Supplementation with Aspergillus oryzae decreases intestinal and fecal methane emissions and affects the production performance of beef cattle

preprint OA: closed
Full text JSON View at publisher
Full text 142,007 characters · extracted from preprint-html · click to expand
Supplementation with Aspergillus oryzae decreases intestinal and fecal methane emissions and affects the production performance of beef cattle | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Supplementation with Aspergillus oryzae decreases intestinal and fecal methane emissions and affects the production performance of beef cattle Hongrui Zhang, Kaijia Sun, Tong Fu, Liyang Zhang, Hongxia Lian, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4484300/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract This study aimed to assess the impact of Aspergillus oryzae supplementation on CH 4 emissions and the production performance of beef cattle. Sixteen healthy Simmental crossbred steers (552.38 ± 35.48 kg) were randomly assigned to either a control group (CG, basal diet) or an A. oryzae group (AO, basal diet + 6 g A. oryzae per head daily). CH 4 emissions from enteric fermentation and manure, production performance, nutrient and energy digestibility, rumen fermentation parameters, and microbial populations were evaluated. The results showed that A. oryzae supplementation did not significantly affect average daily gain (ADG) or dry matter intake (DMI), though ADG increased by 11.11%. The AO group exhibited a 36.41% increase in apparent NDF digestibility ( P < 0.05), a significant reduction in ammonia-N ( P < 0.05), and elevated rumen fungi and Butyrivibrio fibrisolvens populations while reducing protozoa and methanogens ; CH 4 emissions from enteric fermentation and manure decreased by 18.78% ( P < 0.05) and 56.55%, respectively. In summary, supplementation with A. oryzae effectively lowers CH 4 emissions both enteric fermentation and manure without compromising beef cattle production performance. Aspergillus oryzae Intestinal Fecal Methane Emission Beef Cattle Figures Figure 1 Introduction Livestock plays a crucial social and economic role, yet it significantly contributes to greenhouse gas (GHG) emissions, particularly through enteric and manure methane (CH 4 ) emissions (Arango et al., 2020 ; Congio et al., 2021 ). Ruminants are responsible for 56% of global agricultural GHG emissions and 93% of livestock emissions, thereby impacting global warming (Watts et al., 2021 ). Although CH 4 is a potent, short-lived GHG, mitigating its emissions is vital for short-term climate change control (Arango et al., 2020 ; Arndt et al., 2021 ). The UNFCCC Paris Agreement (2015) outlines 17 sustainable development goals (SDGs), addressing food security, poverty alleviation, and climate action. However, it is crucial that climate change mitigation does not impede efforts to eradicate poverty and hunger (Arango et al., 2020 ; Arndt et al., 2021 ). Thus, strategies to reduce CH 4 emissions must be developed without compromising livestock productivity. Reducing CH 4 emissions from ruminants is a pressing issue. Incorporating enzyme feed additives can enhance rumen fiber digestibility and ruminant productivity while curbing enteric CH 4 emissions (Boadi et al., 2004 ; Beauchemin et al., 2008 ; Beauchemin et al., 2020 ). Aspergillus oryzae has been approved by the US FAD as a safe enzyme feed additive (Tada et al., 2015 ; Zhu et al., 2020 ; Bampidis et al., 2022 ). This aerobic culture produces various polysaccharide-degrading enzymes, including cellulases, hemicellulases, esterases, and amylases, and is present in the rumen (Di Francia et al., 2008 ). Both in vitro and in vivo studies indicate that A. oryzae modifies rumen fermentation patterns, promotes rumen microbial growth, and enhances ruminant performance (Wiedmeier et al., 1987 ; Frumholtz et al., 1989 ; Yoon and Stern, 1996 ; Di Francia et al., 2008 ). However, its impact on CH 4 emissions is underexplored, prompting this study. This experiment aims to assess the effect of A. oryzae on reducing rumen and fecal CH 4 emissions in beef cattle, alongside examining its influence on diet digestibility, ruminal fermentation, and overall production performance. Materials and methods Animal care All animal experiments received approval from the Animal Ethics Committee of Henan Agricultural University, Zhengzhou, China (Approval NO. 2019-003-35). Experimental design The study was executed at Henan Agricultural University’s cattle farm from April to July and encompassed feeding and manure CH 4 emission trials, each divided into two cohorts. The feeding trail spanned 38 days: days 1–25 were for acclimatization, days 26–30 for enteric CH 4 measurement, days 31–37 for feed intake and digestion/ metabolism assessments, and day 38 for rumen fluid sampling. The manure CH 4 emission trial extended over 45 days, with manure collected from days 29–35 in both cattle groups. Seven-day manure samples from each group were mixed, homogenized, and divided into three uniform piles (80 cm length, 80 cm width, 10 cm height) stored on an outdoor cement surface. Methane emissions were gauged daily from days 0–9, and every other day from days 10–45. Throughout the manure CH 4 emission trial, ambient air temperature was recorded every 5 minutes using an automatic temperature logger (L91-1, Hangzhou Logger Technology Co., Ltd., China). Animals, diets and management Sixteen healthy Simmental crossbred bulls (initial weight 552.38 ± 35.48 kg) were randomly divided into two groups of 8 heads each. The control group (CG, initial average weight 551.00 kg) received a basal diet, while the A. oryzae group (AO, initial average weight 553.75 kg) received the same basal diet supplemented with 6 g of A. oryzae (Yiyuan Kangyuan Biotechnology Co., Ltd., China). All cattle were fed with a total mixed ration (TMR) provided at 05:00 and 17:00, and had unrestricted access to fresh water. The TMR had a concentrate-to-roughage ratio of 40:60 and was composed of 31.49% whole maize silage, 28.19% peanut hay, and 40.32% concentrate (on a dry matter basis). The concentrate mix included 50% corn, 5% wheat bran, 9.5% soybean meal, 10% peanut meal, 12% distillers dried grains with solubles, and additives such as NaCl, NaHCO 3 , limestone powder, Ca(HCO 3 ) 2 and a premix. The premix per kg of DM contained 2500 mg Fe, 2000 mg Mn, 600 mg Cu, 1667 mg Zn, 2500 IU VE, 500000 IU VA, 50000 IU VD, and 500 IU VH. Measurement methods Average daily gain and dry matter intake Animals were weighed using a Kunshan Lightever electronic scale (Jiangsu Province, China) at the start and end of the feeding trial to determine average daily gain (ADG). Feed consumption and residuals were logged daily for each cow from days 31 to 37, allowing for the calculation of daily dry matter intake (DMI). The formulas used were: $$\text{A}\text{D}\text{G}=(\text{F}\text{i}\text{n}\text{a}\text{l} \text{w}\text{e}\text{i}\text{g}\text{h}\text{t}-\text{I}\text{n}\text{i}\text{t}\text{i}\text{a}\text{l} \text{w}\text{e}\text{i}\text{g}\text{h}\text{t})/\text{E}\text{x}\text{p}\text{e}\text{r}\text{i}\text{m}\text{e}\text{n}\text{t}\text{a}\text{l} \text{d}\text{a}\text{y}\text{s}$$ $$\text{D}\text{M}\text{I}=\text{D}\text{M} \text{o}\text{f}\text{f}\text{e}\text{r}\text{e}\text{d}-\text{D}\text{M} \text{r}\text{e}\text{f}\text{u}\text{s}\text{e}\text{d}$$ Digestibility of nutrients In the final week of the feeding trial, four cattle from cattle from each group were selected for total manure and urine collection to assess nutrient digestibility (Aerts et al., 1984 ; Soto-Navarro et al., 2014 ). The fecal collection apparatus was modified per Gorski et al.. Briefly, a urine collection bag was secured to the test cow with a rubber band, directing the urine into a collection bucket containing 200 mL of 10% sulfuric acid. Fresh weights of manure and urine were recorded daily, thoroughly mixed, and representative samples were collected for analysis. Five percent of the total urine was filtered through gauze and stored at -20 ℃ for subsequent testing. Four percent of the manure was weighed, mixed with tartaric (1/4 of the manure’s weight), and dried at 65 ℃. During the collection period, the weights of feed offered and refused were recorded, and samples were dried for chemical analysis. The diet, orts, manure, and urine were analyzed for DM, total nitrogen (TN), total organic carbon (TOC), neutral detergent fiber (NDF), acid detergent fiber (ADF), and gross energy (GE). DM was determined by drying samples in a forced-air oven at 105 ± 2℃ for 24 hours (George W. Latimer, 2016 ). TN was measured using a Kjeldahl method with a Kjeltec 2300 Analyzer Unit (Foss Tecator AB, Hillerød, Denmark) (George W. Latimer, 2016 ). TOC was determined by the thermal potassium dichromate oxidation-capacity method (Chadwick et al., 2011 ). NDF and ADF were analyzed by neutral and acid detergent extraction, respectively, using a fiber analyzer (ANKOM A200i fiber analyzer, ANKOM Technology Company, Fairport, NY, USA) (Senger et al., 2008 ). GE was measured with an adiabatic bomb calorimeter (ZDHW-9000A, Huanuo Electronic Technology, Hebei, China) and expressed as MJ/kg of DM. The apparent digestibility coefficient (ADC) of nutrients and energy was calculated according to the following equation (Zhang et al., 2018 ): Ruminal sampling, fermentation parameters, and microbial populations Rumen fluid samples (100 mL) were collected on the final day of the feeding trial, 6 hours post-morning feeding, using a rumen stomach tube connected to a vacuum pump (Zhejiang World Electromechanical Products Co., Ltd., Zhejiang, China). Five milliliters of these samples were immediately frozen and stored in liquid nitrogen for microbiome analysis. The pH of a portion of the remaining rumen fluid was measured within 5 minutes using a pH meter (Metter Toledo instrument Shanghai Co. Ltd., China). Another portion was filtered through four layers of gauze, placed in a 50 mL centrifuge tube, and stored at -20℃ for later analysis of ammonia-N, microbial protein (MCP) and volatile fatty acids (VFAs). VFAs (acetic acid, propionic acid, and butyric acid) were quantified following Hoskin’s method using ion chromatography (Dionex ICS-3000, Dionex, Sunnyvale, USA) with an IonPac AS 11-HC separation column (4× 250 mm) and an IonPac AG 11-HC column (4× 50 mm). The column temperature was set at 30 o C, with a flow rate was 0.9 mL·min -1 , and an injection volume of 25 µL. Ammonia-N and MCP concentrations were determined using the methods of Chaney et al. and Makkar et al. . The populations of total bacteria , methanogens , fungi , protozoa , Fibrobacter succinogenes , Ruminococcus flavefaciens , Ruminococcus albus , and Butyrivibrio fibrisolvens were quantified via real-time absolute quantitative PCR. Total microbial DNA was extracted from rumen fluid, ligated into a pMD 18-T vector to construct recombinant plasmids, and transfected into Escherichia coli. Positive colonies were identified via ampicillin screening, direct PCR, and DNA sequencing. Plasmid DNA from positive clones was purified, and its concentration was measured spectrophotometrically. These plasmid DNA serial dilutions served as standards for plotting standard curves for each species. Primers for PCR are listed in Table 1 . The PCR reaction mixture (20 µL total volume) included 0.5 µmoL/L forward and reverse primers, 10 µL 2× SybrGreen qPCR Master Mix (Roche Molecular Biochemicals), 6 µL ddH 2 O, and 2 µL DNA template. Cycling conditions were: initial denaturation at 95℃ for 3 minutes, followed by 40 cycles at 95℃ for 15 seconds, 57℃ for 20 seconds, and 72℃ for 30 seconds. This was followed by a melting curve analysis (65–95℃ with a heating rate of 0.1℃ per second) and a finally a cooling step to 45℃. Light Cycler quantification software (v. 3.5, Roche Molecular Biochemicals) was used to compare experimental sample amplification during the log-linear phase with the standard curve. Copy number calculations followed the methods of Wanapat et al. and Kralik et al. Table 1 Oligonucleotide primers used in real-time PCR Species Forward primer Size (bp) Reference Total bacteria F- CGGCAACGAGCGCAACCC R- CCATTGTAGCACGTGTGTAGCC 145 Koike and Kobayashi ( 2001 ) Methanogens F- TTCGGTGGATCDCARAGRGC R- GBARGTCGWAWCCGTAGAATCC 160 Zhou et al. ( 2009 ) Fungi F-GAGGAAGTAAAAGTCGTAACAAGGTTTC R- CAAATTCACAAAGGGTAGGATGATT 120 Denman and McSweeney ( 2007 ) Protozoa F- GCTTTCGWTGGTAGTGTATT R- CTTGCCCTCYAATCGTWCT 234 Zhou et al. ( 2011 ) Fibrobacter succinogenes F- GTTCGGAATTACTGGGCGTAAA R - CGCCTGCCCCTGAACTATC 121 Denman and McSweeney ( 2007 ) Ruminococcus flavefaciens F-CGAACGGAGATAATTTGAGTTTACTTAGG R- CGGTCTCTGTATGTTATGAGGTATTACC 132 Denman and McSweeney ( 2007 ) Ruminobacter albus F-CCCTAA AAGCAGTCTTAGTTCG R- CCTCCTTGCGGTTAGAACA 175 Koike and Kobayashi ( 2001 ) Butyrivibrio fibrisolvens F-GAGGAAGTAAAAGTCGTAACAAGGTTTC R- CAAATTCACAAAGGGTAGGATGATT 110 Zhou et al. ( 2011 ) Gas collection and measurement Enteric CH 4 production was quantified using the SF6 tracer technique, following Johnson et al., in 4 cattle per group during the final 5 days of the feeding trail. One week prior to CH 4 collection, a brass permeation tube containing approximately 1.00 g of SF 6 with a specified release rate ( Table S1 and Table S2 ) was inserted into the rumen. Cattle were acclimated to a gas collection apparatus (halter, PVC yoke, capillary tube) after SF 6 tube insertion. Exhaled gases were collected into a pre-evacuated (-0.1– -0.08 MPa) PVC yoke via a 1.2-m capillary tube with a filer and flexible nosepiece. Samples were collected over five consecutive days, with background air samples collected daily using the same device. Post 24-hour collection, device pressure was checked for collection efficiency, then pressurized to 110 kPa with pure nitrogen (99.9999%). Mixed gases were transferred to collection bags with 24 hours for analysis. SF 6 concentrations were measured using gas chromatography (GC-4000A, East & West Analytical Instruments incorporated, Beijing, China) with an electron capture detector (ECD) and a Molecular Sieve 5A column (60–80 mesh). Conditions: column at 50 ℃, injector at 100 ℃, detector at 250 ℃, with high-purity nitrogen as the carrier gas at 35 mL/min flow rate. A 1.0 mL sample was manually injected per run. Calibration was performed using an SF 6 calibration gas (150 ng/L) at 101.325 kPa at the start and end of measurements. CH 4 percentage was calculated from chromatogram peak areas using the external standard method. Daily CH 4 production per animal was computed using the method outlined by Liu, with the following equation: $${\text{C}\text{H}}_{4}\left(\text{L}/\text{d}\right)={\text{S}\text{F}}_{6 }\text{p}\text{e}\text{r}\text{m}\text{e}\text{a}\text{t}\text{i}\text{o}\text{n} \text{r}\text{a}\text{t}\text{e} \left(\text{L}/\text{d}\right)\times \frac{{\text{C}}_{{\text{C}\text{H}}_{4}}}{{\text{C}}_{{\text{S}\text{F}}_{6}}}$$ where, L/d represents emission volume per day. The CH 4 emissions from stored beef cattle manure subjected to various treatments were quantified using the static chamber-GC method (Grau, 1995 ; Zhang et al., 2021 ). Gas samples were collected between 09:00 and 10:00, and CH 4 emissions were analyzed the same day via gas chromatography (GC) as per Zhang et al. CH 4 concentrations in the samples were determined using a GC-112A (Shanghai Suny Hengping Scientific Instrument Co., China) equipped with a flame ionization detector (FID) and a TP-porapak Q capillary column (15 m× 0.32 mm× 5 µm). The column, injector, and detector were maintained at 55 ℃, 150 ℃, and 200 ℃, respectively. Nitrogen (99.9999%) served as the carrier gas, with a flow rate of 10 mL/min and a purge time of 0.75 min. A 0.3 mL gas sample was manually injected for each run, and parallel injections were conducted. Instrument calibration was performed using a CH 4 calibration gas (20 ppm, 101.325 kPa) at the start and end of the measurements. CH 4 percentage in the samples was calculated from the chromatogram peak area using the external standard method. The CH 4 emission rates from the manure then calculated using the following equation (Sommer and MØLler, 2000 ): $$\text{F}={\rho }0\times \text{V}\times (\text{d}\text{c}/\text{d}\text{t})\times \left[273.15/\left(273.15+\text{T}\right)\right]\times \left(\text{P}/101.325\right)\times \left(1/\text{A}\right)$$ F (mg·m − 2 ·d − 1 ) represents the emission rate of CH 4 ; ρ 0 (0.717 kg/m 3 ) refers to the CH 4 density under standard conditions; V (m 3 ) refers to the volume of the headspace in the bucket; dc/dt represents the CH 4 concentration variance in the bucket; T (℃) represents the average gas temperature in the bucket during gas sampling; P refers to the atmospheric pressure during gas sampling; and A (m 2 ) is the area of the cattle manure in each bucket. Statistical analysis Cattle weight, ADG, DMI, ADC, CH 4 emissions, energy metabolism, and microbial populations were analyzed via independent samples t-test using SPSS 21.0 (USA) and reported as mean values. Significance was defined as P < 0.05; highly significant at P < 0.01; and trends at 0.05 ≤ P < 0.1. Results Production performance and dry matter intake Table 2 presents the ADG and DMI for both groups. The AO group exhibited an 11.11% and 0.94% increase in ADG and DMI, respectively, relative to the CG group, though the differences were statistically insignificant ( P > 0.05). Table 2 Average daily gain and dry matter intake of the experimental cattle (n = 8) Item 1) CG 2) AO 3) SEM 4) P -value Initial weight (kg) 551.00 553.75 27.08 0.922 Final weight (kg) 597.75 605.50 28.57 0.795 ADG (kg/d) 1.26 1.40 0.11 0.253 DMI (kg/d) 11.68 11.79 0.63 0.868 1) ADG = Average daily gain, DMI = dry matter intake. 2) CG = control group fed with basal diet. 3) AO = basal diet + 6 g A. oryzae per head per day. 4) SEM, standard error of the means. Apparent digestible coefficient of nutrition Table 3 presents the impact of A. oryzae on nutrient digestibility. The NDF digestibility in the AO group increased by 36.41% ( P 0.05). Table 3 The apparent digestible coefficient of nutrition of beef cattle (%, n = 4) Indices 1) CG 2) AO 3) SEM 4) P -value DM (%) 65.83 70.02 3.41 0.265 TN (%) 69.69 71.45 2.94 0.571 NDF (%) 40.49 55.22 4.45 0.016 ADF (%) 62.16 68.67 4.72 0.217 TOC (%) 71.00 73.15 2.19 0.366 1) DM = dry matter; TN = total nitrogen; NDF = neutral detergent fiber; ADF = Acid detergent fiber; TOC = Total organic carbon. 2) CG = control group fed with basal diet. 3) AO = basal diet + 6 g A. oryzae per head per day. 4) SEM, standard error of the means. Methane emission and energy metabolism The data on enteric CH 4 emissions and energy metabolism are detailed in Table 4 . Enteric CH4 emissions for the CG and AO groups were 418.90 and 340.24 L/d, respectively, with the AO group showing a significant reduction of 18.78% (P < 0.01) compared to the CG. CH4 emissions per unit body weight and per unit dry matter intake (DMI) in the AO group were reduced by 20% ( P < 0.01) and 19.40% ( P < 0.05), respectively, relative to the CG. The CH4-E (energy gaseous products of digestion, Eg) in the AO group was significantly lower than in the CG ( P < 0.01). There were no significant impacts of A. oryzae on gross energy (GE), fecal energy (FE), urinary energy (UE), apparent digestible energy (ADE), apparent metabolizable energy (AME), or the energy efficiency of GE and ADE in the experimental cattle ( P > 0.05). The CH4 proportion of GE was significantly reduced by 20.30% with the inclusion of A. oryzae in the diet ( P < 0.05). Table 4 Enteric methane emission production and energy metabolism of experimental cattle (n = 4) Indices CG 1) AO 2) SEM 3) P-value Methane (L/d) 418.90 340.24 14.55 0.002 The methane of BW (L/kg) 0.70 0.56 0.01 < 0.001 The methane of DMI (L/kg) 36.03 29.04 2.42 0.028 Input or output of energy (MJ/d) Gross energy (GE, MJ/d) 183.58 185.61 12.15 0.873 Energy in faces (FE, MJ/d) 56.53 54.38 5.64 0.717 Energy in urine (UE, MJ/d) 5.03 4.84 0.81 0.820 Energy gaseous products of digestion (Eg, MJ/d) 16.76 13.62 0.58 0.002 Apparent digestible energy (ADE, MJ/d) 127.05 131.23 11.67 0.733 Apparent metabolizable energy (AME, MJ/d) 105.26 112.78 11.28 0.530 Energy efficiency (%) ADE/GE (%) 68.93 70.73 3.22 0.598 AME/ADE (%) 82.46 85.94 1.68 0.083 Eg/GE (%) 9.21 7.34 0.52 0.11 1) CG = control group fed with basal diet. 2) AO = basal diet + 6 g A. oryzae per head per day. 3) SEM, standard error of the means. Manure methane emission Figure 1 illustrates the CH 4 emission rate from manure and the corresponding air temperature during storage. Throughout the storage period, the daily average air temperature exceeded 23 ℃. The CH 4 emission trends for the CG and AO groups aligned with storage duration, particularly within the initial 15 days. Thereafter, CH 4 emissions in the CG group surged significantly, exhibiting greater variability compared to the AO group. Effects of A. oryzae on rumen microbial populations and ruminal fermentation parameters Table 5 presents the impact of A. oryzae on NH3-N and VFAs in the rumen of beef cattle. The AO group exhibited a significant 13.72% reduction in ruminal ammonia-N compared to the CG group ( P < 0.05). Additionally, concentrations of acetate and butyrate in ruminal fluid were significantly elevated in the AO group ( P < 0.05). Table 5 Ruminal fermentation parameters (n = 8) Indices CG 1) AO 2) SEM 3) P -value pH 6.53 6.34 0.26 0.459 Ammonia-N (mg/L) 108.63 93.66 5.37 0.032 Microbial protein (g/L) 0.43 0.54 0.04 0.028 Acetate (mmol/L) 55.36 61.15 2.14 0.035 Propionate (mmol/L) 17.62 17.90 1.38 0.847 Butyrate (mmol/L) 10.00 11.78 0.51 0.013 Acetate/Propionate (%) 3.18 3.44 0.28 0.372 1) CG = control group fed with basal diet. 2) AO = basal diet + 6 g A. oryzae per head per day. 3) SEM, standard error of the means. According to Table 6 , the proportions of fungi and B. fibrisolvens increased by 43.88% and 60.67% respectively, upon A. oryzae supplementation ( P < 0.05). Conversely, Protozoa and methanogens decreased by 17.14% and 40.24% respectively ( P 0.05). Table 6 Microbial population of experimental cattle (‰ of total bacterial, n = 8) Indices CG 1) AO 2) SEM 3) P -value Fungi (×10 − 3 , ‰) 6.45 9.28 1.06 0.038 Protozoa (×10 − 4 , ‰) 7.70 6.36 0.54 0.048 Methanogens (‰) 0.82 0.49 0.01 0.027 Fibrobacter succinogenes (‰) 2.19 2.04 0.42 0.731 Ruminococcus flavefaciens (‰) 0.22 0.18 0.05 0.399 Ruminobacter albus (‰) 0.15 0.11 0.03 0.216 Butyrivibrio fibrisolvens (×10 − 3 , ‰) 7.45 11.97 1.57 0.029 1) CG = control group fed with basal diet. 2) AO = basal diet + 6 g A. oryzae per head per day 3) SEM, standard error of the means. Discussion The rumen, a distinguishing feature of ruminants, is integral to their health, productivity, and nutrient digestion. Ammonia-N, microbial crude protein (MCP), and volatile fatty acids (VFAs) are key indicators of ruminal fermentation, reflecting microbial activity. Rumen ammonia concentration serves as a proxy for the equilibrium between feed protein degradation and microbial protein synthesis. Most rumen bacteria depend on ammonia-N for nitrogen (Salter et al., 1979 ; Bach et al., 2005 ). Optimizing ruminant protein systems involves maximizing ammonia conversion to microbial protein and minimizing ammonia loss via absorption. This study found that dietary supplementation with A. oryzae reduced ammonia-N levels and increased MCP in beef cattle, indicating enhanced microbial growth. Additionally, protozoa , which are net producers of ammonia-N due to their inability to synthesize amino acids from ammonia-N, decreased by 17.14% with A. oryzae supplementation, contributing to the reduction in ammonia-N. Ruminants primarily obtain energy from cellulose, hemicellulose, and starch, which are decomposed by rumen microorganisms into glucose, fructose, and xylose, subsequently converted into pyruvate via glycolysis. Pyruvate is then transformed into volatile fatty acids (VFAs), with over 95% being acetic, propionic, and butyric acids (Newbold and Ramos-Morales, 2020 ). In this study, acetate and butyrate levels were elevated in the AO group compared to the CG group, likely due to the significantly higher NDF digestibility observed in the AO group. Cellulose degradation is intrinsically linked to the abundance of cellulolytic bacteria and fungi. Unlike rumen bacteria, which only degrade the plant's peripheral tissues, rumen fungi can extensively degrade thick-walled plant tissues by penetrating the cuticle and utilizing enzymes to break down the cell wall. Sun et al. demonstrated that A. oryzae culture supplementation significantly increased the relative proportion of rumen fungi . In our study, the populations of fungi and B. fibrisolvens were enhanced by 43.88% and 60.67%, respectively, following A. oryzae addition, indicating that A. oryzae supplementation may enhance feed fiber degradation by increasing the populations of these microorganisms. A minor fraction of acetate in the rumen might have been absorbed by the rumen epithelium, converted to ketones, and predominantly transported to the liver via the portal vein, with 80% entering peripheral circulation (Tokura et al., 1997 ). The majority of blood-borne acetic acid absorbed by tissues is oxidized, fueling the tricarboxylic acid cycle or serving as a precursor for fatty acid synthesis. Elevated acetate and butyrate levels in the AO group compared to the CG group suggest that A. oryzae supplementation enhances energy absorption in beef cattle. Methane production in ruminants is considered an energy loss. The AO group exhibited lower CH4-E (Eg) levels and a 11.11% increase in ADG compared to the CG group. These findings indicate that A. oryzae supplementation can potentially enhance beef cattle production performance by optimizing energy utilization. CH 4 arises naturally from anaerobic respiration and acts as the primary electron sink in the rumen (Beauchemin et al., 2008 ). Methanogens , which convert CO 2 to H 2 , are the principal producers of ruminal CH 4 , closely associated with protozoa that generate hydrogen and formate (Stumm et al., 1982 ). A single ruminal protozoan can produce up to 5 nmol of hydrogen daily (Lopez et al., 1999 ). Methanogens frequently inhabit the outer surfaces of ruminal ciliate protozoa and utilize hydrogen from these protozoa to reduce carbon dioxide, producing CH 4 (Stumm et al., 1982 ). Reducing protozoa populations correlates with a decrease in methanogens, thus lowering CH 4 emissions. (VanderZaag et al., 2011 ). Frumholtz et al. reported that supplementing A. oryzae in vitro reduced protozoa in sheep rumen fluid by nearly 45%, significantly decreasing CH 4 levels.. The study aligns with these findings, showing that adding A. oryzae to beef cattle diets significantly reduced protozoan and methanogen counts and CH 4 production.. In the absence of methanogens , acetogenic bacteria can utilize H 2 and CO 2 to produce acetate without generating CH 4 . (Baral et al., 2018 ). This suggests A. oryzae significantly influences intracellular hydrogen transfer pathways in the rumen. Furthermore, the decline in protozoa likely led to increased fungal numbers in the AO group, as reduced protozoan predation allowed more bacterial flora to thrive. This shift in fungal populations may partly explain the reduction in CH 4 following the introduction of A. oryzae into the rumen. Manure CH 4 emissions are influenced by the degradable organic matter content and anaerobic conditions from manure accumulation (Koike and Kobayashi, 2001 ; Zhou et al., 2009 ). The primary degradable organic components in feces are fiber and starch, which remain undigested in the rumen and intestines. This study found a significantly higher apparent NDF digestibility in the AO group compared to the CG group, suggesting a lower cellulose content in AO group manure. Rumen protozoa , primarily ciliates, utilize plant cellulose and starch directly and consume rumen bacteria, thereby reducing the bacterial starch digestion rate. Furthermore, B. fibrisolvens inhibits starch-degrading enzymes (Denman and McSweeney, 2007 ). In this experiment, the AO group had significantly higher total bacterial and B. fibrisolvens counts, while protozoa numbers were lower compared to the CG group. This indicates that A. oryzae supplementation enhances starch digestion and absorption in beef cattle. Consequently, the AO group's manure had lower degradable organic matter (fiber and starch) and reduced CH 4 emissions compared to the CG group's manure. Conclusion Supplementing A. oryzae in the diet of beef cattle led to a reduction in enteric and manure CH 4 emissions by modulating rumen microbial populations, altering fermentation dynamics, and enhancing the apparent digestibility of NDF. This intervention has the potential to improve the production performance of beef cattle and could serve as an effective CH 4 mitigation strategy in livestock production. Declarations Ethics approval All experimental procedures in this study adhered to Chinese regulations on the use and care of laboratory animals. The experimental protocol was approved by the Animal Care and Use Committee of Henan Agricultural University (Permit NO. 2020-003-35). Funding The authors extend their sincere appreciation to the Henan Agricultural University cattle farm staff for their technical support. This research was funded by the China Agriculture Research System (CARS-36). Data availability The primary data from this research can be accessed from the corresponding author upon justified request. Consent for publication The authors disclose no competing interests. References Aerts, J. V., De Boever, J. L., Cottyn, B. G., De Brabander, D. L., and Buysse, F. X. (1984). Comparative digestibility of feedstuffs by sheep and cows. Animal Feed Science and Technology 12(1):47-56. doi: https://doi.org/10.1016/0377-8401(84)90035-X Arango, J., Ruden, A., Martinez-Baron, D., Loboguerrero, A. M., Berndt, A., Chacón, M., Torres, C. F., Oyhantcabal, W., Gomez, C. A., Ricci, P., Ku-Vera, J., Burkart, S., Moorby, J. M., and Chirinda, N. (2020). Ambition meets reality: Achieving GHG emission reduction targets in the livestock sector of Latin America. Frontiers in Sustainable Food Systems 4(Perspective) doi: 10.3389/fsufs.2020.00065 Arndt, C., Hristov, A., Price, W., McClelland, S., Pelaez, A., Cueva, S., Oh, J., Bannink, A., Bayat, A., Crompton, L., Dijkstra, J., Eugène, M., Kebreab, E., Kreuzer, M., McGee, M., Martin, C., Newbold, C., Reynolds, C., Schwarm, A., and Yu, Z. (2021). Strategies to mitigate enteric methane emissions by ruminants -A way to approach the 2.0°C target. Bach, A., Calsamiglia, S., and Stern, M. (2005). Nitrogen metabolism in the rumen. Journal of Dairy Science 88 Suppl 1:E9-21. doi: 10.3168/jds.S0022-0302(05)73133-7 Bampidis, V., Azimonti, G., de Lourdes Bastos, M., Christensen, H., Dusemund, B., Fašmon Durjava, M., Kouba, M., López-Alonso, M., López Puente, S., Marcon, F., Mayo, B., Pechová, A., Petkova, M., Ramos, F., Sanz, Y., Edoardo Villa, R., Woutersen, R., Dierick, N., Prieto Maradona, M., Galobart, J., Pettenati, E., and Anguita, M. (2022). Safety of the fermentation product of Aspergillus oryzae NRRL 458 (Amaferm(®)) as a feed additive for dairy cows (Biozyme Inc.). European Food Safety Authority Journal 20(2):e06983. doi: 10.2903/j.efsa.2022.6983 Baral, K. R., Jégo, G., Amon, B., Bol, R., Chantigny, M. H., Olesen, J. E., and Petersen, S. O. (2018). Greenhouse gas emissions during storage of manure and digestates: Key role of methane for prediction and mitigation. Agricultural Systems 166:26-35. doi: https://doi.org/10.1016/j.agsy.2018.07.009 Beauchemin, K., Mo, K., O’Mara, F., and McAllister, T. (2008). Nutritional management for enteric methane abatement: A review. Australian Journal of Experimental Agriculture 48(2), 21-27. doi: 10.1071/EA07199 Beauchemin, K. A., Ungerfeld, E. M., Eckard, R. J., and Wang, M. (2020). Review: Fifty years of research on rumen methanogenesis: Lessons learned and future challenges for mitigation. Animal 14:s2-s16. doi: https://doi.org/10.1017/S1751731119003100 Boadi, D., Benchaar, C., Chiquette, J., Massé, D., and And, J. (2004). Mitigation strategies to reduce enteric methane emissions from dairy cows: Update review. Canadian Jouranl of Animal Science 84(3), 319-335. doi: 10.4141/A03-109 Chadwick, D., Sommer, S., Thorman, R., Fangueiro, D., Cardenas, L., Amon, B., and Misselbrook, T. (2011). Manure management: Implications for greenhouse gas emissions. Animal Feed Science and Technology 166-167:514-531. doi: https://doi.org/10.1016/j.anifeedsci.2011.04.036 Chaney, A. L., and Marbach, E. P. (1962). Modified reagents for determination of urea and ammonia. Clinical Chemistry 8(2):130-132. doi: 10.1093/clinchem/8.2.130 Congio, G., Bannink, A., Mayorga, O., Hristov, A., Jaurena, G., Gonda, H., Gere, J., Cerón Cucchi, M., Ortiz Chura, A., Tieri, M., Hernández, O., Ricci, P., Juliarena, M., Lombardi, B., Abdalla, A., Abdalla Filho, A., Berndt, A., Oliveira, P., Henrique, F., and Astigarraga, L. (2021). Enteric methane mitigation strategies for ruminant livestock systems in the Latin America and Caribbean region: A meta-analysis. Journal of Cleaner Production 312:127693. doi: 10.1016/j.jclepro.2021.127693 Denman, S., and McSweeney, C. (2007). Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiology Ecology 58:572-582. doi: 10.1111/j.1574-6941.2006.00190.x Di Francia, A., Masucci, F., Rosa, G., Varricchio, M. L., and Proto, V. (2008). Effects of Aspergillus oryzae extract and a Saccharomyces cerevisiae fermentation product on intake, body weight gain and digestibility in buffalo calves. Animal Feed Science and Technology 140:67-77. doi: 10.1016/j.anifeedsci.2007.02.010 Frumholtz, P. P., Newbold, C. J., and Wallace, R. J. (1989). Influence Of Aspergillus oryzae fermentation extract on the fermentation of a basal ration in the rumen simulation technique (Rusitec). The Journal of Agricultural Science 113(2):169-172. doi: 10.1017/S002185960008672X George W. Latimer, J. (2016). Official Methods of Analysis of Aoac International-20th Edition. AOAC International. Gorski, J., Blosser, T. H., Murdock, F. R., Hodgson, A. S., Soni, B. K., and Erb, R. E. (1957). A urine and faeces collecting apparatus for heifers and cows. Journal of Animal Science 16:9. Grau, A. (1995). A closed chamber technique for field measurement of gas exchange of forage canopies. New Zealand Journal of Agricultural Research 38(1):71-77. doi: 10.1080/00288233.1995.9513105 Hoskin, S. O., Stafford, K. J., and Barry, T. N. (1995). Digestion, rumen fermentation and chewing behaviour of red deer fed fresh chicory and perennial ryegrass. The Journal of Agricultural Science 124(2):289-295. doi: 10.1017/S0021859600072956 Johnson, K. A., Westberg, H. H., Michal, J., and Cossalman, M. W. (2007). The SF6 tracer technique: methane measurement from ruminants. p. 33-67. Koike, S., and Kobayashi, Y. (2001). Development and use of competitive PCR assays for the rumen cellulolytic bacteria: Fibrobacter succinogenes, Ruminococcus albus and Ruminococcus flavefaciens. FEMS Microbiology Letters 204(2):361-366. doi: https://doi.org/10.1016/S0378-1097(01)00428-1 Kralik, P., and Ricchi, M. (2017). A basic guide to real time PCR in microbial diagnostics: Definitions, parameters, and everything. Frontiers in Microbiology 8 doi: 10.3389/fmicb.2017.00108 Liu, C., Zhu, Z. P., Shang, B., Chen, Y. X., Guo, T. J., and Luo, Y. M. (2013). Long-term effects of ensiled cornstalk diet on methane emission, rumen fermentation, methanogenesis and weight gain in sheep. Small Ruminant Research 115(1):15-20. doi: https://doi.org/10.1016/j.smallrumres.2013.07.011 Lopez, S., McIntosh, F. M., Wallace, R. J., and Newbold, C. J. (1999). Effect of adding acetogenic bacteria on methane production by mixed rumen microorganisms. Animal Feed Science and Technology 78(1):1-9. doi: https://doi.org/10.1016/S0377-8401(98)00273-9 Makkar, H. P. S., Sharma, O. P., Dawra, R. K., and Negi, S. S. (1982). Simple determination of microbial protein in rumen liquor. Journal of Dairy Science 65(11):2170-2173. doi: https://doi.org/10.3168/jds.S0022-0302(82)82477-6 Newbold, C. J., and Ramos-Morales, E. (2020). Review: Ruminal microbiome and microbial metabolome: effects of diet and ruminant host. Animal 14:s78-s86. doi: https://doi.org/10.1017/S1751731119003252 Salter, D. N., Daneshvar, K., and Smith, R. H. (1979). The origin of nitrogen incorporated into compounds in the rumen bacteria of steers given protein- and urea-containing diets. British Journal of Nutrition 41(1):197-209. doi: 10.1079/BJN19790026 Senger, C. C. D., Kozloski, G. V., Bonnecarrère Sanchez, L. M., Mesquita, F. R., Alves, T. P., and Castagnino, D. S. (2008). Evaluation of autoclave procedures for fibre analysis in forage and concentrate feedstuffs. Animal Feed Science and Technology 146(1):169-174. doi: https://doi.org/10.1016/j.anifeedsci.2007.12.008 Sommer, S. G., and MØLler, H. B. (2000). Emission of greenhouse gases during composting of deep litter from pig production – effect of straw content. The Journal of Agricultural Science 134(3):327-335. doi: 10.1017/S0021859699007625 Soto-Navarro, S. A., Lopez, R., Sankey, C., Capitan, B. M., Holland, B. P., Balstad, L. A., and Krehbiel, C. R. (2014). Comparative digestibility by cattle versus sheep: Effect of forage quality1,2. Journal of Animal Science 92(4):1621-1629. doi: 10.2527/jas.2013-6740 Stumm, C. K., Gijzen, H. J., and Vogels, G. D. (1982). Association of methanogenic bacteria with ovine rumen ciliates. British Journal of Nutrition 47(1):95-99. doi: 10.1079/BJN19820013 Sun, H., Wu, Y. M., Wang, Y. M., Liu, J. X., and Myung, K. H. (2014). Effects of Aspergillus oryzae culture and 2-Hydroxy-4-(Methylthio)-butanoic acid on in vitro rumen fermentation and microbial populations between different roughage sources. Asian-Australasian Journal of Animal Sciences 27:1285 - 1292. Tada, S., Ohkuchi, H., Matsushita-Morita, M., Furukawa, I., Hattori, R., Suzuki, S., Kashiwagi, Y., and Kusumoto, K.-I. (2015). Telomere-mediated chromosomal truncation in Aspergillus oryzae. Journal of Bioscience and Bioengineering 119(1):43-46. doi: https://doi.org/10.1016/j.jbiosc.2014.06.011 Tokura, M., Ushida, K., Miyazaki, K., and Kojima, Y. (1997). Methanogens associated with rumen ciliates. FEMS Microbiology Ecology 22(2):137-143. doi: https://doi.org/10.1016/S0168-6496(96)00084-0 VanderZaag, A. C., Wagner-Riddle, C., Park, K. H., and Gordon, R. J. (2011). Methane emissions from stored liquid dairy manure in a cold climate. Animal Feed Science and Technology 166-167:581-589. doi: https://doi.org/10.1016/j.anifeedsci.2011.04.041 Wanapat, M., and Cherdthong, A. (2009). Use of real-time PCR technique in studying rumen cellulolytic bacteria population as affected by level of roughage in Swamp Buffalo. Current Microbiology 58(4):294-299. doi: 10.1007/s00284-008-9322-6 Watts, N., Amann, M., Arnell, N., Ayeb-Karlsson, S., Beagley, J., Belesova, K., Boykoff, M., Byass, P., Cai, W., Campbell-Lendrum, D., Capstick, S., Chambers, J., Coleman, S., Dalin, C., Daly, M., Dasandi, N., Dasgupta, S., Davies, M., Di Napoli, C., Dominguez-Salas, P., Drummond, P., Dubrow, R., Ebi, K. L., Eckelman, M., Ekins, P., Escobar, L. E., Georgeson, L., Golder, S., Grace, D., Graham, H., Haggar, P., Hamilton, I., Hartinger, S., Hess, J., Hsu, S. C., Hughes, N., Jankin Mikhaylov, S., Jimenez, M. P., Kelman, I., Kennard, H., Kiesewetter, G., Kinney, P. L., Kjellstrom, T., Kniveton, D., Lampard, P., Lemke, B., Liu, Y., Liu, Z., Lott, M., Lowe, R., Martinez-Urtaza, J., Maslin, M., McAllister, L., McGushin, A., McMichael, C., Milner, J., Moradi-Lakeh, M., Morrissey, K., Munzert, S., Murray, K. A., Neville, T., Nilsson, M., Sewe, M. O., Oreszczyn, T., Otto, M., Owfi, F., Pearman, O., Pencheon, D., Quinn, R., Rabbaniha, M., Robinson, E., Rocklöv, J., Romanello, M., Semenza, J. C., Sherman, J., Shi, L., Springmann, M., Tabatabaei, M., Taylor, J., Triñanes, J., Shumake-Guillemot, J., Vu, B., Wilkinson, P., Winning, M., Gong, P., Montgomery, H., and Costello, A. (2021). The 2020 report of The Lancet Countdown on health and climate change: responding to converging crises. Lancet (London, England) 397(10269):129-170. doi: 10.1016/s0140-6736(20)32290-x Wiedmeier, R. D., Arambel, M. J., and Walters, J. L. (1987). Effect of Yeast culture and Aspergillus oryzae fermentation extract on ruminal characteristics and nutrient digestibility1. Journal of Dairy Science 70(10):2063-2068. doi: https://doi.org/10.3168/jds.S0022-0302(87)80254-0 Yoon, I. K., and Stern, M. D. (1996). Effects of Saccharomyces cerevisiae and Aspergillus oryzae cultures on ruminal fermentation in dairy cows. Journal of Dairy Science 79(3):411-417. doi: https://doi.org/10.3168/jds.S0022-0302(96)76380-4 Zhang, C. Z., Sun, H. Z., Li, S. L., Sang, D., Zhang, C., Jin, L., Antonini, M., and Zhao, C. (2018). Effects of photoperiod on nutrient digestibility, hair follicle activity and cashmere quality in Inner Mongolia white cashmere goats. Asian-Australasian Journal of Animal Sciences 32:541 - 547. Zhang, H., Yang, G., Li, H., Wang, L., Fu, T., Li, G., and Gao, T. (2021). Effects of dietary supplementation with alpha-lipoic acid on apparent digestibility and serum metabolome alterations of sheep in summer. Tropical Animal Health and Production 53(5):505. doi: 10.1007/s11250-021-02917-7 Zhou, M., Hernandez Sanabria, E., and Guan, L. (2009). Assessment of the microbial ecology of ruminal methanogens in cattle with different feed efficiencies. Applied and Environmental Microbiology 75:6524-6533. doi: 10.1128/AEM.02815-08 Zhou, Y. Y., Mao, H. L., Jiang, F., Wang, J. K., Liu, J. X., and McSweeney, C. S. (2011). Inhibition of rumen methanogenesis by tea saponins with reference to fermentation pattern and microbial communities in Hu sheep. Animal Feed Science and Technology 166-167:93-100. doi: https://doi.org/10.1016/j.anifeedsci.2011.04.007 Zhu, J., Shurson, G. C., Whitacre, L., Ipharraguerre, I. R., and Urriola, P. E. (2020). 181 Effects of Aspergillus oryzae prebiotic on energy and nutrient digestibility of growing pigs. Journal of Animal Science 98(Supplement_3):80-80. doi: 10.1093/jas/skaa054.143 Supplementary Files TableS1andTableS2.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision with re-assessment 18 Jul, 2024 Reviewers agreed at journal 20 Jun, 2024 Reviewers invited by journal 20 Jun, 2024 Editor assigned by journal 29 May, 2024 First submitted to journal 27 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4484300","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":317029442,"identity":"5280522e-aa09-43ea-8063-436506497216","order_by":0,"name":"Hongrui Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIiWNgGAWjYBACAwglwcPPzP/xQUJFDfFa5CTbG4wNHpw5RrQWBmODMwfMJB+2MBPWYs7ee/h1ZZtFYsONhLSKxAY2Bv727gS8Wix7zqVZnm2TSGyckXDsRuIOGQaJM2c34HfYjRwzw0aglmaJxLYbiWfYGAwkconU0iaRzFaQ2MZMlBbjh0Atxjw8x9gYiNNy5owZY8M5CTkJ9h5miYQzx3gI++V4j/HHhrI6HvvDPIwff1TUyPG39+LXAgRsEsg8HkLKQYD5AzGqRsEoGAWjYAQDAFQYScqkU2AvAAAAAElFTkSuQmCC","orcid":"","institution":"Ningxia University","correspondingAuthor":true,"prefix":"","firstName":"Hongrui","middleName":"","lastName":"Zhang","suffix":""},{"id":317029443,"identity":"c1071e96-767b-4698-a992-7616cfa18285","order_by":1,"name":"Kaijia Sun","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Kaijia","middleName":"","lastName":"Sun","suffix":""},{"id":317029444,"identity":"67d1523d-a0d8-4f02-9e9e-6d2eae354702","order_by":2,"name":"Tong Fu","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Tong","middleName":"","lastName":"Fu","suffix":""},{"id":317029445,"identity":"889b0fce-2033-45bc-9cac-eb2bd8e318c9","order_by":3,"name":"Liyang Zhang","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Liyang","middleName":"","lastName":"Zhang","suffix":""},{"id":317029446,"identity":"4139d273-fc45-4c47-beab-ab115bdba32b","order_by":4,"name":"Hongxia Lian","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hongxia","middleName":"","lastName":"Lian","suffix":""},{"id":317029447,"identity":"3fae84e4-38b3-4064-999b-0b4b7033b435","order_by":5,"name":"Gaiying Li","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Gaiying","middleName":"","lastName":"Li","suffix":""},{"id":317029448,"identity":"a308729c-57c9-400e-83b5-93b03527e603","order_by":6,"name":"Tengyun Gao","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Tengyun","middleName":"","lastName":"Gao","suffix":""}],"badges":[],"createdAt":"2024-05-27 10:32:01","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4484300/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4484300/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60075063,"identity":"5a74cd9a-8a41-4402-bd94-3a596b427ea7","added_by":"auto","created_at":"2024-07-11 12:20:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":423265,"visible":true,"origin":"","legend":"\u003cp\u003eMethane emission rate of manure (n= 3)\u003c/p\u003e\n\u003cp\u003eA shows the daily CH\u003csub\u003e4\u003c/sub\u003e emission rate during the storage of manure, and B shows the average CH\u003csub\u003e4\u003c/sub\u003e emission rate during the storage period. CG means control group fed with basal diet; AO means fed a basal diet plus 6 g \u003cem\u003eA. oryzae \u003c/em\u003eper head per day.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4484300/v1/e8902ee5c0723b0841f2f897.png"},{"id":60075864,"identity":"3c766c1f-f00d-49d6-82d1-b251c41030ae","added_by":"auto","created_at":"2024-07-11 12:28:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1153833,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4484300/v1/94311eaa-7d05-4eab-9a11-b3e768b4f25c.pdf"},{"id":60074766,"identity":"7999d161-7f55-4bb7-854b-12713d1c0af8","added_by":"auto","created_at":"2024-07-11 12:12:20","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":18317,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1andTableS2.docx","url":"https://assets-eu.researchsquare.com/files/rs-4484300/v1/385f8d887c54a0bdd1c4e674.docx"}],"financialInterests":"","formattedTitle":"Supplementation with Aspergillus oryzae decreases intestinal and fecal methane emissions and affects the production performance of beef cattle","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLivestock plays a crucial social and economic role, yet it significantly contributes to greenhouse gas (GHG) emissions, particularly through enteric and manure methane (CH\u003csub\u003e4\u003c/sub\u003e) emissions (Arango et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Congio et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Ruminants are responsible for 56% of global agricultural GHG emissions and 93% of livestock emissions, thereby impacting global warming (Watts et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Although CH\u003csub\u003e4\u003c/sub\u003e is a potent, short-lived GHG, mitigating its emissions is vital for short-term climate change control (Arango et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Arndt et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The UNFCCC Paris Agreement (2015) outlines 17 sustainable development goals (SDGs), addressing food security, poverty alleviation, and climate action. However, it is crucial that climate change mitigation does not impede efforts to eradicate poverty and hunger (Arango et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Arndt et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Thus, strategies to reduce CH\u003csub\u003e4\u003c/sub\u003e emissions must be developed without compromising livestock productivity.\u003c/p\u003e \u003cp\u003eReducing CH\u003csub\u003e4\u003c/sub\u003e emissions from ruminants is a pressing issue. Incorporating enzyme feed additives can enhance rumen fiber digestibility and ruminant productivity while curbing enteric CH\u003csub\u003e4\u003c/sub\u003e emissions (Boadi et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Beauchemin et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Beauchemin et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). \u003cem\u003eAspergillus oryzae\u003c/em\u003e has been approved by the US FAD as a safe enzyme feed additive (Tada et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Zhu et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Bampidis et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This aerobic culture produces various polysaccharide-degrading enzymes, including cellulases, hemicellulases, esterases, and amylases, and is present in the rumen (Di Francia et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBoth in vitro and \u003cem\u003ein vivo\u003c/em\u003e studies indicate that \u003cem\u003eA. oryzae\u003c/em\u003e modifies rumen fermentation patterns, promotes rumen microbial growth, and enhances ruminant performance (Wiedmeier et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e1987\u003c/span\u003e; Frumholtz et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Yoon and Stern, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Di Francia et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). However, its impact on CH\u003csub\u003e4\u003c/sub\u003e emissions is underexplored, prompting this study. This experiment aims to assess the effect of \u003cem\u003eA. oryzae\u003c/em\u003e on reducing rumen and fecal CH\u003csub\u003e4\u003c/sub\u003e emissions in beef cattle, alongside examining its influence on diet digestibility, ruminal fermentation, and overall production performance.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\"\u003e\n \u003ch2\u003eAnimal care\u003c/h2\u003e\n \u003cp\u003eAll animal experiments received approval from the Animal Ethics Committee of Henan Agricultural University, Zhengzhou, China (Approval NO. 2019-003-35).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\"\u003e\n \u003ch2\u003eExperimental design\u003c/h2\u003e\n \u003cp\u003eThe study was executed at Henan Agricultural University\u0026rsquo;s cattle farm from April to July and encompassed feeding and manure CH\u003csub\u003e4\u003c/sub\u003e emission trials, each divided into two cohorts. The feeding trail spanned 38 days: days 1\u0026ndash;25 were for acclimatization, days 26\u0026ndash;30 for enteric CH\u003csub\u003e4\u003c/sub\u003e measurement, days 31\u0026ndash;37 for feed intake and digestion/ metabolism assessments, and day 38 for rumen fluid sampling. The manure CH\u003csub\u003e4\u003c/sub\u003e emission trial extended over 45 days, with manure collected from days 29\u0026ndash;35 in both cattle groups. Seven-day manure samples from each group were mixed, homogenized, and divided into three uniform piles (80 cm length, 80 cm width, 10 cm height) stored on an outdoor cement surface. Methane emissions were gauged daily from days 0\u0026ndash;9, and every other day from days 10\u0026ndash;45. Throughout the manure CH\u003csub\u003e4\u003c/sub\u003e emission trial, ambient air temperature was recorded every 5 minutes using an automatic temperature logger (L91-1, Hangzhou Logger Technology Co., Ltd., China).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\"\u003e\n \u003ch2\u003eAnimals, diets and management\u003c/h2\u003e\n \u003cp\u003eSixteen healthy Simmental crossbred bulls (initial weight 552.38\u0026thinsp;\u0026plusmn;\u0026thinsp;35.48 kg) were randomly divided into two groups of 8 heads each. The control group (CG, initial average weight 551.00 kg) received a basal diet, while the \u003cem\u003eA. oryzae\u003c/em\u003e group (AO, initial average weight 553.75 kg) received the same basal diet supplemented with 6 g of \u003cem\u003eA. oryzae\u003c/em\u003e (Yiyuan Kangyuan Biotechnology Co., Ltd., China). All cattle were fed with a total mixed ration (TMR) provided at 05:00 and 17:00, and had unrestricted access to fresh water. The TMR had a concentrate-to-roughage ratio of 40:60 and was composed of 31.49% whole maize silage, 28.19% peanut hay, and 40.32% concentrate (on a dry matter basis). The concentrate mix included 50% corn, 5% wheat bran, 9.5% soybean meal, 10% peanut meal, 12% distillers dried grains with solubles, and additives such as NaCl, NaHCO\u003csub\u003e3\u003c/sub\u003e, limestone powder, Ca(HCO\u003csub\u003e3\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003e and a premix. The premix per kg of DM contained 2500 mg Fe, 2000 mg Mn, 600 mg Cu, 1667 mg Zn, 2500 IU VE, 500000 IU VA, 50000 IU VD, and 500 IU VH.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\"\u003e\n \u003ch2\u003eMeasurement methods\u003c/h2\u003e\n \u003cdiv id=\"Sec7\"\u003e\n \u003ch2\u003eAverage daily gain and dry matter intake\u003c/h2\u003e\n \u003cp\u003eAnimals were weighed using a Kunshan Lightever electronic scale (Jiangsu Province, China) at the start and end of the feeding trial to determine average daily gain (ADG). Feed consumption and residuals were logged daily for each cow from days 31 to 37, allowing for the calculation of daily dry matter intake (DMI). The formulas used were:\u003c/p\u003e\n \u003cdiv id=\"Equa\"\u003e\n \u003cdiv id=\"FileID_Equa\" name=\"EquationSource\"\u003e$$\\text{A}\\text{D}\\text{G}=(\\text{F}\\text{i}\\text{n}\\text{a}\\text{l} \\text{w}\\text{e}\\text{i}\\text{g}\\text{h}\\text{t}-\\text{I}\\text{n}\\text{i}\\text{t}\\text{i}\\text{a}\\text{l} \\text{w}\\text{e}\\text{i}\\text{g}\\text{h}\\text{t})/\\text{E}\\text{x}\\text{p}\\text{e}\\text{r}\\text{i}\\text{m}\\text{e}\\text{n}\\text{t}\\text{a}\\text{l} \\text{d}\\text{a}\\text{y}\\text{s}$$\u003c/div\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Equb\"\u003e\n \u003cdiv id=\"FileID_Equb\" name=\"EquationSource\"\u003e$$\\text{D}\\text{M}\\text{I}=\\text{D}\\text{M} \\text{o}\\text{f}\\text{f}\\text{e}\\text{r}\\text{e}\\text{d}-\\text{D}\\text{M} \\text{r}\\text{e}\\text{f}\\text{u}\\text{s}\\text{e}\\text{d}$$\u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\"\u003e\n \u003ch2\u003eDigestibility of nutrients\u003c/h2\u003e\n \u003cp\u003eIn the final week of the feeding trial, four cattle from cattle from each group were selected for total manure and urine collection to assess nutrient digestibility (Aerts et al., \u003cspan\u003e1984\u003c/span\u003e; Soto-Navarro et al., \u003cspan\u003e2014\u003c/span\u003e). The fecal collection apparatus was modified per Gorski et al.. Briefly, a urine collection bag was secured to the test cow with a rubber band, directing the urine into a collection bucket containing 200 mL of 10% sulfuric acid. Fresh weights of manure and urine were recorded daily, thoroughly mixed, and representative samples were collected for analysis. Five percent of the total urine was filtered through gauze and stored at -20 ℃ for subsequent testing. Four percent of the manure was weighed, mixed with tartaric (1/4 of the manure\u0026rsquo;s weight), and dried at 65 ℃. During the collection period, the weights of feed offered and refused were recorded, and samples were dried for chemical analysis.\u003c/p\u003e\n \u003cp\u003eThe diet, orts, manure, and urine were analyzed for DM, total nitrogen (TN), total organic carbon (TOC), neutral detergent fiber (NDF), acid detergent fiber (ADF), and gross energy (GE). DM was determined by drying samples in a forced-air oven at 105\u0026thinsp;\u0026plusmn;\u0026thinsp;2℃ for 24 hours (George W. Latimer, \u003cspan\u003e2016\u003c/span\u003e). TN was measured using a Kjeldahl method with a Kjeltec 2300 Analyzer Unit (Foss Tecator AB, Hiller\u0026oslash;d, Denmark) (George W. Latimer, \u003cspan\u003e2016\u003c/span\u003e). TOC was determined by the thermal potassium dichromate oxidation-capacity method (Chadwick et al., \u003cspan\u003e2011\u003c/span\u003e). NDF and ADF were analyzed by neutral and acid detergent extraction, respectively, using a fiber analyzer (ANKOM A200i fiber analyzer, ANKOM Technology Company, Fairport, NY, USA) (Senger et al., \u003cspan\u003e2008\u003c/span\u003e). GE was measured with an adiabatic bomb calorimeter (ZDHW-9000A, Huanuo Electronic Technology, Hebei, China) and expressed as MJ/kg of DM. The apparent digestibility coefficient (ADC) of nutrients and energy was calculated according to the following equation (Zhang et al., \u003cspan\u003e2018\u003c/span\u003e):\u003c/p\u003e\n \u003cdiv id=\"Equc\"\u003e\n \u003cdiv id=\"FileID_Equc\" name=\"EquationSource\"\u003e\u003cimg src=\"https://myfiles.space/user_files/122228_c8a1650c59388082/122228_custom_files/img1720699322.png\"\u003e\u003cbr\u003e\u003c/div\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Equg\"\u003e\u003cbr\u003e\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\"\u003e\n \u003ch2\u003eRuminal sampling, fermentation parameters, and microbial populations\u003c/h2\u003e\n \u003cp\u003eRumen fluid samples (100 mL) were collected on the final day of the feeding trial, 6 hours post-morning feeding, using a rumen stomach tube connected to a vacuum pump (Zhejiang World Electromechanical Products Co., Ltd., Zhejiang, China). Five milliliters of these samples were immediately frozen and stored in liquid nitrogen for microbiome analysis. The pH of a portion of the remaining rumen fluid was measured within 5 minutes using a pH meter (Metter Toledo instrument Shanghai Co. Ltd., China). Another portion was filtered through four layers of gauze, placed in a 50 mL centrifuge tube, and stored at -20℃ for later analysis of ammonia-N, microbial protein (MCP) and volatile fatty acids (VFAs). VFAs (acetic acid, propionic acid, and butyric acid) were quantified following Hoskin\u0026rsquo;s method using ion chromatography (Dionex ICS-3000, Dionex, Sunnyvale, USA) with an IonPac AS 11-HC separation column (4\u0026times; 250 mm) and an IonPac AG 11-HC column (4\u0026times; 50 mm). The column temperature was set at 30 \u003csup\u003eo\u003c/sup\u003eC, with a flow rate was 0.9 mL\u0026middot;min\u003csup\u003e-1\u003c/sup\u003e, and an injection volume of 25 \u0026micro;L. Ammonia-N and MCP concentrations were determined using the methods of Chaney et al. and Makkar et al. .\u003c/p\u003e\n \u003cp\u003eThe populations of \u003cem\u003etotal bacteria\u003c/em\u003e, \u003cem\u003emethanogens\u003c/em\u003e, \u003cem\u003efungi\u003c/em\u003e, \u003cem\u003eprotozoa\u003c/em\u003e, \u003cem\u003eFibrobacter succinogenes\u003c/em\u003e, \u003cem\u003eRuminococcus flavefaciens\u003c/em\u003e, \u003cem\u003eRuminococcus albus\u003c/em\u003e, and \u003cem\u003eButyrivibrio fibrisolvens\u003c/em\u003e were quantified via real-time absolute quantitative PCR. Total microbial DNA was extracted from rumen fluid, ligated into a pMD 18-T vector to construct recombinant plasmids, and transfected into \u003cem\u003eEscherichia coli.\u003c/em\u003e Positive colonies were identified via ampicillin screening, direct PCR, and DNA sequencing. Plasmid DNA from positive clones was purified, and its concentration was measured spectrophotometrically. These plasmid DNA serial dilutions served as standards for plotting standard curves for each species. Primers for PCR are listed in Table \u003cspan\u003e1\u003c/span\u003e. The PCR reaction mixture (20 \u0026micro;L total volume) included 0.5 \u0026micro;moL/L forward and reverse primers, 10 \u0026micro;L 2\u0026times; SybrGreen qPCR Master Mix (Roche Molecular Biochemicals), 6 \u0026micro;L ddH\u003csub\u003e2\u003c/sub\u003eO, and 2 \u0026micro;L DNA template. Cycling conditions were: initial denaturation at 95℃ for 3 minutes, followed by 40 cycles at 95℃ for 15 seconds, 57℃ for 20 seconds, and 72℃ for 30 seconds. This was followed by a melting curve analysis (65\u0026ndash;95℃ with a heating rate of 0.1℃ per second) and a finally a cooling step to 45℃. Light Cycler quantification software (v. 3.5, Roche Molecular Biochemicals) was used to compare experimental sample amplification during the log-linear phase with the standard curve. Copy number calculations followed the methods of Wanapat et al. and Kralik et al.\u003c/p\u003e\n \u003cdiv\u003e \u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eOligonucleotide primers used in real-time PCR\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward primer\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSize (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTotal bacteria\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF- CGGCAACGAGCGCAACCC\u003c/p\u003e\n \u003cp\u003eR- CCATTGTAGCACGTGTGTAGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e145\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKoike and Kobayashi (\u003cspan\u003e2001\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eMethanogens\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF- TTCGGTGGATCDCARAGRGC\u003c/p\u003e\n \u003cp\u003eR- GBARGTCGWAWCCGTAGAATCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e160\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eZhou et al. (\u003cspan\u003e2009\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eFungi\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-GAGGAAGTAAAAGTCGTAACAAGGTTTC\u003c/p\u003e\n \u003cp\u003eR- CAAATTCACAAAGGGTAGGATGATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDenman and McSweeney (\u003cspan\u003e2007\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eProtozoa\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF- GCTTTCGWTGGTAGTGTATT\u003c/p\u003e\n \u003cp\u003eR- CTTGCCCTCYAATCGTWCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e234\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eZhou et al. (\u003cspan\u003e2011\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eFibrobacter succinogenes\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF- GTTCGGAATTACTGGGCGTAAA\u003c/p\u003e\n \u003cp\u003eR\u003cstrong\u003e-\u003c/strong\u003e CGCCTGCCCCTGAACTATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e121\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDenman and McSweeney (\u003cspan\u003e2007\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eRuminococcus flavefaciens\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-CGAACGGAGATAATTTGAGTTTACTTAGG\u003c/p\u003e\n \u003cp\u003eR- CGGTCTCTGTATGTTATGAGGTATTACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e132\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDenman and McSweeney (\u003cspan\u003e2007\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eRuminobacter albus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-CCCTAA AAGCAGTCTTAGTTCG\u003c/p\u003e\n \u003cp\u003eR- CCTCCTTGCGGTTAGAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e175\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKoike and Kobayashi (\u003cspan\u003e2001\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eButyrivibrio fibrisolvens\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF-GAGGAAGTAAAAGTCGTAACAAGGTTTC\u003c/p\u003e\n \u003cp\u003eR- CAAATTCACAAAGGGTAGGATGATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e110\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eZhou et al. (\u003cspan\u003e2011\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\"\u003e\n \u003ch2\u003eGas collection and measurement\u003c/h2\u003e\n \u003cp\u003eEnteric CH\u003csub\u003e4\u003c/sub\u003e production was quantified using the SF6 tracer technique, following Johnson et al., in 4 cattle per group during the final 5 days of the feeding trail. One week prior to CH\u003csub\u003e4\u003c/sub\u003e collection, a brass permeation tube containing approximately 1.00 g of SF\u003csub\u003e6\u003c/sub\u003e with a specified release rate (\u003cstrong\u003eTable \u003cspan\u003eS1\u003c/span\u003e\u003c/strong\u003e and \u003cstrong\u003eTable S2\u003c/strong\u003e) was inserted into the rumen. Cattle were acclimated to a gas collection apparatus (halter, PVC yoke, capillary tube) after SF\u003csub\u003e6\u003c/sub\u003e tube insertion. Exhaled gases were collected into a pre-evacuated (-0.1\u0026ndash; -0.08 MPa) PVC yoke via a 1.2-m capillary tube with a filer and flexible nosepiece. Samples were collected over five consecutive days, with background air samples collected daily using the same device. Post 24-hour collection, device pressure was checked for collection efficiency, then pressurized to 110 kPa with pure nitrogen (99.9999%). Mixed gases were transferred to collection bags with 24 hours for analysis.\u003c/p\u003e\n \u003cp\u003eSF\u003csub\u003e6\u003c/sub\u003e concentrations were measured using gas chromatography (GC-4000A, East \u0026amp; West Analytical Instruments incorporated, Beijing, China) with an electron capture detector (ECD) and a Molecular Sieve 5A column (60\u0026ndash;80 mesh). Conditions: column at 50 ℃, injector at 100 ℃, detector at 250 ℃, with high-purity nitrogen as the carrier gas at 35 mL/min flow rate. A 1.0 mL sample was manually injected per run. Calibration was performed using an SF\u003csub\u003e6\u003c/sub\u003e calibration gas (150 ng/L) at 101.325 kPa at the start and end of measurements. CH\u003csub\u003e4\u003c/sub\u003e percentage was calculated from chromatogram peak areas using the external standard method. Daily CH\u003csub\u003e4\u003c/sub\u003e production per animal was computed using the method outlined by Liu, with the following equation:\u003c/p\u003e\n \u003cdiv id=\"Equh\"\u003e\n \u003cdiv id=\"FileID_Equh\" name=\"EquationSource\"\u003e$${\\text{C}\\text{H}}_{4}\\left(\\text{L}/\\text{d}\\right)={\\text{S}\\text{F}}_{6 }\\text{p}\\text{e}\\text{r}\\text{m}\\text{e}\\text{a}\\text{t}\\text{i}\\text{o}\\text{n} \\text{r}\\text{a}\\text{t}\\text{e} \\left(\\text{L}/\\text{d}\\right)\\times \\frac{{\\text{C}}_{{\\text{C}\\text{H}}_{4}}}{{\\text{C}}_{{\\text{S}\\text{F}}_{6}}}$$\u003c/div\u003e\n \u003c/div\u003e\n \u003cp\u003ewhere, L/d represents emission volume per day.\u003c/p\u003e\n \u003cp\u003eThe CH\u003csub\u003e4\u003c/sub\u003e emissions from stored beef cattle manure subjected to various treatments were quantified using the static chamber-GC method (Grau, \u003cspan\u003e1995\u003c/span\u003e; Zhang et al., \u003cspan\u003e2021\u003c/span\u003e). Gas samples were collected between 09:00 and 10:00, and CH\u003csub\u003e4\u003c/sub\u003e emissions were analyzed the same day via gas chromatography (GC) as per Zhang et al. CH\u003csub\u003e4\u003c/sub\u003e concentrations in the samples were determined using a GC-112A (Shanghai Suny Hengping Scientific Instrument Co., China) equipped with a flame ionization detector (FID) and a TP-porapak Q capillary column (15 m\u0026times; 0.32 mm\u0026times; 5 \u0026micro;m). The column, injector, and detector were maintained at 55 ℃, 150 ℃, and 200 ℃, respectively. Nitrogen (99.9999%) served as the carrier gas, with a flow rate of 10 mL/min and a purge time of 0.75 min. A 0.3 mL gas sample was manually injected for each run, and parallel injections were conducted. Instrument calibration was performed using a CH\u003csub\u003e4\u003c/sub\u003e calibration gas (20 ppm, 101.325 kPa) at the start and end of the measurements. CH\u003csub\u003e4\u003c/sub\u003e percentage in the samples was calculated from the chromatogram peak area using the external standard method. The CH\u003csub\u003e4\u003c/sub\u003e emission rates from the manure then calculated using the following equation (Sommer and M\u0026Oslash;Ller, \u003cspan\u003e2000\u003c/span\u003e):\u003c/p\u003e\n \u003cdiv id=\"Equi\"\u003e\n \u003cdiv id=\"FileID_Equi\" name=\"EquationSource\"\u003e$$\\text{F}={\\rho }0\\times \\text{V}\\times (\\text{d}\\text{c}/\\text{d}\\text{t})\\times \\left[273.15/\\left(273.15+\\text{T}\\right)\\right]\\times \\left(\\text{P}/101.325\\right)\\times \\left(1/\\text{A}\\right)$$\u003c/div\u003e\n \u003c/div\u003e\n \u003cp\u003eF (mg\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;d\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) represents the emission rate of CH\u003csub\u003e4\u003c/sub\u003e; \u0026rho;\u003csub\u003e0\u003c/sub\u003e (0.717 kg/m\u003csup\u003e3\u003c/sup\u003e) refers to the CH\u003csub\u003e4\u003c/sub\u003e density under standard conditions; V (m\u003csup\u003e3\u003c/sup\u003e) refers to the volume of the headspace in the bucket; dc/dt represents the CH\u003csub\u003e4\u003c/sub\u003e concentration variance in the bucket; T (℃) represents the average gas temperature in the bucket during gas sampling; P refers to the atmospheric pressure during gas sampling; and A (m\u003csup\u003e2\u003c/sup\u003e) is the area of the cattle manure in each bucket.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eCattle weight, ADG, DMI, ADC, CH\u003csub\u003e4\u003c/sub\u003e emissions, energy metabolism, and microbial populations were analyzed via independent samples t-test using SPSS 21.0 (USA) and reported as mean values. Significance was defined as \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; highly significant at \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; and trends at 0.05\u0026thinsp;\u0026le;\u0026thinsp;\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.1.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eProduction performance and dry matter intake\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e presents the ADG and DMI for both groups. The AO group exhibited an 11.11% and 0.94% increase in ADG and DMI, respectively, relative to the CG group, though the differences were statistically insignificant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAverage daily gain and dry matter intake of the experimental cattle (n\u0026thinsp;=\u0026thinsp;8)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eItem\u003csup\u003e1)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCG\u003csup\u003e2)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAO\u003csup\u003e3)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSEM\u003csup\u003e4)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInitial weight (kg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e551.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e553.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.922\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFinal weight (kg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e597.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e605.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.795\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADG (kg/d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.253\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDMI (kg/d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e11.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.868\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e1)\u003c/sup\u003e ADG\u0026thinsp;=\u0026thinsp;Average daily gain, DMI\u0026thinsp;=\u0026thinsp;dry matter intake.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e2)\u003c/sup\u003e CG\u0026thinsp;=\u0026thinsp;control group fed with basal diet.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e3)\u003c/sup\u003e AO\u0026thinsp;=\u0026thinsp;basal diet\u0026thinsp;+\u0026thinsp;6 g \u003cem\u003eA. oryzae\u003c/em\u003e per head per day.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e4)\u003c/sup\u003e SEM, standard error of the means.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eApparent digestible coefficient of nutrition\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e presents the impact of A. oryzae on nutrient digestibility. The NDF digestibility in the AO group increased by 36.41% (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to the CG group. No significant changes were observed in the digestibility of DM, TN, ADF, and TOC between the two groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe apparent digestible coefficient of nutrition of beef cattle (%, n\u0026thinsp;=\u0026thinsp;4)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIndices\u003csup\u003e1)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCG\u003csup\u003e2)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAO\u003csup\u003e3)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSEM\u003csup\u003e4)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDM (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e65.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e70.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.265\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTN (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e69.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e71.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.571\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNDF (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e55.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.016\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADF (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e62.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e68.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.217\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTOC (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e71.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e73.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.366\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e1)\u003c/sup\u003e DM\u0026thinsp;=\u0026thinsp;dry matter; TN\u0026thinsp;=\u0026thinsp;total nitrogen; NDF\u0026thinsp;=\u0026thinsp;neutral detergent fiber; ADF\u0026thinsp;=\u0026thinsp;Acid detergent fiber; TOC\u0026thinsp;=\u0026thinsp;Total organic carbon.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e2)\u003c/sup\u003e CG\u0026thinsp;=\u0026thinsp;control group fed with basal diet.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e3)\u003c/sup\u003e AO\u0026thinsp;=\u0026thinsp;basal diet\u0026thinsp;+\u0026thinsp;6 g \u003cem\u003eA. oryzae\u003c/em\u003e per head per day.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e4)\u003c/sup\u003e SEM, standard error of the means.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eMethane emission and energy metabolism\u003c/h2\u003e \u003cp\u003eThe data on enteric CH\u003csub\u003e4\u003c/sub\u003e emissions and energy metabolism are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. Enteric CH4 emissions for the CG and AO groups were 418.90 and 340.24 L/d, respectively, with the AO group showing a significant reduction of 18.78% \u003cem\u003e(P\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) compared to the CG. CH4 emissions per unit body weight and per unit dry matter intake (DMI) in the AO group were reduced by 20% (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and 19.40% (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), respectively, relative to the CG. The CH4-E (energy gaseous products of digestion, Eg) in the AO group was significantly lower than in the CG (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). There were no significant impacts of A. oryzae on gross energy (GE), fecal energy (FE), urinary energy (UE), apparent digestible energy (ADE), apparent metabolizable energy (AME), or the energy efficiency of GE and ADE in the experimental cattle (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The CH4 proportion of GE was significantly reduced by 20.30% with the inclusion of A. oryzae in the diet (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEnteric methane emission production and energy metabolism of experimental cattle (n\u0026thinsp;=\u0026thinsp;4)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIndices\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCG\u003csup\u003e1)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAO\u003csup\u003e2)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSEM\u003csup\u003e3)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eP-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethane (L/d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e418.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e340.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.002\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eThe methane of BW (L/kg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eThe methane of DMI (L/kg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e36.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.028\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003eInput or output of energy (MJ/d)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGross energy (GE, MJ/d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e183.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e185.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.873\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEnergy in faces (FE, MJ/d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e56.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e54.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.717\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEnergy in urine (UE, MJ/d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.820\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEnergy gaseous products of digestion (Eg, MJ/d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.002\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eApparent digestible energy (ADE, MJ/d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e127.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e131.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.733\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eApparent metabolizable energy (AME, MJ/d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e105.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e112.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.530\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003eEnergy efficiency (%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADE/GE (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e68.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e70.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.598\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAME/ADE (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e82.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e85.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.083\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEg/GE (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e1)\u003c/sup\u003e CG\u0026thinsp;=\u0026thinsp;control group fed with basal diet.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e2)\u003c/sup\u003e AO\u0026thinsp;=\u0026thinsp;basal diet\u0026thinsp;+\u0026thinsp;6 g \u003cem\u003eA. oryzae\u003c/em\u003e per head per day.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e3)\u003c/sup\u003e SEM, standard error of the means.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eManure methane emission\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e illustrates the CH\u003csub\u003e4\u003c/sub\u003e emission rate from manure and the corresponding air temperature during storage. Throughout the storage period, the daily average air temperature exceeded 23 ℃. The CH\u003csub\u003e4\u003c/sub\u003e emission trends for the CG and AO groups aligned with storage duration, particularly within the initial 15 days. Thereafter, CH\u003csub\u003e4\u003c/sub\u003e emissions in the CG group surged significantly, exhibiting greater variability compared to the AO group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eEffects of A. oryzae on rumen microbial populations and ruminal fermentation parameters\u003c/h2\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e presents the impact of A. oryzae on NH3-N and VFAs in the rumen of beef cattle. The AO group exhibited a significant 13.72% reduction in ruminal ammonia-N compared to the CG group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Additionally, concentrations of acetate and butyrate in ruminal fluid were significantly elevated in the AO group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRuminal fermentation parameters (n\u0026thinsp;=\u0026thinsp;8)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIndices\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCG\u003csup\u003e1)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAO\u003csup\u003e2)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSEM\u003csup\u003e3)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.459\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmmonia-N (mg/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e108.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e93.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.032\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMicrobial protein (g/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.028\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAcetate (mmol/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e55.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e61.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.035\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePropionate (mmol/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e17.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e17.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.847\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eButyrate (mmol/L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.013\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAcetate/Propionate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.372\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e1)\u003c/sup\u003e CG\u0026thinsp;=\u0026thinsp;control group fed with basal diet.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e2)\u003c/sup\u003e AO\u0026thinsp;=\u0026thinsp;basal diet\u0026thinsp;+\u0026thinsp;6 g \u003cem\u003eA. oryzae\u003c/em\u003e per head per day.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e3)\u003c/sup\u003e SEM, standard error of the means.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAccording to Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, the proportions of \u003cem\u003efungi\u003c/em\u003e and \u003cem\u003eB. fibrisolvens\u003c/em\u003e increased by 43.88% and 60.67% respectively, upon \u003cem\u003eA. oryzae\u003c/em\u003e supplementation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Conversely, \u003cem\u003eProtozoa\u003c/em\u003e and \u003cem\u003emethanogens\u003c/em\u003e decreased by 17.14% and 40.24% respectively (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) following \u003cem\u003eA. oryzae\u003c/em\u003e addition. No significant changes were observed in the proportions of \u003cem\u003eF. succinogenes\u003c/em\u003e, \u003cem\u003eR. flavefaciens\u003c/em\u003e, or \u003cem\u003eR. albus\u003c/em\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMicrobial population of experimental cattle (\u0026permil; of total bacterial, n\u0026thinsp;=\u0026thinsp;8)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIndices\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCG\u003csup\u003e1)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAO\u003csup\u003e2)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSEM\u003csup\u003e3)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFungi\u003c/em\u003e (\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e, \u0026permil;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.038\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eProtozoa\u003c/em\u003e (\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e, \u0026permil;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.048\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMethanogens\u003c/em\u003e (\u0026permil;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.027\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFibrobacter succinogenes\u003c/em\u003e (\u0026permil;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.731\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRuminococcus flavefaciens\u003c/em\u003e (\u0026permil;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.399\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRuminobacter albus\u003c/em\u003e (\u0026permil;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.216\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eButyrivibrio fibrisolvens\u003c/em\u003e (\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e, \u0026permil;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.029\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e1)\u003c/sup\u003eCG\u0026thinsp;=\u0026thinsp;control group fed with basal diet.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e2)\u003c/sup\u003eAO\u0026thinsp;=\u0026thinsp;basal diet\u0026thinsp;+\u0026thinsp;6 g \u003cem\u003eA. oryzae\u003c/em\u003e per head per day\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e3)\u003c/sup\u003e SEM, standard error of the means.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe rumen, a distinguishing feature of ruminants, is integral to their health, productivity, and nutrient digestion. Ammonia-N, microbial crude protein (MCP), and volatile fatty acids (VFAs) are key indicators of ruminal fermentation, reflecting microbial activity. Rumen ammonia concentration serves as a proxy for the equilibrium between feed protein degradation and microbial protein synthesis. Most rumen bacteria depend on ammonia-N for nitrogen (Salter et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1979\u003c/span\u003e; Bach et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Optimizing ruminant protein systems involves maximizing ammonia conversion to microbial protein and minimizing ammonia loss via absorption. This study found that dietary supplementation with \u003cem\u003eA. oryzae\u003c/em\u003e reduced ammonia-N levels and increased MCP in beef cattle, indicating enhanced microbial growth. Additionally, \u003cem\u003eprotozoa\u003c/em\u003e, which are net producers of ammonia-N due to their inability to synthesize amino acids from ammonia-N, decreased by 17.14% with \u003cem\u003eA. oryzae\u003c/em\u003e supplementation, contributing to the reduction in ammonia-N.\u003c/p\u003e \u003cp\u003eRuminants primarily obtain energy from cellulose, hemicellulose, and starch, which are decomposed by rumen microorganisms into glucose, fructose, and xylose, subsequently converted into pyruvate via glycolysis. Pyruvate is then transformed into volatile fatty acids (VFAs), with over 95% being acetic, propionic, and butyric acids (Newbold and Ramos-Morales, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In this study, acetate and butyrate levels were elevated in the AO group compared to the CG group, likely due to the significantly higher NDF digestibility observed in the AO group. Cellulose degradation is intrinsically linked to the abundance of cellulolytic bacteria and fungi. Unlike rumen bacteria, which only degrade the plant's peripheral tissues, rumen \u003cem\u003efungi\u003c/em\u003e can extensively degrade thick-walled plant tissues by penetrating the cuticle and utilizing enzymes to break down the cell wall. Sun et al. demonstrated that \u003cem\u003eA. oryzae\u003c/em\u003e culture supplementation significantly increased the relative proportion of rumen \u003cem\u003efungi\u003c/em\u003e. In our study, the populations of \u003cem\u003efungi\u003c/em\u003e and \u003cem\u003eB. fibrisolvens\u003c/em\u003e were enhanced by 43.88% and 60.67%, respectively, following \u003cem\u003eA. oryzae\u003c/em\u003e addition, indicating that \u003cem\u003eA. oryzae\u003c/em\u003e supplementation may enhance feed fiber degradation by increasing the populations of these microorganisms.\u003c/p\u003e \u003cp\u003eA minor fraction of acetate in the rumen might have been absorbed by the rumen epithelium, converted to ketones, and predominantly transported to the liver via the portal vein, with 80% entering peripheral circulation (Tokura et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). The majority of blood-borne acetic acid absorbed by tissues is oxidized, fueling the tricarboxylic acid cycle or serving as a precursor for fatty acid synthesis. Elevated acetate and butyrate levels in the AO group compared to the CG group suggest that \u003cem\u003eA. oryzae\u003c/em\u003e supplementation enhances energy absorption in beef cattle. Methane production in ruminants is considered an energy loss. The AO group exhibited lower CH4-E (Eg) levels and a 11.11% increase in ADG compared to the CG group. These findings indicate that \u003cem\u003eA. oryzae\u003c/em\u003e supplementation can potentially enhance beef cattle production performance by optimizing energy utilization.\u003c/p\u003e \u003cp\u003eCH\u003csub\u003e4\u003c/sub\u003e arises naturally from anaerobic respiration and acts as the primary electron sink in the rumen (Beauchemin et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). \u003cem\u003eMethanogens\u003c/em\u003e, which convert CO\u003csub\u003e2\u003c/sub\u003e to H\u003csub\u003e2\u003c/sub\u003e, are the principal producers of ruminal CH\u003csub\u003e4\u003c/sub\u003e, closely associated with \u003cem\u003eprotozoa\u003c/em\u003e that generate hydrogen and formate (Stumm et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1982\u003c/span\u003e). A single ruminal protozoan can produce up to 5 nmol of hydrogen daily (Lopez et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Methanogens frequently inhabit the outer surfaces of ruminal ciliate \u003cem\u003eprotozoa\u003c/em\u003e and utilize hydrogen from these \u003cem\u003eprotozoa\u003c/em\u003e to reduce carbon dioxide, producing CH\u003csub\u003e4\u003c/sub\u003e (Stumm et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1982\u003c/span\u003e). Reducing protozoa populations correlates with a decrease in methanogens, thus lowering CH\u003csub\u003e4\u003c/sub\u003e emissions. (VanderZaag et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Frumholtz et al. reported that supplementing \u003cem\u003eA. oryzae\u003c/em\u003e in vitro reduced \u003cem\u003eprotozoa\u003c/em\u003e in sheep rumen fluid by nearly 45%, significantly decreasing CH\u003csub\u003e4\u003c/sub\u003e levels.. The study aligns with these findings, showing that adding \u003cem\u003eA. oryzae\u003c/em\u003e to beef cattle diets significantly reduced \u003cem\u003eprotozoan\u003c/em\u003e and \u003cem\u003emethanogen\u003c/em\u003e counts and CH\u003csub\u003e4\u003c/sub\u003e production.. In the absence of \u003cem\u003emethanogens\u003c/em\u003e, acetogenic bacteria can utilize H\u003csub\u003e2\u003c/sub\u003e and CO\u003csub\u003e2\u003c/sub\u003e to produce acetate without generating CH\u003csub\u003e4\u003c/sub\u003e. (Baral et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). This suggests \u003cem\u003eA. oryzae\u003c/em\u003e significantly influences intracellular hydrogen transfer pathways in the rumen. Furthermore, the decline in \u003cem\u003eprotozoa\u003c/em\u003e likely led to increased \u003cem\u003efungal\u003c/em\u003e numbers in the AO group, as reduced \u003cem\u003eprotozoan\u003c/em\u003e predation allowed more bacterial flora to thrive. This shift in \u003cem\u003efungal\u003c/em\u003e populations may partly explain the reduction in CH\u003csub\u003e4\u003c/sub\u003e following the introduction of \u003cem\u003eA. oryzae\u003c/em\u003e into the rumen.\u003c/p\u003e \u003cp\u003eManure CH\u003csub\u003e4\u003c/sub\u003e emissions are influenced by the degradable organic matter content and anaerobic conditions from manure accumulation (Koike and Kobayashi, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Zhou et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The primary degradable organic components in feces are fiber and starch, which remain undigested in the rumen and intestines. This study found a significantly higher apparent NDF digestibility in the AO group compared to the CG group, suggesting a lower cellulose content in AO group manure. Rumen \u003cem\u003eprotozoa\u003c/em\u003e, primarily ciliates, utilize plant cellulose and starch directly and consume rumen bacteria, thereby reducing the bacterial starch digestion rate. Furthermore, \u003cem\u003eB. fibrisolvens\u003c/em\u003e inhibits starch-degrading enzymes (Denman and McSweeney, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). In this experiment, the AO group had significantly higher total bacterial and \u003cem\u003eB. fibrisolvens\u003c/em\u003e counts, while \u003cem\u003eprotozoa\u003c/em\u003e numbers were lower compared to the CG group. This indicates that \u003cem\u003eA. oryzae\u003c/em\u003e supplementation enhances starch digestion and absorption in beef cattle. Consequently, the AO group's manure had lower degradable organic matter (fiber and starch) and reduced CH\u003csub\u003e4\u003c/sub\u003e emissions compared to the CG group's manure.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eSupplementing \u003cem\u003eA. oryzae\u003c/em\u003e in the diet of beef cattle led to a reduction in enteric and manure CH\u003csub\u003e4\u003c/sub\u003e emissions by modulating rumen microbial populations, altering fermentation dynamics, and enhancing the apparent digestibility of NDF. This intervention has the potential to improve the production performance of beef cattle and could serve as an effective CH\u003csub\u003e4\u003c/sub\u003e mitigation strategy in livestock production.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003eEthics approval\u003c/p\u003e\n\u003cp\u003eAll experimental procedures in this study adhered to Chinese regulations on the use and care of laboratory animals. The experimental protocol was approved by the Animal Care and Use Committee of Henan Agricultural University (Permit NO. 2020-003-35).\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThe authors extend their sincere appreciation to the Henan Agricultural University cattle farm staff for their technical support. This research was funded by the China Agriculture Research\u0026nbsp;System (CARS-36).\u003c/p\u003e\n\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eThe primary data from this research can be accessed from the corresponding author upon justified request.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eThe authors disclose no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAerts, J. V., De Boever, J. L., Cottyn, B. G., De Brabander, D. L., and Buysse, F. X. (1984). Comparative digestibility of feedstuffs by sheep and cows. Animal Feed Science and Technology 12(1):47-56. doi: https://doi.org/10.1016/0377-8401(84)90035-X\u003c/li\u003e\n\u003cli\u003eArango, J., Ruden, A., Martinez-Baron, D., Loboguerrero, A. M., Berndt, A., Chac\u0026oacute;n, M., Torres, C. F., Oyhantcabal, W., Gomez, C. A., Ricci, P., Ku-Vera, J., Burkart, S., Moorby, J. M., and Chirinda, N. (2020). Ambition meets reality: Achieving GHG emission reduction targets in the livestock sector of Latin America. Frontiers in Sustainable Food Systems 4(Perspective) doi: 10.3389/fsufs.2020.00065\u003c/li\u003e\n\u003cli\u003eArndt, C., Hristov, A., Price, W., McClelland, S., Pelaez, A., Cueva, S., Oh, J., Bannink, A., Bayat, A., Crompton, L., Dijkstra, J., Eug\u0026egrave;ne, M., Kebreab, E., Kreuzer, M., McGee, M., Martin, C., Newbold, C., Reynolds, C., Schwarm, A., and Yu, Z. (2021). Strategies to mitigate enteric methane emissions by ruminants -A way to approach the 2.0\u0026deg;C target.\u003c/li\u003e\n\u003cli\u003eBach, A., Calsamiglia, S., and Stern, M. (2005). Nitrogen metabolism in the rumen. Journal of Dairy Science 88 Suppl 1:E9-21. doi: 10.3168/jds.S0022-0302(05)73133-7\u003c/li\u003e\n\u003cli\u003eBampidis, V., Azimonti, G., de Lourdes Bastos, M., Christensen, H., Dusemund, B., Fa\u0026scaron;mon Durjava, M., Kouba, M., L\u0026oacute;pez-Alonso, M., L\u0026oacute;pez Puente, S., Marcon, F., Mayo, B., Pechov\u0026aacute;, A., Petkova, M., Ramos, F., Sanz, Y., Edoardo Villa, R., Woutersen, R., Dierick, N., Prieto Maradona, M., Galobart, J., Pettenati, E., and Anguita, M. (2022). Safety of the fermentation product of Aspergillus oryzae NRRL 458 (Amaferm(\u0026reg;)) as a feed additive for dairy cows (Biozyme Inc.). European Food Safety Authority Journal 20(2):e06983. doi: 10.2903/j.efsa.2022.6983\u003c/li\u003e\n\u003cli\u003eBaral, K. R., J\u0026eacute;go, G., Amon, B., Bol, R., Chantigny, M. H., Olesen, J. E., and Petersen, S. O. (2018). Greenhouse gas emissions during storage of manure and digestates: Key role of methane for prediction and mitigation. Agricultural Systems 166:26-35. doi: https://doi.org/10.1016/j.agsy.2018.07.009\u003c/li\u003e\n\u003cli\u003eBeauchemin, K., Mo, K., O\u0026rsquo;Mara, F., and McAllister, T. (2008). Nutritional management for enteric methane abatement: A review. Australian Journal of Experimental Agriculture 48(2), 21-27. doi: 10.1071/EA07199\u003c/li\u003e\n\u003cli\u003eBeauchemin, K. A., Ungerfeld, E. M., Eckard, R. J., and Wang, M. (2020). Review: Fifty years of research on rumen methanogenesis: Lessons learned and future challenges for mitigation. Animal 14:s2-s16. doi: https://doi.org/10.1017/S1751731119003100\u003c/li\u003e\n\u003cli\u003eBoadi, D., Benchaar, C., Chiquette, J., Mass\u0026eacute;, D., and And, J. (2004). Mitigation strategies to reduce enteric methane emissions from dairy cows: Update review. Canadian Jouranl of Animal Science 84(3), 319-335. doi: 10.4141/A03-109\u003c/li\u003e\n\u003cli\u003eChadwick, D., Sommer, S., Thorman, R., Fangueiro, D., Cardenas, L., Amon, B., and Misselbrook, T. (2011). Manure management: Implications for greenhouse gas emissions. Animal Feed Science and Technology 166-167:514-531. doi: https://doi.org/10.1016/j.anifeedsci.2011.04.036\u003c/li\u003e\n\u003cli\u003eChaney, A. L., and Marbach, E. P. (1962). Modified reagents for determination of urea and ammonia. Clinical Chemistry 8(2):130-132. doi: 10.1093/clinchem/8.2.130\u003c/li\u003e\n\u003cli\u003eCongio, G., Bannink, A., Mayorga, O., Hristov, A., Jaurena, G., Gonda, H., Gere, J., Cer\u0026oacute;n Cucchi, M., Ortiz Chura, A., Tieri, M., Hern\u0026aacute;ndez, O., Ricci, P., Juliarena, M., Lombardi, B., Abdalla, A., Abdalla Filho, A., Berndt, A., Oliveira, P., Henrique, F., and Astigarraga, L. (2021). Enteric methane mitigation strategies for ruminant livestock systems in the Latin America and Caribbean region: A meta-analysis. Journal of Cleaner Production 312:127693. doi: 10.1016/j.jclepro.2021.127693\u003c/li\u003e\n\u003cli\u003eDenman, S., and McSweeney, C. (2007). Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiology Ecology 58:572-582. doi: 10.1111/j.1574-6941.2006.00190.x\u003c/li\u003e\n\u003cli\u003eDi Francia, A., Masucci, F., Rosa, G., Varricchio, M. L., and Proto, V. (2008). Effects of Aspergillus oryzae extract and a Saccharomyces cerevisiae fermentation product on intake, body weight gain and digestibility in buffalo calves. Animal Feed Science and Technology 140:67-77. doi: 10.1016/j.anifeedsci.2007.02.010\u003c/li\u003e\n\u003cli\u003eFrumholtz, P. P., Newbold, C. J., and Wallace, R. J. (1989). Influence Of Aspergillus oryzae fermentation extract on the fermentation of a basal ration in the rumen simulation technique (Rusitec). The Journal of Agricultural Science 113(2):169-172. doi: 10.1017/S002185960008672X\u003c/li\u003e\n\u003cli\u003eGeorge W. Latimer, J. (2016). Official Methods of Analysis of Aoac International-20th Edition. AOAC International.\u003c/li\u003e\n\u003cli\u003eGorski, J., Blosser, T. H., Murdock, F. R., Hodgson, A. S., Soni, B. K., and Erb, R. E. (1957). A urine and faeces collecting apparatus for heifers and cows. Journal of Animal Science 16:9.\u003c/li\u003e\n\u003cli\u003eGrau, A. (1995). A closed chamber technique for field measurement of gas exchange of forage canopies. New Zealand Journal of Agricultural Research 38(1):71-77. doi: 10.1080/00288233.1995.9513105\u003c/li\u003e\n\u003cli\u003eHoskin, S. O., Stafford, K. J., and Barry, T. N. (1995). Digestion, rumen fermentation and chewing behaviour of red deer fed fresh chicory and perennial ryegrass. The Journal of Agricultural Science 124(2):289-295. doi: 10.1017/S0021859600072956\u003c/li\u003e\n\u003cli\u003eJohnson, K. A., Westberg, H. H., Michal, J., and Cossalman, M. W. (2007). The SF6 tracer technique: methane measurement from ruminants. p. 33-67.\u003c/li\u003e\n\u003cli\u003eKoike, S., and Kobayashi, Y. (2001). Development and use of competitive PCR assays for the rumen cellulolytic bacteria: Fibrobacter succinogenes, Ruminococcus albus and Ruminococcus flavefaciens. FEMS Microbiology Letters 204(2):361-366. doi: https://doi.org/10.1016/S0378-1097(01)00428-1\u003c/li\u003e\n\u003cli\u003eKralik, P., and Ricchi, M. (2017). A basic guide to real time PCR in microbial diagnostics: Definitions, parameters, and everything. Frontiers in Microbiology 8 doi: 10.3389/fmicb.2017.00108\u003c/li\u003e\n\u003cli\u003eLiu, C., Zhu, Z. P., Shang, B., Chen, Y. X., Guo, T. J., and Luo, Y. M. (2013). Long-term effects of ensiled cornstalk diet on methane emission, rumen fermentation, methanogenesis and weight gain in sheep. Small Ruminant Research 115(1):15-20. doi: https://doi.org/10.1016/j.smallrumres.2013.07.011\u003c/li\u003e\n\u003cli\u003eLopez, S., McIntosh, F. M., Wallace, R. J., and Newbold, C. J. (1999). Effect of adding acetogenic bacteria on methane production by mixed rumen microorganisms. Animal Feed Science and Technology 78(1):1-9. doi: https://doi.org/10.1016/S0377-8401(98)00273-9\u003c/li\u003e\n\u003cli\u003eMakkar, H. P. S., Sharma, O. P., Dawra, R. K., and Negi, S. S. (1982). Simple determination of microbial protein in rumen liquor. Journal of Dairy Science 65(11):2170-2173. doi: https://doi.org/10.3168/jds.S0022-0302(82)82477-6\u003c/li\u003e\n\u003cli\u003eNewbold, C. J., and Ramos-Morales, E. (2020). Review: Ruminal microbiome and microbial metabolome: effects of diet and ruminant host. Animal 14:s78-s86. doi: https://doi.org/10.1017/S1751731119003252\u003c/li\u003e\n\u003cli\u003eSalter, D. N., Daneshvar, K., and Smith, R. H. (1979). The origin of nitrogen incorporated into compounds in the rumen bacteria of steers given protein- and urea-containing diets. British Journal of Nutrition 41(1):197-209. doi: 10.1079/BJN19790026\u003c/li\u003e\n\u003cli\u003eSenger, C. C. D., Kozloski, G. V., Bonnecarr\u0026egrave;re Sanchez, L. M., Mesquita, F. R., Alves, T. P., and Castagnino, D. S. (2008). Evaluation of autoclave procedures for fibre analysis in forage and concentrate feedstuffs. Animal Feed Science and Technology 146(1):169-174. doi: https://doi.org/10.1016/j.anifeedsci.2007.12.008\u003c/li\u003e\n\u003cli\u003eSommer, S. G., and M\u0026Oslash;Ller, H. B. (2000). Emission of greenhouse gases during composting of deep litter from pig production \u0026ndash; effect of straw content. The Journal of Agricultural Science 134(3):327-335. doi: 10.1017/S0021859699007625\u003c/li\u003e\n\u003cli\u003eSoto-Navarro, S. A., Lopez, R., Sankey, C., Capitan, B. M., Holland, B. P., Balstad, L. A., and Krehbiel, C. R. (2014). Comparative digestibility by cattle versus sheep: Effect of forage quality1,2. Journal of Animal Science 92(4):1621-1629. doi: 10.2527/jas.2013-6740\u003c/li\u003e\n\u003cli\u003eStumm, C. K., Gijzen, H. J., and Vogels, G. D. (1982). Association of methanogenic bacteria with ovine rumen ciliates. British Journal of Nutrition 47(1):95-99. doi: 10.1079/BJN19820013\u003c/li\u003e\n\u003cli\u003eSun, H., Wu, Y. M., Wang, Y. M., Liu, J. X., and Myung, K. H. (2014). Effects of Aspergillus oryzae culture and 2-Hydroxy-4-(Methylthio)-butanoic acid on in vitro rumen fermentation and microbial populations between different roughage sources. Asian-Australasian Journal of Animal Sciences 27:1285 - 1292.\u003c/li\u003e\n\u003cli\u003eTada, S., Ohkuchi, H., Matsushita-Morita, M., Furukawa, I., Hattori, R., Suzuki, S., Kashiwagi, Y., and Kusumoto, K.-I. (2015). Telomere-mediated chromosomal truncation in Aspergillus oryzae. Journal of Bioscience and Bioengineering 119(1):43-46. doi: https://doi.org/10.1016/j.jbiosc.2014.06.011\u003c/li\u003e\n\u003cli\u003eTokura, M., Ushida, K., Miyazaki, K., and Kojima, Y. (1997). Methanogens associated with rumen ciliates. FEMS Microbiology Ecology 22(2):137-143. doi: https://doi.org/10.1016/S0168-6496(96)00084-0\u003c/li\u003e\n\u003cli\u003eVanderZaag, A. C., Wagner-Riddle, C., Park, K. H., and Gordon, R. J. (2011). Methane emissions from stored liquid dairy manure in a cold climate. Animal Feed Science and Technology 166-167:581-589. doi: https://doi.org/10.1016/j.anifeedsci.2011.04.041\u003c/li\u003e\n\u003cli\u003eWanapat, M., and Cherdthong, A. (2009). Use of real-time PCR technique in studying rumen cellulolytic bacteria population as affected by level of roughage in Swamp Buffalo. Current Microbiology 58(4):294-299. doi: 10.1007/s00284-008-9322-6\u003c/li\u003e\n\u003cli\u003eWatts, N., Amann, M., Arnell, N., Ayeb-Karlsson, S., Beagley, J., Belesova, K., Boykoff, M., Byass, P., Cai, W., Campbell-Lendrum, D., Capstick, S., Chambers, J., Coleman, S., Dalin, C., Daly, M., Dasandi, N., Dasgupta, S., Davies, M., Di Napoli, C., Dominguez-Salas, P., Drummond, P., Dubrow, R., Ebi, K. L., Eckelman, M., Ekins, P., Escobar, L. E., Georgeson, L., Golder, S., Grace, D., Graham, H., Haggar, P., Hamilton, I., Hartinger, S., Hess, J., Hsu, S. C., Hughes, N., Jankin Mikhaylov, S., Jimenez, M. P., Kelman, I., Kennard, H., Kiesewetter, G., Kinney, P. L., Kjellstrom, T., Kniveton, D., Lampard, P., Lemke, B., Liu, Y., Liu, Z., Lott, M., Lowe, R., Martinez-Urtaza, J., Maslin, M., McAllister, L., McGushin, A., McMichael, C., Milner, J., Moradi-Lakeh, M., Morrissey, K., Munzert, S., Murray, K. A., Neville, T., Nilsson, M., Sewe, M. O., Oreszczyn, T., Otto, M., Owfi, F., Pearman, O., Pencheon, D., Quinn, R., Rabbaniha, M., Robinson, E., Rockl\u0026ouml;v, J., Romanello, M., Semenza, J. C., Sherman, J., Shi, L., Springmann, M., Tabatabaei, M., Taylor, J., Tri\u0026ntilde;anes, J., Shumake-Guillemot, J., Vu, B., Wilkinson, P., Winning, M., Gong, P., Montgomery, H., and Costello, A. (2021). The 2020 report of The Lancet Countdown on health and climate change: responding to converging crises. Lancet (London, England) 397(10269):129-170. doi: 10.1016/s0140-6736(20)32290-x\u003c/li\u003e\n\u003cli\u003eWiedmeier, R. D., Arambel, M. J., and Walters, J. L. (1987). Effect of Yeast culture and Aspergillus oryzae fermentation extract on ruminal characteristics and nutrient digestibility1. Journal of Dairy Science 70(10):2063-2068. doi: https://doi.org/10.3168/jds.S0022-0302(87)80254-0\u003c/li\u003e\n\u003cli\u003eYoon, I. K., and Stern, M. D. (1996). Effects of Saccharomyces cerevisiae and Aspergillus oryzae cultures on ruminal fermentation in dairy cows. Journal of Dairy Science 79(3):411-417. doi: https://doi.org/10.3168/jds.S0022-0302(96)76380-4\u003c/li\u003e\n\u003cli\u003eZhang, C. Z., Sun, H. Z., Li, S. L., Sang, D., Zhang, C., Jin, L., Antonini, M., and Zhao, C. (2018). Effects of photoperiod on nutrient digestibility, hair follicle activity and cashmere quality in Inner Mongolia white cashmere goats. Asian-Australasian Journal of Animal Sciences 32:541 - 547.\u003c/li\u003e\n\u003cli\u003eZhang, H., Yang, G., Li, H., Wang, L., Fu, T., Li, G., and Gao, T. (2021). Effects of dietary supplementation with alpha-lipoic acid on apparent digestibility and serum metabolome alterations of sheep in summer. Tropical Animal Health and Production 53(5):505. doi: 10.1007/s11250-021-02917-7\u003c/li\u003e\n\u003cli\u003eZhou, M., Hernandez Sanabria, E., and Guan, L. (2009). Assessment of the microbial ecology of ruminal methanogens in cattle with different feed efficiencies. Applied and Environmental Microbiology 75:6524-6533. doi: 10.1128/AEM.02815-08\u003c/li\u003e\n\u003cli\u003eZhou, Y. Y., Mao, H. L., Jiang, F., Wang, J. K., Liu, J. X., and McSweeney, C. S. (2011). Inhibition of rumen methanogenesis by tea saponins with reference to fermentation pattern and microbial communities in Hu sheep. Animal Feed Science and Technology 166-167:93-100. doi: https://doi.org/10.1016/j.anifeedsci.2011.04.007\u003c/li\u003e\n\u003cli\u003eZhu, J., Shurson, G. C., Whitacre, L., Ipharraguerre, I. R., and Urriola, P. E. (2020). 181 Effects of Aspergillus oryzae prebiotic on energy and nutrient digestibility of growing pigs. Journal of Animal Science 98(Supplement_3):80-80. doi: 10.1093/jas/skaa054.143\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"tropical-animal-health-and-production","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"trop","sideBox":"Learn more about [Tropical Animal Health and Production](https://www.springer.com/journal/11250)","snPcode":"11250","submissionUrl":"https://submission.nature.com/new-submission/11250/3","title":"Tropical Animal Health and Production","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Aspergillus oryzae, Intestinal, Fecal, Methane Emission, Beef Cattle","lastPublishedDoi":"10.21203/rs.3.rs-4484300/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4484300/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study aimed to assess the impact of \u003cem\u003eAspergillus oryzae\u003c/em\u003e supplementation on CH\u003csub\u003e4\u003c/sub\u003e emissions and the production performance of beef cattle. Sixteen healthy Simmental crossbred steers (552.38\u0026thinsp;\u0026plusmn;\u0026thinsp;35.48 kg) were randomly assigned to either a control group (CG, basal diet) or an \u003cem\u003eA. oryzae\u003c/em\u003e group (AO, basal diet\u0026thinsp;+\u0026thinsp;6 g \u003cem\u003eA. oryzae\u003c/em\u003e per head daily). CH\u003csub\u003e4\u003c/sub\u003e emissions from enteric fermentation and manure, production performance, nutrient and energy digestibility, rumen fermentation parameters, and microbial populations were evaluated. The results showed that \u003cem\u003eA. oryzae\u003c/em\u003e supplementation did not significantly affect average daily gain (ADG) or dry matter intake (DMI), though ADG increased by 11.11%. The AO group exhibited a 36.41% increase in apparent NDF digestibility (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), a significant reduction in ammonia-N (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and elevated rumen \u003cem\u003efungi\u003c/em\u003e and \u003cem\u003eButyrivibrio fibrisolvens\u003c/em\u003e populations while reducing \u003cem\u003eprotozoa\u003c/em\u003e and \u003cem\u003emethanogens\u003c/em\u003e; CH\u003csub\u003e4\u003c/sub\u003e emissions from enteric fermentation and manure decreased by 18.78% (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and 56.55%, respectively. In summary, supplementation with \u003cem\u003eA. oryzae\u003c/em\u003e effectively lowers CH\u003csub\u003e4\u003c/sub\u003e emissions both enteric fermentation and manure without compromising beef cattle production performance.\u003c/p\u003e","manuscriptTitle":"Supplementation with Aspergillus oryzae decreases intestinal and fecal methane emissions and affects the production performance of beef cattle","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-11 12:12:15","doi":"10.21203/rs.3.rs-4484300/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision with re-assessment","date":"2024-07-18T13:29:42+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-06-21T01:04:18+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-20T20:10:48+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-29T12:06:04+00:00","index":"","fulltext":""},{"type":"submitted","content":"Tropical Animal Health and Production","date":"2024-05-27T06:31:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"tropical-animal-health-and-production","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"trop","sideBox":"Learn more about [Tropical Animal Health and Production](https://www.springer.com/journal/11250)","snPcode":"11250","submissionUrl":"https://submission.nature.com/new-submission/11250/3","title":"Tropical Animal Health and Production","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"cb47a592-8d46-4cb3-a94e-2551a33846e7","owner":[],"postedDate":"July 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-07-24T10:08:08+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-11 12:12:15","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4484300","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4484300","identity":"rs-4484300","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00