Genetic polymorphism detection in semi-domesticated perennial cotton (Gossypium ssp.) using an ISSR marker system and its application for molecular interspecific differentiation

Genetic polymorphism detection in semi-domesticated perennial cotton (Gossypium ssp.) using an ISSR marker system and its application for molecular interspecific differentiation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genetic polymorphism detection in semi-domesticated perennial cotton (Gossypium ssp.) using an ISSR marker system and its application for molecular interspecific differentiation Fernando dos Santos Araújo, Riselane de Lucena Alcântara Bruno, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1902987/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Jan, 2023 Read the published version in Molecular Biology Reports → Version 1 posted 4 You are reading this latest preprint version Abstract Background The perennial cotton species Gossypium hirsutum L. r. marie-galante Hutch. and Gossypium barbadense L. are sources of variability for creating modern cotton varieties. However, these species are similar in shape and easily confused in young stages of their life, leading to difficulties in identification based on their morphology. Thus, in this study, an Inter-Simple Sequence Repeat (ISSR) marker system was used as a measure of genetic differentiation among 28 genotypes of perennial cotton from a Brazilian collection. Methods and Results A set of eleven ISSR primers yielded 101 bands, of which 48 (47.5%) were polymorphic. The mean values of polymorphism information content ( PIC =0.304) and polymorphism ( P =45.8%) showed that the ISSR primers are moderately informative. The ISSR markers exposed the high genetic differentiation ( G ST = 0.598) and a low level of gene flow ( N m = 0.338) between species, which suggests a pattern of reproductive isolation. The Cluster Analysis, based on Nei's genetic identity, clustered the 28 genotypes into two groups consistent with the taxonomical delimitation, occurrence mode (semi-domesticated and improved types) and partial concordance with geographic origin. Bayesian model-based structural analysis also suggests the existence of two genetic groups (Delta K = 2) and high membership likelihood (Q>0.98). Conclusions The ISSR marker system offers a new molecular approach to differentiate the G. hirsutum L. r. marie-galante and G. barbadense L. species. This study can expand the molecular marker resources for the identification and improvement of our knowledge about the genetic relationships between perennial cotton genotypes from Brazilian collections. Gossypium genetic resource molecular markers DNA fingerprinting Figures Figure 1 Figure 2 Background The cotton fibre ( Gossypium L.) consumed by the Brazilian textile industry comes from modern upland cotton ( Gossypium hirsutum L. r. latifolium). In the past, this raw material was mainly obtained from perennial cotton species: Gossypium hirsutum L. r. marie-galante and Gossypium barbadense L. These allotetraploid species are not native to Brazil but are widely distributed and adapted to conditions there, which is considered a secondary diversity centre of the genus Gossypium L. [ 1 – 3 ]. The G. barbadense L. (kidney-cotton and non-aggregated seeds races) and G. hirsutum L. r. marie-galante (mocó cotton ecotype) are found “ in situ ” in the form of subsistence crops, semi-wild populations and dooryard plants [ 4 – 5 ]. These perennial cottons are used to spin and weave lint, and are used for ornamental and medicinal purposes by the local populations of North and Northeast Brazil [ 4 ]. In addition, they have advantageous traits and are potentially applied to improve fibre quality ( G. barbadense L.) as well as having a high tolerance for environmental stresses ( G. hirsutum L. r. marie-galante) [ 6 – 7 ], helping to develop modern cotton cultivars. The conservation of Brazilian cotton’s genetic resources has been coordinated by the Brazilian Agricultural Research Agency (Embrapa) which holds almost 1,700 Brazilian accessions of G. hirsutum L. r. marie-galante and G. barbadense L. together in the Active Germplasm Bank (AGB), from an Embrapa unit (Embrapa Cotton, Campina Grande, Paraíba, Brazil) [ 8 ]. However, the botanical identities of several accessions of perennial cotton in this collection remain undefined because these species are similar in shape and are easily confused in the young stages of their life, leading to difficulties in their identification based on their morphology. Therefore, a new identification approach is critical to the authentication and improvement of the use of this germplasm. The Inter-Simple Sequence Repeat (ISSR) marker system has been used as a valuable marker for revealing inter and intraspecific variations in cotton [ 9 ]. Therefore, it is a genotyping technique which is potentially suitable for DNA fingerprinting and determining the genetic relationships of semi-domesticated perennial cotton. The ISSR marker system is a technique that involves the use of microsatellite sequences as primers to generate multilocus markers [ 10 ]. The ISSRs are highly polymorphic, relatively easy to develop, and inexpensive when compared to other methods [ 11 ]. The hypothesis in this study was that the ISSR molecular markers can provide estimates with high discrimination power between semi-domesticated perennial cotton species, with low cost and high reproducibility. In this study, an ISSR marker system was used to assess genetic differentiation and the relationships between 28 perennial cotton genotypes of G. hirsutum L. r. marie-galante and G. barbadense L. from a Brazilian cotton germplasm collection. Materials And Methods Cotton germplasm This study used 28 perennial cotton genotypes (25 semi-domesticated genotypes and 3 improved genotypes) provided by the Brazilian Agricultural Research Corporation (Embrapa Cotton, Campina Grande, Brazil) (Table 1 ). The improved genotypes CNPA 5M, BRS 200 ( G. hirsutum L. r. marie-galante) and Pima S7, EUA ( G. barbadense L.) were considered as a control group (Table 1 ). In this investigation, improved types were defined as those which received human manipulation through breeding techniques, while semi-domesticated types were defined to include landraces, dooryard, and semi-wild cottons. Table 1 Genotype code, botanical identity (species), occurrence mode, origin (state/country) of 28 perennial cotton genotypes ( G. hirsutum L. r. marie-galante and G. barbadense L.) from a Brazilian cotton germplasm collection ID number Botanical identity (specie) Occurrence mode Origin (state/country) 1 G. hirsutum L. r. marie-galante Landrace Paraíba, Brazil 2 G. hirsutum L. r. marie-galante Landrace Rio Grande do Norte, Brazil 3 G. hirsutum L. r. marie-galante Dooryard Paraíba, Brazil 4 G. hirsutum L. r. marie-galante Dooryard Paraíba, Brazil 5 G. hirsutum L. r. marie-galante Dooryard Rio Grande do Norte, Brazil 6 G. hirsutum L. r. marie-galante cv. CNPA 5M Cultivar Paraíba, Brazil 7 G. hirsutum L. r. marie-galante Semi-wild Paraíba, Brazil 8 G. hirsutum L. r. marie-galante Dooryard Paraíba, Brazil 9 G. hirsutum L. r. marie-galante cv. BRS 200 Cultivar Paraíba, Brazil 10 G. hirsutum L. r. marie-galante Landrace Paraíba, Brazil 11 G. hirsutum L. r. marie-galante Landrace Paraíba, Brazil 12 G. hirsutum L. r. marie-galante Landrace Paraíba, Brazil 13 G. hirsutum L. r. marie-galante Landrace Paraíba, Brazil 14 G. hirsutum L. r. marie-galante Semi-wild Rio Grande do Norte, Brazil 15 G. hirsutum L. r. marie-galante Semi-wild Rio Grande do Norte, Brazil 16 G. hirsutum L. r. marie-galante Landrace Pernambuco, Brazil 17 G. barbadense L. Semi-wild Minas Gerais, Brazil 18 G. barbadense L. Dooryard Minas Gerais, Brazil 19 G. barbadense L. Dooryard Minas Gerais, Brazil 20 G. barbadense L. Dooryard Minas Gerais, Brazil 21 G. barbadense L. Dooryard Minas Gerais, Brazil 22 G. barbadense L. Dooryard Pará, Brazil 23 G. barbadense L. Dooryard Pará, Brazil 24 G. barbadense L. Dooryard Amapá, Brazil 25 G. barbadense L. Dooryard Pará, Brazil 26 G. barbadense L. Dooryard Ceará, Brazil 27 G. barbadense L. Dooryard Amapá, Brazil 28 G. barbadense L. cv. Pima S7 Cultivar Arizona, United States (Insert Table 1 ) Genomic DNA extraction and quantification Genomic DNA was extracted from samples of cotyledon tissue from dry seeds (1/2 of the cotyledon) using an adapted protocol by Doyle and Doyle [ 12 ]. The concentration and quality of the genomic DNA were measured by spectrophotometry. The quality of DNA extracted was also checked by running the electrophoresis on a 0.8% agarose gel, using a lambda phage DNA standard (50, 100 and 200 ng µl − 1 ). A ratio absorbance of 260/280 nm and 260/230 nm (more than 1.8) were considered as standard. ISSR analysis The DNA amplification was performed by conventional polymerase chain reaction (PCR) using 11 ISSR primers from the Nucleic Acid-Protein Service Unit (University of British Columbia, USA). The PCR were prepared with a final volume of 25 µL, containing 1.0 mM primer, 0.25 mM dNTP's, 2.5 mM MgCl 2 , PCR buffer [100 mM Tris-HCl (pH 8.5)], 500 mM KCl], 1 unit of Taq DNA polymerase (Ludwig Biotec®), 20 ng of DNA template and ultrapure water. DNA amplification was performed in a thermal cycler (PCR Thermal Cyclers, Amplitherm 96-Well). The protocol consisted of an initial denaturation at 94°C for 5 min, 40 amplification cycles (denaturation at 94°C for 1 min, annealing at 45°C for 1 min and extension at 72°C for 2 min) and a final extension at 72°C for 5 min. The amplicons were cooled to 4ºC and stored at -20ºC. All PCRs were performed in duplicate. Reactions without the DNA template were used as a negative control. The dyes SYBR® Gold nucleic acid gel stain (Invitrogen™) and bromophenol Blue (0.01%) were added to the amplicons. The samples were applied on an agarose gel (1.5% m v − 1 ) with a TBE 0.5X running buffer (Tris, boric acid, EDTA). The applied voltage was 75 V and the migration time of the fragments was 120 min. A molecular weight standard (1 Kb Plus Express® DNA Ladder) was used. The DNA fragments (bands) were photocumented using an Ultra Lum Electronic UV Transilluminator and Kodak GEL Logic 200 Imaging System. Scoring ISSR band and marker efficiency analysis The electrophoretic profiles were coded as ‘1’ presence and ‘0’ absence of the band at the same loci, according to the visible and repeatable bands on the gel-electrophoresis. The primer’s performance was measured by calculating different parameters including the total number of bands, polymorphism (%), number of specific bands (defined as bands that occurred in only one of the species) and Polymorphism Information Content (PIC), calculated according by Botstein [ 13 ]. Genetic differentiation and relationship analysis Based on the band profiles (presence/absence of bands), the genetic differentiation, Nei's genetic identity [ 14 ] and indirect gene flow [ 15 ] were calculated using the POPGENE software (version 1.32) [ 16 ]. A similarity dendrogram based on the UPGMA nethod (Unweighted Pair-Group Method using Arithmetic Averages) was conducted using a matrix of Nei's genetic identity values calculated in NTSYS-pc software (version 2.1) [ 17 ]. The structuring of the clusters was interpreted by considering the species ( G. hirsutum L. r. marie-galante and G. barbadense L.) and the mode of occurrence (improved and semi-domesticated types). Genetic structure and admixture analysis STRUCTURE software (version 2.3.4.) [ 18 ] was used to infer the population structure profile and admixture detection. The program was run using the admixture model and assuming the mixed ancestry model, frequency of correlated alleles and prior information from the population (prior taxonomic classification). To estimate the most probable number of genetic groups (K-value), a burn-in of 5,000 followed by 10,000 Markov Chain Monte Carlo simulations, at 5 iterations with 10 autonomous runs, were performed with a K-value pre-set from 1 to 6. The results of the structural analysis were analysed by STRUCTURE HARVESTER software ‘on-line’ (version 0.6.93) ( http://taylor0.biology.ucla.edu/structureHarvester/ ) [ 19 ] to determine: Delta K = (|L”(K)|)/sd(L(K)) (mean); L' (K) = rate of change of the likelihood distribution (mean); L''(K) = absolute value of the 2nd order rate of the likelihood distribution change (mean); and Lnprob (K) = mean of estimated Ln probability by Evanno [ 20 ]. The genotypes were allocated to a specific cluster (K) based on the membership likelihood (Q > 0.60). Result Electrophoretic profiles and ISSR marker efficiency The detailed electrophoretic profiles and marker efficiency analysis of 11 ISSR primers are given in Table 2 . The PCR-ISSR amplification of genomic DNA from 28 perennial cotton genotypes yielded a total of 101 bands, of which 47.58% were polymorphic. The polymorphic band values for ISSR primers ranged from 12–73% and the average was found to be 45.8%, while the PIC ranged from 0.161 to 0.452 (an average of 0.304). The primers UBC-872, UBC-812, UBC-823 and UBC-828 were more informative, in terms of polymorphism and PIC, but the UBC-808, UBC-812, UBC-866 and UBC-828 primers revealed specific bands in two species. However, UBC-814 and UBC-823 primers only revealed specific bands of G. hirsutum L. r. marie-galante. Table 2 Summary of banding profile and polymorphism revealed by 11 ISSR primers Primer code Sequence 5′ −> 3′ Total bands Polymorphic bands Polymorphism (%) Private bands PIC G. hirsutum G. barbadense UBC-808 (AG)8 C 12 5 42 2 2 0.262 UBC-812 (GA)8 A 14 9 64 2 3 0.452 UBC-814 (CT)8 A 8 2 25 1 0 0.271 UBC-823 (TC)8 C 8 5 62 1 0 0.357 UBC-827 (AC)8 G 6 3 50 0 0 0.328 UBC-828 (TG)8 A 8 5 62 1 4 0.451 UBC-834 (AG)8 YT 9 3 33 0 0 0.250 UBC-866 (CTC)6 8 3 37 1 1 0.226 UBC-872 (GATA)4 11 8 73 0 0 0.397 UBC-884 HBH (AG)7 9 4 44 0 0 0.191 UBC-892 TAGATCTGATATCTGAATTCC 8 1 12 0 0 0.161 Total 101 48 48 8 10 - Means 9 4 46 0.7 0.9 0.304 Y = (C, T); B = (C, G, T); H = (A, G, T). PIC = Polymorphism Information Content (Insert Table 2 ) Genetic differentiation and relationship among genotypes The interspecific genetic differentiation was high ( G ST =0.598), showing that 59.98% of the variability is distributed between the species. The indirect gene flow ( N m = 0.338) showed that gene exchange between species was low, which strengthens genetic differentiation between species. The genetic relationship of 28 perennial cotton genotypes was attained from ISSR primers scoring a data set using Nei’s genetic identity coefficient. The magnitude of the relatedness and disparity among the genotypes is demonstrated in Fig. 1 . (Insert Fig. 1 ) The mean values of Nei’s genetic identity, calculated among pairs of genotypes, ranged from 0.886 to 0.990 in G. barbadense L.; 0.828 to 0.971 in G. hirsutum L. r. marie-galante; and 0.657 to 0.714 between species. The genotypes were grouped into two clusters. One cluster included the 16 G. hirsutum L. r. marie-galante genotypes and the other group comprised 12 G. barbadense L. genotypes. The improved genotypes were grouped separately from the semi-domesticated genotypes (Fig. 1 ). The interspecific genetic similarity was greater between the improved genotypes CNPA 5M and BRS 200 of the group G. hirsutum L. r marie-galante and the improved genotype Pima S7 of the group G. barbadense L. (Fig. 1 ). Semi-domesticated genotypes collected from the same provinces showed close genetic relationships (Fig. 1 ). However, some exceptions were observed, including a genotype of G. barbadense L. collected in Minas Gerais State (17 genotypes) and two genotypes of G. hirsutum L. r. marie-galante collected in Paraíba (7 genotypes) and Rio Grande do Norte State (5 genotypes) that differed from the other genotypes collected in the same provinces (Fig. 1 ). Genetic structure and admixture analysis The genetic structure of 28 perennial cotton genotypes was estimated based on Bayesian inference. The parameters for estimating the most probable number of genetic groups (K) and membership likelihood of the genotypes to a specific cluster (K) are demonstrated in Fig. 2 . (Insert Fig. 2 ) The most probable number of genetic groups formed by the resulting data set, estimated using the Evanno method, was K = 2 [Lnprob (K) = -546.260; Ln'(K) = 821.760; Ln''(K) = 820.920; and Delta K = 217.864) (Fig. 2 A-D). Regarding the membership likelihood (Q > 0.60), all 16 G. hirsutum L. r. marie-galante genotypes (green zone) and 12 G. barbadense L. genotypes (red zone) were recorded as highly pure (Fig. 2 E). Our STRUCTURE analysis findings had a similar trend to the genotypic relatedness revealed by UPGMA clustering, resulting in all of the genotypes being in two distinct clusters. Discussion The ISSR primers allowed the detection of genetic polymorphism in perennial cotton. High levels of polymorphism (45.8%) represented the genetic variation in genomic ISSR regions of the combined dataset (28 genotypes of G. hirsutum L. r. marie-galante and G. barbadense L.). Therefore, this technique proved itself to be effective in differentiating species using little resources and with the possibility of high reproducibility. The efficiency of individual ISSR primers was variable. Ordinarily, the efficiency of a certain ISSR primer is correlated with the level of polymorphism that could be generated among the genotypes [ 21 ]. However, our results (mean values 0.304 for PIC and 45.8% for polymorphism) were similar to those reported in several studies that assessed the genetic diversity of Gossypium spp. using ISSR markers [ 22 – 28 ]. Thus, the electrophoretic profiles and ISSR marker efficiency in this study are within the expected range for Gossypium L. All primers showed polymorphism, suggesting the efficacy of these ISSR markers for the assessment of genetic variation between the Gossypium L. species. In this way, all of the primers can be effectively used in the primary evaluation of perennial cotton germplasm. However, UBC-808, UBC-812, UBC-866, UBC-828, UBC-814, and UBC-823 primers revealed specific bands in G. hirsutum L. r. marie-galante (eight bands) and G. barbadense L. (ten bands). This finding can be useful for botanical identification, enabling authentication and qualitative identification of errors of classification in cotton germplasm collections. The genetic polymorphism revealed by the ISSR marker system was effective in discriminating two perennial cotton species, as well as revealing intraspecific genetic relationships. Genetic analysis of population samples of G. hirsutum L. r. marie-galante and G. barbadense L. provided evidence of three levels of genetic differentiation and two levels of reproductive isolation between species. The high interspecific genetic differentiation ( G ST = 0.598) was consistent with the other differentiation index, including genetic structuring in two groups (K = 2) and low genetic identity (0.657) between species. The absence of mixing (Q > 0.98) and the low gene flow ( Nm = 0.338) suggest the existence of reproductive barriers between G. hirsutum L. r. marie-galante and G. barbadense L. In this context, despite these two species being sexually compatible [ 29 ] the low gene flow can be attributed to geographic isolation. As a matter of fact, natural hybrids between G. hirsutum L. and G. barbadense L. do not occur in situ , or occur with low frequency due to the rare places where they appear in sympatry [ 30 ]. Another hypothesis can be attributed to the habitats where G. hirsutum L r. marie-galante occurs in the semi-arid region of Northeast Brazil which, generally, does not have adequate rainfall for the establishment of G. barbadense L. [ 31 ]. Intraspecific genetic similarity was high in both species but the genotypes of G. barbadense L. (0.938) showed greater genetic identity than the genotypes of G. hirsutum L. r. maria galante (0.899). These results suggest that the genetic diversity in these groups is low or moderate, in agreement with the results reported by Hinze [ 32 – 33 ] who also reported low genetic diversity in reference groups of these species. The high similarity between the semi-domesticated genotypes of the two species indicates that there is a potential risk of decline in genetic variation, requiring the inclusion of effective conservation measures. Nonetheless, the high divergence between semi-domesticated and improved genotypes suggests that hybridization between these types can result in more heterotic combinations. The high divergence between semi-domesticated and improved genotypes shows the usefulness of including them in breeding programs to increase the variability within germplasm collections. The smallest similarity observed between the semi-domesticated genotypes and the improved Pima S7 genotype of the G. barbadense L. group was also reported by [ 6 ] and attributed to the wide differentiation between the gene pools of origin. The improved genotypes CNPA 5M and BRS 200 of the group G. hirsutum L. r marie-galante are different from the semi-domesticated genotypes of this group. This divergence stems from the selection of precocity and fibre colour characteristics which were applied during the creation of the improved genotypes CNPA 5M and BRS 200, respectively [ 34 ]. The divergence between semi-domesticated genotypes collected in the same province suggests that semi-domesticated populations of G. hirsutum L. r. marie-galante and populations of G. barbadense L. were originally formed by germplasm from different sources. However, the introduction of new sources of germplasm mediated by humans in these populations also seems plausible, as the exchange of seeds is a common practice among horticulturists and farmers in different Brazilian regions. Conclusion The ISSR marker system offers a new molecular approach to differentiate the G. hirsutum L. r. marie-galante and G. barbadense L. species. This study can expand the molecular marker resources to the identification and improvement of our knowledge of the genetic relationships between perennial cotton genotypes from germplasm collections. Declarations Acknowledgements The authors express their gratitude to the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Brazil) for funding scholarships (Finance Code 001), the Brazilian Agricultural Research Agency (Brazil) for providing the germplasm and institutional support, and Kyvia Pontes for her help in creating the artwork (the figures). Funding This study was funded by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, Brazil (Finance Code 001) and Brazilian Agricultural Research Agency (Brazil). Conflict of interest The authors declare that they have no conflict of interest. Ethical approval This article does not contain any studies with human participants or animals performed by any of the authors. Author Contributions Fernando dos Santos Araújo, Riselane de Lucena Alcântara Bruno, Nair Helena Castro Arriel and Everaldo Paulo de Medeiros contributed to the study conception and design. Material preparation, data collection and analysis were performed by Liziane Maria de Lima and Mayara Andrade de Souza. The first draft of the manuscript was written by Fernando dos Santos Araújo, Riselane de Lucena Alcântara Bruno, Nair Helena Castro Arriel and Alberício Pereira de Andrade. Francival Cardoso Felix, Richeliel Albert Rodrigues Silva and Karialane da Silva Belarmino commented on previous versions of the manuscript. All authors read and approved the final manuscript. References Borém A, Freire EC, Penna JCV and Barroso PAV (2003) Considerations about cotton gene escape in Brazil: a review. Crop Breeding and Applied Biotechnology 3: 315–332. Almeida VCD, Hoffmann LV, Yokomizo GKI, Costa JND, Giband M and Barroso PAV (2009) In situ and genetic characterization of Gossypium barbadense populations from the States of Pará and Amapá, Brazil. Pesquisa Agropecuaria Brasileira 44: 719–725. Menezes IPP, Hoffmann LV, Lima TH, Silva AR, Lucena VS and Barroso PAV (2017) Genetic diversity of arboreal cotton populations of the Brazilian semiarid: a remnant primary gene pool for cotton cultivars. Genetics and Molecular Research 16: gmr16039659. Menezes IPP, Hoffmann LV, Silva JO and Barroso PAV (2018). Distribuição do modo de ocorrência no local de raças de algodoeiro Semiárido Brasileiro. Multi-Sci Journal 1: 39–47. Hoffmann LV, Cardoso KCM, Rocha ASNC, Oliveira AID, Abreu AG, Pereira CCO, Malafaia G and Menezes IPP (2018) Genetic diversity of Gossypium barbadense from the central Brazilian Amazon. Acta Amazonica 48: 1–9. Rodrigues JIS, Carvalho LP and Farias FJC (2016) Comparison of wild accessions of Gossypium barbadense L. from Peru and Brazil via microsatellite markers. Bioscience Journal 32: 1352–1363. Vasconcelos UAA, Cavalcanti JJV, Farias FJC, Vasconcelos WS and Santos RC (2018) Diallel analysis in cotton ( Gossypium hirsutum L.) for water stress tolerance. Crop Breeding and Applied Biotechnology 18: 24–30. Albrana (2022) Algodões brasileiros nativos e naturalizados. CNPA Embrapa. http://www.cnpa.embrapa.br/albrana. Accessed 10 January 2022 Sabev P, Valkova N and Todorovska EG (2020) Molecular markers and their application in cotton breeding: progress and future perspectives. Bulgarian Journal of Agricultural Science 26: 816–828. Marwal A and Gaur RK (2020). Molecular markers: tool for genetic analysis. In: Verma A, Singh A. (ed) Animal Biotechnology . Cambridge: Academic Press Elsevier, pp. 353–372. Gemmill CE and Grierson ER (2021) Inter-Simple Sequence Repeats (ISSR), microsatellite-primed genomic profiling using universal primers. Mol Plant Taxonomy 2222: 249–262. Doyle JJ and Doyle JL (1987) Isolatin of plant DNA from fresh tissue. Focus 12: 13–15. Botstein D, White RL, Skolnick M and Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American Journal of Human Genetics 32: 314–331. Nei M (1973) Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Sciences of the United States of America 70: 3321–3323. McDermott JM and McDonald BA (1993) Gene flow in plant pathosystem. Annual Review of Phytopathology 31: 353–373. Yeh FC, Boyle TYZ and Xiyan JM (1999) POPGENE: Microsoft Window-based freeware for population genetic analysis. Version 131. Edmonton: University of Alberta. Rohlf FJ (2000) NTSYS-pc: numerical taxonomy and multivariate analysis system: version 2.1. Exeter Software, New York Pritchard JK, Stephens M and Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155: 945–959 Earl DA and Von-Holdt BM (2012) Structure Harvester: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetics Resources 4: 359–361. Evanno G, Regnaut S and Goudet J (2005) Detecting the number of clusters of individuals using the software structure: a simulation study. Molecular Ecology 14: 2611–2620. Khan MMH, Rafii MY, Ramlee SI, Jusoh M, Al Mamun M and Halidu J. (2021). DNA fingerprinting, fixation-index (Fst), and admixture mapping of selected Bambara groundnut ( Vigna subterranea [L.] Verdc.) accessions using ISSR markers system. Scientific Reports 1: 1–23. Bilwal BB, Vadodariya KV, Rajkumar BK, Upadhyay AK and Lahane GR (2017) Genetic diversity of parents using RAPD, ISSR and SSR molecular markers in upland cotton ( Gossypium hirsutum L.). Bulletin of Environment, Pharmacology and Life Sciences 6: 51–57. Ghuge SB, Mehetre SS, Chimote VP, Pawar BD and Naik RM (2018) Molecular characterization of cotton genotypes using SSR, ISSR and RAPD markers in relation to fiber quality traits. Journal of Cotton Research 32: 1–12. Nimbal S, Kuldeep J and Pawan K (2020) Molecular diversity analysis among elite genotypes of American cotton ( Gossypium hirsutum L.). Pantnagar Journal of Research 18: 1–4. Tajik-Khaveh Z, Iranbakhsh A, Vafaie-Tabar M and Ebadi M (2020) Study of genetic variation among some Gossypium spp. genotypes available in Iran using ISSR molecular marker. Rostaniha 21: 264–277. Şahin CB, İşler N and Rustamova V (2020) Characterization of some cotton varieties using ISSR markers. KSU Journal of Agriculture and Nature 23: 108–116. Hocaoglu-Ozyigit A, Ucar B, Altay V and Ozyigit II (2020) Genetic diversity and phylogenetic analyses of Turkish cotton ( Gossypium hirsutum L.) lines using ISSR markers and chloroplast trnL-F regions. Journal of Natural Fibers 17: 1–14. Sevindik E, Çayir EM, Emrebaş T and Filiz E (2021) Assessment of phylogenetic relationships of some worldwide-cultivated cotton genotypes ( Gossypium hirsutum L.) by using ISSR and RAPD markers. Biologica Nyssana 12: 131–139. Stephens SG (1946) The genetics of ''Corky''. The New World alleles and their possible role as an interspecific isolating mechanism. Journal of Genetics 47: 150–161. Pereira GS, Sousa RL, Araújo RL, Hoffmann LV, Silva EF and Barroso PAV (2012). Selective fertilization in interspecific crosses of allotetraploid species. Botany 90: 159–166. Freire EC (2000) Distribuição, coleta, uso e preservação das espécies silvestres de algodão no Brasil. Embrapa. https://www.embrapa.br/busca-de-publicacoes/-/publicacao/272012/distribuicao-coleta-uso-e-preservacao-das-especies-silvestres-de-algodao-no-brasil. Accessed 20 Jan 2022. Hinze LL, Fang DD, Gore MA, Scheffler BE, Yu JZ, Frelichowski J and Percy RG (2015) Molecular characterization of the Gossypium diversity reference set of the US national cotton germplasm collection. Theoretical and Applied Genetics 128: 313–327. Hinze LL, Gazave E, Gore MA, Fang DD, Scheffler BE, Yu JZ, Jones DC, Frelichowski J, Percy RG (2016) Genetic diversity of the two commercial tetraploid cotton species in the Gossypium diversity reference set. Journal of Heredity 107: 274–286. Embrapa (2001) BRS 200 marron: cultivar de algodão de fibra colorida. Embrapa Algodão. https://www.embrapa.br/busca-de-publicacoes/-/publicacao/276144/brs-200-marrom--cultivar-de-algodao-de-fibra-colorida . Accessed 20 Jan 2022. Cite Share Download PDF Status: Published Journal Publication published 18 Jan, 2023 Read the published version in Molecular Biology Reports → Version 1 posted Reviewers agreed at journal 22 Aug, 2022 Reviewers invited by journal 02 Aug, 2022 Editor assigned by journal 29 Jul, 2022 First submitted to journal 27 Jul, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1902987","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":125856280,"identity":"26145bcb-2ee6-4c6b-999e-b5788afbb345","order_by":0,"name":"Fernando dos Santos Araújo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABQ0lEQVRIie2RP0vDQBTAcxwky0nXF4rxKxgKtVBIP4hLQyCdbnIJWOsFIVnsLljar9Au0TEhkCyHfoAunbIVnKSigpdUB02qjoL5De+9O96Pd38kqabmD6KwIuHtCoqI/OcXJ9/ErEohYVnBDAjPM/qF8jEZ9rxiXLWijLPV021Xa1zHGXQcw7jxXXaoTs+OG75QNk5QUkh6pI/5oAV3dhuAW9aER6yvBym9ihFDl3z5VemBLYtjxCbjUhtUD1sAJgvNIKFMKBh5JYUcZLL6KpQZVx6Fcp4rLosmCZ3tUkCWm/mUOSf5lNgQygVy2ZDOdynElpv73qClc3LSAZ72gUQelpKQLoQSVdyFKImsrr2upnFlsQTntAeKn2FpOKLT+zhabZyS8gksvtJk2zouYvhtvwA9iCd8r0c/NdfU1NT8H94An8BxqjrYrW8AAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0002-0605-1613","institution":"University of Pernambuco: Universidade de Pernambuco","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Fernando","middleName":"dos Santos","lastName":"Araújo","suffix":""},{"id":125856281,"identity":"5e4e8d46-7990-49a6-b4e2-e83a78cd142d","order_by":1,"name":"Riselane de Lucena Alcântara Bruno","email":"","orcid":"","institution":"Paraiba Federal University: Universidade Federal da Paraiba","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Riselane","middleName":"de Lucena Alcântara","lastName":"Bruno","suffix":""},{"id":125856282,"identity":"b7bfcb6f-a715-40a0-86d4-c81ff28c3351","order_by":2,"name":"Nair Helena Castro Arriel","email":"","orcid":"","institution":"Brazilian Agricultural Research Corporation: Empresa Brasileira de Pesquisa Agropecuaria","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Nair","middleName":"Helena Castro","lastName":"Arriel","suffix":""},{"id":125856283,"identity":"c1daba57-474a-4c37-a087-62038c81588c","order_by":3,"name":"Everaldo Paulo de Medeiros","email":"","orcid":"","institution":"Brazilian Agricultural Research Corporation: Empresa Brasileira de Pesquisa Agropecuaria","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Everaldo","middleName":"Paulo","lastName":"de Medeiros","suffix":""},{"id":125856284,"identity":"605b9ecd-5aae-44f7-9a83-bd95406c8b4d","order_by":4,"name":"Liziane Maria de Lima","email":"","orcid":"","institution":"Brazilian Agricultural Research Corporation: Empresa Brasileira de Pesquisa Agropecuaria","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Liziane","middleName":"Maria","lastName":"de Lima","suffix":""},{"id":125856285,"identity":"fa11a07f-eb0b-4270-a4c6-97cf9b8a7688","order_by":5,"name":"Mayara Andrade de Souza","email":"","orcid":"","institution":"Centro de Estudos Superiores de Maceió: Centro Universitario CESMAC","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mayara","middleName":"Andrade","lastName":"de Souza","suffix":""},{"id":125856286,"identity":"1bfe0670-2488-4d12-9139-6befe32f7920","order_by":6,"name":"Alberício Pereira de Andrade","email":"","orcid":"","institution":"Federal University of Pernambuco: Universidade Federal de Pernambuco","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alberício","middleName":"Pereira","lastName":"de Andrade","suffix":""},{"id":125856287,"identity":"ad2165b2-dcdf-421a-a7bf-c343d776ddf5","order_by":7,"name":"Richeliel Albert Rodrigues Silva","email":"","orcid":"","institution":"Federal University of Campina Grande: Universidade Federal de Campina Grande","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Richeliel","middleName":"Albert Rodrigues","lastName":"Silva","suffix":""},{"id":125856288,"identity":"d436f7da-afa4-4d41-9e7a-af2b19a5070f","order_by":8,"name":"Francival Cardoso Felix","email":"","orcid":"","institution":"Universidade Federal do Paraná: Universidade Federal do Parana","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Francival","middleName":"Cardoso","lastName":"Felix","suffix":""},{"id":125856289,"identity":"39040288-f6ad-44a7-80a4-018920409c80","order_by":9,"name":"Karialane da Silva Belarmino","email":"","orcid":"","institution":"Universidade Federal da Paraíba: Universidade Federal da Paraiba","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Karialane","middleName":"da Silva","lastName":"Belarmino","suffix":""}],"badges":[],"createdAt":"2022-07-27 21:00:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1902987/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1902987/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11033-022-08165-8","type":"published","date":"2023-01-18T18:23:59+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":24948083,"identity":"e8c56699-b41f-4a71-a3d9-e22851347afa","added_by":"auto","created_at":"2022-08-09 00:19:45","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":72766,"visible":true,"origin":"","legend":"\u003cp\u003eDendrogram UPGMA illustrating the relationship bewteen 28 perennial cotton genotypes based on Nei’s genetic identity. The numeric value beneath the branches displayed the Nei’s genetic identity value, while the numeric value on the right indicates genotype ID numbers according to Table 1 (1 to 16 = \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante;\u003cem\u003e \u003c/em\u003e17 to 28 = \u003cem\u003eG. barbadense\u003c/em\u003e L.)\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-1902987/v1/9129da60c461b4bd2ed7f7b6.png"},{"id":24948082,"identity":"19703011-d70d-47c4-96b0-172f04108c89","added_by":"auto","created_at":"2022-08-09 00:19:45","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":569481,"visible":true,"origin":"","legend":"\u003cp\u003eGenetic structure of 28 perennial cotton genotypes by Bayesian inference. (A) Mean of estimated Ln probability change rate of the likelihood distribution; (B) change rate of the likelihood distribution (mean); (C) absolute value of the 2nd order change rate of the likelihood distribution (mean); (D) Delta K (mean); (E) Bar plot based on estimated membership coefficient values (Q) for maximum K value (Delta K = 2). Each vertical line represents an accession and different colours represent the estimated membership coefficients. The numbers at the base of each vertical line indicate the genotypes’ ID numbers according to Table 1 (1 to 16 = \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante;\u003cem\u003e \u003c/em\u003e17 to 28 = \u003cem\u003eG. barbadense\u003c/em\u003e L.) while the values inside the parentheses indicate the two groups based on prior taxonomic classification (1 = \u003cem\u003eG. hirsutum \u003c/em\u003eL. r. marie-galante; 2 = \u003cem\u003eG. barbadense\u003c/em\u003e L.)\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-1902987/v1/07b820adcd2c5e876e38ae77.png"},{"id":44717031,"identity":"933a70aa-7aa8-4f22-9868-cb1788ca080f","added_by":"auto","created_at":"2023-10-16 18:32:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":556614,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1902987/v1/45720ab8-4a34-4dbe-8a44-ed5cafa4caae.pdf"}],"financialInterests":"","formattedTitle":"Genetic polymorphism detection in semi-domesticated perennial cotton (Gossypium ssp.) using an ISSR marker system and its application for molecular interspecific differentiation","fulltext":[{"header":"Background","content":"\u003cp\u003eThe cotton fibre (\u003cem\u003eGossypium\u003c/em\u003e L.) consumed by the Brazilian textile industry comes from modern upland cotton (\u003cem\u003eGossypium hirsutum\u003c/em\u003e L. r. latifolium). In the past, this raw material was mainly obtained from perennial cotton species: \u003cem\u003eGossypium hirsutum\u003c/em\u003e L. r. marie-galante and \u003cem\u003eGossypium barbadense\u003c/em\u003e L. These allotetraploid species are not native to Brazil but are widely distributed and adapted to conditions there, which is considered a secondary diversity centre of the genus \u003cem\u003eGossypium\u003c/em\u003e L. [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The \u003cem\u003eG. barbadense\u003c/em\u003e L. (kidney-cotton and non-aggregated seeds races) and \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante (moc\u0026oacute; cotton ecotype) are found \u0026ldquo;\u003cem\u003ein situ\u003c/em\u003e\u0026rdquo; in the form of subsistence crops, semi-wild populations and dooryard plants [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThese perennial cottons are used to spin and weave lint, and are used for ornamental and medicinal purposes by the local populations of North and Northeast Brazil [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In addition, they have advantageous traits and are potentially applied to improve fibre quality (\u003cem\u003eG. barbadense\u003c/em\u003e L.) as well as having a high tolerance for environmental stresses (\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], helping to develop modern cotton cultivars.\u003c/p\u003e \u003cp\u003eThe conservation of Brazilian cotton\u0026rsquo;s genetic resources has been coordinated by the Brazilian Agricultural Research Agency (Embrapa) which holds almost 1,700 Brazilian accessions of \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante and \u003cem\u003eG. barbadense\u003c/em\u003e L. together in the Active Germplasm Bank (AGB), from an Embrapa unit (Embrapa Cotton, Campina Grande, Para\u0026iacute;ba, Brazil) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, the botanical identities of several accessions of perennial cotton in this collection remain undefined because these species are similar in shape and are easily confused in the young stages of their life, leading to difficulties in their identification based on their morphology. Therefore, a new identification approach is critical to the authentication and improvement of the use of this germplasm.\u003c/p\u003e \u003cp\u003eThe Inter-Simple Sequence Repeat (ISSR) marker system has been used as a valuable marker for revealing inter and intraspecific variations in cotton [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Therefore, it is a genotyping technique which is potentially suitable for DNA fingerprinting and determining the genetic relationships of semi-domesticated perennial cotton. The ISSR marker system is a technique that involves the use of microsatellite sequences as primers to generate multilocus markers [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The ISSRs are highly polymorphic, relatively easy to develop, and inexpensive when compared to other methods [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe hypothesis in this study was that the ISSR molecular markers can provide estimates with high discrimination power between semi-domesticated perennial cotton species, with low cost and high reproducibility. In this study, an ISSR marker system was used to assess genetic differentiation and the relationships between 28 perennial cotton genotypes of \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante and \u003cem\u003eG. barbadense\u003c/em\u003e L. from a Brazilian cotton germplasm collection.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCotton germplasm\u003c/h2\u003e \u003cp\u003eThis study used 28 perennial cotton genotypes (25 semi-domesticated genotypes and 3 improved genotypes) provided by the Brazilian Agricultural Research Corporation (Embrapa Cotton, Campina Grande, Brazil) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The improved genotypes CNPA 5M, BRS 200 (\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante) and Pima S7, EUA (\u003cem\u003eG. barbadense\u003c/em\u003e L.) were considered as a control group (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In this investigation, improved types were defined as those which received human manipulation through breeding techniques, while semi-domesticated types were defined to include landraces, dooryard, and semi-wild cottons.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenotype code, botanical identity (species), occurrence mode, origin (state/country) of 28 perennial cotton genotypes (\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante and \u003cem\u003eG. barbadense\u003c/em\u003e L.) from a Brazilian cotton germplasm collection\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eID number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBotanical identity (specie)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOccurrence mode\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOrigin (state/country)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLandrace\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLandrace\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRio Grande do Norte, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRio Grande do Norte, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante cv. CNPA 5M\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSemi-wild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante cv. BRS 200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLandrace\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLandrace\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLandrace\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLandrace\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePara\u0026iacute;ba, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSemi-wild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRio Grande do Norte, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSemi-wild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRio Grande do Norte, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLandrace\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePernambuco, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSemi-wild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMinas Gerais, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMinas Gerais, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMinas Gerais, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMinas Gerais, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMinas Gerais, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePar\u0026aacute;, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePar\u0026aacute;, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAmap\u0026aacute;, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePar\u0026aacute;, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCear\u0026aacute;, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDooryard\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAmap\u0026aacute;, Brazil\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e L. cv. Pima S7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eArizona, United States\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e(Insert Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGenomic DNA extraction and quantification\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted from samples of cotyledon tissue from dry seeds (1/2 of the cotyledon) using an adapted protocol by Doyle and Doyle [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The concentration and quality of the genomic DNA were measured by spectrophotometry. The quality of DNA extracted was also checked by running the electrophoresis on a 0.8% agarose gel, using a lambda phage DNA standard (50, 100 and 200 ng \u0026micro;l\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). A ratio absorbance of 260/280 nm and 260/230 nm (more than 1.8) were considered as standard.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eISSR analysis\u003c/h2\u003e \u003cp\u003eThe DNA amplification was performed by conventional polymerase chain reaction (PCR) using 11 ISSR primers from the Nucleic Acid-Protein Service Unit (University of British Columbia, USA). The PCR were prepared with a final volume of 25 \u0026micro;L, containing 1.0 mM primer, 0.25 mM dNTP's, 2.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, PCR buffer [100 mM Tris-HCl (pH 8.5)], 500 mM KCl], 1 unit of Taq DNA polymerase (Ludwig Biotec\u0026reg;), 20 ng of DNA template and ultrapure water.\u003c/p\u003e \u003cp\u003eDNA amplification was performed in a thermal cycler (PCR Thermal Cyclers, Amplitherm 96-Well). The protocol consisted of an initial denaturation at 94\u0026deg;C for 5 min, 40 amplification cycles (denaturation at 94\u0026deg;C for 1 min, annealing at 45\u0026deg;C for 1 min and extension at 72\u0026deg;C for 2 min) and a final extension at 72\u0026deg;C for 5 min. The amplicons were cooled to 4\u0026ordm;C and stored at -20\u0026ordm;C. All PCRs were performed in duplicate. Reactions without the DNA template were used as a negative control.\u003c/p\u003e \u003cp\u003eThe dyes SYBR\u0026reg; Gold nucleic acid gel stain (Invitrogen\u0026trade;) and bromophenol Blue (0.01%) were added to the amplicons. The samples were applied on an agarose gel (1.5% m v\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) with a TBE 0.5X running buffer (Tris, boric acid, EDTA). The applied voltage was 75 V and the migration time of the fragments was 120 min. A molecular weight standard (1 Kb Plus Express\u0026reg; DNA Ladder) was used. The DNA fragments (bands) were photocumented using an Ultra Lum Electronic UV Transilluminator and Kodak GEL Logic 200 Imaging System.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eScoring ISSR band and marker efficiency analysis\u003c/h2\u003e \u003cp\u003eThe electrophoretic profiles were coded as \u0026lsquo;1\u0026rsquo; presence and \u0026lsquo;0\u0026rsquo; absence of the band at the same loci, according to the visible and repeatable bands on the gel-electrophoresis. The primer\u0026rsquo;s performance was measured by calculating different parameters including the total number of bands, polymorphism (%), number of specific bands (defined as bands that occurred in only one of the species) and Polymorphism Information Content (PIC), calculated according by Botstein [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGenetic differentiation and relationship analysis\u003c/h2\u003e \u003cp\u003eBased on the band profiles (presence/absence of bands), the genetic differentiation, Nei's genetic identity [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] and indirect gene flow [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] were calculated using the POPGENE software (version 1.32) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eA similarity dendrogram based on the UPGMA nethod (Unweighted Pair-Group Method using Arithmetic Averages) was conducted using a matrix of Nei's genetic identity values calculated in NTSYS-pc software (version 2.1) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The structuring of the clusters was interpreted by considering the species (\u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante and \u003cem\u003eG. barbadense\u003c/em\u003e L.) and the mode of occurrence (improved and semi-domesticated types).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eGenetic structure and admixture analysis\u003c/h2\u003e \u003cp\u003eSTRUCTURE software (version 2.3.4.) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] was used to infer the population structure profile and admixture detection. The program was run using the admixture model and assuming the mixed ancestry model, frequency of correlated alleles and prior information from the population (prior taxonomic classification). To estimate the most probable number of genetic groups (K-value), a burn-in of 5,000 followed by 10,000 Markov Chain Monte Carlo simulations, at 5 iterations with 10 autonomous runs, were performed with a K-value pre-set from 1 to 6.\u003c/p\u003e \u003cp\u003eThe results of the structural analysis were analysed by STRUCTURE HARVESTER software \u0026lsquo;on-line\u0026rsquo; (version 0.6.93) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://taylor0.biology.ucla.edu/structureHarvester/\u003c/span\u003e\u003cspan address=\"http://taylor0.biology.ucla.edu/structureHarvester/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] to determine: Delta K = (|L\u0026rdquo;(K)|)/sd(L(K)) (mean); L' (K)\u0026thinsp;=\u0026thinsp;rate of change of the likelihood distribution (mean); L''(K)\u0026thinsp;=\u0026thinsp;absolute value of the 2nd order rate of the likelihood distribution change (mean); and Lnprob (K)\u0026thinsp;=\u0026thinsp;mean of estimated Ln probability by Evanno [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The genotypes were allocated to a specific cluster (K) based on the membership likelihood (Q\u0026thinsp;\u0026gt;\u0026thinsp;0.60).\u003c/p\u003e \u003c/div\u003e"},{"header":"Result","content":"\u003cdiv class=\"Section2\" id=\"Sec10\"\u003e\n \u003ch2\u003eElectrophoretic profiles and ISSR marker efficiency\u003c/h2\u003e\n \u003cp\u003eThe detailed electrophoretic profiles and marker efficiency analysis of 11 ISSR primers are given in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. The PCR-ISSR amplification of genomic DNA from 28 perennial cotton genotypes yielded a total of 101 bands, of which 47.58% were polymorphic. The polymorphic band values for ISSR primers ranged from 12\u0026ndash;73% and the average was found to be 45.8%, while the PIC ranged from 0.161 to 0.452 (an average of 0.304). The primers UBC-872, UBC-812, UBC-823 and UBC-828 were more informative, in terms of polymorphism and PIC, but the UBC-808, UBC-812, UBC-866 and UBC-828 primers revealed specific bands in two species. However, UBC-814 and UBC-823 primers only revealed specific bands of \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante.\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003ctable border=\"1\" id=\"Tab2\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eSummary of banding profile and polymorphism revealed by 11 ISSR primers\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003ePrimer code\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequence 5\u0026prime; \u0026minus;\u0026gt; 3\u0026prime;\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eTotal bands\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003ePolymorphic bands\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003ePolymorphism (%)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003ePrivate bands\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003ePIC\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eG. hirsutum\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eG. barbadense\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-808\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(AG)8 C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.262\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-812\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(GA)8 A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.452\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-814\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(CT)8 A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.271\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-823\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(TC)8 C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.357\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-827\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(AC)8 G\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.328\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-828\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(TG)8 A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.451\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-834\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(AG)8 YT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.250\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-866\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(CTC)6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.226\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-872\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(GATA)4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.397\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-884\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHBH (AG)7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.191\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBC-892\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTAGATCTGATATCTGAATTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.161\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e101\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eMeans\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.304\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003csup\u003eY = (C, T); B = (C, G, T); H = (A, G, T). PIC = Polymorphism Information Content\u003c/sup\u003e\u003c/p\u003e\n \u003cp\u003e(Insert Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e)\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003eGenetic differentiation and relationship among genotypes\u003c/h2\u003e\n \u003cp\u003eThe interspecific genetic differentiation was high (\u003cem\u003eG\u003c/em\u003e\u003csub\u003e\u003cem\u003eST\u003c/em\u003e\u003c/sub\u003e=0.598), showing that 59.98% of the variability is distributed between the species. The indirect gene flow (\u003cem\u003eN\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e = 0.338) showed that gene exchange between species was low, which strengthens genetic differentiation between species.\u003c/p\u003e\n \u003cp\u003eThe genetic relationship of 28 perennial cotton genotypes was attained from ISSR primers scoring a data set using Nei\u0026rsquo;s genetic identity coefficient. The magnitude of the relatedness and disparity among the genotypes is demonstrated in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n \u003cp\u003e(Insert Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e)\u003c/p\u003e\n \u003cp\u003eThe mean values of Nei\u0026rsquo;s genetic identity, calculated among pairs of genotypes, ranged from 0.886 to 0.990 in \u003cem\u003eG. barbadense\u003c/em\u003e L.; 0.828 to 0.971 in \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante; and 0.657 to 0.714 between species. The genotypes were grouped into two clusters. One cluster included the 16 \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante genotypes and the other group comprised 12 \u003cem\u003eG. barbadense\u003c/em\u003e L. genotypes. The improved genotypes were grouped separately from the semi-domesticated genotypes (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eThe interspecific genetic similarity was greater between the improved genotypes CNPA 5M and BRS 200 of the group \u003cem\u003eG. hirsutum\u003c/em\u003e L. r marie-galante and the improved genotype Pima S7 of the group \u003cem\u003eG. barbadense\u003c/em\u003e L. (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Semi-domesticated genotypes collected from the same provinces showed close genetic relationships (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). However, some exceptions were observed, including a genotype of \u003cem\u003eG. barbadense\u003c/em\u003e L. collected in Minas Gerais State (17 genotypes) and two genotypes of \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante collected in Para\u0026iacute;ba (7 genotypes) and Rio Grande do Norte State (5 genotypes) that differed from the other genotypes collected in the same provinces (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec12\"\u003e\n \u003ch2\u003eGenetic structure and admixture analysis\u003c/h2\u003e\n \u003cp\u003eThe genetic structure of 28 perennial cotton genotypes was estimated based on Bayesian inference. The parameters for estimating the most probable number of genetic groups (K) and membership likelihood of the genotypes to a specific cluster (K) are demonstrated in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\n \u003cp\u003e(Insert Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e)\u003c/p\u003e\n \u003cp\u003eThe most probable number of genetic groups formed by the resulting data set, estimated using the Evanno method, was K\u0026thinsp;=\u0026thinsp;2 [Lnprob (K) = -546.260; Ln\u0026apos;(K)\u0026thinsp;=\u0026thinsp;821.760; Ln\u0026apos;\u0026apos;(K)\u0026thinsp;=\u0026thinsp;820.920; and Delta K\u0026thinsp;=\u0026thinsp;217.864) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA-D). Regarding the membership likelihood (Q\u0026thinsp;\u0026gt;\u0026thinsp;0.60), all 16 \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante genotypes (green zone) and 12 \u003cem\u003eG. barbadense\u003c/em\u003e L. genotypes (red zone) were recorded as highly pure (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eE). Our STRUCTURE analysis findings had a similar trend to the genotypic relatedness revealed by UPGMA clustering, resulting in all of the genotypes being in two distinct clusters.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe ISSR primers allowed the detection of genetic polymorphism in perennial cotton. High levels of polymorphism (45.8%) represented the genetic variation in genomic ISSR regions of the combined dataset (28 genotypes of \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante and \u003cem\u003eG. barbadense\u003c/em\u003e L.). Therefore, this technique proved itself to be effective in differentiating species using little resources and with the possibility of high reproducibility.\u003c/p\u003e \u003cp\u003eThe efficiency of individual ISSR primers was variable. Ordinarily, the efficiency of a certain ISSR primer is correlated with the level of polymorphism that could be generated among the genotypes [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. However, our results (mean values 0.304 for PIC and 45.8% for polymorphism) were similar to those reported in several studies that assessed the genetic diversity of \u003cem\u003eGossypium\u003c/em\u003e spp. using ISSR markers [\u003cspan additionalcitationids=\"CR23 CR24 CR25 CR26 CR27\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Thus, the electrophoretic profiles and ISSR marker efficiency in this study are within the expected range for \u003cem\u003eGossypium\u003c/em\u003e L.\u003c/p\u003e \u003cp\u003eAll primers showed polymorphism, suggesting the efficacy of these ISSR markers for the assessment of genetic variation between the \u003cem\u003eGossypium\u003c/em\u003e L. species. In this way, all of the primers can be effectively used in the primary evaluation of perennial cotton germplasm. However, UBC-808, UBC-812, UBC-866, UBC-828, UBC-814, and UBC-823 primers revealed specific bands in \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante (eight bands) and \u003cem\u003eG. barbadense\u003c/em\u003e L. (ten bands). This finding can be useful for botanical identification, enabling authentication and qualitative identification of errors of classification in cotton germplasm collections.\u003c/p\u003e \u003cp\u003eThe genetic polymorphism revealed by the ISSR marker system was effective in discriminating two perennial cotton species, as well as revealing intraspecific genetic relationships. Genetic analysis of population samples of \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante and \u003cem\u003eG. barbadense\u003c/em\u003e L. provided evidence of three levels of genetic differentiation and two levels of reproductive isolation between species.\u003c/p\u003e \u003cp\u003eThe high interspecific genetic differentiation (\u003cem\u003eG\u003c/em\u003e\u003csub\u003e\u003cem\u003eST\u003c/em\u003e\u003c/sub\u003e = 0.598) was consistent with the other differentiation index, including genetic structuring in two groups (K\u0026thinsp;=\u0026thinsp;2) and low genetic identity (0.657) between species. The absence of mixing (Q\u0026thinsp;\u0026gt;\u0026thinsp;0.98) and the low gene flow (\u003cem\u003eNm\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.338) suggest the existence of reproductive barriers between \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante and \u003cem\u003eG. barbadense\u003c/em\u003e L.\u003c/p\u003e \u003cp\u003eIn this context, despite these two species being sexually compatible [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] the low gene flow can be attributed to geographic isolation. As a matter of fact, natural hybrids between \u003cem\u003eG. hirsutum\u003c/em\u003e L. and \u003cem\u003eG. barbadense\u003c/em\u003e L. do not occur \u003cem\u003ein situ\u003c/em\u003e, or occur with low frequency due to the rare places where they appear in sympatry [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Another hypothesis can be attributed to the habitats where \u003cem\u003eG. hirsutum\u003c/em\u003e L r. marie-galante occurs in the semi-arid region of Northeast Brazil which, generally, does not have adequate rainfall for the establishment of \u003cem\u003eG. barbadense\u003c/em\u003e L. [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIntraspecific genetic similarity was high in both species but the genotypes of \u003cem\u003eG. barbadense\u003c/em\u003e L. (0.938) showed greater genetic identity than the genotypes of \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. maria galante (0.899). These results suggest that the genetic diversity in these groups is low or moderate, in agreement with the results reported by Hinze [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] who also reported low genetic diversity in reference groups of these species. The high similarity between the semi-domesticated genotypes of the two species indicates that there is a potential risk of decline in genetic variation, requiring the inclusion of effective conservation measures. Nonetheless, the high divergence between semi-domesticated and improved genotypes suggests that hybridization between these types can result in more heterotic combinations.\u003c/p\u003e \u003cp\u003eThe high divergence between semi-domesticated and improved genotypes shows the usefulness of including them in breeding programs to increase the variability within germplasm collections. The smallest similarity observed between the semi-domesticated genotypes and the improved Pima S7 genotype of the \u003cem\u003eG. barbadense\u003c/em\u003e L. group was also reported by [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and attributed to the wide differentiation between the gene pools of origin. The improved genotypes CNPA 5M and BRS 200 of the group \u003cem\u003eG. hirsutum\u003c/em\u003e L. r marie-galante are different from the semi-domesticated genotypes of this group. This divergence stems from the selection of precocity and fibre colour characteristics which were applied during the creation of the improved genotypes CNPA 5M and BRS 200, respectively [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe divergence between semi-domesticated genotypes collected in the same province suggests that semi-domesticated populations of \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante and populations of \u003cem\u003eG. barbadense\u003c/em\u003e L. were originally formed by germplasm from different sources. However, the introduction of new sources of germplasm mediated by humans in these populations also seems plausible, as the exchange of seeds is a common practice among horticulturists and farmers in different Brazilian regions.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe ISSR marker system offers a new molecular approach to differentiate the \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante and \u003cem\u003eG. barbadense\u003c/em\u003e L. species. This study can expand the molecular marker resources to the identification and improvement of our knowledge of the genetic relationships between perennial cotton genotypes from germplasm collections.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors express their gratitude to the Coordena\u0026ccedil;\u0026atilde;o de Aperfei\u0026ccedil;oamento de Pessoal de N\u0026iacute;vel Superior (Brazil) for funding scholarships (Finance Code 001), the Brazilian Agricultural Research Agency (Brazil) for providing the germplasm and institutional support, and Kyvia Pontes for her help in creating the artwork (the figures).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by Coordena\u0026ccedil;\u0026atilde;o de Aperfei\u0026ccedil;oamento de Pessoal de N\u0026iacute;vel Superior, Brazil (Finance Code 001)\u0026nbsp;and Brazilian Agricultural Research Agency (Brazil).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis article does not contain any studies with human participants or animals performed by any of the authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e Fernando dos Santos Ara\u0026uacute;jo, Riselane de Lucena Alc\u0026acirc;ntara Bruno, Nair Helena Castro Arriel and Everaldo Paulo de Medeiros contributed to the study conception and design. Material preparation, data collection and analysis were performed by Liziane Maria de Lima and Mayara Andrade de Souza. The first draft of the manuscript was written by Fernando dos Santos Ara\u0026uacute;jo, Riselane de Lucena Alc\u0026acirc;ntara Bruno, Nair Helena Castro Arriel and Alber\u0026iacute;cio Pereira de Andrade. Francival Cardoso Felix, Richeliel Albert Rodrigues Silva and Karialane da Silva Belarmino commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBor\u0026eacute;m A, Freire EC, Penna JCV and Barroso PAV (2003) Considerations about cotton gene escape in Brazil: a review. \u003cem\u003eCrop Breeding and Applied Biotechnology\u003c/em\u003e 3: 315\u0026ndash;332.\u003c/li\u003e\n\u003cli\u003eAlmeida VCD, Hoffmann LV, Yokomizo GKI, Costa JND, Giband M and Barroso PAV (2009) In situ and genetic characterization of \u003cem\u003eGossypium barbadense\u003c/em\u003e populations from the States of Par\u0026aacute; and Amap\u0026aacute;, Brazil. \u003cem\u003ePesquisa Agropecuaria Brasileira\u003c/em\u003e 44: 719\u0026ndash;725.\u003c/li\u003e\n\u003cli\u003eMenezes IPP, Hoffmann LV, Lima TH, Silva AR, Lucena VS and Barroso PAV (2017) Genetic diversity of arboreal cotton populations of the Brazilian semiarid: a remnant primary gene pool for cotton cultivars. \u003cem\u003eGenetics and Molecular Research\u003c/em\u003e 16: gmr16039659. \u003c/li\u003e\n\u003cli\u003eMenezes IPP, Hoffmann LV, Silva JO and Barroso PAV (2018). Distribui\u0026ccedil;\u0026atilde;o do modo de ocorr\u0026ecirc;ncia no local de ra\u0026ccedil;as de algodoeiro Semi\u0026aacute;rido Brasileiro. \u003cem\u003eMulti-Sci Journal\u003c/em\u003e 1: 39\u0026ndash;47. \u003c/li\u003e\n\u003cli\u003eHoffmann LV, Cardoso KCM, Rocha ASNC, Oliveira AID, Abreu AG, Pereira CCO, Malafaia G and Menezes IPP (2018) Genetic diversity of \u003cem\u003eGossypium barbadense\u003c/em\u003e from the central Brazilian Amazon. \u003cem\u003eActa Amazonica\u003c/em\u003e 48: 1\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eRodrigues JIS, Carvalho LP and Farias FJC (2016) Comparison of wild accessions of \u003cem\u003eGossypium barbadense\u003c/em\u003e L. from Peru and Brazil via microsatellite markers. \u003cem\u003eBioscience Journal\u003c/em\u003e 32: 1352\u0026ndash;1363. \u003c/li\u003e\n\u003cli\u003eVasconcelos UAA, Cavalcanti JJV, Farias FJC, Vasconcelos WS and Santos RC (2018) Diallel analysis in cotton (\u003cem\u003eGossypium hirsutum\u003c/em\u003e L.) for water stress tolerance. \u003cem\u003eCrop Breeding and Applied Biotechnology\u003c/em\u003e 18: 24\u0026ndash;30. \u003c/li\u003e\n\u003cli\u003eAlbrana (2022) Algod\u0026otilde;es brasileiros nativos e naturalizados. CNPA Embrapa. http://www.cnpa.embrapa.br/albrana. Accessed 10 January 2022\u003c/li\u003e\n\u003cli\u003eSabev P, Valkova N and Todorovska EG (2020) Molecular markers and their application in cotton breeding: progress and future perspectives. \u003cem\u003eBulgarian Journal of Agricultural Science\u003c/em\u003e 26: 816\u0026ndash;828.\u003c/li\u003e\n\u003cli\u003eMarwal A and Gaur RK (2020). Molecular markers: tool for genetic analysis. In: Verma A, Singh A. (ed) \u003cem\u003eAnimal Biotechnology\u003c/em\u003e. Cambridge: Academic Press Elsevier, pp. 353\u0026ndash;372.\u003c/li\u003e\n\u003cli\u003eGemmill CE and Grierson ER (2021) Inter-Simple Sequence Repeats (ISSR), microsatellite-primed genomic profiling using universal primers. Mol Plant Taxonomy 2222: 249\u0026ndash;262. \u003c/li\u003e\n\u003cli\u003eDoyle JJ and Doyle JL (1987) Isolatin of plant DNA from fresh tissue. \u003cem\u003eFocus\u003c/em\u003e 12: 13\u0026ndash;15.\u003c/li\u003e\n\u003cli\u003eBotstein D, White RL, Skolnick M and Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. \u003cem\u003eAmerican Journal of Human Genetics\u003c/em\u003e 32: 314\u0026ndash;331.\u003c/li\u003e\n\u003cli\u003eNei M (1973) Analysis of gene diversity in subdivided populations. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e 70: 3321\u0026ndash;3323.\u003c/li\u003e\n\u003cli\u003eMcDermott JM and McDonald BA (1993) Gene flow in plant pathosystem. \u003cem\u003eAnnual Review of Phytopathology \u003c/em\u003e31: 353\u0026ndash;373.\u003c/li\u003e\n\u003cli\u003eYeh FC, Boyle TYZ and Xiyan JM (1999) \u003cem\u003ePOPGENE: Microsoft Window-based freeware for population genetic analysis. Version 131.\u003c/em\u003e Edmonton: University of Alberta. \u003c/li\u003e\n\u003cli\u003eRohlf FJ (2000) NTSYS-pc: numerical taxonomy and multivariate analysis system: version 2.1. Exeter Software, New York\u003c/li\u003e\n\u003cli\u003ePritchard JK, Stephens M and Donnelly P (2000) Inference of population structure using multilocus genotype data. \u003cem\u003eGenetics\u003c/em\u003e 155: 945\u0026ndash;959\u003c/li\u003e\n\u003cli\u003eEarl DA and Von-Holdt BM (2012) Structure Harvester: a website and program for visualizing STRUCTURE output and implementing the Evanno method. \u003cem\u003eConservation Genetics Resources\u003c/em\u003e 4: 359\u0026ndash;361. \u003c/li\u003e\n\u003cli\u003eEvanno G, Regnaut S and Goudet J (2005) Detecting the number of clusters of individuals using the software structure: a simulation study. \u003cem\u003eMolecular Ecology\u003c/em\u003e 14: 2611\u0026ndash;2620. \u003c/li\u003e\n\u003cli\u003eKhan MMH, Rafii MY, Ramlee SI, Jusoh M, Al Mamun M and Halidu J. (2021). DNA fingerprinting, fixation-index (Fst), and admixture mapping of selected Bambara groundnut (\u003cem\u003eVigna subterranea\u003c/em\u003e [L.] Verdc.) accessions using ISSR markers system. \u003cem\u003eScientific Reports\u003c/em\u003e 1: 1\u0026ndash;23. \u003c/li\u003e\n\u003cli\u003eBilwal BB, Vadodariya KV, Rajkumar BK, Upadhyay AK and Lahane GR (2017) Genetic diversity of parents using RAPD, ISSR and SSR molecular markers in upland cotton (\u003cem\u003eGossypium hirsutum\u003c/em\u003e L.). \u003cem\u003eBulletin of Environment, Pharmacology and Life Sciences\u003c/em\u003e 6: 51\u0026ndash;57.\u003c/li\u003e\n\u003cli\u003eGhuge SB, Mehetre SS, Chimote VP, Pawar BD and Naik RM (2018) Molecular characterization of cotton genotypes using SSR, ISSR and RAPD markers in relation to fiber quality traits. \u003cem\u003eJournal of Cotton Research\u003c/em\u003e 32: 1\u0026ndash;12.\u003c/li\u003e\n\u003cli\u003eNimbal S, Kuldeep J and Pawan K (2020) Molecular diversity analysis among elite genotypes of American cotton (\u003cem\u003eGossypium hirsutum\u003c/em\u003e L.). \u003cem\u003ePantnagar Journal of Research\u003c/em\u003e 18: 1\u0026ndash;4.\u003c/li\u003e\n\u003cli\u003eTajik-Khaveh Z, Iranbakhsh A, Vafaie-Tabar M and Ebadi M (2020) Study of genetic variation among some \u003cem\u003eGossypium\u003c/em\u003e spp. genotypes available in Iran using ISSR molecular marker. \u003cem\u003eRostaniha\u003c/em\u003e 21: 264\u0026ndash;277.\u003c/li\u003e\n\u003cli\u003eŞahin CB, İşler N and Rustamova V (2020) Characterization of some cotton varieties using ISSR markers. \u003cem\u003eKSU Journal of Agriculture and Nature\u003c/em\u003e 23: 108\u0026ndash;116.\u003c/li\u003e\n\u003cli\u003eHocaoglu-Ozyigit A, Ucar B, Altay V and Ozyigit II (2020) Genetic diversity and phylogenetic analyses of Turkish cotton (\u003cem\u003eGossypium hirsutum\u003c/em\u003e L.) lines using ISSR markers and chloroplast trnL-F regions. \u003cem\u003eJournal of Natural Fibers\u003c/em\u003e 17: 1\u0026ndash;14. \u003c/li\u003e\n\u003cli\u003eSevindik E, \u0026Ccedil;ayir EM, Emrebaş T and Filiz E (2021) Assessment of phylogenetic relationships of some worldwide-cultivated cotton genotypes (\u003cem\u003eGossypium hirsutum\u003c/em\u003e L.) by using ISSR and RAPD markers. \u003cem\u003eBiologica Nyssana\u003c/em\u003e 12: 131\u0026ndash;139.\u003c/li\u003e\n\u003cli\u003eStephens SG (1946) The genetics of \u0026apos;\u0026apos;Corky\u0026apos;\u0026apos;. The New World alleles and their possible role as an interspecific isolating mechanism. \u003cem\u003eJournal of Genetics\u003c/em\u003e 47: 150\u0026ndash;161.\u003c/li\u003e\n\u003cli\u003ePereira GS, Sousa RL, Ara\u0026uacute;jo RL, Hoffmann LV, Silva EF and Barroso PAV (2012). Selective fertilization in interspecific crosses of allotetraploid species. \u003cem\u003eBotany\u003c/em\u003e 90: 159\u0026ndash;166. \u003c/li\u003e\n\u003cli\u003eFreire EC (2000) Distribui\u0026ccedil;\u0026atilde;o, coleta, uso e preserva\u0026ccedil;\u0026atilde;o das esp\u0026eacute;cies silvestres de algod\u0026atilde;o no Brasil. Embrapa. https://www.embrapa.br/busca-de-publicacoes/-/publicacao/272012/distribuicao-coleta-uso-e-preservacao-das-especies-silvestres-de-algodao-no-brasil. Accessed 20 Jan 2022. \u003c/li\u003e\n\u003cli\u003eHinze LL, Fang DD, Gore MA, Scheffler BE, Yu JZ, Frelichowski J and Percy RG (2015) Molecular characterization of the \u003cem\u003eGossypium\u003c/em\u003e diversity reference set of the US national cotton germplasm collection. \u003cem\u003eTheoretical and Applied Genetics\u003c/em\u003e 128: 313\u0026ndash;327. \u003c/li\u003e\n\u003cli\u003eHinze LL, Gazave E, Gore MA, Fang DD, Scheffler BE, Yu JZ, Jones DC, Frelichowski J, Percy RG (2016) Genetic diversity of the two commercial tetraploid cotton species in the \u003cem\u003eGossypium \u003c/em\u003ediversity reference set. \u003cem\u003eJournal of Heredity\u003c/em\u003e 107: 274\u0026ndash;286. \u003c/li\u003e\n\u003cli\u003eEmbrapa (2001) BRS 200 marron: cultivar de algod\u0026atilde;o de fibra colorida. Embrapa Algod\u0026atilde;o. https://www.embrapa.br/busca-de-publicacoes/-/publicacao/276144/brs-200-marrom--cultivar-de-algodao-de-fibra-colorida . Accessed 20 Jan 2022. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Gossypium, genetic resource, molecular markers, DNA fingerprinting","lastPublishedDoi":"10.21203/rs.3.rs-1902987/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1902987/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground \u003c/strong\u003eThe perennial cotton species \u003cem\u003eGossypium hirsutum\u003c/em\u003e L. r. marie-galante Hutch. and \u003cem\u003eGossypium barbadense\u003c/em\u003e L. are sources of variability for creating modern cotton varieties. However, these species are similar in shape and easily confused in young stages of their life, leading to difficulties in identification based on their morphology. Thus, in this study, an Inter-Simple Sequence Repeat (ISSR) marker system was used as a measure of genetic differentiation among 28 genotypes of perennial cotton\u003cem\u003e \u003c/em\u003efrom a Brazilian collection. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods and Results\u003c/strong\u003e A set of eleven ISSR primers yielded 101 bands, of which 48 (47.5%) were polymorphic. The mean values of polymorphism information content (\u003cem\u003ePIC\u003c/em\u003e=0.304) and polymorphism (\u003cem\u003eP\u003c/em\u003e=45.8%) showed that the ISSR primers are moderately informative. The ISSR markers exposed the high genetic differentiation (\u003cem\u003eG\u003c/em\u003e\u003csub\u003e\u003cem\u003eST\u003c/em\u003e\u003c/sub\u003e = 0.598) and a low level of gene flow (\u003cem\u003eN\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e = 0.338) between species, which suggests a pattern of reproductive isolation. The Cluster Analysis, based on Nei's genetic identity, clustered the 28 genotypes into two groups consistent with the taxonomical delimitation, occurrence mode (semi-domesticated and improved types) and partial concordance with geographic origin. Bayesian model-based structural analysis also suggests the existence of two genetic groups (Delta K = 2) and high membership likelihood (Q\u0026gt;0.98). \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e The ISSR marker system offers a new molecular approach to differentiate the \u003cem\u003eG. hirsutum\u003c/em\u003e L. r. marie-galante and \u003cem\u003eG. barbadense\u003c/em\u003e L. species. This study can expand the molecular marker resources for the identification and improvement of our knowledge about the genetic relationships between perennial cotton genotypes from Brazilian collections.\u003c/p\u003e","manuscriptTitle":"Genetic polymorphism detection in semi-domesticated perennial cotton (Gossypium ssp.) using an ISSR marker system and its application for molecular interspecific differentiation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-08-09 00:19:43","doi":"10.21203/rs.3.rs-1902987/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2022-08-22T17:32:46+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-08-02T12:47:06+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-07-29T14:54:22+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2022-07-27T16:58:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"cf2e88c7-c276-45f9-b788-55c922e2357b","owner":[],"postedDate":"August 9th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-10-16T18:27:52+00:00","versionOfRecord":{"articleIdentity":"rs-1902987","link":"https://doi.org/10.1007/s11033-022-08165-8","journal":{"identity":"molecular-biology-reports","isVorOnly":false,"title":"Molecular Biology Reports"},"publishedOn":"2023-01-18 18:23:59","publishedOnDateReadable":"January 18th, 2023"},"versionCreatedAt":"2022-08-09 00:19:43","video":"","vorDoi":"10.1007/s11033-022-08165-8","vorDoiUrl":"https://doi.org/10.1007/s11033-022-08165-8","workflowStages":[]},"version":"v1","identity":"rs-1902987","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1902987","identity":"rs-1902987","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}