Interactions between Helcococcus kunzii and Staphylococcus aureus: How a commensal bacterium modulates the virulence and metabolism of a pathogen in a chronic wound in vitro model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Interactions between Helcococcus kunzii and Staphylococcus aureus: How a commensal bacterium modulates the virulence and metabolism of a pathogen in a chronic wound in vitro model Benjamin A.R.N Durand, Lucia Grenga, Madjid Morsli, Jean Armengaud, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4435685/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Oct, 2024 Read the published version in BMC Microbiology → Version 1 posted 10 You are reading this latest preprint version Abstract Background Staphylococcus aureus is the predominant pathogen isolated in diabetic foot infections. Recently, the skin commensal bacterium Helcococcus kunzii was found to modulate the virulence of this pathogen in an in vivo model. This study aims to elucidate the molecular mechanisms underlying the interaction between these two bacterial species using a proteomic approach. Results Our results demonstrate that H. kunzii can coexist and grow with S. aureus in a Chronic Wound Media (CWM), mimicking an in vitro chronic wound environment. We observed that the secreted proteome of H. kunzii induced a transcriptional effect on S. aureus virulence, leading to a decrease in the expression level of agrA , a gene involved in quorum sensing. The observed effect may be attributed to specific proteins secreted by H. kunzii including polysaccharide deacetylase, peptidoglycan DD-metalloendopeptidase, glyceraldehyde-3-phosphate dehydrogenase, trypsin-like peptidase and an extracellular solute-binding protein. These proteins potentially interact with the Agr system, affecting S. aureus virulence. Additionally, the virulence of S. aureus was notably impacted by alterations in iron-related pathways and components of cell wall architecture in the presence of H. kunzii . Furthermore, the overall metabolism of S. aureus was reduced when cocultured with H. kunzii . Conclusion Future investigations will focus on elucidating the role of these excreted factors in modulating virulence. bacterial interactions chronic wound Helcococcus kunzii Staphylococcus aureus in vitro model proteomic analysis (Min.5-Max. 8) Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Chronic wounds pose a significant public health challenge, characterized by prolonged and challenging management, with a high risk of recurrence and associated cost. The complications linked to chronic wounds increase the economic burden and diminish patients’ quality of life [ 1 ]. Among these complications, bacterial infections are a frequent cause of delayed healing. Managing these infections remains problematic due to the difficulties in distinguishing between bacterial colonization and wound infections. Chronic wounds exhibit characteristics of a polymicrobial environment [ 2 ], where pathogenic and commensal bacteria organize into biofilm structures [ 3 ]. This biofilm formation contributes to the delay in wound healing [ 4 ]. Interactions between microorganisms play a crucial role in modulating pathogen virulence, aiming to evade the host’s immune defenses. This organization fosters bacterial persistence and contributes to the chronicity of the wound. The microbial community composition in chronic wounds exhibits considerable interpersonal variability [ 5 ], with no distinct pathogens but rather a combination of associated species that either worsen or improve the wound condition [ 6 , 7 ]. The intricate network of interactions among species in close contact elicits cooperative or antagonist effects [ 4 ]. Understanding this network of microbial crosstalk and cooperation between commensal and pathogenic bacteria is a priority to enhance the management of these challenging wounds. S. aureus is the main pathogenic bacteria found in chronic wounds [ 8 ]. A study observed a coaggregation of S. aureus and a commensal Gram-positive cocci isolated from cutaneous microbiota, Helcococcus kunzii [ 9 ]. We previously studied the virulence phenotypes of these species, both individually and in association, using a Caenorhabditis elegans model. While H. kunzii strains did not reduce worm survival, confirming their commensalism, their association with S. aureus could modulate the virulence potential of the pathogen [ 10 ]. This attenuation was linked to the ability of certain strains of H. kunzii to downregulate the key virulence regulator of S. aureus , the Agr system [ 10 ]. The Agr system is induced during the transition from late exponential growth to the stationary phase, and sustained throughout the stationary phase, enabling the production of several virulence factors [ 11 ]. We recently performed a genomic comparison study to elucidate potential interaction mechanisms. Two main hypothesis were explored: (i) H. kunzii proteins secretion with a direct effect on the Agr system through ligand antagonistic competition for AgrC and (ii) modulation of bacterial metabolism, specifically targeting iron-related metabolism [ 12 ]. Of the five potential candidates identified, three were produced by the H. kunzii strain with the in silico capacity to attenuate S. aureus virulence [ 13 ]. The objective of this study was to identify potential proteins (from intracellular or secreted fractions) produced by H. kunzii involved in decreasing S. aureus virulence, and to describe the impact of H. kunzii on the S. aureus virulence regulatory network and global metabolism. Materials and methods Strains and media Strains used were isolated from Grade 3 infected foot ulcers from people with diabetes. The NSA739 strain is a S. aureus strain belonging to ST8 [ 14 ]. H13 is an H. kunzii strain with potent activity against S. aureus virulence [ 9 , 10 ]. All strains belonged to the collection of the Department of Microbiology at Nîmes University Hospital (France). This study was submitted to the Institutional Review Board of University Hospital, Nımes, France which was deemed unnecessary to obtain a consent to participate for patients according to national regulation. In fact, the analysis of biological samples was obtained in the context of medical care and was considered as non-interventional research. In addition, in this study, we use only bacterial strains and not human specimens and no clinical data was explored. IRB judged, in this context, that only the non-opposition of the patient during sampling has required according to articles L1221-1.1, L1211-2, and N°DC-2020-4155 of the French Public Health Code. The consent to participate was waived by IRB of University Hospital, Nımes. Cultures of the strains were obtained using Luria Bertani broth Agar (LBA) for isolating S. aureus and Trypticase Soy supplemented with 5% sheep blood (TSS, Biomerieux, Marcy l’Etoile, France) agar media for isolating both S. aureus and H. kunzii . Additionally, we used the in vitro modified Chronic Wound Medium (CWM) [ 15 ] that mimics conditions encountered in wounds. This medium contained 20% serum, 0.5% blood, and 79.5% Bolton broth and was here adapted with 5% serum, 0,125% blood 0.125% and 94.87% Bolton broth to reduce contamination from human-origin proteins for the proteomic analysis. Mono- and Coculture assays Coculture experiments and their corresponding monocultures were conducted using the modified CWM. 40 mL of NSA739 and H13 precultures were grown for 24h at 37°C with shaking at 250 rpm under aerobic or anaerobic conditions, respectively. The cultures were then centrifuged at 4000 rpm for 150 s. Bacterial interactions were monitored during exponential and stationary phases. Cell pellets were resuspended in 6 mL of Bolton base broth (Sigma-Aldrich, Saint-Quentin-Fallavier, France), and the optical density (OD 600nm ) was adjusted to 0.1 (± 0.02) (to evaluate the exponential and early stationary phase, in a 1 to 3 ratio in favor of H. kunzii ), and 1 (± 0.3) (to evaluate the stationary phase). The resulting bacterial suspensions were added on top of a 6 mL layer of solid CWM in 25 cm 3 flasks. Cultures were anaerobically incubated for 24h at 37°C under constant agitation at 50 rpm. In parallel, to assess the number of viable bacteria after H. kunzii and S. aureus cocultures, CFU counts were performed at 0, 6, 16 and 24h on LBA and TSS agar media. After 24h, bacterial suspensions were collected in 15 mL tubes and centrifuged for 10 min at 4,000 rpm at + 4°C. The bacterial pellets were washed with 1 mL of PBS 1X (Sigma-Aldrich), centrifuged at 10,000 rpm for 180 s, and then resuspended in 60 µL of LDS 1X (Lithium duodecylsulfate; NuPAGE, ThermoFisher, Waltham, MA, USA) supplemented with 5% β-mercaptoethanol (Sigma-Aldrich) before being stored at -20°C. To obtain the exoproteome, the culture supernatants were filtered through a 0.22 µm membrane (syringe filter; VWR, Rosny sous Bois, France). Aliquots of 200 µL were then transferred into 2 mL tubes (Sarstedt, Marnay, France). Proteins were precipitated by chloroform-methanol extraction, as previously described [ 16 ]. The resulting protein pellet was air-dried before being resuspended in 30 µL of LDS 1X supplemented with 5% β-mercaptoethanol and stored at -20°C. Medium enriched with H. kunzii exoproteome (MEHkE) preparation and agrB transcriptomic study To study the role of H. kunzii secreted proteome on the agrA gene at the transcriptomic level, S. aureus was growth in a medium containing this secreted proteome, adapted from [ 17 ]. Briefly, a preculture of H. kunzii H13, described above, was centrifugated. The supernatant was precipitated in chloroform-methanol and resuspended in LDS 1X (2.2 mL supernatant in 500 µL LDS 1X) to concentrate secreted proteins. This MEHkE solution was stored at -20°C. Then, 5 mL of modified CWM was inoculated with NSA739 at the OD adjusted to 0.1 or 1 and supplemented with 0.1 mL LDS 1X MEHkE solution. A negative control with LDS 1X alone was performed. Cultures were incubated for 24h at 37°C under 250 rpm. After centrifugation (10 min at 4,000rpm and 4°C), S. aureus pellets were stored at -80°C before RNA extraction. Cell pellets from MEHkE exposed S. aureus culture and coculture were treated in the same way, following an adapted protocol from [ 18 ]. The bacterial fraction was washed once with 1 mL Tris Triton EDTA (TTE) 1X and then extracted according to the RNAeasy Plus kit (Qiagen, Courtaboeuf, France), following the manufacturer’s recommendations with two extra-steps. Culture samples were resuspended in 200 µL TTE1X added to 10 µL of a solution of lysozyme (10µg/mL), lysostaphin (1mg/mL), and mutanolysin (62.5 µg/mL) (Sigma-Aldrich) and were further incubated for 30 min at 37°C. After the first column wash, a DNAse treatment was performed using 10µL of DNAse (Qiagen) and 70µL of DNAse Buffer (Qiagen). Extracted RNAs were quantified using an ELISA plate reader (ThermoFisher) and further normalized at 50 ng/µL. Reverse transcription was performed using iScript™ Reverse Transcription Supermix for RT-qPCR (BioRad, Marne La Coquette, France). Reverse transcription products were quantified and normalized to 50 ng/µL. Quantitative PCR assay was performed using 2 µL of normalized cDNA (50ng/µL), 1.2 µL of each target primers (10 mM), 2.4 µL LightCycler® RNA Master SYBR Green I kit (Roche Applied Science, Meylan, France) for a total of 10 µL per well in a LightCycler®480 device (Roche Diagnostics, Meylan, France). Primers used were agrA - F (5ʹ- CAAAGAGAAAACATGGTTACCATTATTAA‐3’), agrA-R (5ʹ‐ CTCAAGCACCTCATAAGGATTATCAG‐3’) [ 19 ], gyrB-F (5’‐ GGTGGCGACTTTGATCTAGC‐3’) and gyrB-R (5’‐ TTATACAACGGTGGCTGTGC‐3’) [ 20 ]. 35 PCR cycles were programmed with 30s of denaturation, 30s of hybridation at 52°C and 1 min of elongation. Cycle threshold ( Ct ) values of the different target genes were compared with the Ct -values of the house-keeping gene ( gyrB ) [ 21 ]. Amplifications were performed in triplicate from three different RNA preparations. The ΔΔC t were calculated following the equation [ 22 ]: 2 −ΔΔCt (ΔΔCt = (Ct gene − Ct gyrB ) NSA739 exposed to H. kunzii − (Ct gene − Ct gyrB ) NSA739 alone ). Whole genome sequencing. The H. kunzii and S. aureus genomes were sequenced according to the Illumina library preparation protocol using 250 ng of the extracted DNA following the DNA Prep kit library paired-end protocol (Illumina, San Diego, USA) and sequenced in a 39-h run providing 2x250-bp reads on a Miseq sequencer (Illumina), as previously described [ 23 ]. Both genomes were de novo assembled using Spades software (version 3.15.4) and annotated using DDBJ Fast Annotation and Submission Tool online platform ( https://dfast.ddbj.nig.ac.jp/ ) , then compared by Pangenome analysis using Roary tools (Version 3.13.0). Proteomic study during the H. kunzii and S. aureus interaction Tryptic peptides were obtained and identified from the exoproteome and proteome samples as previously described [ 13 ]. Briefly, peptides were identified using an UltiMate 3000 nano-LC system (ThermoFisher Scientific) coupled to a Q Exactive HF mass spectrometer (ThermoFisher Scientific). Peptides were desalted on a reverse-phase PepMap 100 C18 µ-precolumn (5 µm, 100 Å, 300 µm i.d. × 5 mm, ThermoFisher Scientific) before separation on a nanoscale PepMap 100 C18 nano-LC column (3 µm, 100 Å, 75 µm i.d. × 50 cm, ThermoFisher Scientific) using a 90 min gradient (75 min from 4–25% solvent B, and 15 min from 25–40% of solvent B) at a flow rate of 0.2 µL per min. Solvent A was 0.1% formic acid in water, while solvent B was 80% acetonitrile, 0.1% formic acid in water. The mass spectrometer was operated in Top 20 mode, acquiring full MS from 350 to 1500 m/z, and selecting the 20 most abundant precursor ions for fragmentation, with a 10-s dynamic exclusion window. Ions with charge 2 + and 3 + were chosen for MS/MS analysis, and secondary ions were isolated within a 2.0-m/z window. Data were interpreted using the Mascot Daemon software version 2.6.0 (Matrix Sciences, Chicago, IL, USA) by seraching a database comprising 82,248 polypeptide sequences, representing the annotated genomes of H. sapiens , H. kunzii H13 strain (NZ_CP048105.1) and S. aureus Newman strain (AP009351.1) as detailed in [ 13 ]. Newman strain is closely similar to NSA-739 exhibiting > 99% genome coverage and identity. The coding ration are closely similar Pangenome comparison yielded the totality of proteins predicted in NSA739 genome was found in the Newman strain justifying the choose of this strain. Statistical and bioinformatic analysis Comparison of agrA expression in S. aureus with and without the presence of H. kunzii was analyzed using the Student’s t-test with GraphPad Prism (v9.2.0) (San Diego, CA, USA). Regarding the proteomic analysis, normalization of spectral counts, their variation and visualization were carried out using an R script [ 24 – 28 ]. Statistical analysis of proteomic data was performed using Pearseus software (v1.6.5.0) [ 29 ] allowing for permutated FDR correction; this correction accounted for both fold change and p-values through a nonlinear weighting. Results Validation of coculture conditions to proteomic assays The potential ability for H. kunzii and S. aureus to grow together was assessed. Both strains remained fairly stable over the 24h-contact after an inoculation at OD 600 = 1 and were detected in a similar proportion (Fig. 1A). Using an OD 600 = 0.1, increased CFU counts were noted after 24h, compared to the initial inoculum, suggesting that both species had initiated an exponential phase (Fig. 1B). By 24h, both species were in similar proportions. The growth kinetic of the coculture at the initial OD 600 = 0.1 was investigated (Fig. 1C). The exponential phase of S. aureus began immediately and resolved after 5h, reaching the stationary phase. H. kunzii exhibited a different profile with a longer initial lag phase, entering exponential growth after 16h and reaching its stationary state at 21h. Interestingly, the H. kunzii strain in co-culture started to replicate actively when the S. aureus strain was already in its stationary phase. Both strains were found at an equivalent ratio by the end of the experiment (24h). These results demonstrate that, despite the non-concurrent exponential phases of the two species, both underwent a complete exponential phase over the 24h contact time and entered the stationary phase (activation phase of the Agr system and production of virulence factors in S. aureus ). Underexpression of agrA in S. aureus in presence of exoproteome of H. kunzii The next step involved monitoring S. aureus agrB expression in two ways: (i) after coculture and (ii) following exposure to H. kunzii exoproteome (MEHkE). The objective was to confirm the hypothesis of a contact-independent interaction between the two species sufficient to induce the downregulation of the Agr system and the reduction of S. aureus virulence. Under all tested conditions, we observed a consistent decrease in agrA expression (Fig. 2 ). Notably, this reduction was statistically significant (p < 0.05) after exposure to MEHkE when S. aureus was in the stationary phase (OD 600 = 1). This finding supports the idea that H. kunzii H13 may secrete proteins that downregulate agrA in S. aureus . Identification of candidate H. kunzii secreted proteins decreasing S. aureus virulence To identify the proteins secreted by H. kunzii in the absence/presence of S. aureus , a proteomic study was conducted. H. kunzii alone secreted a limited number of proteins at all stages of its growth ( n = 42 at OD 600 = 1 and n = 44 at OD 600 = 0.1). This “poor secretor” profile remained unchanged in the presence of S. aureus ( n = 55 at OD 600 = 1 and n = 18 at OD 600 = 0.1) ( Supplementary Figure S1 ). Given the significant downregulation of the Agr system observed after exposure to MEHkE, we searched for proteins secreted by H. kunzii interacting with S. aureus . Among the initial list of 75 proteins recovered from the H. kunzii exoproteome, 55 belonged to the exoprotein fraction from coculture at OD 600 = 1, representing the most promising candidates to interfere with S. aureus virulence. Of these 55 candidates, 17 were associated with transcriptional activity, including 8 ribosomal subunits. Surprinsignly, RsmB (Ribosomal Subunit B) (GUI37_RS04270), a genomic candidate previously identified [ 12 ], was found only in proteome and not in exoproteome. In addition, 17 of 55 exoproteins found were linked to carbohydrate metabolism, including the type 3 glyceraldehyde-3-phosphate dehydrogenase protein, already described as a “moonlighting” protein (protein with variable independent biological activities) [ 30 ]. At OD 600 = 0.1, 18 proteins candidates were identified. Ultimately, 16 proteins were definitively included because they were present in all conditions (Table 1 ). Interestingly, four of these proteins were associated with a potential to alter cell wall architecture: the polysaccharide deacetylase family protein (WP_212661168.1), peptidoglycan DD-metalloendopeptidase family protein (WP_212661263.1), and the aforementioned type I glyceraldehyde-3-phosphate dehydrogenase (WP_005397984.1 and WP_005398187.1). Two of 16 selected included presented an stronger interest: the trypsin-like peptidase domain-containing protein (WP_212661130.1) with a serine protease domain, previously described for their potential in S. aureus - S. epidermidis interaction [ 31 ] and the extracellular solute-binding protein (WP_212660510.1), which could impact nutritional competition [ 32 ]. Table 1 Exoproteome H. kunzii associated proteins (relative abundance) showing the most potential regarding S. aureus virulence attenuation. Locus_tag Protein_id Protein Coculture OD = 0.1 Monoculture OD = 0.1 Coculture OD = 1 Monoculture OD = 1 GUI37_RS00090 WP_005396836.1 hypothetical protein 0.000606555 0.00256595 0.001437565 0.004309736 GUI37_RS00890 WP_005397107.1 formate C-acetyltransferase 0.001196144 0.003703013 0.005617706 0.004597426 GUI37_RS01090 WP_212661130.1 trypsin-like peptidase domain-containing protein 0.002148342 0.002857483 0.002299551 0.002849986 GUI37_RS01425 WP_212661168.1 polysaccharide deacetylase family protein 0.000952198 0.003290195 0.002687416 0.004150736 GUI37_RS01930 WP_212661252.1 2-dehydropantoate 2-reductase 0.000257553 0.001063231 0.001706237 0.000173433 GUI37_RS02030 WP_212661263.1 peptidoglycan DD-metalloendopeptidase family protein 0.000430375 0.001046678 0.00048113 0.00104926 GUI37_RS02985 WP_005397814.1 HU family DNA-binding protein 0.000515063 0.001344793 0.002180884 0.001585436 GUI37_RS03540 WP_005397984.1 type I glyceraldehyde-3-phosphate dehydrogenase 0.000593077 0.002599056 0.002668364 0.00120393 GUI37_RS03545 WP_212661385.1 phosphoglycerate kinase 0.000599837 0.001321561 0.003500177 0.000770347 GUI37_RS03555 WP_005397990.1 2,3-bisphosphoglycerate-independent phosphoglycerate mutase 0.000257553 0.001945353 0.002918642 0.00129209 GUI37_RS03560 WP_005397992.1 phosphopyruvate hydratase 0.00145374 0.002820892 0.005523651 0.003488873 GUI37_RS04205 WP_005398187.1 type I glyceraldehyde-3-phosphate dehydrogenase 0.003090292 0.007941784 0.009235759 0.006067161 GUI37_RS05200 WP_212660510.1 extracellular solute-binding protein 0.001026853 0.00160322 0.005455659 0.007139515 GUI37_RS06220 WP_212660639.1 flavocytochrome c 0.002246638 0.009022606 0.005361868 0.011533081 GUI37_RS07030 WP_212660710.1 hypothetical protein 0.000260912 0.000979331 0.000581271 0.00114175 GUI37_RS07980 WP_005399120.1 IMP dehydrogenase 0.00016942 0.000264961 0.00038112 0.000263036 Shortlisted candidates are highlighted in gray. Impact of H. kunzii exoproteome on S. aureus virulence under continuous stationary conditions To explore the impact of the H. kunzii exoproteome on S. aureus virulence, we focused on the regulatory gene network governing S. aureus (Fig. 3 ). The RNAIII activating regulator, AgrA (NWMN_1946), exhibited decreased abundance, while the RNAIII activating protein TRAP (NWMN_1726) was significantly ( p = 0.0068) underabundant with a 2-fold change (log 2 FC)[FC] of 0.69 [1.61] and 0.68 [1.60], respectively. Both proteins are associated with RNAIII induction, a stable regulatory RNA with activating effects on hemolysin production [ 33 ]. AgrA production was positively regulated by SarA (NWMN_0588) and by SarV (NWMN_2167) and negatively regulated by SarX (NWMN_0637) and CodY (NWMN_1165) [ 34 – 36 ]. Surprinsingly, CodY was significantly underabundant ( p = 0.0269) in coculture experiments (log 2 FC = 0.91, FC = 1.88) despite the decrease of AgrA, while SarX showed a trend of increased abundance (log 2 FC =-1.59, FC = 0.33). Both positive regulators, SarA and SarV, exhibited trends of underabundance in coculture experiments explaining potentially underabundance of AgrA. In summary, the virulence regulatory network of S. aureus appears to be impaired upon coculture, leading to alpha hemolysin repression (NWMN_1073, p = 0.0079). Additionally, the stress repsonse pathway also showed evidence of an impacted regulatory network. Sigma B (NWMN_1970) and both its repressor (anti-sigmaB, RsbW, NWMN_1971) and activator (anti-sigma B factor antagonist, RsbV, NWMN_1972), were underrepresented in coculture (log 2 FC = 0.53[FC = 1.45], p = 0.1430; 0.32[1.25] p = 0.0869; and 1.56 [2.96], p. =0.0044, respectively) (Fig. 3 ). As virulence factors with cytolytic activity need to be secreted, particularly in the stationary phase, the exoproteome fraction of S. aureus in the stationary phase was also investigated. Only two proteins were statistically underabundant in coculture: a threonyl-tRNA synthetase (NWMN_1576, p = 0.0048) and an ATP-binding subunit ClpC (NWMN_2448, p = 0.0020), reduced by 1.92 [3.79] and 2.69 [6.44] fold, respectively. Moreover, some virulence effectors were impacted by the presence of the H. kunzii exoproteome. The gamma hemolysin component ABC, leukocidin/hemolysin toxin family F and S subunits, as well as the alpha hemolysin precursor, showed a trend of decreased abundance in the exoproteome fraction of the coculture. To explore if this decrease in virulence factors from the exoproteome was associated with a defect in their production or export, the proteomic fraction was analyzed. The alpha hemolysin precursor (NWMN_1073, p = 0.0079) was significantly reduced, suggesting that its production was repressed. However, leukocidin/hemolysin toxin family F and S subunits and gamma hemolysin component B were overabundant in the intracellular proteome, suggesting that they are retained intracellularly or that they are less stable once excreted. S. aureus virulence is modified by H. kunzii exoproteome independently of the Agr system. Bacteria acquire iron through ABC transport, transferrin binding, or siderophore production to sustain their metabolism [ 37 ]. In our study, one S. aureus siderophore biosynthetic pathway ( Figure S2 ) was hindered by two proteins involved in the conversion of D-ornithine to Staphyloferrin A [ 38 ]. These proteins were exclusively detected in monoculture samples. Additionally, a Staphyloferrin precursor, 2-oxaloglutarate, produced by the citrate cycle through acetate oxidation (TCA) [ 39 , 40 ], was also primarily affected in coculture samples as the entire TCA pathway showed either a decrease or absence in coculture. We also observed that six proteins involved in iron metabolism were significantly differentially abundant. Ferrochelatase (NWMN_1724, p = 0.030) was overexpressed (-0.77 [0.58 FC]), while the other five were underrepresented: the iron compound ABC transporter, the iron compound-binding protein (NWMN_2185, p = 0.0045, and NWMN_0581, p = 0.0007), the siderophore compound ABC transporter binding protein (NWMN_0059, p = 0.0006), and two ferrichrome ABC transporter lipoprotein (NWMN_2078 p = 0.0003, NWMN_0705, p = 0.0002). The latter exhibited the most significant decrease in abundance (5.23 [37.60 FC]). Finally, proteins involved in cell wall formation and virulence effectors of S. aureus were directly inhibited ( Figure S3 ). The cell wall formation was affected at the level of wall teichoic and lipoteichoic acids. Moreover, staphyloxanthin production, a protein protecting S. aureus from neutrophils clearance [ 41 , 42 ], was impaired by the absence of CrtM and CrtP in coculture samples. Impact of H. kunzii exoproteome on S. aureus metabolism The ability of S. aureus to produce proteins was reduced upon exposure to H. kunzii exoproteome, as the absolute diversity of proteins recovered from monoculture samples was higher than that from coculture. Additionally, coculture in the stationary phase showed the lowest diversity of S. aureus proteins (Fig. 4 ). Out of the 775 proteins found during the stationary phase, constituting the S. aureus proteome under coculture conditions, 315 (40.6%) were significantly differentially abundant (ranging from p = 0.00023 to 0.2651, with the latter becoming significant through Perseus statistical treatment). Among them, only 10 (1.3%) were overabundant, highlighting the metabolic repression potential of H. kunzii presence. Discussion These results from clinical and microbiological observations confirm the in vivo results obtained previously and suggest a potential interaction between S. aureus and H. kunzii in chronic wounds, particularly in foot ulcers in patients with diabetes. The frequent co-isolation of these two species indicates their proximity in the wound bed [ 9 ]. Furthermore, our previous study demonstrated phenotypic variation in S. aureus in the presence of H. kunzii [ 10 ]. This commensal bacteria had the ability to reduce S. aureus virulence in an in vivo C. elegans model [ 10 ] by acting on the Agr system, a key virulence regulator. Building upon these findings, this study aimed to replicate, in an in vitro model, the environmental conditions leading to a decrease in S. aureus virulence in the presence of H. kunzii and to elucidate the proteins involved in this molecular interaction. To explore in vitro molecular interactions between S. aureus and H. kunzii , we utilized the CWM [ 15 ]. In conventional in vitro experiments, bacteria are typically grown in artificial culture medium, which differs considerably from the environment encountered in clinical situations. This condition can influence bacterial virulence, but its clinical relevance is often limited. The use of CWM, designed to mimic the environmental conditions of a chronic wound (containing blood and serum), was crucial in enabling the growth of H. kunzii in liquid medium. This growth was unattainable in traditional culture media like LB media. Our results confirm that S. aureus and H. kunzii can coexist and grow together in this environment, overcoming challenges observed in other studies focusing on bacterial interactions. Notably, studies investigating interactions between S. aureus and Pseudomonas aeruginosa have encountered difficulties in cultivating them together in vitro , thereby impeding a comprehensive understanding of their interplay. Traditional culture media were shown to hinder the growth of P. aeruginosa and S. aureus simultaneously [ 43 ]. In such artificial environment, bacteria primarily compete for nutrients like iron, leading to one species outcompeting the other. We have previously demonstrated that CWM enables the concurrent growth of P. aeruginosa and S. aureus without dominance by either species [ 15 ]. Our study affirms the feasibility of coculturing H. kunzii and S. aureus in this medium. Additionally, growth curves revealed that, even though H. kunzii exhibited a delayed exponential phase, both S. aureus and H. kunzii reached the stationary phase in similar proportions after 24h. The growth curves indicated that H. kunzii enters its exponential phase only once S. aureus is in stationary phase. H. kunzii could use resources (nutrients..) and space once S. aureus is no longer multiplying [ 44 , 45 ]. Furthermore, we demonstrated that exposure to the secreted proteome of H. kunzii significantly downregulated the Agr system in vitro , similar to our previous in vivo findings and when S. aureus was in stationary phase. As the Agr system is activated during the late exponential phase and sustains a lower level during stationary phase (first 6-7h) [ 11 ], this interaction likely affects the maintenance of the Agr loop rather than its initial activation [ 11 ]. This effect on the Agr system is more pronounced after MEHkE exposure than in coculture, as previously demonstrated by Ramsey et al . These authors highlighted that exposure to Corynebacterium striatum culture supernatant was sufficient to alter S. aureus Agr-dependent gene expression during stationary phase [ 17 ]. The potential molecular interactions between H. kunzii and S. aureus were further investigated through transcriptomic analysis of the secreted proteome. Several candidate proteins to explain the interaction were identified (Table 1 ). For instance, GPAH (glyceraldehyde-3-phosphate dehydrogenase), previously described in Lactobacillus to cause cell wall damage [ 46 , 47 ] and to play a role in iron uptake, may contribute also to the H. kunzii and S. aureus interaction [ 48 ]. Additionally, proteins such as the peptidoglycan DD-metalloendopeptidase family protein and polysaccharide deacetylase family protein possess the potential to damage membranes, suggesting a redundant activity. The combined catalytic activities of these proteins could impair membrane function, potentially inducing a stress response that contributes to the alteration of virulence factors regulation. The remaining potential targets, a trypsin-like peptidase domain-containing protein and an extracellular solute-binding protein, may also adversely affect cell wall function and compete for resources. As mentioned in previous publications, extracellular serine proteases have already been described as being involved in S. aureus - S. epidermidis interaction, with negative impact on biofilm degradation [ 31 ] and cell wall-associated proteins [ 49 ], potentially adding another layer to cell wall disruption. The extracellular solute-binding protein is also an interesting candidate, as solute binding proteins are involved in nutrient acquisition, with the potential to compete and alter S. aureus feeding behaviour [ 32 ], and also in sensing environmental cues [ 50 ]. Focusing on the regulatory network of S. aureus virulence (Fig. 3 ), RNA III (pleiotropic regulator of virulence factors) activators were significantly underrepresented, resulting in a decreased production of alpha hemolysin. However, the regulatory network governing alpha hemolysin production showed some inconsistencies. For instance, CodY, expected to negatively impact virulence factor production, was found at lower abundance in coculture, but its involvement seems most relevant during exponential growth [ 35 ]. The stress response SigmaB regulon also appeared to be altered, with SigmaB and its regulators being underrepresented. SigmaB, with its pleiotropic role, plays a central role in adaptation [ 51 ], impacting virulence factor production by activating SarA, which itself activates AgrA, and inhibiting the Agr system [ 52 ]. Sigma B transcriptional activity relies on the phosphorylation status of RsbV; only the unphosphorylated RsbV can free Sigma B from RsbW [ 53 ]. Sigma B is associated with osmotic stress [ 54 ] and cell wall alteration, as a result of the WTA (Wall Teichoic Acid) synthesis pathway inhibition, has been linked to osmotic stress [ 55 – 57 ]. The overall result is a disrupted regulation factor coordinating virulence factor production. Several S. aureus metabolic pathways were impacted by S. aureus/ H. kunzii interaction, particularly in stationary phase. For example, staphyloxantin and staphyloferrin productions were repressed. These proteins are involved in staphylococcal virulence [ 58 ], either directly through escaping the immune system response (ROS (Reduction of Oxydatif Stress) or facilitating iron uptake [ 58 , 59 ]. Nutrient uptake, especially co-factors like iron, is a limiting factor in bacterial virulence [ 59 ], particularly in S. aureus through fur regulation [ 60 ]. Cell wall components of S aureus were also affected, including wall teichoic and lipoteichoic acids. These alterations can affect both virulence [ 61 , 62 ] and surface colonization (D-alanin incorporation) [ 63 ]. The results collectively suggest a metabolically repressed state of S. aureus when associated with H. kunzii . The profound remodeling of S. aureus proteome, with a decrease in diversity during coculture indicates an adaptation to the presence of H. kunzii . A total of 279 proteins were no longer produced at OD = 1 in coculture with H. kunzii compared to S. aureus monoculture, with 212 associated with the proteomic fraction and 67 with the exoproteome (Fig. 4 ). Additionally, the exoproteome of S. aureus has been extensively studied under various conditions [ 65 , 66 ], revealing a range of proteins identified from 186 to 1404. These proteins are predominantly associated with virulence, metabolism, and carbohydrate functions [ 63 ]. Aligning the reconstructed pathways revealed that those affected at OD = 0.1 were even more impacted at OD = 1 suggesting that the fine-tuning of S. aureus metabolism is more affected after reaching the stationary state. This could be attributed to impaired nutrient and cofactor uptake, highlighting the tight connection between metabolic capacities and virulence [ 32 ]. Conclusion In summary, this study provides insights into the in vitro molecular interactions between S. aureus and H. kunzii , elucidating the mechanism behind the reduction in S. aureus virulence in the presence of H. kunzii . The findings shed light on the potential proteins involved in this interaction at a molecular level, unraveling a complex interplay that impacts the regulatory network and global metabolism of S. aureus . The decrease in S. aureus virulence is not linked to cell-cell contact but is mainly dependent on H. kunzii secreted proteins. The proteomic approach indicates that these secreted proteins may be involved in virulence attenuation, and this attenuated virulence phenotype is associated with a substantial metabolic remodeling, altering the S. aureus virulence regulatory network. Finally, a shortlist of six proteins produced by H. kunzii with high potential for anti-virulence therapy was identified. Subsequent investigations will explore the phenotypic impact of the excreted factors potentially involved in this virulence modulation. This work contributes to a better understanding of the dynamics between bacterial species in chronic wound environments, laying the foundation for further research into therapeutic interventions and strategies for managing diabetic foot infections. Abbreviations CFU Colony Forming Unit CWM Chronic Wound Medium FC Fold Change GPAH Glyceraldehyde-3-phosphate dehydrogenase LDS Lithium duodecylsulfate LBA Luria Bertani broth Agar MEHkE Medium enriched with H. kunzii exoproteome NSA Nîmes Staphylococcus aureus OD optical density ROS Reduction of Oxydatif Stress RsmB Ribosomal Subunit B RT-qPCR: Retrotranscription quantitative PCR ST Sequence type TCA through acetate oxidation TRAP translocon-associated protein TTE Tris Triton EDTA TSS Trypticase Soy supplemented with 5% sheep blood WTA Wall Teichoic Acid Declarations Avaibilty of data and materials: The genomic data are disponible on NCBI GenBank database under the BioProject number: PRJNA107820. Proteomic data are accessible online using the following details ( [email protected] as username, and 0qZ91Ona as password]. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD049416 and 10.6019/PXD049416. [This dataset is accessible for the reviewers with [email protected] as username and 0qZ91Ona as password]. [67]. Ethics approval and consent All strains belonged to the collection of the Department of Microbiology at Nîmes University Hospital (France). This study was submitted to the Institutional Review Board of University Hospital, Nımes, France which was deemed unnecessary to obtain a consent to participate for patients according to national regulation. In fact, the analysis of biological samples was obtained in the context of medical care and was considered as non-interventional research. In addition, in this study, we use only bacterial strains and not human specimens and no clinical data was explored. IRB judged, in this context, that only the non-opposition of the patient during sampling has required according to articles L1221-1.1, L1211-2, and N°DC-2020-4155 of the French Public Health Code. The consent to participate was waived by IRB of University Hospital, Nımes. Consent for publication Not applicable Competing interests The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Funding This research was funded by CHU Nîmes, grant number: Thematique Phare 1. The funder had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript. Authors’ Contributions BARND conducted all experiments and wrote the manuscript. BARND and LG conducted the proteomic experiments. MM conducted genomic analysis. JA, JPL and CDR conceived and designed the experiments. All authors have read the article and approved the submitted version. Acknowledgments We thank the Nîmes University hospital for its structural, human and financial support through the award obtained by our team during the internal call for tenders « Thématiques phares ». We thank Sarah Kabani for her editing assistance. References Järbrink K, Ni G, Sönnergren H, Schmidtchen A, Pang C, Bajpai R, et al. The humanistic and economic burden of chronic wounds: a protocol for a systematic review. Syst Rev. 2017. 10.1186/s13643-016-0400-8 . Dowd SE, Wolcott RD, Sun Y, McKeehan T, Smith E, Rhoads D. Polymicrobial Nature of Chronic Diabetic Foot Ulcer Biofilm Infections Determined Using Bacterial Tag Encoded FLX Amplicon Pyrosequencing (bTEFAP). PLoS ONE. 2008. 10.1371/journal.pone.0003326 . Johani K, Malone M, Jensen S, Gosbell I, Dickson H, Hu H, et al. Microscopy visualisation confirms multi-species biofilms are ubiquitous in diabetic foot ulcers. Int Wound J. 2017. https://doi.org/10.1111/iwj.12777 . Durand BARN, Pouget C, Magnan C, Molle V, Lavigne J-P, Dunyach-Remy C. Bacterial Interactions in the Context of Chronic Wound Biofilm: A Review. Microorganisms. 2022a. 10.3390/microorganisms10081500 . Wolcott RD, Hanson JD, Rees EJ, Koenig LD, Phillips CD, Wolcott RA, et al. Analysis of the chronic wound microbiota of 2,963 patients by 16S rDNA pyrosequencing. Wound Repair Regen. 2016. 10.1111/wrr.12370 . Wolcott R. Disrupting the biofilm matrix improves wound healing outcomes. J Wound Care. 2015. 10.12968/jowc.2015.24.8.366 . Pouget C, Dunyach-Remy C, Pantel A, Schuldiner S, Sotto A, Lavigne JP. Biofilms in Diabetic Foot Ulcers: Significance and Clinical Relevance. Microorganisms. 2020. 10.3390/microorganisms8101580 . Dunyach-Remy C, Ngba Essebe C, Sotto A, Lavigne JP. Staphylococcus aureus Toxins and Diabetic Foot Ulcers: Role in Pathogenesis and Interest in Diagnosis. Toxins. 2016. 10.3390/toxins8070209 . Vergne A, Guérin F, Lienhard R, Le Coustumier A, Daurel C, Isnard C, et al. In vitro antimicrobial susceptibility of Helcococcus kunzii and molecular analysis of macrolide and tetracycline resistance. Eur J Clin Microbiol Infect Dis. 2015. 10.1007/s10096-015-2451-5 . Ngba Essebe C, Visvikis O, Fines-Guyon M, Vergne A, Cattoir V, Lecoustumier A, et al. Decrease of Staphylococcus aureus Virulence by Helcococcus kun z ii in a Caenorhabditis elegans Model. Front Cell Infect Microbiol. 2017;7. 10.3389/fcimb.2017.00077 . Grundstad ML, Parlet CP, Kwiecinski JM, Kavanaugh JS, Crosby HA, Cho Y-S, et al. Quorum Sensing, Virulence, and Antibiotic Resistance of USA100 Methicillin-Resistant Staphylococcus aureus Isolates. mSphere. 2019. 10.1128/mSphere.00553-19 . Durand BARN, Yahiaoui Martinez A, Baud D, François P, Lavigne J-P, Dunyach-Remy C. Comparative genomics analysis of two Helcococcus kun zii strains co-isolated with Staphylococcus aureus from diabetic foot ulcers. Genomics. 2022b. 10.1016/j.ygeno.2022.110365 . Durand BARN, Dunyach-Remy C, El Kaddouri O, Daher R, Lavigne JP, Armengaud J, Grenga L. Proteomic insights into Helcococcus kunzii in a diabetic foot ulcer-like environment. Proteom Clin Appl 2023. 10.1002/prca.202200069 . Sotto A, Lina G, Richard JL, Combescure C, Bourg G, Vidal L, et al. Virulence Potential of Staphylococcus aureus Strains Isolated From Diabetic Foot Ulcers: A new paradigm. Diabetes Care. 2008. 10.2337/dc08-1010 . Pouget C, Dunyach-Remy C, Bernardi T, Provot C, Tasse J, Sotto A, et al. A Relevant Wound-Like in vitro Media to Study Bacterial Cooperation and Biofilm in Chronic Wounds. Front Microbiol. 2022. 10.3389/fmicb.2022.705479 . Wessel D, Flügge UI. A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal Biochem. 1984. 10.1016/0003-2697(84)90782-6 . Ramsey MM, Freire MO, Gabrilska RA, Rumbaugh KP, Lemon KP. Staphylococcus aureus Shifts toward Commensalism in Response to Corynebacterium Species. Front. Microbiol. 2016. 10.3389/fmicb.2016.01230 . Pouget C, Gustave CA, Ngba-Essebe C, Laurent F, Lemichez E, Tristan A, et al. Adaptation of Staphylococcus aureus in a Medium Mimicking a Diabetic Foot Environment. Toxins. 2021. 10.3390/toxins13030230 . Garzoni C, Francois P, Huyghe A, Couzinet S, Tapparel C, Charbonnier Y, et al. A global view of Staphylococcus aureus whole genome expression upon internalization in human epithelial cells. BMC Genomics. 2007. 10.1186/1471-2164-8-171 . Labandeira-Rey M, Couzon F, Boisset S, Brown EL, Bes M, Benito Y et al. Staphylococcus aureus Panton-Valentine Leukocidin Causes Necrotizing Pneumonia. Science. 2007. 10.1126/science.1137165 . Sihto HM, Tasara T, Stephan R, Johler S. Validation of reference genes for normalization of qPCR mRNA expression levels in Staphylococcus aureus exposed to osmotic and lactic acid stress conditions encountered during food production and preservation. FEMS Microbiol Lett. 2014. 10.1111/1574-6968.12491 . Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 – ∆∆CT Method. Methods. 2001. 10.1006/meth.2001.1262 . Magnan C, Ahmad-Mansour N, Pouget C, Morsli M, Huc-Brandt S, Pantel A, et al. Phenotypic and Genotypic Virulence Characterisation of Staphylococcus pettenkoferi Strains Isolated from Human Bloodstream and Diabetic Foot Infections. Int J Mol Sci. 2022. 10.3390/ijms232415476 . Lê S, Josse J, Husson F, FactoMineR. A Package for Multivariate Analysis. J Stat Softw. 2008. 10.18637/jss.v025.i01 . Weijun L. Pathview: an R/Bioconductor package for pathway-based data integration and visualization. Bioinformatics. 2013. 10.1093/bioinformatics/btt285 . Gu Z, Eils R, Schlesner M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics. 2016. 10.1093/bioinformatics/btw313 . Kassambara A, Mundt F. Factoextra: Extract and Visualize the Results of Multivariate Data Analyses . 2020. https://CRAN.Rproject.org/package=factoextra . Core Team R. R: A Language and Environment for Statistical Computing . Vienna, Austria: R Foundation for Statistical Computing. 2021. https://www.R-project.org/ . Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, et al. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat Methods. 2016. 10.1038/nmeth.3901 . Boradia VM, Raje M, Raje CI. Protein moonlighting in iron metabolism: glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Biochem Soc Trans. 2014. 10.1042/BST20140220 . Iwase T, Uehara Y, Shinji H, Tajima A, Seo H, Takada K, et al. Staphylococcus epidermidis Esp inhibits Staphylococcus aureus biofilm formation and nasal colonization. Nature. 2010. 10.1038/nature09074 . Richardson AR, Virulence. Metabolism Microbiol Spectr. 2019. 10.1128/microbiolspec.GPP3-0011-2018 . Morfeldt E, Taylor D, von Gabain A, Arvidson S. Activation of alpha-toxin translation in Staphylococcus aureus by the trans-encoded antisense RNA, RNAIII. EMBO J. 1995. 10.1002/j.1460-2075.1995.tb00136.x . Manna AC, Cheung AL. Expression of SarX, a Negative Regulator of agr and Exoprotein Synthesis, Is Activated by MgrA in Staphylococcus aureus . J Bacteriol. 2006. 10.1128/JB.00297-06 . Majerczyk CD, Sadykov MR, Luong TT, Lee C, Somerville GA, Sonenshein AL. Staphylococcu s aureus CodY Negatively Regulates Virulence Gene Expression. J Bacteriol. 2008. 10.1128/JB.01545-07 . Reyes D, Andrey DO, Monod A, Kelley WL, Zhang G, Cheung AL. Coordinated Regulation by AgrA, SarA, and SarR To Control agr Expression in Staphylococcus aureus . J Bacteriol. 2011. 10.1128/JB.05436-11 . Brown JS, Holden DW. Iron acquisition by Gram-positive bacterial pathogens. Microbes Infect. 2002. 10.1016/S1286-4579(02)01640-4 . Beasley FC, Marolda CL, Cheung J, Buac S, Heinrichs DE. Staphylococcus aureus Transporters Hts, Sir, and Sst Capture Iron Liberated from Human Transferrin by Staphyloferrin A, Staphyloferrin B, and Catecholamine Stress Hormones, Respectively, and Contribute to Virulence. Infect. Immun. 2011. 10.1128/IAI.00117-11 . Ragsdale SW. (1991). Enzymology of the Acetyl-CoA Pathway of CO2 Fixation. Crit Rev Biochem Mol Biol. 1991. 10.3109/10409239109114070 . Galushko AS, Schink B. Oxidation of acetate through reactions of the citric acid cycle by Geobacter sulfurreducen s in pure culture and in syntrophic coculture. Arch Microbiol. 2000. 10.1007/s002030000208 . Liu GY, Essex A, Buchanan JT, Datta V, Hoffman HM, Bastian JF, et al. Staphylococcus aureus golden pigment impairs neutrophil killing and promotes virulence through its antioxidant activity. J Exp Med. 2005. 10.1084/jem.20050846 . Xue L, Chen YY, Yan, Lu W, Wan D, Zhu H. Staphyloxanthin: a potential target for antivirulence therapy. Infect Drug Resist. 2019;12:2151–60. 10.2147/IDR.S193649 . Filkins LM, Graber JA, Olson DG, Dolben EL, Lynd LR, Bhuju S, et al. Coculture of Staphylococcus aureus with Pseudomonas aeruginosa Drives S. aureus towards Fermentative Metabolism and Reduced Viability in a Cystic Fibrosis Model. J Bacteriol. 2015. 10.1128/JB.00059-15 . López D, Vlamakis H, Kolter R, Biofilms. Cold Spring Harb Perspect Biol. 2010. 10.1101/cshperspect.a000398 . DeLeon S, Clinton A, Fowler H, Everett J, Horswill AR, Rumbaugh KP. Synergistic Interactions of Pseudomonas aeruginosa and Staphylococcus aureus in an In Vitro Wound Model. Infect Immun. 2014. 10.1128/IAI.02198-14 . Ramsey MM, Freire MO, Gabrilska RA, Rumbaugh KP, Lemon KP. Staphylococcus aureus Shifts toward Commensalism in Response to Corynebacterium Species. Front. Microbiol. 2016. 10.3389/fmicb.2016.01230 . Antikainen J, Kupannen V, Lähteenmäki K, Korhone TK. pH-Dependent Association of Enolase and Glyceraldehyde-3-Phosphate Dehydrogenase of Lactobacillus crispatus with the Cell Wall and Lipoteichoic Acids. J Bacteriol. 2007. 10.1128/JB.00378-07 . Ong JS, Taylor TD, Wong CB, Khoo BY, Sasidharan S, Choi SB, et al. Extracellular transglycosylase and glyceraldehyde-3-phosphate dehydrogenase attributed to the anti-staphylococcal activity of Lactobacillus plantarum USM8613. J Biotechnol. 2019. 10.1016/j.jbiotec.2019.05.006 . Sugimoto S, Iwamoto T, Takada K, Okuda K, Tajima A, Iwase T, et al. Staphylococcus epidermidis Esp Degrades Specific Proteins Associated with Staphylococcus aureus Biofilm Formation and Host-Pathogen Interaction. J Bacteriol. 2013. 10.1128/JB.01672-12 . Matilla MA, Ortega Á, Krell T. The role of solute binding proteins in signal transduction. Comput Struct Biotechnol J. 2021. 10.1016/j.csbj.2021.03.029 . Tuchscherr L, Bischoff M, Lattar SM, Llana MN, Pförtner H, Niemann S, et al. Sigma Factor SigB Is Crucial to Mediate Staphylococcus aureus Adaptation during Chronic Infections. PLOS Pathog. 2015. 10.1371/journal.ppat.1004870 . Bischoff M, Dunman P, Kormanec J, Macapagal D, Murphy E, Mounts W, et al. Microarray-Based Analysis of the Staphylococcus aureus σB Regulon. J Bacteriol. 2004. 10.1128/JB.186.13.4085-4099.2004 . Junecko JM, Zielinska AK, Mrak LN, Ryan DC, Graham JW, Smeltzer MS, et al. Transcribing virulence in Staphylococcus aureus . World J Clin Infect Dis. 2012. 10.5495/wjcid.v2.i4.63 . Rachid S, Ohlsen K, Wallner U, Hacker J, Hecker M, Ziebuhr W. Alternative Transcription Factor ςB Is Involved in Regulation of Biofilm Expression in a Staphylococcus aureus Mucosal Isolate. J Bacteriol. 2000. 10.1128/JB.182.23.6824-6826.2000 . Campbell J, Singh AK, Swoboda JG, Gilmore MS, Wilkinson BJ. An Antibiotic That Inhibits a Late Step in Wall Teichoic Acid Biosynthesis Induces the Cell Wall Stress Stimulon in Staphylococcus aureus . Antimicrob Agents Chemother. 2012. 10.1128/AAC.05938-11 . Weidenmaier C, Peschel A. Teichoic acids and related cell-wall glycopolymers in Gram-positive physiology and host interactions. Nat Rev Microbiol. 2008. 10.1038/nrmicro1861 . Xia G, Peschel A. Toward the Pathway of S. aureus WTA Biosynthesis. Chem Biol. 2008. 10.1016/j.chembiol.2008.02.005 . Xue L, Chen YY, Yan Z, Lu W, Wan D, Zhu H. Staphyloxanthin: a potential target for antivirulence therapy. Infect Drug Resist. 2019. 10.2147/IDR.S193649 . Brown JS, Holden DW. Iron acquisition by Gram-positive bacterial pathogens. Microbes Infect. 2002;4:1149–56. 10.1016/S1286-4579(02)01640-4 . Johnson M, Sengupta M, Purves J, Tarrant E, Williams PH, Cockayne A, et al. Fur is required for the activation of virulence gene expression through the induction of the sae regulatory system in Staphylococcus aureus . Int J Med Microbiol. 2011. 10.1016/j.ijmm.2010.05.003 . Litwin CM, Calderwood SB. Role of iron in regulation of virulence genes. Clin Microbiol Rev 1993 10.1128/CMR.6.2.137 . Gross M, Cramton SE, Götz F, Peschel A. Key Role of Teichoic Acid Net Charge in Staphylococcus aureus Colonization of Artificial Surfaces. Infect Immun. 2001;69:3423–6. 10.1128/IAI.69.5.3423-3426.2001 . Ziebandt A-K, Kusch H, Degner M, Jaglitz S, Sibbald MJJB, Arends JP, et al. Proteomics uncovers extreme heterogeneity in the Staphylococcus aureus exoproteome due to genomic plasticity and variant gene regulation. Proteomics. 2010;10:1634–44. 10.1002/pmic.200900313 . Muthukrishnan G, Quinn GA, Lamers RP, Diaz C, Cole AL, Chen S, et al. Exoproteome of Staphylococcus aureus Reveals Putative Determinants of Nasal Carriage. J Proteome Res. 2011;10:2064–78. 10.1021/pr200029r . Lin MH, Li C, Shu JC, Chu HW, Liu CC, Wu CC. Exoproteome Profiling Reveals the Involvement of the Foldase PrsA in the Cell Surface Properties and Pathogenesis of Staphylococcus aureus . Proteomics. 2018. 10.1002/pmic.201700195 . Zhao X, Palma Medina LM, Stobernack T, Glasner C, de Jong A, Utari P et al. (2019). Exoproteome Heterogeneity among Closely Related Staphylococcus aureus t437 Isolates and Possible Implications for Virulence. J Proteome Res. 2019. 10.1021/acs.jproteome.9b00179 . Perez-Riverol Y, Bai J, Bandla C, Hewapathirana S, García-Seisdedos D, Kamatchinathan, et al. The PRIDE database resources in 2022: A Hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 2022. 10.1093/nar/gkab1038 . Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterial.docx Cite Share Download PDF Status: Published Journal Publication published 11 Oct, 2024 Read the published version in BMC Microbiology → Version 1 posted Editorial decision: Revision requested 16 Jul, 2024 Reviews received at journal 11 Jul, 2024 Reviews received at journal 03 Jul, 2024 Reviewers agreed at journal 30 Jun, 2024 Reviewers agreed at journal 19 Jun, 2024 Reviewers invited by journal 19 Jun, 2024 Editor invited by journal 17 Jun, 2024 Editor assigned by journal 14 Jun, 2024 Submission checks completed at journal 14 Jun, 2024 First submitted to journal 17 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4435685","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":321378620,"identity":"a4137f34-53be-4063-a210-23f72f47efff","order_by":0,"name":"Benjamin A.R.N Durand","email":"","orcid":"","institution":"Bacterial Virulence and Chronic Infections, INSERM U1047, Univ Montpellier, CHU Nîmes","correspondingAuthor":false,"prefix":"","firstName":"Benjamin","middleName":"A.R.N","lastName":"Durand","suffix":""},{"id":321378621,"identity":"bc993289-31ee-4ed9-99a4-1fed6b7bcc8d","order_by":1,"name":"Lucia Grenga","email":"","orcid":"","institution":"Université Paris-Saclay, CEA, INRAE","correspondingAuthor":false,"prefix":"","firstName":"Lucia","middleName":"","lastName":"Grenga","suffix":""},{"id":321378622,"identity":"b474c217-8cd2-4c0a-83a5-902c4c016784","order_by":2,"name":"Madjid Morsli","email":"","orcid":"","institution":"Bacterial Virulence and Chronic Infections, INSERM U1047, Univ Montpellier, CHU Nîmes","correspondingAuthor":false,"prefix":"","firstName":"Madjid","middleName":"","lastName":"Morsli","suffix":""},{"id":321378623,"identity":"3b246023-99f2-4620-b7b9-1e502863f560","order_by":3,"name":"Jean Armengaud","email":"","orcid":"","institution":"Université Paris-Saclay, CEA, INRAE","correspondingAuthor":false,"prefix":"","firstName":"Jean","middleName":"","lastName":"Armengaud","suffix":""},{"id":321378624,"identity":"e7ec7d7a-a3ba-4332-a99c-fa9cb920c89a","order_by":4,"name":"Jean-Philippe Lavigne","email":"","orcid":"","institution":"Bacterial Virulence and Chronic Infections, INSERM U1047, Univ Montpellier, CHU Nîmes","correspondingAuthor":false,"prefix":"","firstName":"Jean-Philippe","middleName":"","lastName":"Lavigne","suffix":""},{"id":321378625,"identity":"39ddcccf-2112-48fb-80eb-6da2da09f903","order_by":5,"name":"Catherine Dunyach-Remy","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABGUlEQVRIie3OMUvDQBTA8QsH7xZL1gsZ8hUuFNShtF/ljkCnRAfBUTJdF6FrPkangCB4ENCltGvFJbXQXQRRWtAXtFohqY6C94e74+D9uCPEZvubAS6+uXSIqA5ZbdQ0CPqN9LcIyF3ks+KdkB3EHUyvy4fLwyOXtOb3t3oaHHAJ5Tzu9Ai0yjrCxxELsyU/8VLWbif6LrzIJBMq76sUmKgjgkTg7xmuRgbARyLF7PiJq7yQJNC1HxPuAvw1kisDbJXoCRIJSF7xY1BPOL5CqldwgibabIhx0gbCZ4t97xxJVgD140kUjsZlRSKlG4g7VEv+bM7UcKCdx/i0G4gbCd5L3u25DeQrisvZHvoJfLT+3ZjNZrP9r94AX8NWqFLwLgEAAAAASUVORK5CYII=","orcid":"","institution":"Bacterial Virulence and Chronic Infections, INSERM U1047, Univ Montpellier, CHU Nîmes","correspondingAuthor":true,"prefix":"","firstName":"Catherine","middleName":"","lastName":"Dunyach-Remy","suffix":""}],"badges":[],"createdAt":"2024-05-17 09:28:58","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4435685/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4435685/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12866-024-03520-0","type":"published","date":"2024-10-11T15:57:18+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":59598062,"identity":"433da168-9a94-4f81-9ab2-d2dbf160ff77","added_by":"auto","created_at":"2024-07-03 16:17:18","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":65926,"visible":true,"origin":"","legend":"\u003cp\u003eGrowth kinetics of coculture experiment. Endpoint CFU counts at 0 and 24h for \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eH. kunzii\u003c/em\u003e with the initial OD\u003csub\u003e600\u003c/sub\u003e set at \u003cstrong\u003eA.\u003c/strong\u003e 1 and \u003cstrong\u003eB.\u003c/strong\u003e 0.1. \u003cstrong\u003eC.\u003c/strong\u003e Growth curves in coculture (initial inoculum OD= 0.1) of \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eH. kunzii\u003c/em\u003e over 24h. The initial ratio was 1:3 in favour of \u003cem\u003eH. kunzii\u003c/em\u003e to obtain a same quantity of bacteria at 21h. The curves were smoothed using a linear model. Each point represents CFU counts according to time in hours.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4435685/v1/5fffeb426fab4769fa2196e9.png"},{"id":59598063,"identity":"a72ea52f-1c5c-41b8-a262-69ea55020f3d","added_by":"auto","created_at":"2024-07-03 16:17:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":52978,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eagrA \u003c/em\u003egene expression level in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e after 24h exposure to \u003cem\u003eHelcococcus kunzii\u003c/em\u003e cells (coculture) or MEHkE (protein extract from \u003cem\u003eH. kunzii\u003c/em\u003e culture media supernatant). Initial inoculum of \u003cem\u003eS. aureus\u003c/em\u003ewere OD= 1 (stationary phase), OD= 0.1 (exponential and stationary phase). MEHkE (Medium enriched with \u003cem\u003eH. kunzii\u003c/em\u003e exoproteome).(\u003cem\u003ep\u003c/em\u003e: *\u0026lt;0.05)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4435685/v1/2d67aeb81108166bc3791a92.png"},{"id":59598064,"identity":"cf87e0db-8a0d-4a23-85d2-8aadf1e52b46","added_by":"auto","created_at":"2024-07-03 16:17:18","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":87508,"visible":true,"origin":"","legend":"\u003cp\u003eRegulatory network of \u003cem\u003eS. aureus\u003c/em\u003e virulence within the proteome fraction OD1. Arrows indicate activating (green) or inhibiting (red) activity. Proteins are represented in solid black border (statistically significant) or dashed (trends) boxes. Green indicates overabundance in monoculture, while red indicates the opposite. The associated fold change values are presented above\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4435685/v1/7f4a61bc17206ba050dd03da.png"},{"id":59598066,"identity":"8a962c48-26ff-4926-8c4e-19f087e0fbf1","added_by":"auto","created_at":"2024-07-03 16:17:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":252921,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eStaphylococcus aureus\u003c/em\u003e \u003cstrong\u003eA.\u003c/strong\u003e proteome and \u003cstrong\u003eB.\u003c/strong\u003e exoproteome protein distribution and their associated pathways. Comparison of \u003cem\u003eS. aureus \u003c/em\u003eproteome and exoproteome identified at the exponential (OD=0.1) and stationary (OD=1) phases of growth in mono- (NSA) and coculture (Coculture). Data are visualized using the UpSet matrix layout and plotted horizontally. Each column contains the proteins of the sets represented by the dark circles and illustrates the associated pathways\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4435685/v1/cff4383f390ce447f0ce05e0.png"},{"id":66597334,"identity":"5df87ae1-5567-4989-aec4-012c0081a069","added_by":"auto","created_at":"2024-10-14 16:09:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1162388,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4435685/v1/12473719-fbb6-4bab-b09b-d275ae34031e.pdf"},{"id":59598067,"identity":"4e76109b-e494-4016-871d-050634ab4510","added_by":"auto","created_at":"2024-07-03 16:17:18","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":790083,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-4435685/v1/7bd7f30aa8c0fe413a101847.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Interactions between Helcococcus kunzii and Staphylococcus aureus: How a commensal bacterium modulates the virulence and metabolism of a pathogen in a chronic wound in vitro model","fulltext":[{"header":"Background","content":"\u003cp\u003eChronic wounds pose a significant public health challenge, characterized by prolonged and challenging management, with a high risk of recurrence and associated cost. The complications linked to chronic wounds increase the economic burden and diminish patients\u0026rsquo; quality of life [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Among these complications, bacterial infections are a frequent cause of delayed healing. Managing these infections remains problematic due to the difficulties in distinguishing between bacterial colonization and wound infections.\u003c/p\u003e \u003cp\u003eChronic wounds exhibit characteristics of a polymicrobial environment [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], where pathogenic and commensal bacteria organize into biofilm structures [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. This biofilm formation contributes to the delay in wound healing [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Interactions between microorganisms play a crucial role in modulating pathogen virulence, aiming to evade the host\u0026rsquo;s immune defenses. This organization fosters bacterial persistence and contributes to the chronicity of the wound. The microbial community composition in chronic wounds exhibits considerable interpersonal variability [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], with no distinct pathogens but rather a combination of associated species that either worsen or improve the wound condition [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The intricate network of interactions among species in close contact elicits cooperative or antagonist effects [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Understanding this network of microbial crosstalk and cooperation between commensal and pathogenic bacteria is a priority to enhance the management of these challenging wounds.\u003c/p\u003e \u003cp\u003e \u003cem\u003eS. aureus\u003c/em\u003e is the main pathogenic bacteria found in chronic wounds [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. A study observed a coaggregation of \u003cem\u003eS. aureus\u003c/em\u003e and a commensal Gram-positive cocci isolated from cutaneous microbiota, \u003cem\u003eHelcococcus kunzii\u003c/em\u003e [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. We previously studied the virulence phenotypes of these species, both individually and in association, using a \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e model. While \u003cem\u003eH. kunzii\u003c/em\u003e strains did not reduce worm survival, confirming their commensalism, their association with \u003cem\u003eS. aureus\u003c/em\u003e could modulate the virulence potential of the pathogen [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. This attenuation was linked to the ability of certain strains of \u003cem\u003eH. kunzii\u003c/em\u003e to downregulate the key virulence regulator of \u003cem\u003eS. aureus\u003c/em\u003e, the Agr system [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe Agr system is induced during the transition from late exponential growth to the stationary phase, and sustained throughout the stationary phase, enabling the production of several virulence factors [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. We recently performed a genomic comparison study to elucidate potential interaction mechanisms. Two main hypothesis were explored: (i) \u003cem\u003eH. kunzii\u003c/em\u003e proteins secretion with a direct effect on the Agr system through ligand antagonistic competition for AgrC and (ii) modulation of bacterial metabolism, specifically targeting iron-related metabolism [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Of the five potential candidates identified, three were produced by the \u003cem\u003eH. kunzii\u003c/em\u003e strain with the \u003cem\u003ein silico\u003c/em\u003e capacity to attenuate \u003cem\u003eS. aureus\u003c/em\u003e virulence [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe objective of this study was to identify potential proteins (from intracellular or secreted fractions) produced by \u003cem\u003eH. kunzii\u003c/em\u003e involved in decreasing \u003cem\u003eS. aureus\u003c/em\u003e virulence, and to describe the impact of \u003cem\u003eH. kunzii\u003c/em\u003e on the \u003cem\u003eS. aureus\u003c/em\u003e virulence regulatory network and global metabolism.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eStrains and media\u003c/p\u003e\n\u003cp\u003eStrains used were isolated from Grade 3 infected foot ulcers from people with diabetes. The NSA739 strain is a \u003cem\u003eS. aureus\u003c/em\u003e strain belonging to ST8 [\u003cspan\u003e14\u003c/span\u003e]. H13 is an \u003cem\u003eH. kunzii\u003c/em\u003e strain with potent activity against \u003cem\u003eS. aureus\u003c/em\u003e virulence [\u003cspan\u003e9\u003c/span\u003e, \u003cspan\u003e10\u003c/span\u003e]. All strains belonged to the collection of the Department of Microbiology at N\u0026icirc;mes University Hospital (France). This study was submitted to the Institutional Review Board of University Hospital, Nımes, France which was deemed unnecessary to obtain a consent to participate for patients according to national regulation. In fact, the analysis of biological samples was obtained in the context of medical care and was considered as non-interventional research. In addition, in this study, we use \u003cstrong\u003eonly bacterial strains and not human specimens\u003c/strong\u003e and no clinical data was explored. IRB judged, in this context, that only the non-opposition of the patient during sampling has required according to articles L1221-1.1, L1211-2, and N\u0026deg;DC-2020-4155 of the French Public Health Code. The consent to participate was waived by IRB of University Hospital, Nımes.\u003c/p\u003e\n\u003cp\u003eCultures of the strains were obtained using Luria Bertani broth Agar (LBA) for isolating \u003cem\u003eS. aureus\u003c/em\u003e and Trypticase Soy supplemented with 5% sheep blood (TSS, Biomerieux, Marcy l\u0026rsquo;Etoile, France) agar media for isolating both \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eH. kunzii\u003c/em\u003e. Additionally, we used the \u003cem\u003ein vitro\u003c/em\u003e modified Chronic Wound Medium (CWM) [\u003cspan\u003e15\u003c/span\u003e] that mimics conditions encountered in wounds. This medium contained 20% serum, 0.5% blood, and 79.5% Bolton broth and was here adapted with 5% serum, 0,125% blood 0.125% and 94.87% Bolton broth to reduce contamination from human-origin proteins for the proteomic analysis.\u003c/p\u003e\n\u003cp\u003eMono- and Coculture assays\u003c/p\u003e\n\u003cp\u003eCoculture experiments and their corresponding monocultures were conducted using the modified CWM. 40 mL of NSA739 and H13 precultures were grown for 24h at 37\u0026deg;C with shaking at 250 rpm under aerobic or anaerobic conditions, respectively. The cultures were then centrifuged at 4000 rpm for 150 s. Bacterial interactions were monitored during exponential and stationary phases. Cell pellets were resuspended in 6 mL of Bolton base broth (Sigma-Aldrich, Saint-Quentin-Fallavier, France), and the optical density (OD\u003csub\u003e600nm\u003c/sub\u003e) was adjusted to 0.1 (\u0026plusmn;\u0026thinsp;0.02) (to evaluate the exponential and early stationary phase, in a 1 to 3 ratio in favor of \u003cem\u003eH. kunzii\u003c/em\u003e), and 1 (\u0026plusmn;\u0026thinsp;0.3) (to evaluate the stationary phase). The resulting bacterial suspensions were added on top of a 6 mL layer of solid CWM in 25 cm\u003csup\u003e3\u003c/sup\u003e flasks. Cultures were anaerobically incubated for 24h at 37\u0026deg;C under constant agitation at 50 rpm. In parallel, to assess the number of viable bacteria after \u003cem\u003eH. kunzii\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e cocultures, CFU counts were performed at 0, 6, 16 and 24h on LBA and TSS agar media.\u003c/p\u003e\n\u003cp\u003eAfter 24h, bacterial suspensions were collected in 15 mL tubes and centrifuged for 10 min at 4,000 rpm at +\u0026thinsp;4\u0026deg;C. The bacterial pellets were washed with 1 mL of PBS 1X (Sigma-Aldrich), centrifuged at 10,000 rpm for 180 s, and then resuspended in 60 \u0026micro;L of LDS 1X (Lithium duodecylsulfate; NuPAGE, ThermoFisher, Waltham, MA, USA) supplemented with 5% \u0026beta;-mercaptoethanol (Sigma-Aldrich) before being stored at -20\u0026deg;C. To obtain the exoproteome, the culture supernatants were filtered through a 0.22 \u0026micro;m membrane (syringe filter; VWR, Rosny sous Bois, France). Aliquots of 200 \u0026micro;L were then transferred into 2 mL tubes (Sarstedt, Marnay, France). Proteins were precipitated by chloroform-methanol extraction, as previously described [\u003cspan\u003e16\u003c/span\u003e]. The resulting protein pellet was air-dried before being resuspended in 30 \u0026micro;L of LDS 1X supplemented with 5% \u0026beta;-mercaptoethanol and stored at -20\u0026deg;C.\u003c/p\u003e\n\u003cp\u003eMedium enriched with \u003cem\u003eH. kunzii\u003c/em\u003e exoproteome (MEHkE) preparation and \u003cem\u003eagrB\u003c/em\u003e transcriptomic study\u003c/p\u003e\n\u003cp\u003eTo study the role of \u003cem\u003eH. kunzii\u003c/em\u003e secreted proteome on the \u003cem\u003eagrA\u003c/em\u003e gene at the transcriptomic level, \u003cem\u003eS. aureus\u003c/em\u003e was growth in a medium containing this secreted proteome, adapted from [\u003cspan\u003e17\u003c/span\u003e]. Briefly, a preculture of \u003cem\u003eH. kunzii\u003c/em\u003e H13, described above, was centrifugated. The supernatant was precipitated in chloroform-methanol and resuspended in LDS 1X (2.2 mL supernatant in 500 \u0026micro;L LDS 1X) to concentrate secreted proteins. This MEHkE solution was stored at -20\u0026deg;C. Then, 5 mL of modified CWM was inoculated with NSA739 at the OD adjusted to 0.1 or 1 and supplemented with 0.1 mL LDS 1X MEHkE solution. A negative control with LDS 1X alone was performed. Cultures were incubated for 24h at 37\u0026deg;C under 250 rpm. After centrifugation (10 min at 4,000rpm and 4\u0026deg;C), \u003cem\u003eS. aureus\u003c/em\u003e pellets were stored at -80\u0026deg;C before RNA extraction.\u003c/p\u003e\n\u003cp\u003eCell pellets from MEHkE exposed \u003cem\u003eS. aureus\u003c/em\u003e culture and coculture were treated in the same way, following an adapted protocol from [\u003cspan\u003e18\u003c/span\u003e]. The bacterial fraction was washed once with 1 mL Tris Triton EDTA (TTE) 1X and then extracted according to the RNAeasy Plus kit (Qiagen, Courtaboeuf, France), following the manufacturer\u0026rsquo;s recommendations with two extra-steps. Culture samples were resuspended in 200 \u0026micro;L TTE1X added to 10 \u0026micro;L of a solution of lysozyme (10\u0026micro;g/mL), lysostaphin (1mg/mL), and mutanolysin (62.5 \u0026micro;g/mL) (Sigma-Aldrich) and were further incubated for 30 min at 37\u0026deg;C. After the first column wash, a DNAse treatment was performed using 10\u0026micro;L of DNAse (Qiagen) and 70\u0026micro;L of DNAse Buffer (Qiagen). Extracted RNAs were quantified using an ELISA plate reader (ThermoFisher) and further normalized at 50 ng/\u0026micro;L. Reverse transcription was performed using iScript\u0026trade; Reverse Transcription Supermix for RT-qPCR (BioRad, Marne La Coquette, France). Reverse transcription products were quantified and normalized to 50 ng/\u0026micro;L. Quantitative PCR assay was performed using 2 \u0026micro;L of normalized cDNA (50ng/\u0026micro;L), 1.2 \u0026micro;L of each target primers (10 mM), 2.4 \u0026micro;L LightCycler\u0026reg; RNA Master SYBR Green I kit (Roche Applied Science, Meylan, France) for a total of 10 \u0026micro;L per well in a LightCycler\u0026reg;480 device (Roche Diagnostics, Meylan, France). Primers used were agrA\u003cem\u003e-\u003c/em\u003eF (5ʹ- CAAAGAGAAAACATGGTTACCATTATTAA‐3\u0026rsquo;), agrA-R (5ʹ‐ CTCAAGCACCTCATAAGGATTATCAG‐3\u0026rsquo;) [\u003cspan\u003e19\u003c/span\u003e], gyrB-F (5\u0026rsquo;‐ GGTGGCGACTTTGATCTAGC‐3\u0026rsquo;) and gyrB-R (5\u0026rsquo;‐ TTATACAACGGTGGCTGTGC‐3\u0026rsquo;) [\u003cspan\u003e20\u003c/span\u003e]. 35 PCR cycles were programmed with 30s of denaturation, 30s of hybridation at 52\u0026deg;C and 1 min of elongation. Cycle threshold (\u003cem\u003eCt\u003c/em\u003e) values of the different target genes were compared with the \u003cem\u003eCt\u003c/em\u003e-values of the house-keeping gene (\u003cem\u003egyrB\u003c/em\u003e) [\u003cspan\u003e21\u003c/span\u003e]. Amplifications were performed in triplicate from three different RNA preparations. The \u0026Delta;\u0026Delta;C\u003csub\u003et\u003c/sub\u003e were calculated following the equation [\u003cspan\u003e22\u003c/span\u003e]: 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e (\u0026Delta;\u0026Delta;Ct = (Ct\u003csub\u003egene\u003c/sub\u003e \u0026minus; Ct\u003csub\u003e\u003cem\u003egyrB\u003c/em\u003e\u003c/sub\u003e)\u003csub\u003eNSA739 exposed to \u003cem\u003eH. kunzii\u003c/em\u003e\u003c/sub\u003e \u0026minus; (Ct\u003csub\u003egene\u003c/sub\u003e \u0026minus; Ct\u003csub\u003e\u003cem\u003egyrB\u003c/em\u003e\u003c/sub\u003e)\u003csub\u003eNSA739 alone\u003c/sub\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWhole genome sequencing.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eH. kunzii\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e genomes were sequenced according to the Illumina library preparation protocol using 250 ng of the extracted DNA following the DNA Prep kit library paired-end protocol (Illumina, San Diego, USA) and sequenced in a 39-h run providing 2x250-bp reads on a Miseq sequencer (Illumina), as previously described [\u003cspan\u003e23\u003c/span\u003e]. Both genomes were \u003cem\u003ede novo\u003c/em\u003e assembled using Spades software (version 3.15.4) and annotated using DDBJ Fast Annotation and Submission Tool online platform (\u003cspan\u003e\u003cspan\u003ehttps://dfast.ddbj.nig.ac.jp/\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" name=\"Emphasis\"\u003e)\u003c/span\u003e, then compared by Pangenome analysis using Roary tools (Version 3.13.0).\u003c/p\u003e\n\u003cp\u003eProteomic study during the \u003cem\u003eH. kunzii\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e interaction\u003c/p\u003e\n\u003cp\u003eTryptic peptides were obtained and identified from the exoproteome and proteome samples as previously described [\u003cspan\u003e13\u003c/span\u003e]. Briefly, peptides were identified using an UltiMate 3000 nano-LC system (ThermoFisher Scientific) coupled to a Q Exactive HF mass spectrometer (ThermoFisher Scientific). Peptides were desalted on a reverse-phase PepMap 100 C18 \u0026micro;-precolumn (5 \u0026micro;m, 100 \u0026Aring;, 300 \u0026micro;m i.d. \u0026times; 5 mm, ThermoFisher Scientific) before separation on a nanoscale PepMap 100 C18 nano-LC column (3 \u0026micro;m, 100 \u0026Aring;, 75 \u0026micro;m i.d. \u0026times; 50 cm, ThermoFisher Scientific) using a 90 min gradient (75 min from 4\u0026ndash;25% solvent B, and 15 min from 25\u0026ndash;40% of solvent B) at a flow rate of 0.2 \u0026micro;L per min. Solvent A was 0.1% formic acid in water, while solvent B was 80% acetonitrile, 0.1% formic acid in water. The mass spectrometer was operated in Top 20 mode, acquiring full MS from 350 to 1500 m/z, and selecting the 20 most abundant precursor ions for fragmentation, with a 10-s dynamic exclusion window. Ions with charge 2\u0026thinsp;+\u0026thinsp;and 3\u0026thinsp;+\u0026thinsp;were chosen for MS/MS analysis, and secondary ions were isolated within a 2.0-m/z window. Data were interpreted using the Mascot Daemon software version 2.6.0 (Matrix Sciences, Chicago, IL, USA) by seraching a database comprising 82,248 polypeptide sequences, representing the annotated genomes of \u003cem\u003eH. sapiens\u003c/em\u003e, \u003cem\u003eH. kunzii\u003c/em\u003e H13 strain (NZ_CP048105.1) and \u003cem\u003eS. aureus\u003c/em\u003e Newman strain (AP009351.1) as detailed in [\u003cspan\u003e13\u003c/span\u003e]. Newman strain is closely similar to NSA-739 exhibiting\u0026thinsp;\u0026gt;\u0026thinsp;99% genome coverage and identity. The coding ration are closely similar Pangenome comparison yielded the totality of proteins predicted in NSA739 genome was found in the Newman strain justifying the choose of this strain.\u003c/p\u003e\n\u003cp\u003eStatistical and bioinformatic analysis\u003c/p\u003e\n\u003cp\u003eComparison of \u003cem\u003eagrA\u003c/em\u003e expression in \u003cem\u003eS. aureus\u003c/em\u003e with and without the presence of \u003cem\u003eH. kunzii\u003c/em\u003e was analyzed using the Student\u0026rsquo;s t-test with GraphPad Prism (v9.2.0) (San Diego, CA, USA). Regarding the proteomic analysis, normalization of spectral counts, their variation and visualization were carried out using an R script [\u003cspan\u003e24\u003c/span\u003e\u0026ndash;\u003cspan\u003e28\u003c/span\u003e]. Statistical analysis of proteomic data was performed using Pearseus software (v1.6.5.0) [\u003cspan\u003e29\u003c/span\u003e] allowing for permutated FDR correction; this correction accounted for both fold change and p-values through a nonlinear weighting.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eValidation of coculture conditions to proteomic assays\u003c/p\u003e\n\u003cp\u003eThe potential ability for \u003cem\u003eH. kunzii\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e to grow together was assessed. Both strains remained fairly stable over the 24h-contact after an inoculation at OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1 and were detected in a similar proportion (Fig.\u0026nbsp;1A). Using an OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.1, increased CFU counts were noted after 24h, compared to the initial inoculum, suggesting that both species had initiated an exponential phase (Fig.\u0026nbsp;1B). By 24h, both species were in similar proportions.\u003c/p\u003e\n\u003cp\u003eThe growth kinetic of the coculture at the initial OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.1 was investigated (Fig. 1C). The exponential phase of \u003cem\u003eS. aureus\u003c/em\u003e began immediately and resolved after 5h, reaching the stationary phase. \u003cem\u003eH. kunzii\u003c/em\u003e exhibited a different profile with a longer initial lag phase, entering exponential growth after 16h and reaching its stationary state at 21h. Interestingly, the \u003cem\u003eH. kunzii\u003c/em\u003e strain in co-culture started to replicate actively when the \u003cem\u003eS. aureus\u003c/em\u003e strain was already in its stationary phase. Both strains were found at an equivalent ratio by the end of the experiment (24h). These results demonstrate that, despite the non-concurrent exponential phases of the two species, both underwent a complete exponential phase over the 24h contact time and entered the stationary phase (activation phase of the Agr system and production of virulence factors in \u003cem\u003eS. aureus\u003c/em\u003e).\u003c/p\u003e\n\u003cp\u003eUnderexpression of \u003cem\u003eagrA\u003c/em\u003e in \u003cem\u003eS. aureus\u003c/em\u003e in presence of exoproteome of \u003cem\u003eH. kunzii\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe next step involved monitoring \u003cem\u003eS. aureus agrB\u003c/em\u003e expression in two ways: (i) after coculture and (ii) following exposure to \u003cem\u003eH. kunzii\u003c/em\u003e exoproteome (MEHkE). The objective was to confirm the hypothesis of a contact-independent interaction between the two species sufficient to induce the downregulation of the Agr system and the reduction of \u003cem\u003eS. aureus\u003c/em\u003e virulence.\u003c/p\u003e\n\u003cp\u003eUnder all tested conditions, we observed a consistent decrease in \u003cem\u003eagrA\u003c/em\u003e expression (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Notably, this reduction was statistically significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) after exposure to MEHkE when \u003cem\u003eS. aureus\u003c/em\u003e was in the stationary phase (OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1). This finding supports the idea that \u003cem\u003eH. kunzii\u003c/em\u003e H13 may secrete proteins that downregulate \u003cem\u003eagrA\u003c/em\u003e in \u003cem\u003eS. aureus\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eIdentification of candidate \u003cem\u003eH. kunzii\u003c/em\u003e secreted proteins decreasing \u003cem\u003eS. aureus\u003c/em\u003e virulence\u003c/p\u003e\n\u003cp\u003eTo identify the proteins secreted by \u003cem\u003eH. kunzii\u003c/em\u003e in the absence/presence of \u003cem\u003eS. aureus\u003c/em\u003e, a proteomic study was conducted. \u003cem\u003eH. kunzii\u003c/em\u003e alone secreted a limited number of proteins at all stages of its growth (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;42 at OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1 and \u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;44 at OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.1). This \u0026ldquo;poor secretor\u0026rdquo; profile remained unchanged in the presence of \u003cem\u003eS. aureus\u003c/em\u003e (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;55 at OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1 and \u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;18 at OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.1) (\u003cstrong\u003eSupplementary Figure \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eGiven the significant downregulation of the Agr system observed after exposure to MEHkE, we searched for proteins secreted by \u003cem\u003eH. kunzii\u003c/em\u003e interacting with \u003cem\u003eS. aureus\u003c/em\u003e. Among the initial list of 75 proteins recovered from the \u003cem\u003eH. kunzii\u003c/em\u003e exoproteome, 55 belonged to the exoprotein fraction from coculture at OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1, representing the most promising candidates to interfere with \u003cem\u003eS. aureus\u003c/em\u003e virulence. Of these 55 candidates, 17 were associated with transcriptional activity, including 8 ribosomal subunits. Surprinsignly, RsmB (Ribosomal Subunit B) (GUI37_RS04270), a genomic candidate previously identified [\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e], was found only in proteome and not in exoproteome. In addition, 17 of 55 exoproteins found were linked to carbohydrate metabolism, including the type 3 glyceraldehyde-3-phosphate dehydrogenase protein, already described as a \u0026ldquo;moonlighting\u0026rdquo; protein (protein with variable independent biological activities) [\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e]. At OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.1, 18 proteins candidates were identified. Ultimately, 16 proteins were definitively included because they were present in all conditions (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Interestingly, four of these proteins were associated with a potential to alter cell wall architecture: the polysaccharide deacetylase family protein (WP_212661168.1), peptidoglycan DD-metalloendopeptidase family protein (WP_212661263.1), and the aforementioned type I glyceraldehyde-3-phosphate dehydrogenase (WP_005397984.1 and WP_005398187.1). Two of 16 selected included presented an stronger interest: the trypsin-like peptidase domain-containing protein (WP_212661130.1) with a serine protease domain, previously described for their potential in \u003cem\u003eS. aureus\u003c/em\u003e-\u003cem\u003eS. epidermidis\u003c/em\u003e interaction [\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e] and the extracellular solute-binding protein (WP_212660510.1), which could impact nutritional competition [\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eExoproteome \u003cem\u003eH. kunzii\u003c/em\u003e associated proteins (relative abundance) showing the most potential regarding \u003cem\u003eS. aureus\u003c/em\u003e virulence attenuation.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eLocus_tag\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eProtein_id\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eProtein\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCoculture\u003c/p\u003e\n \u003cp\u003eOD\u0026thinsp;=\u0026thinsp;0.1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eMonoculture\u003c/p\u003e\n \u003cp\u003eOD\u0026thinsp;=\u0026thinsp;0.1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCoculture\u003c/p\u003e\n \u003cp\u003eOD\u0026thinsp;=\u0026thinsp;1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eMonoculture\u003c/p\u003e\n \u003cp\u003eOD\u0026thinsp;=\u0026thinsp;1\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS00090\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_005396836.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ehypothetical protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000606555\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.00256595\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001437565\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.004309736\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS00890\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_005397107.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eformate C-acetyltransferase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001196144\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.003703013\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.005617706\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.004597426\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS01090\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_212661130.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003etrypsin-like peptidase domain-containing protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002148342\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002857483\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002299551\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002849986\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS01425\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_212661168.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003epolysaccharide deacetylase family protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000952198\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.003290195\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002687416\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.004150736\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS01930\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_212661252.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2-dehydropantoate 2-reductase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000257553\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001063231\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001706237\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000173433\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS02030\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_212661263.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003epeptidoglycan DD-metalloendopeptidase family protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000430375\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001046678\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.00048113\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.00104926\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS02985\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_005397814.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHU family DNA-binding protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000515063\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001344793\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002180884\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001585436\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS03540\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_005397984.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003etype I glyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000593077\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002599056\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002668364\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.00120393\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS03545\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_212661385.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ephosphoglycerate kinase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000599837\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001321561\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.003500177\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000770347\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS03555\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_005397990.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2,3-bisphosphoglycerate-independent phosphoglycerate mutase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000257553\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001945353\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002918642\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.00129209\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS03560\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_005397992.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ephosphopyruvate hydratase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.00145374\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002820892\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.005523651\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.003488873\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS04205\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_005398187.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003etype I glyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.003090292\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.007941784\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.009235759\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.006067161\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS05200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_212660510.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eextracellular solute-binding protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.001026853\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.00160322\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.005455659\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.007139515\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS06220\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_212660639.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eflavocytochrome c\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002246638\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.009022606\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.005361868\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.011533081\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS07030\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_212660710.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ehypothetical protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000260912\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000979331\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000581271\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.00114175\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUI37_RS07980\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWP_005399120.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIMP dehydrogenase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.00016942\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000264961\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.00038112\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.000263036\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003eShortlisted candidates are highlighted in gray.\u003c/p\u003e\n\u003cp\u003eImpact of \u003cem\u003eH. kunzii\u003c/em\u003e exoproteome on \u003cem\u003eS. aureus\u003c/em\u003e virulence under continuous stationary conditions\u003c/p\u003e\n\u003cp\u003eTo explore the impact of the \u003cem\u003eH. kunzii\u003c/em\u003e exoproteome on \u003cem\u003eS. aureus\u003c/em\u003e virulence, we focused on the regulatory gene network governing \u003cem\u003eS. aureus\u003c/em\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). The RNAIII activating regulator, AgrA (NWMN_1946), exhibited decreased abundance, while the RNAIII activating protein TRAP (NWMN_1726) was significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0068) underabundant with a 2-fold change (log\u003csub\u003e2\u003c/sub\u003eFC)[FC] of 0.69 [1.61] and 0.68 [1.60], respectively. Both proteins are associated with RNAIII induction, a stable regulatory RNA with activating effects on hemolysin production [\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eAgrA production was positively regulated by SarA (NWMN_0588) and by SarV (NWMN_2167) and negatively regulated by SarX (NWMN_0637) and CodY (NWMN_1165) [\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e]. Surprinsingly, CodY was significantly underabundant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0269) in coculture experiments (log\u003csub\u003e2\u003c/sub\u003eFC\u0026thinsp;=\u0026thinsp;0.91, FC\u0026thinsp;=\u0026thinsp;1.88) despite the decrease of AgrA, while SarX showed a trend of increased abundance (log\u003csub\u003e2\u003c/sub\u003eFC =-1.59, FC\u0026thinsp;=\u0026thinsp;0.33). Both positive regulators, SarA and SarV, exhibited trends of underabundance in coculture experiments explaining potentially underabundance of AgrA. In summary, the virulence regulatory network of \u003cem\u003eS. aureus\u003c/em\u003e appears to be impaired upon coculture, leading to alpha hemolysin repression (NWMN_1073, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0079).\u003c/p\u003e\n\u003cp\u003eAdditionally, the stress repsonse pathway also showed evidence of an impacted regulatory network. Sigma B (NWMN_1970) and both its repressor (anti-sigmaB, RsbW, NWMN_1971) and activator (anti-sigma B factor antagonist, RsbV, NWMN_1972), were underrepresented in coculture (log\u003csub\u003e2\u003c/sub\u003eFC\u0026thinsp;=\u0026thinsp;0.53[FC\u0026thinsp;=\u0026thinsp;1.45], \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.1430; 0.32[1.25] \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0869; and 1.56 [2.96], \u003cem\u003ep.\u003c/em\u003e=0.0044, respectively) (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eAs virulence factors with cytolytic activity need to be secreted, particularly in the stationary phase, the exoproteome fraction of \u003cem\u003eS. aureus\u003c/em\u003e in the stationary phase was also investigated. Only two proteins were statistically underabundant in coculture: a threonyl-tRNA synthetase (NWMN_1576, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0048) and an ATP-binding subunit ClpC (NWMN_2448, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0020), reduced by 1.92 [3.79] and 2.69 [6.44] fold, respectively. Moreover, some virulence effectors were impacted by the presence of the \u003cem\u003eH. kunzii\u003c/em\u003e exoproteome. The gamma hemolysin component ABC, leukocidin/hemolysin toxin family F and S subunits, as well as the alpha hemolysin precursor, showed a trend of decreased abundance in the exoproteome fraction of the coculture. To explore if this decrease in virulence factors from the exoproteome was associated with a defect in their production or export, the proteomic fraction was analyzed. The alpha hemolysin precursor (NWMN_1073, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0079) was significantly reduced, suggesting that its production was repressed. However, leukocidin/hemolysin toxin family F and S subunits and gamma hemolysin component B were overabundant in the intracellular proteome, suggesting that they are retained intracellularly or that they are less stable once excreted.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eS. aureus\u003c/em\u003e virulence is modified by \u003cem\u003eH. kunzii\u003c/em\u003e exoproteome independently of the Agr system.\u003c/p\u003e\n\u003cp\u003eBacteria acquire iron through ABC transport, transferrin binding, or siderophore production to sustain their metabolism [\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e]. In our study, one \u003cem\u003eS. aureus\u003c/em\u003e siderophore biosynthetic pathway (\u003cstrong\u003eFigure S2\u003c/strong\u003e) was hindered by two proteins involved in the conversion of D-ornithine to Staphyloferrin A [\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e]. These proteins were exclusively detected in monoculture samples. Additionally, a Staphyloferrin precursor, 2-oxaloglutarate, produced by the citrate cycle through acetate oxidation (TCA) [\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e], was also primarily affected in coculture samples as the entire TCA pathway showed either a decrease or absence in coculture. We also observed that six proteins involved in iron metabolism were significantly differentially abundant. Ferrochelatase (NWMN_1724, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.030) was overexpressed (-0.77 [0.58 FC]), while the other five were underrepresented: the iron compound ABC transporter, the iron compound-binding protein (NWMN_2185, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0045, and NWMN_0581, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0007), the siderophore compound ABC transporter binding protein (NWMN_0059, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0006), and two ferrichrome ABC transporter lipoprotein (NWMN_2078 \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0003, NWMN_0705, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0002). The latter exhibited the most significant decrease in abundance (5.23 [37.60 FC]).\u003c/p\u003e\n\u003cp\u003eFinally, proteins involved in cell wall formation and virulence effectors of \u003cem\u003eS. aureus\u003c/em\u003e were directly inhibited (\u003cstrong\u003eFigure S3\u003c/strong\u003e). The cell wall formation was affected at the level of wall teichoic and lipoteichoic acids. Moreover, staphyloxanthin production, a protein protecting \u003cem\u003eS. aureus\u003c/em\u003e from neutrophils clearance [\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e], was impaired by the absence of CrtM and CrtP in coculture samples.\u003c/p\u003e\n\u003cp\u003eImpact of \u003cem\u003eH. kunzii\u003c/em\u003e exoproteome on \u003cem\u003eS. aureus\u003c/em\u003e metabolism\u003c/p\u003e\n\u003cp\u003eThe ability of \u003cem\u003eS. aureus\u003c/em\u003e to produce proteins was reduced upon exposure to \u003cem\u003eH. kunzii\u003c/em\u003e exoproteome, as the absolute diversity of proteins recovered from monoculture samples was higher than that from coculture. Additionally, coculture in the stationary phase showed the lowest diversity of \u003cem\u003eS. aureus\u003c/em\u003e proteins (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). Out of the 775 proteins found during the stationary phase, constituting the \u003cem\u003eS. aureus\u003c/em\u003e proteome under coculture conditions, 315 (40.6%) were significantly differentially abundant (ranging from \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.00023 to 0.2651, with the latter becoming significant through Perseus statistical treatment). Among them, only 10 (1.3%) were overabundant, highlighting the metabolic repression potential of \u003cem\u003eH. kunzii\u003c/em\u003e presence.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThese results from clinical and microbiological observations confirm the \u003cem\u003ein vivo\u003c/em\u003e results obtained previously and suggest a potential interaction between \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eH. kunzii\u003c/em\u003e in chronic wounds, particularly in foot ulcers in patients with diabetes. The frequent co-isolation of these two species indicates their proximity in the wound bed [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Furthermore, our previous study demonstrated phenotypic variation in \u003cem\u003eS. aureus\u003c/em\u003e in the presence of \u003cem\u003eH. kunzii\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. This commensal bacteria had the ability to reduce \u003cem\u003eS. aureus\u003c/em\u003e virulence in an \u003cem\u003ein vivo C. elegans\u003c/em\u003e model [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] by acting on the Agr system, a key virulence regulator. Building upon these findings, this study aimed to replicate, in an \u003cem\u003ein vitro\u003c/em\u003e model, the environmental conditions leading to a decrease in \u003cem\u003eS. aureus\u003c/em\u003e virulence in the presence of \u003cem\u003eH. kunzii\u003c/em\u003e and to elucidate the proteins involved in this molecular interaction.\u003c/p\u003e \u003cp\u003eTo explore \u003cem\u003ein vitro\u003c/em\u003e molecular interactions between \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eH. kunzii\u003c/em\u003e, we utilized the CWM [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In conventional \u003cem\u003ein vitro\u003c/em\u003e experiments, bacteria are typically grown in artificial culture medium, which differs considerably from the environment encountered in clinical situations. This condition can influence bacterial virulence, but its clinical relevance is often limited. The use of CWM, designed to mimic the environmental conditions of a chronic wound (containing blood and serum), was crucial in enabling the growth of \u003cem\u003eH. kunzii\u003c/em\u003e in liquid medium. This growth was unattainable in traditional culture media like LB media. Our results confirm that \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eH. kunzii\u003c/em\u003e can coexist and grow together in this environment, overcoming challenges observed in other studies focusing on bacterial interactions. Notably, studies investigating interactions between \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e have encountered difficulties in cultivating them together \u003cem\u003ein vitro\u003c/em\u003e, thereby impeding a comprehensive understanding of their interplay. Traditional culture media were shown to hinder the growth of \u003cem\u003eP. aeruginosa\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e simultaneously [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In such artificial environment, bacteria primarily compete for nutrients like iron, leading to one species outcompeting the other. We have previously demonstrated that CWM enables the concurrent growth of \u003cem\u003eP. aeruginosa\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e without dominance by either species [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Our study affirms the feasibility of coculturing \u003cem\u003eH. kunzii\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e in this medium.\u003c/p\u003e \u003cp\u003eAdditionally, growth curves revealed that, even though \u003cem\u003eH. kunzii\u003c/em\u003e exhibited a delayed exponential phase, both \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eH. kunzii\u003c/em\u003e reached the stationary phase in similar proportions after 24h. The growth curves indicated that \u003cem\u003eH. kunzii\u003c/em\u003e enters its exponential phase only once \u003cem\u003eS. aureus\u003c/em\u003e is in stationary phase. \u003cem\u003eH. kunzii\u003c/em\u003e could use resources (nutrients..) and space once \u003cem\u003eS. aureus\u003c/em\u003e is no longer multiplying [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFurthermore, we demonstrated that exposure to the secreted proteome of \u003cem\u003eH. kunzii\u003c/em\u003e significantly downregulated the Agr system \u003cem\u003ein vitro\u003c/em\u003e, similar to our previous \u003cem\u003ein vivo\u003c/em\u003e findings and when \u003cem\u003eS. aureus\u003c/em\u003e was in stationary phase. As the Agr system is activated during the late exponential phase and sustains a lower level during stationary phase (first 6-7h) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], this interaction likely affects the maintenance of the Agr loop rather than its initial activation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. This effect on the Agr system is more pronounced after MEHkE exposure than in coculture, as previously demonstrated by Ramsey \u003cem\u003eet al\u003c/em\u003e. These authors highlighted that exposure to \u003cem\u003eCorynebacterium striatum\u003c/em\u003e culture supernatant was sufficient to alter \u003cem\u003eS. aureus\u003c/em\u003e Agr-dependent gene expression during stationary phase [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe potential molecular interactions between \u003cem\u003eH. kunzii\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e were further investigated through transcriptomic analysis of the secreted proteome. Several candidate proteins to explain the interaction were identified (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor instance, GPAH (glyceraldehyde-3-phosphate dehydrogenase), previously described in \u003cem\u003eLactobacillus\u003c/em\u003e to cause cell wall damage [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] and to play a role in iron uptake, may contribute also to the \u003cem\u003eH. kunzii\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e interaction [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Additionally, proteins such as the peptidoglycan DD-metalloendopeptidase family protein and polysaccharide deacetylase family protein possess the potential to damage membranes, suggesting a redundant activity. The combined catalytic activities of these proteins could impair membrane function, potentially inducing a stress response that contributes to the alteration of virulence factors regulation. The remaining potential targets, a trypsin-like peptidase domain-containing protein and an extracellular solute-binding protein, may also adversely affect cell wall function and compete for resources. As mentioned in previous publications, extracellular serine proteases have already been described as being involved in \u003cem\u003eS. aureus\u003c/em\u003e-\u003cem\u003eS. epidermidis\u003c/em\u003e interaction, with negative impact on biofilm degradation [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] and cell wall-associated proteins [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], potentially adding another layer to cell wall disruption. The extracellular solute-binding protein is also an interesting candidate, as solute binding proteins are involved in nutrient acquisition, with the potential to compete and alter \u003cem\u003eS. aureus\u003c/em\u003e feeding behaviour [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], and also in sensing environmental cues [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFocusing on the regulatory network of \u003cem\u003eS. aureus\u003c/em\u003e virulence (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e), RNA III (pleiotropic regulator of virulence factors) activators were significantly underrepresented, resulting in a decreased production of alpha hemolysin. However, the regulatory network governing alpha hemolysin production showed some inconsistencies. For instance, CodY, expected to negatively impact virulence factor production, was found at lower abundance in coculture, but its involvement seems most relevant during exponential growth [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. The stress response SigmaB regulon also appeared to be altered, with SigmaB and its regulators being underrepresented. SigmaB, with its pleiotropic role, plays a central role in adaptation [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], impacting virulence factor production by activating SarA, which itself activates AgrA, and inhibiting the Agr system [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Sigma B transcriptional activity relies on the phosphorylation status of RsbV; only the unphosphorylated RsbV can free Sigma B from RsbW [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Sigma B is associated with osmotic stress [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e] and cell wall alteration, as a result of the WTA (Wall Teichoic Acid) synthesis pathway inhibition, has been linked to osmotic stress [\u003cspan additionalcitationids=\"CR56\" citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. The overall result is a disrupted regulation factor coordinating virulence factor production.\u003c/p\u003e \u003cp\u003eSeveral \u003cem\u003eS. aureus\u003c/em\u003e metabolic pathways were impacted by \u003cem\u003eS. aureus/ H. kunzii\u003c/em\u003e interaction, particularly in stationary phase. For example, staphyloxantin and staphyloferrin productions were repressed. These proteins are involved in staphylococcal virulence [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e], either directly through escaping the immune system response (ROS (Reduction of Oxydatif Stress) or facilitating iron uptake [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Nutrient uptake, especially co-factors like iron, is a limiting factor in bacterial virulence [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], particularly in \u003cem\u003eS. aureus\u003c/em\u003e through \u003cem\u003efur\u003c/em\u003e regulation [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Cell wall components of \u003cem\u003eS aureus\u003c/em\u003e were also affected, including wall teichoic and lipoteichoic acids. These alterations can affect both virulence [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e] and surface colonization (D-alanin incorporation) [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. The results collectively suggest a metabolically repressed state of \u003cem\u003eS. aureus\u003c/em\u003e when associated with \u003cem\u003eH. kunzii\u003c/em\u003e. The profound remodeling of \u003cem\u003eS. aureus\u003c/em\u003e proteome, with a decrease in diversity during coculture indicates an adaptation to the presence of \u003cem\u003eH. kunzii\u003c/em\u003e. A total of 279 proteins were no longer produced at OD\u0026thinsp;=\u0026thinsp;1 in coculture with \u003cem\u003eH. kunzii\u003c/em\u003e compared to \u003cem\u003eS. aureus\u003c/em\u003e monoculture, with 212 associated with the proteomic fraction and 67 with the exoproteome (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Additionally, the exoproteome of \u003cem\u003eS. aureus\u003c/em\u003e has been extensively studied under various conditions [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e], revealing a range of proteins identified from 186 to 1404. These proteins are predominantly associated with virulence, metabolism, and carbohydrate functions [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAligning the reconstructed pathways revealed that those affected at OD\u0026thinsp;=\u0026thinsp;0.1 were even more impacted at OD\u0026thinsp;=\u0026thinsp;1 suggesting that the fine-tuning of \u003cem\u003eS. aureus\u003c/em\u003e metabolism is more affected after reaching the stationary state. This could be attributed to impaired nutrient and cofactor uptake, highlighting the tight connection between metabolic capacities and virulence [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, this study provides insights into the \u003cem\u003ein vitro\u003c/em\u003e molecular interactions between \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eH. kunzii\u003c/em\u003e, elucidating the mechanism behind the reduction in \u003cem\u003eS. aureus\u003c/em\u003e virulence in the presence of \u003cem\u003eH. kunzii\u003c/em\u003e. The findings shed light on the potential proteins involved in this interaction at a molecular level, unraveling a complex interplay that impacts the regulatory network and global metabolism of \u003cem\u003eS. aureus\u003c/em\u003e. The decrease in \u003cem\u003eS. aureus\u003c/em\u003e virulence is not linked to cell-cell contact but is mainly dependent on \u003cem\u003eH. kunzii\u003c/em\u003e secreted proteins. The proteomic approach indicates that these secreted proteins may be involved in virulence attenuation, and this attenuated virulence phenotype is associated with a substantial metabolic remodeling, altering the \u003cem\u003eS. aureus\u003c/em\u003e virulence regulatory network. Finally, a shortlist of six proteins produced by \u003cem\u003eH. kunzii\u003c/em\u003e with high potential for anti-virulence therapy was identified. Subsequent investigations will explore the phenotypic impact of the excreted factors potentially involved in this virulence modulation. This work contributes to a better understanding of the dynamics between bacterial species in chronic wound environments, laying the foundation for further research into therapeutic interventions and strategies for managing diabetic foot infections.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCFU Colony Forming Unit \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCWM Chronic Wound Medium\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFC Fold Change \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGPAH Glyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e\n\u003cp\u003eLDS Lithium duodecylsulfate\u003c/p\u003e\n\u003cp\u003eLBA Luria Bertani broth Agar\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMEHkE Medium enriched with H. kunzii exoproteome\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNSA\u0026nbsp; \u0026nbsp;\u0026nbsp;N\u0026icirc;mes \u003cem\u003eStaphylococcus aureus\u003c/em\u003e \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOD optical density\u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eROS Reduction of Oxydatif Stress\u003c/p\u003e\n\u003cp\u003eRsmB Ribosomal Subunit B\u003c/p\u003e\n\u003cp\u003eRT-qPCR: Retrotranscription quantitative PCR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eST Sequence type\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTCA through acetate oxidation\u003c/p\u003e\n\u003cp\u003eTRAP \u0026nbsp;translocon-associated protein\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTTE Tris Triton EDTA\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTSS Trypticase Soy supplemented with 5% sheep blood\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWTA Wall Teichoic Acid\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvaibilty of data and materials:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe genomic data are disponible on NCBI GenBank database under the BioProject number: PRJNA107820.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eProteomic data are accessible online using the following details \u0026nbsp;(
[email protected] as username, and 0qZ91Ona as password].\u003c/p\u003e\n\u003cp\u003eThe mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD049416 and 10.6019/PXD049416. [This dataset is accessible for the reviewers with
[email protected] as username and 0qZ91Ona as password]. [67].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll strains belonged to the collection of the Department of Microbiology at Nîmes University Hospital (France). \u0026nbsp;This study was submitted to the Institutional Review Board of University Hospital, Nımes, France which was deemed unnecessary to obtain a consent to participate for patients according to national regulation. In fact, the analysis of biological samples was obtained in the context of medical care and was considered as non-interventional research. In addition, in this study, we use \u003cstrong\u003eonly bacterial strains and\u003c/strong\u003e \u003cstrong\u003enot human specimens\u003c/strong\u003e and no clinical data was explored. IRB judged, in this context, that only the non-opposition of the patient during sampling has required according to articles L1221-1.1, L1211-2, and N\u0026deg;DC-2020-4155 of the French Public Health Code. The consent to participate was waived by IRB of University Hospital, Nımes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003ch1\u003eCompeting interests\u003c/h1\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003ch1\u003eFunding\u003c/h1\u003e\n\u003cp\u003eThis research was funded by CHU N\u0026icirc;mes, grant number: Thematique Phare 1. The funder had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.\u003c/p\u003e\n\u003ch1\u003eAuthors\u0026rsquo; Contributions\u003c/h1\u003e\n\u003cp\u003eBARND conducted all experiments and wrote the manuscript. BARND and LG conducted the proteomic experiments. MM conducted genomic analysis. JA, JPL and CDR conceived and designed the experiments. All authors have read the article and approved the submitted version.\u003c/p\u003e\n\u003ch1\u003eAcknowledgments\u003c/h1\u003e\n\u003cp\u003eWe thank the N\u0026icirc;mes University hospital for its structural, human and financial support through the award obtained by our team during the internal call for tenders \u0026laquo; Th\u0026eacute;matiques phares \u0026raquo;. We thank Sarah Kabani for her editing assistance.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eJ\u0026auml;rbrink K, Ni G, S\u0026ouml;nnergren H, Schmidtchen A, Pang C, Bajpai R, et al. The humanistic and economic burden of chronic wounds: a protocol for a systematic review. Syst Rev. 2017. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13643-016-0400-8\u003c/span\u003e\u003cspan address=\"10.1186/s13643-016-0400-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDowd SE, Wolcott RD, Sun Y, McKeehan T, Smith E, Rhoads D. Polymicrobial Nature of Chronic Diabetic Foot Ulcer Biofilm Infections Determined Using Bacterial Tag Encoded FLX Amplicon Pyrosequencing (bTEFAP). PLoS ONE. 2008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0003326\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0003326\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohani K, Malone M, Jensen S, Gosbell I, Dickson H, Hu H, et al. Microscopy visualisation confirms multi-species biofilms are ubiquitous in diabetic foot ulcers. Int Wound J. 2017. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/iwj.12777\u003c/span\u003e\u003cspan address=\"10.1111/iwj.12777\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDurand BARN, Pouget C, Magnan C, Molle V, Lavigne J-P, Dunyach-Remy C. Bacterial Interactions in the Context of Chronic Wound Biofilm: A Review. Microorganisms. 2022a. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/microorganisms10081500\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms10081500\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWolcott RD, Hanson JD, Rees EJ, Koenig LD, Phillips CD, Wolcott RA, et al. Analysis of the chronic wound microbiota of 2,963 patients by 16S rDNA pyrosequencing. Wound Repair Regen. 2016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/wrr.12370\u003c/span\u003e\u003cspan address=\"10.1111/wrr.12370\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWolcott R. Disrupting the biofilm matrix improves wound healing outcomes. J Wound Care. 2015. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.12968/jowc.2015.24.8.366\u003c/span\u003e\u003cspan address=\"10.12968/jowc.2015.24.8.366\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePouget C, Dunyach-Remy C, Pantel A, Schuldiner S, Sotto A, Lavigne JP. Biofilms in Diabetic Foot Ulcers: Significance and Clinical Relevance. Microorganisms. 2020. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/microorganisms8101580\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms8101580\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDunyach-Remy C, Ngba Essebe C, Sotto A, Lavigne JP. \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Toxins and Diabetic Foot Ulcers: Role in Pathogenesis and Interest in Diagnosis. Toxins. 2016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/toxins8070209\u003c/span\u003e\u003cspan address=\"10.3390/toxins8070209\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVergne A, Gu\u0026eacute;rin F, Lienhard R, Le Coustumier A, Daurel C, Isnard C, et al. In vitro antimicrobial susceptibility of \u003cem\u003eHelcococcus kunzii\u003c/em\u003e and molecular analysis of macrolide and tetracycline resistance. Eur J Clin Microbiol Infect Dis. 2015. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10096-015-2451-5\u003c/span\u003e\u003cspan address=\"10.1007/s10096-015-2451-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNgba Essebe C, Visvikis O, Fines-Guyon M, Vergne A, Cattoir V, Lecoustumier A, et al. Decrease of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Virulence by \u003cem\u003eHelcococcus kun\u003c/em\u003ez\u003cem\u003eii\u003c/em\u003e in a \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e Model. Front Cell Infect Microbiol. 2017;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcimb.2017.00077\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2017.00077\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrundstad ML, Parlet CP, Kwiecinski JM, Kavanaugh JS, Crosby HA, Cho Y-S, et al. Quorum Sensing, Virulence, and Antibiotic Resistance of USA100 Methicillin-Resistant Staphylococcus \u003cem\u003eaureus\u003c/em\u003e Isolates. mSphere. 2019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mSphere.00553-19\u003c/span\u003e\u003cspan address=\"10.1128/mSphere.00553-19\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDurand BARN, Yahiaoui Martinez A, Baud D, Fran\u0026ccedil;ois P, Lavigne J-P, Dunyach-Remy C. Comparative genomics analysis of two \u003cem\u003eHelcococcus kun\u003c/em\u003ezii strains co-isolated with Staphylococcus \u003cem\u003eaureus\u003c/em\u003e from diabetic foot ulcers. Genomics. 2022b. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ygeno.2022.110365\u003c/span\u003e\u003cspan address=\"10.1016/j.ygeno.2022.110365\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDurand BARN, Dunyach-Remy C, El Kaddouri O, Daher R, Lavigne JP, Armengaud J, Grenga L. Proteomic insights into Helcococcus kunzii in a diabetic foot ulcer-like environment. Proteom Clin Appl 2023. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/prca.202200069\u003c/span\u003e\u003cspan address=\"10.1002/prca.202200069\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSotto A, Lina G, Richard JL, Combescure C, Bourg G, Vidal L, et al. Virulence Potential of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Strains Isolated From Diabetic Foot Ulcers: A new paradigm. Diabetes Care. 2008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2337/dc08-1010\u003c/span\u003e\u003cspan address=\"10.2337/dc08-1010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePouget C, Dunyach-Remy C, Bernardi T, Provot C, Tasse J, Sotto A, et al. A Relevant Wound-Like in vitro Media to Study Bacterial Cooperation and Biofilm in Chronic Wounds. Front Microbiol. 2022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2022.705479\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2022.705479\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWessel D, Fl\u0026uuml;gge UI. A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal Biochem. 1984. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0003-2697(84)90782-6\u003c/span\u003e\u003cspan address=\"10.1016/0003-2697(84)90782-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamsey MM, Freire MO, Gabrilska RA, Rumbaugh KP, Lemon KP. \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Shifts toward Commensalism in Response to \u003cem\u003eCorynebacterium\u003c/em\u003e Species. Front. Microbiol. 2016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2016.01230\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2016.01230\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePouget C, Gustave CA, Ngba-Essebe C, Laurent F, Lemichez E, Tristan A, et al. Adaptation of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e in a Medium Mimicking a Diabetic Foot Environment. Toxins. 2021. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/toxins13030230\u003c/span\u003e\u003cspan address=\"10.3390/toxins13030230\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarzoni C, Francois P, Huyghe A, Couzinet S, Tapparel C, Charbonnier Y, et al. A global view of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e whole genome expression upon internalization in human epithelial cells. BMC Genomics. 2007. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1471-2164-8-171\u003c/span\u003e\u003cspan address=\"10.1186/1471-2164-8-171\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLabandeira-Rey M, Couzon F, Boisset S, Brown EL, Bes M, Benito Y et al. Staphylococcus aureus Panton-Valentine Leukocidin Causes Necrotizing Pneumonia. Science. 2007. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.1137165\u003c/span\u003e\u003cspan address=\"10.1126/science.1137165\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSihto HM, Tasara T, Stephan R, Johler S. Validation of reference genes for normalization of qPCR mRNA expression levels in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e exposed to osmotic and lactic acid stress conditions encountered during food production and preservation. FEMS Microbiol Lett. 2014. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/1574-6968.12491\u003c/span\u003e\u003cspan address=\"10.1111/1574-6968.12491\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2\u0026thinsp;\u0026ndash;\u0026thinsp;∆∆CT Method. Methods. 2001. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/meth.2001.1262\u003c/span\u003e\u003cspan address=\"10.1006/meth.2001.1262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMagnan C, Ahmad-Mansour N, Pouget C, Morsli M, Huc-Brandt S, Pantel A, et al. Phenotypic and Genotypic Virulence Characterisation of \u003cem\u003eStaphylococcus pettenkoferi\u003c/em\u003e Strains Isolated from Human Bloodstream and Diabetic Foot Infections. Int J Mol Sci. 2022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms232415476\u003c/span\u003e\u003cspan address=\"10.3390/ijms232415476\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL\u0026ecirc; S, Josse J, Husson F, FactoMineR. A Package for Multivariate Analysis. J Stat Softw. 2008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18637/jss.v025.i01\u003c/span\u003e\u003cspan address=\"10.18637/jss.v025.i01\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeijun L. Pathview: an R/Bioconductor package for pathway-based data integration and visualization. Bioinformatics. 2013. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bioinformatics/btt285\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btt285\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu Z, Eils R, Schlesner M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics. 2016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bioinformatics/btw313\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btw313\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKassambara A, Mundt F. \u003cem\u003eFactoextra: Extract and Visualize the Results of Multivariate Data Analyses\u003c/em\u003e. 2020. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://CRAN.Rproject.org/package=factoextra\u003c/span\u003e\u003cspan address=\"https://CRAN.Rproject.org/package=factoextra\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCore Team R. \u003cem\u003eR: A Language and Environment for Statistical Computing\u003c/em\u003e. Vienna, Austria: R Foundation for Statistical Computing. 2021. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.R-project.org/\u003c/span\u003e\u003cspan address=\"https://www.R-project.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, et al. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat Methods. 2016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nmeth.3901\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.3901\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoradia VM, Raje M, Raje CI. Protein moonlighting in iron metabolism: glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Biochem Soc Trans. 2014. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/BST20140220\u003c/span\u003e\u003cspan address=\"10.1042/BST20140220\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIwase T, Uehara Y, Shinji H, Tajima A, Seo H, Takada K, et al. \u003cem\u003eStaphylococcus epidermidis\u003c/em\u003e Esp inhibits \u003cem\u003eStaphylococcus aureus\u003c/em\u003e biofilm formation and nasal colonization. Nature. 2010. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature09074\u003c/span\u003e\u003cspan address=\"10.1038/nature09074\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRichardson AR, Virulence. Metabolism Microbiol Spectr. 2019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/microbiolspec.GPP3-0011-2018\u003c/span\u003e\u003cspan address=\"10.1128/microbiolspec.GPP3-0011-2018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorfeldt E, Taylor D, von Gabain A, Arvidson S. Activation of alpha-toxin translation in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e by the trans-encoded antisense RNA, RNAIII. EMBO J. 1995. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/j.1460-2075.1995.tb00136.x\u003c/span\u003e\u003cspan address=\"10.1002/j.1460-2075.1995.tb00136.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManna AC, Cheung AL. Expression of SarX, a Negative Regulator of agr and Exoprotein Synthesis, Is Activated by MgrA in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. J Bacteriol. 2006. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JB.00297-06\u003c/span\u003e\u003cspan address=\"10.1128/JB.00297-06\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMajerczyk CD, Sadykov MR, Luong TT, Lee C, Somerville GA, Sonenshein AL. \u003cem\u003eStaphylococcu\u003c/em\u003es \u003cem\u003eaureus\u003c/em\u003e CodY Negatively Regulates Virulence Gene Expression. J Bacteriol. 2008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JB.01545-07\u003c/span\u003e\u003cspan address=\"10.1128/JB.01545-07\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReyes D, Andrey DO, Monod A, Kelley WL, Zhang G, Cheung AL. Coordinated Regulation by AgrA, SarA, and SarR To Control \u003cem\u003eagr\u003c/em\u003e Expression in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. J Bacteriol. 2011. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JB.05436-11\u003c/span\u003e\u003cspan address=\"10.1128/JB.05436-11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown JS, Holden DW. Iron acquisition by Gram-positive bacterial pathogens. Microbes Infect. 2002. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S1286-4579(02)01640-4\u003c/span\u003e\u003cspan address=\"10.1016/S1286-4579(02)01640-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeasley FC, Marolda CL, Cheung J, Buac S, Heinrichs DE. Staphylococcus \u003cem\u003eaureus\u003c/em\u003e Transporters Hts, Sir, and Sst Capture Iron Liberated from Human Transferrin by Staphyloferrin A, Staphyloferrin B, and Catecholamine Stress Hormones, Respectively, and Contribute to Virulence. Infect. Immun. 2011. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/IAI.00117-11\u003c/span\u003e\u003cspan address=\"10.1128/IAI.00117-11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRagsdale SW. (1991). Enzymology of the Acetyl-CoA Pathway of CO2 Fixation. Crit Rev Biochem Mol Biol. 1991. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3109/10409239109114070\u003c/span\u003e\u003cspan address=\"10.3109/10409239109114070\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalushko AS, Schink B. Oxidation of acetate through reactions of the citric acid cycle by \u003cem\u003eGeobacter sulfurreducen\u003c/em\u003es in pure culture and in syntrophic coculture. Arch Microbiol. 2000. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s002030000208\u003c/span\u003e\u003cspan address=\"10.1007/s002030000208\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu GY, Essex A, Buchanan JT, Datta V, Hoffman HM, Bastian JF, et al. \u003cem\u003eStaphylococcus aureus\u003c/em\u003e golden pigment impairs neutrophil killing and promotes virulence through its antioxidant activity. J Exp Med. 2005. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1084/jem.20050846\u003c/span\u003e\u003cspan address=\"10.1084/jem.20050846\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue L, Chen YY, Yan, Lu W, Wan D, Zhu H. Staphyloxanthin: a potential target for antivirulence therapy. Infect Drug Resist. 2019;12:2151\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/IDR.S193649\u003c/span\u003e\u003cspan address=\"10.2147/IDR.S193649\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFilkins LM, Graber JA, Olson DG, Dolben EL, Lynd LR, Bhuju S, et al. Coculture of Staphylococcus \u003cem\u003eaureus\u003c/em\u003e with \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e Drives S. \u003cem\u003eaureus\u003c/em\u003e towards Fermentative Metabolism and Reduced Viability in a Cystic Fibrosis Model. J Bacteriol. 2015. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JB.00059-15\u003c/span\u003e\u003cspan address=\"10.1128/JB.00059-15\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL\u0026oacute;pez D, Vlamakis H, Kolter R, Biofilms. Cold Spring Harb Perspect Biol. 2010. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/cshperspect.a000398\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a000398\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeLeon S, Clinton A, Fowler H, Everett J, Horswill AR, Rumbaugh KP. Synergistic Interactions of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e and \u003cem\u003eStaphylococcus aureus\u003c/em\u003e in an In Vitro Wound Model. Infect Immun. 2014. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/IAI.02198-14\u003c/span\u003e\u003cspan address=\"10.1128/IAI.02198-14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamsey MM, Freire MO, Gabrilska RA, Rumbaugh KP, Lemon KP. \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Shifts toward Commensalism in Response to \u003cem\u003eCorynebacterium\u003c/em\u003e Species. Front. Microbiol. 2016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2016.01230\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2016.01230\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAntikainen J, Kupannen V, L\u0026auml;hteenm\u0026auml;ki K, Korhone TK. pH-Dependent Association of Enolase and Glyceraldehyde-3-Phosphate Dehydrogenase of \u003cem\u003eLactobacillus crispatus\u003c/em\u003e with the Cell Wall and Lipoteichoic Acids. J Bacteriol. 2007. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JB.00378-07\u003c/span\u003e\u003cspan address=\"10.1128/JB.00378-07\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOng JS, Taylor TD, Wong CB, Khoo BY, Sasidharan S, Choi SB, et al. Extracellular transglycosylase and glyceraldehyde-3-phosphate dehydrogenase attributed to the anti-staphylococcal activity of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e USM8613. J Biotechnol. 2019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jbiotec.2019.05.006\u003c/span\u003e\u003cspan address=\"10.1016/j.jbiotec.2019.05.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSugimoto S, Iwamoto T, Takada K, Okuda K, Tajima A, Iwase T, et al. \u003cem\u003eStaphylococcus epidermidis\u003c/em\u003e Esp Degrades Specific Proteins Associated with \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Biofilm Formation and Host-Pathogen Interaction. J Bacteriol. 2013. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JB.01672-12\u003c/span\u003e\u003cspan address=\"10.1128/JB.01672-12\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatilla MA, Ortega \u0026Aacute;, Krell T. The role of solute binding proteins in signal transduction. Comput Struct Biotechnol J. 2021. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.csbj.2021.03.029\u003c/span\u003e\u003cspan address=\"10.1016/j.csbj.2021.03.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTuchscherr L, Bischoff M, Lattar SM, Llana MN, Pf\u0026ouml;rtner H, Niemann S, et al. Sigma Factor SigB Is Crucial to Mediate \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Adaptation during Chronic Infections. PLOS Pathog. 2015. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.ppat.1004870\u003c/span\u003e\u003cspan address=\"10.1371/journal.ppat.1004870\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBischoff M, Dunman P, Kormanec J, Macapagal D, Murphy E, Mounts W, et al. Microarray-Based Analysis of the \u003cem\u003eStaphylococcus aureus\u003c/em\u003e σB Regulon. J Bacteriol. 2004. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JB.186.13.4085-4099.2004\u003c/span\u003e\u003cspan address=\"10.1128/JB.186.13.4085-4099.2004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJunecko JM, Zielinska AK, Mrak LN, Ryan DC, Graham JW, Smeltzer MS, et al. Transcribing virulence in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. World J Clin Infect Dis. 2012. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5495/wjcid.v2.i4.63\u003c/span\u003e\u003cspan address=\"10.5495/wjcid.v2.i4.63\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRachid S, Ohlsen K, Wallner U, Hacker J, Hecker M, Ziebuhr W. Alternative Transcription Factor ςB Is Involved in Regulation of Biofilm Expression in a \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Mucosal Isolate. J Bacteriol. 2000. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JB.182.23.6824-6826.2000\u003c/span\u003e\u003cspan address=\"10.1128/JB.182.23.6824-6826.2000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCampbell J, Singh AK, Swoboda JG, Gilmore MS, Wilkinson BJ. An Antibiotic That Inhibits a Late Step in Wall Teichoic Acid Biosynthesis Induces the Cell Wall Stress Stimulon in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. Antimicrob Agents Chemother. 2012. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AAC.05938-11\u003c/span\u003e\u003cspan address=\"10.1128/AAC.05938-11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeidenmaier C, Peschel A. Teichoic acids and related cell-wall glycopolymers in Gram-positive physiology and host interactions. Nat Rev Microbiol. 2008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrmicro1861\u003c/span\u003e\u003cspan address=\"10.1038/nrmicro1861\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia G, Peschel A. Toward the Pathway of \u003cem\u003eS. aureus\u003c/em\u003e WTA Biosynthesis. Chem Biol. 2008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.chembiol.2008.02.005\u003c/span\u003e\u003cspan address=\"10.1016/j.chembiol.2008.02.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue L, Chen YY, Yan Z, Lu W, Wan D, Zhu H. Staphyloxanthin: a potential target for antivirulence therapy. Infect Drug Resist. 2019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/IDR.S193649\u003c/span\u003e\u003cspan address=\"10.2147/IDR.S193649\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown JS, Holden DW. Iron acquisition by Gram-positive bacterial pathogens. Microbes Infect. 2002;4:1149\u0026ndash;56. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S1286-4579(02)01640-4\u003c/span\u003e\u003cspan address=\"10.1016/S1286-4579(02)01640-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson M, Sengupta M, Purves J, Tarrant E, Williams PH, Cockayne A, et al. Fur is required for the activation of virulence gene expression through the induction of the sae regulatory system in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. Int J Med Microbiol. 2011. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ijmm.2010.05.003\u003c/span\u003e\u003cspan address=\"10.1016/j.ijmm.2010.05.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLitwin CM, Calderwood SB. Role of iron in regulation of virulence genes. Clin Microbiol Rev 1993 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/CMR.6.2.137\u003c/span\u003e\u003cspan address=\"10.1128/CMR.6.2.137\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGross M, Cramton SE, G\u0026ouml;tz F, Peschel A. Key Role of Teichoic Acid Net Charge in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Colonization of Artificial Surfaces. Infect Immun. 2001;69:3423\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/IAI.69.5.3423-3426.2001\u003c/span\u003e\u003cspan address=\"10.1128/IAI.69.5.3423-3426.2001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZiebandt A-K, Kusch H, Degner M, Jaglitz S, Sibbald MJJB, Arends JP, et al. Proteomics uncovers extreme heterogeneity in the \u003cem\u003eStaphylococcus aureus\u003c/em\u003e exoproteome due to genomic plasticity and variant gene regulation. Proteomics. 2010;10:1634\u0026ndash;44. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/pmic.200900313\u003c/span\u003e\u003cspan address=\"10.1002/pmic.200900313\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuthukrishnan G, Quinn GA, Lamers RP, Diaz C, Cole AL, Chen S, et al. Exoproteome of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Reveals Putative Determinants of Nasal Carriage. J Proteome Res. 2011;10:2064\u0026ndash;78. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/pr200029r\u003c/span\u003e\u003cspan address=\"10.1021/pr200029r\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin MH, Li C, Shu JC, Chu HW, Liu CC, Wu CC. Exoproteome Profiling Reveals the Involvement of the Foldase PrsA in the Cell Surface Properties and Pathogenesis of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. Proteomics. 2018. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/pmic.201700195\u003c/span\u003e\u003cspan address=\"10.1002/pmic.201700195\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao X, Palma Medina LM, Stobernack T, Glasner C, de Jong A, Utari P et al. (2019). Exoproteome Heterogeneity among Closely Related \u003cem\u003eStaphylococcus aureus\u003c/em\u003e t437 Isolates and Possible Implications for Virulence. J Proteome Res. 2019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.jproteome.9b00179\u003c/span\u003e\u003cspan address=\"10.1021/acs.jproteome.9b00179\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerez-Riverol Y, Bai J, Bandla C, Hewapathirana S, Garc\u0026iacute;a-Seisdedos D, Kamatchinathan, et al. The PRIDE database resources in 2022: A Hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 2022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkab1038\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkab1038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"bacterial interactions, chronic wound, Helcococcus kunzii, Staphylococcus aureus, in vitro model, proteomic analysis (Min.5-Max. 8)","lastPublishedDoi":"10.21203/rs.3.rs-4435685/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4435685/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003e \u003cem\u003eStaphylococcus aureus\u003c/em\u003e is the predominant pathogen isolated in diabetic foot infections. Recently, the skin commensal bacterium \u003cem\u003eHelcococcus kunzii\u003c/em\u003e was found to modulate the virulence of this pathogen in an \u003cem\u003ein vivo\u003c/em\u003e model. This study aims to elucidate the molecular mechanisms underlying the interaction between these two bacterial species using a proteomic approach.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eOur results demonstrate that \u003cem\u003eH. kunzii\u003c/em\u003e can coexist and grow with \u003cem\u003eS. aureus\u003c/em\u003e in a Chronic Wound Media (CWM), mimicking an \u003cem\u003ein vitro\u003c/em\u003e chronic wound environment. We observed that the secreted proteome of \u003cem\u003eH. kunzii\u003c/em\u003e induced a transcriptional effect on \u003cem\u003eS. aureus\u003c/em\u003e virulence, leading to a decrease in the expression level of \u003cem\u003eagrA\u003c/em\u003e, a gene involved in quorum sensing. The observed effect may be attributed to specific proteins secreted by \u003cem\u003eH. kunzii\u003c/em\u003e including polysaccharide deacetylase, peptidoglycan DD-metalloendopeptidase, glyceraldehyde-3-phosphate dehydrogenase, trypsin-like peptidase and an extracellular solute-binding protein. These proteins potentially interact with the Agr system, affecting \u003cem\u003eS. aureus\u003c/em\u003e virulence. Additionally, the virulence of \u003cem\u003eS. aureus\u003c/em\u003e was notably impacted by alterations in iron-related pathways and components of cell wall architecture in the presence of \u003cem\u003eH. kunzii\u003c/em\u003e. Furthermore, the overall metabolism of \u003cem\u003eS. aureus\u003c/em\u003e was reduced when cocultured with \u003cem\u003eH. kunzii\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eFuture investigations will focus on elucidating the role of these excreted factors in modulating virulence.\u003c/p\u003e","manuscriptTitle":"Interactions between Helcococcus kunzii and Staphylococcus aureus: How a commensal bacterium modulates the virulence and metabolism of a pathogen in a chronic wound in vitro model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-03 16:17:13","doi":"10.21203/rs.3.rs-4435685/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-16T21:44:16+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-11T14:43:33+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-03T16:00:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"33590981561629862170569020029446217683","date":"2024-06-30T14:34:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"220944776417487382803893902984300441209","date":"2024-06-19T19:12:48+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-19T19:03:19+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-06-17T14:13:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-14T15:05:36+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-14T15:04:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Microbiology","date":"2024-05-17T09:27:13+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"81e35e3f-e2d7-4b9e-a8b9-3d351d80fd0a","owner":[],"postedDate":"July 3rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-10-14T16:04:40+00:00","versionOfRecord":{"articleIdentity":"rs-4435685","link":"https://doi.org/10.1186/s12866-024-03520-0","journal":{"identity":"bmc-microbiology","isVorOnly":false,"title":"BMC Microbiology"},"publishedOn":"2024-10-11 15:57:18","publishedOnDateReadable":"October 11th, 2024"},"versionCreatedAt":"2024-07-03 16:17:13","video":"","vorDoi":"10.1186/s12866-024-03520-0","vorDoiUrl":"https://doi.org/10.1186/s12866-024-03520-0","workflowStages":[]},"version":"v1","identity":"rs-4435685","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4435685","identity":"rs-4435685","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.