinitis, and urticaria Montelukast Monograph, 26 also the psychological safety of montelukast has raised concerns among scientists during the last two decades. 27 In the current investigation, we seek to determine the association between montelukast and its potential psychological adverse effects by using several behavioral and physiological indicators, as well as assessing its impact on CHRNA7 and BDNF gene expression. The result of forced swimming test demonstrates that montelukast administration produces dose-dependent psychotropic effects comparable to reserpine, we observed an increase in immobility time in the montelukast-treated group compared to the negative control group in a dose-dependent way, particularly evident in Group V (15 mg/kg). An increase in immobility time during the forced swimming test indicates depressive-like behavior in the animal model. 28 The observed increase in immobility duration may be associated with diminished serotonergic neurotransmission, since serotonin (5-HT) depletion or synthesis inhibition results in heightened immobility. 29 In contrast, conventional antidepressants that augment monoaminergic transmission reliably diminish immobility in the Forced Swim Test (FST). The Elevated Plus Maze (EPM) test in this research demonstrated that Montelukast elicits anxiety-like behavior in a dose-dependent fashion. Rats administered Montelukast (5–20 mg/kg) exhibited reduced time in the open arms and increased time in the closed arms relative to the control group. The group administered 20 mg/kg exhibited behavioral patterns similar to those of the reserpine-treated positive control, indicating heightened anxiety. The results align with growing clinical data indicating a correlation between Montelukast and neuropsychiatric adverse effects, such as anxiety, agitation, sleep problems, and depression. A significant quantity of post-marketing studies has compelled regulatory bodies to issue warnings. In 2020, the U.S. FDA issued a boxed warning for Montelukast owing to the potential for severe mental health adverse effects, especially in children and adolescents. 30 The anxiogenic effects identified in this research reinforce these concerns and underscore the need for care when administering Montelukast, particularly for mild diseases like allergic rhinitis. These findings emphasize the significance of behavioral safety profile in pharmacological repurposing and prolonged use contexts. Gene expression analysis revealed differential regulation of CHRNA7 and BDNF genes across treatment groups. The CHRNA7 gene showed variable expression patterns. Montelukast treatment at 20 mg/kg resulted in the lowest CHRNA7 expression. BDNF gene expression was relatively stable across groups, with slight variations observed. This work investigated the expression of CHRNA7 and BDNF to elucidate the molecular pathways associated with the possible neuropsychological adverse effects of montelukast. CHRNA7, which encodes the α7 nicotinic acetylcholine receptor, is crucial in regulating neuronal excitability, inflammation, and anxiety-associated behavior. Our findings indicate that CHRNA7 expression was markedly downregulated in the montelukast 20 mg/kg group, with expression levels (1.56 ± 1.05) lower than those seen in the reserpine-treated group. This indicates that high-dose montelukast may aggravate cholinergic dysfunction, a mechanism associated with mood and anxiety problems. 31 Likewise, BDNF, an essential neurotrophins implicated in synaptic plasticity, learning, and mood regulation, was diminished in the reserpine cohort and exhibited partial recovery in the 5 and 10 mg/kg montelukast groups. Nonetheless, expression in the 20 mg/kg group persisted at a modest level (1.36 ± 0.91), indicating a suppression of neurotrophic signaling at higher dosages. Although the ANOVA for BDNF did not achieve significance (p = 0.105), the tendency indicates that low-dose montelukast may provide minor neuroprotective benefits, but larger dosages may inhibit plasticity-related genes, hence contributing to the observed anxiogenic behavior. Cortisol levels were significantly elevated in montelukast-treated groups, particularly at the highest dose, exceedingly even the reserpine group, Initially, elevated cortisol levels induce euphoria; but, sustained exposure to high concentrations may lead to the emergence of other psychological symptoms, including irritation, emotional lability, and sadness. Cortisol shortage may induce agitation; nonetheless, in such instances, the majority of patients exhibit apathy and depression. 29 Conclusion The combined behavioral and gene expression results from this research emphasize the need for care in the chronic or off-label administration of montelukast, especially at elevated dosages, and reinforce the significance of assessing central nervous system safety during medication use. Data availability Zenodo. Montelukast altered BDNF and CHRNA7 gene expression were associated with behavioral changes in rats, https://doi.org/10.5281/zenodo.16920011 . 32 This project contains the following underlying data: • behavioral test.xlsx • cortisol.xlsx • GENE.xlsx Data are available under the terms of the Creative Commons Attribution 4.0 International License (CC BY 4.0). Reporting guidelines Zenodo. The ARRIVE Essential 10: author checklist – Montelukast altered BDNF and CHRNA7 gene expression were associated with behavioral changes in rats, https://doi.org/10.5281/zenodo.17008722 . 33 This project contains the following underlying data: • ARRIVE Essential 10: Author Checklist Data are available under the terms of the Creative Commons Attribution 4.0 International License (CC BY 4.0). References 1. Celano CM, Freudenreich O, Fernandez-Robles C, et al. : Depressogenic effects of medications: a review. Dialogues Clin. Neurosci. 2011 Mar 31 [cited 2024 Oct 29]; 13 : 109–125. PubMed Abstract | Publisher Full Text | Free Full Text 2. Rudisch B, Nemeroff CB: Epidemiology of comorbid coronary artery disease and depression. Biol. Psychiatry. 2003 Aug 1; 54 (3): 227–240. Publisher Full Text 3. Strawbridge R, Javed RR, Cave J, et al. : The effects of reserpine on depression: A systematic review. J. Psychopharmacol. (Oxf.). 2023 Mar 1; 37 (3): 248–260. Publisher Full Text 4. Mahdi MR, Abbas WAK, Jasim GA: Histopathological evaluation of induced pulmonary fibrosis under the effect of montelukast. Al Mustansiriyah J. Pharm. Sci. 2023 Feb 28; 23 (1): 14–21. Publisher Full Text 5. Barbosa JS, Paz A, Filipe A, et al. : Montelukast medicines of today and tomorrow: from molecular pharmaceutics to technological formulations. Drug Deliv. 2016 Nov 21; 23 (9): 3257–3265. PubMed Abstract | Publisher Full Text 6. Capuron L, Ravaud A, Gualde N, et al. : Association between immune activation and early depressive symptoms in cancer patients treated with interleukin-2-based therapy. Psychoneuroendocrinology. 2001 Nov; 26 (8): 797–808. PubMed Abstract | Publisher Full Text 7. Branched-Chain Amino Acids and Brain Function. J. Nutr. 2005 June 1; 135 (6): 1539S–1546S. Publisher Full Text 8. Corticosterone. Handbook of Hormones. Academic Press; 2021 [cited 2024 Nov 26]; p. 935–937. Reference Source 9. Prolonged secretion of cortisol as a possible mechanism underlying stress and depressive behaviour|Scientific Reports.[cited 2024 Nov 28]. Reference Source 10. Castrén E, Kojima M: Brain-derived neurotrophic factor in mood disorders and antidepressant treatments. Neurobiol. Dis. 2017 Jan; 97 (Pt B): 119–126. Publisher Full Text 11. Duman RS, Aghajanian GK, Sanacora G, et al. : Synaptic plasticity and depression: New insights from stress and rapid-acting antidepressants. Nat. Med. 2016 Mar; 22 (3): 238–249. PubMed Abstract | Publisher Full Text | Free Full Text 12. Kunii Y, Zhang W, Xu Q, et al. : CHRNA7 and CHRFAM7A mRNAs: co-localized and their expression levels altered in the postmortem dorsolateral prefrontal cortex in major psychiatric disorders. Am. J. Psychiatry. 2015 Nov 1; 172 (11): 1122–1130. PubMed Abstract | Publisher Full Text 13. Albuquerque EX, Pereira EFR, Alkondon M, et al. : Mammalian nicotinic acetylcholine receptors: from structure to function. Physiol. Rev. 2009 Jan; 89 (1): 73–120. PubMed Abstract | Publisher Full Text | Free Full Text 14. Karar H: The ARRIVE Essential 10: author checklist – Montelukast altered BDNF and CHRNA7 gene expression were associated with behavioral changes in rats.2025 Aug 30 [cited 2025 Aug 30]. Reference Source 15. Mohammed FR, Hummadi YMKAM, Al-Ezzi MI: Pentoxifylline ameliorates carbamazepine-induced hepatotoxicity via down expression of CYP3A4 and NF-kB gene expression in the rat: in vivo study. Pharmacia. 2024 Dec 3; 71 : 1–11. Publisher Full Text 16. Antkiewicz-Michaluk L, Wąsik A, Możdżeń E, et al. : Antidepressant-like Effect of Tetrahydroisoquinoline Amines in the Animal Model of Depressive Disorder Induced by Repeated Administration of a Low Dose of Reserpine: Behavioral and Neurochemical Studies in the Rat. Neurotox. Res. 2014; 26 (1): 85–98. PubMed Abstract | Publisher Full Text | Free Full Text 17. Reserpine|Autophagy Inhibitor|MedChemExpress.[cited 2025 July 30]. Reference Source 18. Pu S, Liu Q, Li Y, et al. : Montelukast Prevents Mice Against Acetaminophen-Induced Liver Injury. Front. Pharmacol. 2019 Sept 18; 10 : 1070. PubMed Abstract | Publisher Full Text | Free Full Text 19. Ahmed SM, Hummadi YMKAM, Waheed HJ: A seed extract of Mucuna pruriens reduced male reproductive endocrine disruptions in rats induced by chlorpromazine. Pharmacia. 2024 Aug 23; 71 : 1–10. Publisher Full Text 20. TransStart ® Green qPCR SuperMix UDG - TransGen Biotech Co., LTD.[cited 2025 July 30]. Reference Source 21. Real-Time PCR - Fraga - 2014 - Current Protocols Essential Laboratory Techniques - Wiley Online Library. [cited 2025 July 30]. Publisher Full Text 22. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San Diego Calif. 2001 Dec; 25 (4): 402–408. Publisher Full Text 23. Walf AA, Frye CA: The use of the elevated plus maze as an assay of anxiety-related behavior in rodents. Nat. Protoc. 2007; 2 (2): 322–328. PubMed Abstract | Publisher Full Text | Free Full Text 24. Slattery DA, Cryan JF: Using the rat forced swim test to assess antidepressant-like activity in rodents. Nat. Protoc. 2012 June; 7 (6): 1009–1014. Publisher Full Text 25. The Top 300 of 2022: [cited 2025 July 19]. Reference Source 26. Montelukast Monograph for Professionals - Drugs.com.[cited 2025 July 19]. Reference Source 27. Kraeuter AK, Guest PC, Sarnyai Z: The Forced Swim Test for Depression-Like Behavior in Rodents.Guest PC, editor. Pre-Clinical Models: Techniques and Protocols. New York, NY: Springer; 2019 [cited 2025 July 25]; pp. 75–80. Publisher Full Text 28. Ślifirski G, Król M, Turło J: 5-HT Receptors and the Development of New Antidepressants. Int. J. Mol. Sci. 2021 Aug 20; 22 (16): 9015. PubMed Abstract | Publisher Full Text | Free Full Text 29. Haarman MG, van Hunsel F , de Vries TW : Adverse drug reactions of montelukast in children and adults. Pharmacol. Res. Perspect. 2017 Oct; 5 (5): e00341. PubMed Abstract | Publisher Full Text | Free Full Text 30. Research C for DE and: FDA requires Boxed Warning about serious mental health side effects for asthma and allergy drug montelukast (Singulair); advises restricting use for allergic rhinitis. FDA; 2025 Feb 20 [cited 2025 July 30]. Reference Source 31. Xu ZQ, Zhang WJ, Su DF, et al. : Cellular responses and functions of α7 nicotinic acetylcholine receptor activation in the brain: a narrative review. Ann. Transl. Med. 2021 Mar; 9 (6): 509–509. PubMed Abstract | Publisher Full Text | Free Full Text 32. Haider KHAR: Montelukast altered BDNF and CHRNA7 gene expression were associated with behavioral changes in rats. [Data set]. Zenodo. 2025. Publisher Full Text 33. Haider K: The ARRIVE Essential 10: author checklist – Montelukast altered BDNF and CHRNA7 gene expression were associated with behavioral changes in rats. Zenodo. 2025. Publisher Full Text Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 22 Sep 2025 ADD YOUR COMMENT Comment Author details Author details 1 Pharmacology & toxicology, Mustansiriyah University College of Pharmacy, Baghdad, Baghdad Governorate, Iraq 2 clinical chemistry, Ibn Sina Medical College, Baghdad, Baghdad, Iraq Karar Haider Roles: Conceptualization, Data Curation, Funding Acquisition, Investigation, Methodology, Resources, Software, Writing – Original Draft Preparation Yassir Mustafa Kamal Al Mulla Hummadi Roles: Conceptualization, Supervision, Validation, Visualization, Writing – Review & Editing Rihab Muhamad Guaim Roles: Writing – Review & Editing Mutaz Ahmeid Roles: Supervision, Visualization, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information The author(s) declared that no grants were involved in supporting this work. Article Versions (1) version 1 Published: 22 Sep 2025, 14:963 https://doi.org/10.12688/f1000research.169688.1 Copyright © 2025 Haider K et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Haider K, Al Mulla Hummadi YMK, Muhamad Guaim R and Ahmeid M. Montelukast altered BDNF and CHRNA7 gene expression were associated with behavioral changes in rats. [version 1; peer review: awaiting peer review] . F1000Research 2025, 14 :963 ( https://doi.org/10.12688/f1000research.169688.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: AWAITING PEER REVIEW AWAITING PEER REVIEW ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 22 Sep 2025 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status AWAITING PEER REVIEW Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Montelukast altered BDNF and CHRNA7 gene...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/14-963/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/14-963/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/14-963/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Haider K et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/14-963/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/14-963", templates : { twitter : "Montelukast altered BDNF and CHRNA7 gene expression were associated.... Haider K et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/14-963/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/169688/187046") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "187046"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "423710": 0, "423711": 0, "423708": 0, "423709": 0, "423716": 0, "423717": 0, "423714": 0, "423715": 0, "423712": 0, "423713": 0, "432070": 0, "420422": 0, "432071": 0, "420423": 0, "432068": 0, "432069": 0, "432066": 0, "432067": 0, "432065": 0, "420430": 0, "420431": 0, "420428": 0, "420429": 0, "432074": 0, "420426": 0, "420427": 0, "432072": 0, "420424": 0, "432073": 0, "420425": 0, "426350": 0, "426351": 0, "426349": 0, "417398": 0, "426358": 0, "417399": 0, "417396": 0, "426356": 0, "417397": 0, "426357": 0, "417394": 0, "426354": 0, "417395": 0, "426355": 0, "426352": 0, "417393": 0, "426353": 0, "417402": 0, "417400": 0, "417401": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "163abfb0-4c76-4305-81f1-64143375e081"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "
[email protected]", infoEmail: "
[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.