The conserved SEN1 DNA:RNA helicase has multiple functions during yeast meiosis

The conserved SEN1 DNA:RNA helicase has multiple functions during yeast meiosis | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results The conserved SEN1 DNA:RNA helicase has multiple functions during yeast meiosis View ORCID Profile Robert Gaglione , View ORCID Profile Jonathan Caradonna , View ORCID Profile Amy J. MacQueen , View ORCID Profile Ed Luk , View ORCID Profile Nancy M. Hollingsworth doi: https://doi.org/10.1101/2025.04.10.648140 Robert Gaglione 1 Department of Biochemistry and Cell Biology, Stony Brook University , Stony Brook, New York, United States of America , Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Robert Gaglione Jonathan Caradonna 1 Department of Biochemistry and Cell Biology, Stony Brook University , Stony Brook, New York, United States of America , Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jonathan Caradonna Amy J. MacQueen 2 Department of Molecular Biology and Biochemistry, Wesleyan University , Middletown, Connecticut, United States of America , Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Amy J. MacQueen Ed Luk 1 Department of Biochemistry and Cell Biology, Stony Brook University , Stony Brook, New York, United States of America , Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Ed Luk Nancy M. Hollingsworth 1 Department of Biochemistry and Cell Biology, Stony Brook University , Stony Brook, New York, United States of America , Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Nancy M. Hollingsworth For correspondence: Nancy.Hollingsworth{at}stonybrook.edu Abstract Full Text Info/History Metrics Preview PDF ABSTRACT Diploid Saccharomyces cerevisiae cells undergo meiosis when they are starved of nitrogen in the presence of a non-fermentable carbon source. Nutrient starvation triggers expression of Ime1, a master regulatory protein required to activate transcription of meiotic “early genes” that mediate premeiotic S phase and prophase I processes, including recombination and chromosome synapsis. During prophase I, the highly conserved, toposomerase-like protein, Spo11, creates double strand breaks that are used to identify homologous chromosomes and generate crossovers between them. DNA:RNA hybrids are formed when an RNA molecule anneals to a complementary strand of DNA and are present at the ends of double strand breaks during prophase I of meiosis in a variety of organisms. DNA:RNA hybrids can be removed by degradation of the RNA by RNase H or by unwinding of the RNA by an essential, multi-functional DNA:RNA helicase called Sen1. Sen1 is orthologous to the mammalian Senataxin ( SETX ) helicase. Phenotypic characterization of mouse mutants lacking either Senataxin or RNase H activity exhibit male infertility and defects in double strand break repair. SETX is also required for meiotic sex chromosome inactivation, making it unclear whether SETX ’s role in meiotic recombination is direct or an indirect consequence due to defects in SETX functions that affect transcription. Using a variety of orthogonal approaches, this work demonstrates that SEN1 has multiple, temporally distinct roles that promote yeast meiosis. First, it enables the timely expression of IME1 -regulated early genes. Second, it helps prevent and/or remove DNA:RNA hybrids that form during premeiotic S phase. Third, it facilitates both repair of Spo11 generated double strand breaks generated during prophase I and chromosome synapsis. AUTHOR SUMMARY DNA:RNA hybrids are unusual structures found throughout the genomes of many species, including yeast and mammals. While DNA:RNA hybrids may promote various cellular functions, persistent hybrids lead to double strand breaks, resulting in genomic instability. DNA:RNA hybrid formation and removal are therefore highly regulated by enzymes that either degrade or unwind RNA from the hybrid. Meiosis is the specialized cell division that creates haploid gametes for sexual reproduction. Previous work in yeast and mammals showed that elimination of DNA:RNA hybrids by RNase H facilitates meiotic recombination. This work demonstrates that the conserved Sen1 DNA:RNA helicase regulates the presence of DNA:RNA hybrids in three temporally distinct processes during yeast meiosis. First, SEN1 allows for meiosis-specific genes to be expressed at the proper time to allow entry into meiosis. Second, SEN1 prevents the accumulation of hybrids during premeiotic DNA replication. Third, SEN1 promotes the repair of programmed meiotic double strand breaks that are necessary to form crossovers between homologous chromosomes to allow their proper segregation at the first meiotic division. Given the evolutionary conservation of Sen1 with its mammalian counterpart, Senataxin, studies of Sen1 function in yeast are likely to be informative about the regulation of DNA:RNA hybrids during humans as well. INTRODUCTION DNA:RNA hybrids arise in cells when an RNA molecule base pairs with a complementary single strand of DNA. If the RNA associates with a duplex of DNA, the DNA strand of like polarity is displaced, creating a specific structure called an R-loop. It is estimated that 5-10% of the genome contains DNA:RNA hybrids [ 1 ]. DNA:RNA hybrids have beneficial effects in a variety of cellular processes, including transcriptional termination, chromatin structure, kinetochore function at metaphase I of meiosis and repression of anti-sense transcription [ 2 – 5 ]. However, R-loops that persist lead to the creation of double strand breaks (DSBs), resulting in genomic instability [ 6 – 10 ]. DNA:RNA hybrids present at the ends of DSBs may either help or hinder DSB repair by promoting resection or blocking recombinases from binding to resected single stranded (ss) ends, respectively [ 1 , 11 – 17 ]. Furthermore, in some cases, the presence of too few or too many hybrids is deleterious, indicating that the amount of DNA:RNA hybrids must be tightly regulated [ 3 , 17 ]. The importance of regulating DNA:RNA hybrids is also evident by the numerous mechanisms and proteins involved in preventing or removing them [ 1 , 18 , 19 ]. One way to eliminate DNA:RNA hybrids is degradation of the RNA by the conserved RNase H1 and RNase H2 enzymes [ 7 , 20 , 21 ]. An alternative mechanism is to unwind the RNA from the DNA using a DNA:RNA helicase such as the conserved, essential 5’-3’ yeast helicase, Sen1. Sen1 is orthologous to the mammalian helicase, Senataxin [ 22 – 25 ]. The Sen1 protein is multi-functional; for example, in addition to resolving R-loops, Sen1 forms a complex with Nrd1 and Nab3 to mediate transcriptional termination of unstable non-coding RNAs, as well small nucleolar RNAs. Through this activity, Sen1 influences the distribution of RNA polymerase II across the genome [ 22 ]. Given that DNA:RNA hybrids influence the repair of DSBs in vegetatively growing cells, an interesting question is whether they affect DSB repair of the programmed DSBs that initiate recombination during meiosis. Recent work looking at meiosis in mice, nematodes, and yeast defective in RNase H activity supports this idea. Mice in which RNase H1 was specifically knocked down in the germline exhibit male infertility, and spermatocytes display DSB repair defects and prophase I arrest [ 11 ]. DNA:RNA hybrids also accumulate in the nematode germline in rnh-1.0 rnh-2 mutants [ 26 ]. Budding yeast strains containing rnh1Δ rnh201Δ lack RNase H activity and the resulting defects are exacerbated by deletion of HPR1 , which disrupts the THO complex that binds to nascent messenger RNAs and assists in their maturation and nuclear export [ 17 , 27 – 29 ]. Both rnh1Δ rnh201Δ and rnh1Δ rnh201Δ hpr1Δ diploids exhibit delayed meiotic progression and reduced spore viability [ 17 , 30 , 31 ]. Cytological and genomic studies in yeast using the S9.6 antibody to detect DNA:RNA hybrids in mutants lacking RNase H activity showed that hybrids form on ssDNA at the ends of DSBs generated by the meiosis-specific Spo11 protein during prophase I [ 17 , 31 , 32 ]. Furthermore, in both yeast and mammals lacking RNase H activity, loading of the Rad51 and Dmc1 recombinases to ssDNA ends is impaired and interhomolog recombination is reduced by the presence of DNA:RNA hybrids [ 11 , 17 ]. Interestingly, experiments mapping the genomic locations of DNA:RNA hybrids in rnh1Δ rnh201Δ diploids showed that hybrids also accumulate during premeiotic S phase at places where there are head-on, but not co-directional, collisions between replication and transcription (called TRCs for Transcription Replication Conflicts) [ 31 ]. Given that RNase H-mediated degradation of DNA:RNA hybrids promotes meiotic DSB repair, is the same true for Senataxin/Sen1 helicase activity? SETX , the gene that encodes Senataxin, is required for proper mammalian meiosis, as SETX -/- mutants exhibit male infertility, as well as defects in DSB repair and crossover formation, accumulation of DNA:RNA hybrids and increased apoptosis during prophase I [ 33 , 34 ]. In addition, SETX is required for meiotic sex chromosome inactivation (MSCI) [ 33 , 35 ]. To see if SEN1 similarly affects meiotic DSB repair in yeast, phenotypic analysis was conducted in this study using meiotic cells depleted for Sen1. Meiosis in yeast occurs in the context of a larger process called sporulation, which results in the packaging of the four haploid genomes into gametes called spores [ 36 ]. Diploid cells are induced to sporulate when they are starved for nitrogen in the presence of a nonfermentable carbon source. These conditions result in the expression of Ime1 which, in a complex with Ume6, activates the transcription of a set of “early” meiosis-specific genes [ 37 – 41 ]. The early genes include those necessary for premeiotic DNA synthesis, meiotic recombination and synaptonemal complex formation. Recombination occurs when the 5’ ends of Spo11-generated DSBs are resected, creating 3’ ssDNA tails to which the Rad51 and Dmc1 recombinases bind [ 42 – 44 ]. The resulting nucleoprotein filaments search the genome for homology and preferentially mediate strand invasion of homologs to form intermediates that are then processed to become either crossovers or noncrossovers [ 45 , 46 ]. An intermediate step in the crossover recombination pathway triggers synapsis, the process whereby a tripartite structure called synaptonemal complex (SC) assembles between homologous chromosomes [ 47 ].Crossovers, in combination with sister chromatid cohesion, physically connect homologs, allowing them to segregate properly at Meiosis I. The repair of DSBs is monitored by the meiotic recombination checkpoint (MRC) [ 48 , 49 ]. The meiosis-specific kinase Mek1 is activated by DSBs [ 50 , 51 ]. Mek1 inhibits the meiosis-specific transcription factor Ndt80 by phosphorylating its DNA binding domain [ 52 ]. As DSBs are repaired, Mek1 activity is decreased, allowing Ndt80 to bind the promoters of its target genes and activate transcription of the “middle genes” such as CDC5 , the polo-like kinase that enables the completion of recombination and exit from prophase I, as well as genes required for Meiosis I and II and spore formation [ 36 , 53 , 54 ]. This work demonstrates that SEN1 facilitates three temporally distinct processes during sporulation. First, SEN1 promotes the timely expression of Ime1-Ume6 regulated early genes to allow entry into meiosis. Second, SEN1 prevents the accumulation of DNA:RNA hybrids during premeiotic S phase. Third, during prophase I, SEN 1 promotes the repair of Spo11-generated DSBs and is required for proper chromosome synapsis. RESULTS SEN1 promotes meiotic progression, sporulation and spore viability in yeast Because SEN1 is essential, a meiotic depletion allele ( sen1-md ) was created by placing SEN1 under transcriptional control of the CLB2 promoter, which is not active during meiosis [ 55 , 56 ]. Sen1 protein levels were monitored using a newly developed α-Sen1 antibody. To validate the antibody, SEN1 and sen1-ΔN , (an allele that encodes an N- terminal truncation that lacks the first 1003 amino acids out of 2231) were placed under the control of the meiosis-specific REC8 promoter and transformed into a sen1-md diploid [ 57 ]. Throughout the text, sen1-md :: PREC8-SEN1 strains are referred to simply as PREC8-SEN1 . The diploids were then induced to undergo meiosis. Protein samples from different time points were analyzed on immunoblots probed with α-Sen1 antibodies. In the PREC8-SEN1 diploid, a single band corresponding to Sen1’s predicted molecular weight of 253 kD was observed (S1 Fig). Furthermore, this protein was induced after four hours in Spo medium compared to vegetative cells (0 hours), consistent with SEN1 expression being driven by the REC8 promoter after transfer to Sporulation (Spo) medium. In the extracts from the PREC8-sen1-ΔN diploid, the ∼250 kD band was replaced by a less abundant protein of ∼150 kD, which is close to the expected molecular weight of the Sen1 1004-2231 truncated fragment (135 kD), confirming the antibody’s specificity for Sen1 (S1 Fig). Timecourses using SEN1 and sen1-md diploids confirmed the depletion of the Sen1 protein during meiosis. In the wild-type (WT) diploid, Sen1 protein levels remained relatively constant throughout meiosis ( Fig 1A ). By contrast, the amount of Sen1 protein in vegetative cells at 0 hour in the sen1-md diploid was reduced relative to WT. Sen1 protein levels decreased to below the limit of detection by 3 hours in Spo medium ( Fig 1A ). Download figure Open in new tab Fig 1. Meiotic depletion of Sen1 results in a prophase delay and reduces sporulation and spore viability. (A) Protein extracts from the indicated meiotic timepoints were generated from SEN1 (NH716) and sen1-md (NH2667) diploids and probed on immunoblots with the α-Sen1 antibody. (B) Meiotic progression was followed by staining fixed cells at the indicated timepoints with DAPI and determining the frequency of MI (binucleate) and MII (tetranucleate) cells by fluorescence microscopy. 200 cells were counted at each timepoint for each replicate. SEN1 ( n = 7); sen1-md ( n = 10); PREC8-SEN1 (NH2667::pNH410) ( n = 9). The averages of the biological replicates for each strain were plotted. (C) Whole cell Red1 immunofluorescence. To determine the frequency of cells in prophase I, whole cell immunofluorescence using α-Red1 antibodies was performed at the indicated timepoints in SEN1 and sen1-md diploids. The % maximum Red1 + cells from an average of five replicates was plotted. (D) Sporulation. Cultures derived from different single colonies of the indicated strains were sporulated in liquid Spo medium and the number of asci out of 200 cells was determined by light microscopy. Each dot represents a biological replicate. SEN1 ( n = 25); sen1-md ( n = 29); PREC8-SEN1 ( n = 17) (E) Spore viability. Tetrads from the cultures sporulated in Panel D were dissected to determine the frequency of viable spores. Each dot represents the spore viability of one biological replicate containing 23-28 dissected tetrads. The statistical significance of differences between the strains in Panels D and E was determined using the Mann-Whitney test (**** = p <0.0001). ns = not significant. (F) Distribution of viable spores in tetrads. The total number of tetrads for each strain was SEN1 (623), sen1-md (728) and PREC8-SEN1 (395). Phenotypic characterization of the sen1-md diploid revealed several meiotic defects. Meiotic progression was examined by staining the DNA with a fluorescent dye and counting the number of nuclei per cell. Binucleate cells indicate completion of Meiosis I (MI), while tetra-nucleate cells indicate completion of Meiosis II (MII) (S2 Fig). On average, <30% of sen1-md cells progressed past MI, and those that did were delayed relative to WT ( Fig 1B ). In addition, both sporulation and spore viability were significantly reduced in the sen1-md diploid ( Fig 1D , 1E). Mutants that decrease interhomolog crossovers exhibit higher levels of inviable spores due to MI non-disjunction. As a result, the number of tetrads in which all four spores are viable goes down, with a coordinated increase in the number of tetrads with two and zero viable spores [ 58 ]. This pattern was not observed for sen1-md ( Fig 1F ). While the number of tetrads with 4 viable spores (4:0) was greatly reduced, all other tetrad classes (3:1, 2:2, 1:3, 0:4) were increased, indicating that sen1-md spore lethality is unlikely due to MI chromosome mis-segregation ( Fig 1F ). While the reduced amount of Sen1 protein present in vegetative sen1-md cells is sufficient for viability, it may not be sufficient for other SEN1 functions ( Fig 1A ). This fact raises the possibility that the meiotic progression delay, reduced sporulation and decreased spore viability phenotypes result from DNA damage incurred during vegetative growth, rather than defects in meiotic processes. To test this idea, a PREC8- SEN1 strain was examined to see if expressing SEN1 after the initiation of meiosis meiosis is able to complement sen1-md meiotic phenotypes. In fact, PREC8-SEN1 partially rescued the meiotic progression delay and sporulation defect ( Fig 1B , 1D) and restored spore viability to WT levels ( Fig 1E ). Thus, meiosis-specific expression of SEN1 is sufficient to reverse the meiotic defects of the sen1-md mutant, suggesting a requirement for Sen1 activity during normal meiosis. A delay in meiotic progression was previously observed in the absence of RNase H activity ( rnh1Δ rnh201Δ ) where it is known that DNA:RNA hybrids form on the single- stranded tails of DSBs, thereby making them difficult to repair [ 17 , 31 ]. The MRC delays exit from prophase I when a threshold number of DSBs is present. If the meiotic progression delay in sen1-md is also due to impaired meiotic DSB repair, then cells should take longer to exit prophase I. Prophase I cells can be distinguished using whole cell immunofluorescence with antibodies that detect Red1, a meiosis-specific axial element protein that is degraded upon exit from pachytene [ 54 , 59 , 60 ]. This analysis found that both entry into and exit from prophase I were affected in the sen1-md diploid, indicating there are two separate components to the meiotic progression delay. First, while the upward slopes representing progression to a mid-prophase I stage (where Red1 is maximally abundant in pachytene) were similar between SEN1 and sen1-md , the sen1-md cells reached a peak level of maximal mid-prophase I nuclei one hour later than WT ( Fig 1C ). Second, the sen1-md downward slope due to exit from prophase I was shallower than WT and almost 15% of the cells remained in prophase I at 12 hours ( Fig 1C ). This result indicates that SEN1 is required for timely progression into and through prophase I. SEN1 promotes expression of IME1/UME6 regulated genes REC8 is an early meiotic gene whose transcription is activated by the Ime1- Ume6 complex [ 37 , 38 , 41 , 61 ]. One explanation for why PREC8-SEN1 only partially rescues the sen1-md meiotic progression delay is that SEN1 promotes the timely transcription of genes regulated by Ime1-Ume6. As a first test of this hypothesis, the timing of expression for several early meiosis-specific proteins encoded was examined. HOP1 , RED1 and REC8 encode meiosis-specific components of the axial elements formed along sister chromatids [ 59 , 61 – 63 ]. MEK1/MRE4 encodes a meiosis- specific kinase that regulates many different steps of meiotic recombination, as well as the MRC [ 52 , 64 – 70 ]. Hed1 is a meiosis-specific protein that binds to Rad51 to inhibit its strand exchange activity during prophase I [ 71 , 72 ]. Mek1 phosphorylation of Hed1 threonine 40 stabilizes the protein and can be used as a marker for Mek1 kinase activity [ 53 , 73 ]. In the WT diploid, Rec8 protein was first observed after 2 hours in Spo medium, its level peaked at 4 hours and was nearly undetectable by 8 hours (S1B Fig). By 4 hours, most of the cells were in prophase I, as indicated by peak levels of Red1 and meiotic DSBs [indirectly indicated by Hop1 phosphorylation (pHop1)] ( Fig 1C , S1B Fig) [ 74 ]. Mek1 activity, indicated by phosphorylated Hed1(pHed1), also peaked at four hours, in keeping with the larger amount of phosphorylated Hop1 (S1B Fig)[ 73 ]. Red1 was nearly gone by 6 hours consistent with cells progressing into MI ( Fig 1B , 1C and S1B Fig). In contrast, all 5 proteins in the sen1-md diploid peaked later than 4 hours and were still present at 10 hours, consistent with a portion of the cells being delayed in prophase I. Notably, the Rec8 protein from the PREC8-SEN1 diploid exhibited similar expression kinetics as in sen1-md (S1B Fig). To more directly test the hypothesis that SEN1 promotes early gene transcription, RNA sequencing analysis was performed using cells taken at different times after transfer to Spo medium. As was previously observed, meiotic progression in the sen1- md diploid was delayed in this time course relative to WT ( Fig 2A ). Genes were grouped by k-means based on RNA expression patterns in the SEN1 diploid. The heat map for the WT strain exhibited gene clusters that agreed well with the literature ( Fig 2B ) [ 37 , 41 ]. When a subset of early genes from the WT diploid known to function in prophase I was examined, their expression in the WT diploid nearly uniformly peaked at 3 to 4 hours after transfer to Spo medium ( Fig 2C ). In contrast, expression of the same set of genes in the sen1-md mutant was delayed, with broader peaks occurring between 4 and 6 hours. The delay in early gene transcription correlated with the later appearance of IME1 transcripts, the master regulator for early gene transcription, in the sen1-md strain compared to WT ( Fig 2C ). As expected, the delay in early gene transcription coordinately delayed the expression of NDT80 -regulated middle genes ( Fig 2B , 2C). We propose that meiotic progression proceeds more slowly in sen1-md for two reasons: (1) a delay in the onset of early gene transcription, and (2) activation of the MRC due to the presence of unrepaired DSBs. This hypothesis would explain the partial rescue of the meiotic progression defect in PREC8-SEN1 . Ectopic expression of SEN1 during meiosis using PREC8-SEN1 allows DSB repair, thereby deactivating the MRC and allowing cells to progress faster than sen1-md . However, because SEN1 transcripts produced using the REC8 promoter appeared too late to fix the early gene transcription defect, the cells still exhibited a delay in progression through the early stages of meiosis. Download figure Open in new tab Fig 2. RNA sequencing analysis of SEN1 and sen1-md diploids during meiosis. SEN1 (NH2473) and sen1-md (NH2520) were transferred to Spo medium and cells were taken at various timepoints. (A) Meiotic progression. Fixed cells were stained with DAPI and examined by fluorescence microscopy for the presence of MI and MII cells. (B) RNA-seq analysis. mRNA was isolated at the indicated timepoints from the timecourse shown in Panel A. Numbers above each column indicate hours after transfer to Spo medium. The z value for each timepoint (n) was calculated as [(FPKMn- FPKMave)/SD], where FPKM = fragments per kilobase per million, SD = standard deviation and ave = average. Genes were sorted based on the RNA expression patterns in the SEN1 diploid by clustering analysis (k-means) using Cluster 3.0. The heat map was generated using Java TreeView. Green indicates z values 0. (C) A subset of previously identified IME1/UME6 -dependent early genes and NDT80 -dependent middle genes were selected and clustered as in Panel B. Gene names in orange encode proteins that were examined in S1b Fig, while IME1 is written in blue. The sen1-md delay in exiting prophase I is due to the meiotic recombination checkpoint The MRC is controlled by the meiosis-specific Mek1 kinase [ 49 , 52 , 75 ]. Mek1 is activated by the presence of DSBs [ 50 , 51 , 76 ]. When DSB levels are high, Mek1 phosphorylates and inhibits the meiosis-specific transcription factor, Ndt80, that is required for the expression of >300 genes, including CDC5 and CLB1 , which are involved in completing recombination and prophase I exit [ 52 – 54 , 77 ]. Mek1 interacts with Ndt80 through a five-amino acid sequence in the transcription factor and deletion of that sequence abrogates the MRC [ 52 ]. The NDT80 allele containing this five-codon deletion is referred to as NDT80-mid (Mek1 Interaction Defective). NDT80-mid specifically disrupts the MRC without affecting Mek1 kinase activity and cells progress through meiosis with the same kinetics as WT [ 60 ]. Therefore NDT80-mid is a useful tool for determining whether the MRC is triggered by a particular mutant. The MRC prevents or delays cells from exiting prophase I [ 49 , 60 , 78 ]. This phenotype can be indirectly examined by looking at the frequency of cells that proceed through MI to become binucleate. WT MI cells peaked at ∼13% after only 5 hours in Spo medium ( Fig 3A ). In contrast only ∼7% of the sen1-md cells had completed MI after 12 hours ( Fig 3A ). The onset of MI occurred later than WT in both NDT80-mid sen1-md and sen1-md due to the delay in early gene transcription. However, NDT80-mid sen1- md cells completed MI faster than sen1-md , peaking with ∼18% cells at 8 hours ( Fig 3A ). The fact that the MRC is responsible for the prophase I arrest/delay observed when Sen1 is meiotically depleted indicates that SEN1 is required for timely DSB repair. Download figure Open in new tab Fig 3. Meiotic progression and sporulation of sen1-md diploids containing NDT80-mid or mek1Δ . SEN1 ( n = 13), sen1-md ( n =20), NDT80-mid sen1-md (NH2667::pNH317 2 ) ( n = 4), mek1Δ (NH729) ( n = 6), and mek1Δ sen1-md (NH2669) ( n = 10) diploids were induced to undergo meiosis and the average frequency of the indicated cell types was determined at various time points as described in Fig 1B . (A, E) binucleate cells that have completed MI; (B, F) Post-MI contains both MII cells (tetranucleate) and cells with fragmented nuclei (>4 DAPI foci). (C, G) Cells with fragmented nuclei. (D,H) Different colonies from the diploids used in strains used in Panels A and E, as well as NDT80-mid PREC8-SEN1 (NH2667::pNH410::pNH317 2 ), mek1Δ PREC8-SEN1 (NH2669::pNH410), and mek1Δ PSEN1-SEN1 (NH2669::pBG28), were sporulated at 30°C on solid medium. Each dot represents a biological replicate for which the percentage of sporulated cells was determined for 200 cells. The SEN1 and sen1-md data are repeated in all of the graphs. Error bars indicate the means and standard deviations. Statistical significance of differences between strains was determined using the Mann-Whitney test (* = p <0.02; ** = p <0.002; *** = p <0.001; **** = p <0.0001). Although NDT80-mid allows sen1-md cells to exit prophase I, it does not rescue the sporulation defect ( Fig 3D ). This may be because allowing cells to proceed through the meiotic divisions with unrepaired DSBs resulted in fragmented nuclei, as indicated by the presence of more than 4 DAPI staining foci, similar to what is observed when the MRC is inactivated in dmc1Δ or sae2Δ diploids (S2 Fig)[ 78 , 79 ]. Cells containing either four nuclei (i.e complete MII) or fragmented nuclei were classified as “post-MI”. Greater than 80% of WT cells completed MII by 12 hours with <5% showing fragmented nuclei ( Fig 3B , 3C). In contrast, only ∼25% of sen1-md and NDT80-mid sen1-md cells proceeded past MI ( Fig 3B ). A major difference between these two strains, however, was that almost all the NDT80-mid sen1-md post-MI cells contained fragmented nuclei, compared to <5% of sen1-md cells ( Fig 3C ). Therefore, the prophase I delay created by the MRC in the sen1-md diploid provided time for most DSBs to be repaired. MEK1 controls not only the MRC, but also interhomolog bias and inhibition of Rad51 strand exchange activity [ 67 , 69 , 73 ]. For example, when MEK1 is inactive in a dmc1Δ mutant, cells progress through meiosis with intact chromosomes because Rad51 repairs DSBs using sister chromatids, thereby removing the signal that activates the MRC [ 49 , 74 ]. In contrast, if DSBs are unrepairable using either homologs or sister chromatids as templates (eg. sae2Δ or rad50S ), cells progress through meiosis with fragmented nuclei in the absence of the MRC [ 49 , 79 ]. Similar to NDT80-mid , combining mek1Δ with sen1-md resulted in faster entry into MI compared to sen1-md with a reduced number of post-MI cells ( Fig 3E , 3F). The increased frequency of fragmented nuclei in the mek1Δ sen1-md diploid suggests that DSBs persisted because they were unrepairable ( Fig 3G ). The sporulation defects of NDT80-mid sen1-md and mek1Δ sen1-md were rescued by PREC8-SEN1 to the same extent as the constitutively expressed PSEN1-SEN1 , consistent with a need for SEN1 during prophase I to allow DSB repair ( Fig 3D , 3H). SEN1 facilitates meiotic recombination at the HIS4LEU2 DSB hotspot To determine directly whether SEN1 promotes meiotic recombination, physical analyses using the HIS4LEU2 hotspot were performed. This well characterized hotspot has asymmetric XhoI sites that give rise to distinct bands corresponding to DSBs and crossovers (COs) that can be detected using Southern blots ( Fig 4A ) [ 80 ]. In addition, there is an NgoMIV site on one homolog adjacent to the region where Spo11 makes DSBs. Digestion with both XhoI and NgoMIV therefore also allows detection of noncrossovers (NCOs) resulting from gene conversion events involving the NgoMIV site [ 75 ]. Download figure Open in new tab Fig 4. Physical analysis of DSBs, crossover and noncrossover formation during meiosis in sen1-md and PREC8-SEN1 diploids. Time courses of SEN1 ( n = 2), sen1- md ( n = 3) and PREC8-SEN1 ( n = 3) diploids were performed and genomic DNA isolated from cells at the indicated timepoints. (A) Schematic of the HIS4LEU2 hotspot. The homologs, P1 and P2, have XhoI sites located at asymmetric positions. The dotted vertical line indicates where Spo11 makes DSBs. The NgoMIV site is adjacent to the DSB site on P1. The black box indicates the sequence used as a probe in Southern blot analysis. (B) DSBs: Genomic DNA was digested with XhoI to detect Spo11-generated breaks. The XhoI sites on the two homologs are slightly offset, resulting in two DSB fragments that undergo variable amounts of resection. (C) Average DSB values for the different replicates normalized to the total amount of DNA. (D) CO and NCO: Genomic DNA was digested with XhoI and NgoMIV. CO1 and CO2 indicate crossover bands, while NCO1 and NCO2 represent noncrossover bands. (E) % average CO2 values. (F) % average NCO1 values. The asterisk indicates a band containing a flanking XhoI site gene conversion. In the WT diploid, DSBs peaked at 3 hours after transfer to Spo medium and then rapidly disappeared ( Fig 4B , 4C). In contrast, DSB formation was delayed in both sen1-md and PREC8-SEN1 . This was expected as transcription of most of the genes required for making DSBs (eg. SPO11 , REC114 , REC102 and REC104 ) are dependent on Ime1/Ume6. DSBs also persisted longer in sen1-md than in either SEN1 or PREC8- SEN1 and were still detectable after 12 hours ( Fig 4C ). CO2 and NCO1 fragments that can be unambiguously identified on the XhoI/NgoMIV gel were quantified ( Fig 4D ). In the WT strain, CO formation plateaued by 6 hours. In contrast, CO formation in sen1-md was delayed and reduced by 25% at 12 hours, but still had not reached a plateau ( Fig 4D , 4E). The kinetics of CO formation in the PREC8-SEN1 strain was intermediate between WT and sen1-md , as expected if the sen1-md early gene transcription delay was coupled to more efficient DSB repair by SEN1 . However, for reasons that are unclear, the level of COs in the PREC8-SEN1 strain resembled that of sen1-md and did not reach WT levels. A different phenotype was observed for NCOs in the sen1-md diploid. Instead of being decreased, there were more NCOs at 12 hours compared to WT ( Fig 4D , 4F). This result could be because prophase I length is longer in many of the sen1-md cells, which delays the expression of the polo-like kinase, CDC5 , required for resolution of the double Holliday junctions into COs [ 54 ]. Furthermore, cells arrested in pachytene continue to make DSBs and produce NCOs by synthesis-dependent strand annealing [ 81 – 83 ]. The idea that the increase in NCO formation in sen1-md is due to a delay in prophase I exit is supported by the observation that the PREC8-SEN1 diploid, in which cells were able to progress, NCOs plateaued by 8 hours ( Fig 4D , 4F). SEN1 promotes chromosome synapsis during meiosis In budding yeast, meiotic DSB repair by a crossover specific pathway containing a functionally diverse set of “ZMM” proteins is required for SC formation [ 84 – 89 ]. The SC is a tripartite supramolecular chromosomal complex that initiates assembly from discrete chromosome sites associated with recombination (as well as from centromeres) and extends along the full lengths of aligned homologous chromosome axes [ 90 , 91 ]. SC formation in yeast is completely dependent on DSB formation and early processing. Diploids containing spo11Δ , sae2Δ or rad50S mutants exhibit only aggregates of SC structural proteins (polycomplexes) instead of linear SC structures, while the DSB repair defects of dmc1Δ or msh4Δ are associated with an overall dcrease and delay in SC formation, rather than a complete abrogation of SC [ 92 – 98 ]. Diploids homozygous for ndt80Δ arrest in pachynema, the stage of prophase I when chromosomes are fully synapsed [ 99 ]. The ability of ndt80Δ sen1-md diploids to assemble SCs was assessed by examining the distribution of SC structural components Zip1 (an SC transverse filament protein) and Gmc2 (part of the SC central element) on surface-spread meiotic chromosomes that displayed maximal Red1 accumulation after 5 hours in Spo medium [ 100 , 101 ]. At this timepoint, 83% (n=103) of the ndt80Δ control nuclei exhibited full-length or nearly full-length linear structures of Gmc2 throughout the entirety of the mid-prophase nucleus, while the remaining spread chromosomes showed shorter linear assemblies of Gmc2 ( Fig. 5A , 5B). By contrast, only 4% (n=103) of the surface-spread nuclei from the ndt80Δ sen1-md strain exhibited full-length linear Gmc2 structures, even though most spreads displayed Red1 accumulation on chromosome axes to the same extent as the ndt80Δ control. The remaining nuclei were nearly evenly divided between those that had only Gmc2 foci (50%) and those with shorter linear Gmc2 assemblies (46%). In some ndt80Δ sen1-md cells, the Gmc2 linear assemblies detected on chromatin co-localized with Zip1, indicating that these structures correspond to mature (albeit partial) SCs ( Figure 5A ). Polycomplexes containing Gmc2 were observed in 26% of the ndt80Δ spreads; this number was increased to 49% in the ndt80Δ sen1-md diploid (S1 Data). SEN1 therefore plays an important role in promoting chromosome synapsis during yeast meiosis. Download figure Open in new tab Fig 5. SC assembly in ndt80Δ and ndt80Δ sen1-md diploids The ndt80Δ (NH2188) and ndt80Δ sen1-md (AM6697) diploids were transferred to Spo medium for 5 hours at which time cells were processed to make chromosome spreads. (A) Immunofluorescence on surface-spread meiotic chromosomes to detect chromosome axes (Red) and the central element (Gmc2). Each row corresponds to a different surface-spread nucleus, with the genotypes indicated at left. DNA is labeled with DAPI (white, first column), anti-Red1 (magenta, second column), anti-Gmc2 (green) or anti-Zip1 (magenta, second panel). The last column shows the merged image. Bar, 1 μm. (B) Histogram of the fraction of total nuclei examined ( n =103 for each genotype) with complete SC (full linear structures of Gmc2 that extend throughout the full spread nucleus), incomplete SC (one or more shorter linear structures of Gmc2 that only partially extend throughout the surface-spread nucleus), or only foci of Gmc2. Note that only those surface-spread nuclei with maximal Red1 accumulation on chromosome axes were included in this analysis. SEN1 prevents formation of SPO11 -independent DSBs during meiosis If Spo11 generated meiotic DSBs are solely responsible for the MRC-mediated prophase I delay in the sen1-md diploid, then deleting SPO11 should rescue this delay. In fact, the sen1-md spo11Δ diploid progressed faster through MI than sen1-md , indicating that the MRC was no longer being triggered ( Fig 6A ). However, these chromosomes were predicted to be intact and therefore enter MII efficiently as is true for spo11Δ , but this was not the case ( Fig 6B ). Instead, sen1-md spo11Δ exhibited a reduced number of post-MII cells, an increase in cells with fragmented nuclei, and decreased sporulation ( Fig 6B , 6C, 6D). The presence of fragmented nuclei shows that DSBs were present in the sen1-md spo11Δ cells that were not directly created by Spo11. Download figure Open in new tab Fig 6. Meiotic progression and sporulation of sen1-md diploids containing spo11Δ. SEN1 , sen1-md , spo11Δ (NH1055, n = 10) and spo11Δ sen1-md (NH2689, n = 15) diploids were induced to undergo meiosis and the average frequency of the indicated cell types was determined at various time points as described in Fig 3 . The SEN1 and sen1-md data for panels A-C are the same at Fig 3 . (A) Cells that have completed MI; (B) Post-MI contains both MII cells and cells with fragmented nuclei (>4 DAPI foci). (C) Cells with fragmented nuclei. (D) Different colonies from the diploids used in Panels A-C, spo11Δ PREC8-SEN1 (NH2689::pNH410) and spo11Δ PSEN1-SEN1 (NH2689::pBG28) were sporulated at 30°C on solid medium. Each dot represents a biological replicate for which the frequency of sporulated cells was determined for 200 cells. The data for WT and sen1-md from Fig 3 are repeated in all of the graphs. Error bars indicate the means and standard deviations. Statistical significance of differences between strains was determined using the Mann-Whitney test (* = p <0.02; ** = p <0.002; *** = p <0.001; **** = p <0.0001). In contrast to NDT80-mid sen1-md and mek1Δ sen1-md , PREC8-SEN1 only weakly complemented the sporulation defect of sen1-md spo11Δ ( Fig 6D ). However, the sen1-md spo11Δ sporulation defect was completely rescued when SEN1 was constitutively expressed using PSEN1-SEN1 . This difference indicates that the timing of SEN1 transcription matters in the absence of SPO11 and argues that DSBs present in sen1-md spo11Δ are temporally separable and occur earlier than the Spo11 generated DSBs in sen1-md . SEN1 prevents accumulation of DNA:RNA hybrids during premeiotic S phase and prophase I The sen1-md meiotic phenotypes mirror those of rnh1Δ rnh201Δ and rnh1Δ rnh201Δ hpr1Δ diploids, suggesting they similarly arise from the failure to prevent DNA:RNA hybrids from accumulating during meiosis ( Fig 1 )[ 17 , 31 ]. To test this idea, the frequency of DNA:RNA hybrids (some of which may be R-loops) was compared between SEN1 and sen1-md at different times after transfer to Spo medium. DNA:RNA hybrids were detected as foci on chromosome spreads using the S9.6 antibody ( Fig 7A )[ 32 ]. The rnh1Δ rnh201Δ hpr1Δ diploid was used as a positive control as it has previously been shown that vegetative cells with this genotype exhibit numerous DNA:RNA hybrid foci using this antibody ( Fig 7A )[ 17 ]. To further validate the assay, chromosome spreads from rnh1Δ rnh201Δ hpr1Δ cells collected 9 hours after transfer to Spo medium were treated with RNase H prior to antibody staining. This treatment led to a significant reduction of S9.6 foci, confirming that they are DNA:RNA hybrids ( Fig 7B ). Download figure Open in new tab Fig 7. SEN1 decreases DNA:RNA hybrids during meiosis (A) Chromosome spreads were prepared from vegetatively growing SEN1 , sen1-md and rnh1Δ rnh201Δ hpr1Δ (LZY2919) diploids. The DNA was stained with DAPI (blue) and DNA:RNA hybrids were detected by immunofluorescence (red foci) using the S9.6 antibody. (B) Chromosome spreads from rnh1Δ rnh201Δ hpr1Δ cells at the 9 hr meiotic timepoint were treated with either bovine serum albumin (-RNase H) or RNase H (+RNase H) and then stained with the S9.6 antibody ( n = 2). (C) DNA:RNA hybrid foci were detected on chromosome spreads from SEN1 ( n = 4 or 5 depending on the timepoint), sen1-md ( n = 4, 5 or 6), spo11Δ ( n = 3) and sen1-md spo11Δ ( n = 3) at the indicated timepoints using the S9.6 antibody. n varies for some strains depending upon the timepoint. Two hundred spreads were examined for each biological replicate. Green bars indicate the mean values. Statistical significance was determined using the Mann-Whitney test (* = p <0.02; ** = p <0.002; *** = p <0.001; **** = p <0.0001). The sen1-md , spo11Δ and sen1-md spo11Δ diploids all exhibited a statistically significant increase in S9.6 foci at the 0 hour timepoint compared to WT ( Fig 7C ). This suggests that sen1-md allele is indeed hypomorphic in vegetative cells, that is, while viable, the reduced amount of Sen1 protein does have an effect. Given that SPO11 is a meiosis-specific gene that is not expressed in vegetative cells, it is unclear why the DNA:RNA hybrid signal was elevated in the spo11Δ diploid at 0 hours [ 102 ]. However, while the number of S9.6 foci in spo11Δ remained constant until decreasing at 9 hours, the frequency of DNA:RNA hybrids increased for both sen1-md and sen1-md spo11Δ diploids starting at 2 hours and remained high up to the 9 hour timepoint ( Fig 7C ). Furthermore, spo11Δ exacerbated the sen1-md phenotype, as more DNA:RNA hybrid foci were observed in the double mutant compared to sen1-md alone starting with the 2 hour timepoint. We conclude that during yeast meiosis, the amount of DNA:RNA hybrids is regulated by Sen1 as well as by RNase H activity. DISCUSSION SEN1 is a regulator of meiotic early gene expression In the wild, budding yeast cells are induced to undergo sporulation when they are starved for nutrients such as nitrogen and glucose. As a result, the haploid genomes produced by meiosis are packaged into spores that remain quiescent until nutrients return. Spores are resistant to a variety of stresses, including enzymes present in the fruit fly digestive tract, allowing yeast spores to be dispersed to new locations after being eaten [ 103 ]. Entry into meiosis is controlled by Ime1, a master transcriptional regulator that activates transcription of the “early genes” required for premeiotic S phase and prophase I [ 39 , 104 ]. Because the sen1-md mutant delayed the expression of all the early genes as well as IME1 , we propose that the reduced amount of Sen1 protein generated by the CLB2 promoter delays entry into meiosis by affecting transcription of IME1 (although alternative possibilities cannot be ruled out). The regulation of IME1 expression is complex, as it requires integration of signals relating to both mating type and nutrients (reviewed in [ 104 , 105 ]. The promoter of IME1 is approximately 2 kb in length [ 106 , 107 ]. Within the first 1.1 kb are multiple regulatory sites including ones that repress IME1 transcription when glucose is present or activate transcription when cells are exposed to acetate [ 107 ]. In haploid cells, this region of the IME1 promoter exists in a repressive chromatin state due to transcription of a long noncoding RNA called IRT1 that begins 1.4 kb upstream of the IME1 gene [ 108 ] ( Fig 8 ). This repressive chromatin prevents transcriptional activators such as Pog1 from binding to the IME1 promoter [ 108 ]. RME1 was originally identified as a repressor of meiosis [ 109 ]. Rme1 binds to two sites in the IME1 promoter upstream of IRT1 and its mechanism of repression is to activate transcription of IRT1 , thereby creating the repressive chromatin upstream of IME1 ( Fig 8 )[ 108 ]. Transcription of RME1 itself is repressed in diploids by the a1/α2 repressor encoded by MAT a and MAT α, thereby preventing transcription of IRT1 and allowing expression of IME1 when diploid cells are in Spo medium ( Fig 8 ). In some strain backgrounds (but not SK1), the repression of RME1 is leaky, thereby allowing a low level of IRT1 transcription that reduces the ability of these strains to sporulate [ 108 ]. Transcription of a second long non-coding RNA called IRT2 located immediately upstream of IRT1 prevents Rme1 from binding to its sites in the IME1 promoter, thereby, ensuring that no IRT1 transcripts are made ( Fig 8 )([ 110 ]. IRT2 transcription is activated by a complex formed between Ume6 and Ime1 [ 110 ]. Download figure Open in new tab Fig 8. A model for SEN1 ’s role in regulating IME1 transcription In haploid cells, RME1 -activated transcription of the long non-coding IRT1 RNA establishes a “repressive chromatin state” in the IME1 promoter that prevents transcription factors from binding, resulting in a low level of IME1 transcription. In diploid cells, the transcription of the RME1 gene is prevented by the a1/α2 repressor, thereby preventing IRT1 transcription [ 108 ]. Under sporulation conditions (Spo), transcription factors able to bind to the IME1 promoter and the gene is transcribed. Ime1 then binds to Ume6 upstream of IRT1 to activate transcription of a second long non-coding RNA called IRT2 that further prevents Rme1 from activating IRT1 expression [ 110 ]. We propose that SEN1 functions in transcriptional termination of IRT2 RNAs to prevent transcription of the IRT1 region of the IME1 promoter and that transcriptional termination is less efficient in the sen1-md diploid due to the reduced amount of Sen1 protein. As result, some IRT2 trans cripts extend through the IRT1 region, decreasing the amount of IME1 transcription. How might SEN1 affect IME1 regulation? The essential function of SEN1 is the termination of RNA polymerase II non-coding RNAs as part of a complex with Nrd1 and Nab3 (the NNS complex) [ 111 – 114 ]. When NNS-mediated transcription termination is defective, non-coding transcripts may be extended and interfere with the expression of nearby genes [ 115 , 116 ]. For example, mutation of a specific phosphosite in SEN1 results in readthrough transcription of a long non-coding RNA that interferes with transcription of ZAP1 , a gene that encodes a master regulator of zinc homeostasis [ 115 ]. Extension of a non-coding RNA through the promoter region of ZAP1 decreased the amount of RNA polymerase II at the promoter, as well as the amount of ZAP1 RNA. We propose a similar phenomenon is happening at the IME1 promoter in the sen1-md diploid. Failure to terminate some of the IRT2 transcripts would result in transcription proceeding through the IRT1 part of the promoter, thereby establishing repressive chromatin that would decrease the amount of IME1 transcription ( Fig 8 ). Thus, it may take longer to achieve the amount of Ime1 needed to initiate expression of the early genes. SEN1 functions prior to prophase I to prevent SPO11 -independent DSBs During S phase in vegetatively growing cells, R-loops accumulate at places where replication collides head-on with transcription (TRCs) [ 6 , 9 , 117 – 121 ]. When TRCs occur, positive supercoils accumulate between the replication forks and transcription machinery, stalling both processes. The transcribed RNAs may then base pair with the template strand of the DNA to make R-loops [ 120 ]. Sen1 associates with the replisome and helps prevent R-loops from forming at TRCs both by displacing RNA Pol II as well as coordinating the activities of topoisomerases I and II to relieve topological stress [ 117 , 118 , 120 , 121 ]. R-loops also accumulate at TRCs during premeiotic S phase [ 31 ]. When the precise genomic locations of R-loops were mapped in an rnh1Δ rnh201Δ SK1 diploid after transfer to Spo medium, an increase in R-loops at TRCs was observed over WT at the 2 hour timepoint when premeiotic S was occurring [ 31 , 122 ]. No increase in R-loop signal was detected when the orientation of a specific TRC was changed such that replication and transcription were co-directional. The R-loops at premeiotic TRCs are distinct from the DNA:RNA hybrids formed at Spo11-generated DSBs in that they do not co-localize with Spo11 hotspots and their levels are reduced at later timepoints when chromosomes have fully synapsed [ 31 ]. Interestingly deletion of SPO11 increased the frequency of R-loops at the premeiotic TRCs and these R-loops exhibited a similar distribution as the R-loops observed in the rnh1Δ rnh201Δ diploid [ 31 ]. Several observations support the idea that SEN1 also plays a role in preventing/removing R-loops at TRCs during premeiotic S phase for the following reasons. (1) sen1-md diploids exhibited a severe sporulation defect, in part because some cells arrested in prophase I due to unrepaired DSBs triggering the MRC. If the sen1-md sporulation defect was due solely to unrepaired Spo11 DSBs, then spo11Δ should have rescued sporulation in the sen1-md diploid, but this was not the case. (2) The MRC provides time for DSBs to get repaired, as eliminating the MRC in the sen1- md background using either NDT80-mid or mek1Δ increased the number of fragmented nuclei without improving sporulation. In both cases the sporulation defects were rescued by PREC8-SEN1 . In the sen1-md spo11Δ strain, the MRC was abrogated as expected, with an increase in MI cells compared to sen1-md . However, many cells that completed MI did not proceed through MII, perhaps because DSBs triggered the DNA damage checkpoint [ 76 ]. Most of the cells that progressed through MII exhibited fragmented nuclei, demonstrating the presence of SPO11 -independent DSBs. (3) The fact that PREC8-SEN1 only weakly rescued the sporulation defect of sen1-md spo11Δ , while PSEN1-SEN1 rescued completely, argues that the timing of PREC8-SEN1 expression was too late in the sen1-md spo11Δ diploid to effectively complement sen1-md . In contrast, PREC8-SEN1 expression was not too late to complement the failure to repair Spo11- generated DSBs in NDT80-mid sen1-md or mek1Δ sen1-md strains. These results suggest the SPO11 -independent DSBs arise at an earlier time than SPO11 -dependent prophase I DSBs. (4) DNA:RNA hybrid foci were increased after 2 hours in Spo medium in sen1-md compared to both WT at 2 hours and sen1-md at 0 hours. This phenotype was exacerbated in the absence of SPO11 . The latter finding is informative because spo11Δ diploids do not make the prophase I DSBs that are used for recombination and therefore the S9.6 foci in the sen1-md spo11Δ cannot be attributed to DNA:RNA hybrids at resected DSB ends. We propose that the SPO11 -independent DSBs in the sen1-md spo11Δ diploid arise from R-loops that form during premeiotic S phase and that SEN1 functions to prevent/eliminate R loops at premeiotic TRCs. Sen1 could help prevent R-loop formation by removing RNA pol II from TRCs or coordinating topoisomerase I and II activity as it does during vegetative S phase. However, SEN1 is not sufficient to completely prevent R-loop formation at TRCs, otherwise the R-loop frequency at TRCs would not increase in rnh1Δ rnh201Δ diploids where SEN1 is functional [ 31 ]. Therefore, it is also possible that Sen1 may disassemble R-loops at premeiotic TRCs using its helicase activity. The multi-functional roles that SEN1 may play at premeiotic TRCs could explain why sen1-md is more defective in sporulation and spore viability than the rnh1Δ rnh201Δ mutant, since RNase H1/2 can only remove R-loops but not prevent their formation [ 17 , 31 ]. An interesting question is what role SPO11 is playing at TRCs in premeiotic S phase. During WT meiosis, Spo11 is recruited to chromosome axes where it generates prophase I DSBs after DNA replication [ 123 – 125 ]. During premeiotic S phase, Spo11 may generate DSBs to relieve the topological constraints of the positive supercoils on unreplicated DNA, which would be a novel function for this highly conserved endonuclease. The fact that progression through MI in NDT80-mid sen1-md , mek1Δ sen1-md and sen1-md spo11Δ diploids was similar indicates that SPO11 -independent DSBs do not trigger the MRC. Spo11-generated DSBs occur on the chromosome axes, after which the Mec1/Tel1 checkpoint kinases phosphorylate Hop1 [ 48 ]. Mek1 binds to phosphorylated Hop1 via its FHA domain and then activates itself by phosphorylation of the Mek1 activation loop in trans [ 50 , 51 , 126 ]. We propose that the SPO11 -independent DSBs arise from processing of persistent R-loops formed at TRCs during premeiotic S phase and thus are likely not forming on chromosome axes, in which case Mek1 (and therefore the MRC) would not be activated [ 50 , 51 , 126 ]. A similar phenomenon was observed in C. elegans mutants lacking RNase H activity where R-loops accumulated in the germ line [ 26 ]. An increased frequency of DSBs was observed in rnh-1.0 rnh-2; spo11 worms compared to spo11 alone and these DSBs failed to trigger the DNA damage checkpoint [ 26 ]. Therefore it is possible that a non-canonical function for Spo11 in regulating R-loops during meiosis may be conserved. SEN1 promotes the repair of SPO11 DSBs during prophase I Several studies have shown that DNA:RNA hybrids can form on the resected ends of DSBs in a variety of species both in vegetative and meiotic prophase I cells [ 13 , 14 , 16 , 17 , 26 , 31 , 33 , 34 ]. In budding yeast meiosis, DNA:RNA hybrids that accumulated at the resected ends of DSBs in an rnh1Δ rnh201Δ hpr1Δ diploid impaired recombinase binding and interfered with DNA repair [ 17 ]. Our work indicates that SEN1 also functions to promote repair of SPO11 DSBs. Meiotic progression in sen1-md was delayed due to the MRC that is triggered by Spo11- generated DSBs [ 50 – 53 ]. Furthermore, when sen1-md diploids were allowed to progress through meiosis without the MRC-mediated delay, nuclei were fragmented, indicating the presence of broken chromosomes. DNA:RNA hybrid foci were elevated in sen1-md strains throughout prophase I. Interestingly, COs were reduced only by 25% in the sen1-md diploid and 40% in rnh1Δ rnh201Δ hpr1Δ diploid ( Fig 4 ) [ 17 ], indicating that only a subset of DSBs was not repaired. This may be due to redundancy between RNase H1/2 and Sen1 in removing the DNA:RNA hybrids at the ends of DSBs, although the rnh1Δ rnh201Δ sen1-md diploid was too sick to directly test this idea. Another possibility is that Sen1 and RNase H act on qualitatively different DSBs. Both COs and NCOs were reduced in the rnh1Δ rnh201Δ hpr1Δ diploid, while only COs were decreased by sen1-md ( Fig 4 ) [ 17 ]. Interestingly, chromosome synapsis is defective in the sen1-md mutant, despite a relatively small reduction in crossovers at the HIS4LEU2 hotspot. The ZMM crossover pathway is required for chromosome synapsis [ 64 , 84 , 88 ]. An intriguing idea is that Sen1 specifically removes DNA:RNA hybrids from DSB ends that are destined to be repaired by the ZMM pathway. In this case, most of the COs observed in the sen1-md mutant would be generated by the action of structure-selective nucleases such as Mus81-Mms4 that do not contribute to synapsis. RNase H may instead remove DNA:RNA hybrids from DSBs that are processed by other pathways to form either COs or NCOs. Further work is necessary to test this idea. METHODS Strains and media All the strains used in this study were derived from the SK1 background. Genotypes of each strain are listed in S1 Table. Growth media are described in [ 127 ]. Sporulation (Spo) medium consisted of 2% potassium acetate. Gene deletions were made using polymerase chain reaction (PCR) generated fragments to replace open reading frames (ORFs) with either kanMX6 (confers G418 resistance), natMX4 [confers nourseothricin (NAT) resistance], or hphMX4 (confers Hygromycin B resistance) using the plasmids pFA6a-kanMX6, p4339, or pAG32, respectively. Deletions were verified by PCR using a forward primer upstream of the deleted ORF and a reverse primer within the drug marker. In addition, the absence of the WT gene was confirmed by failure to detect a PCR product using the same forward primer and a reverse primer in the ORF. For the ndt80Δ::hphMX4 haploid parents of AM6697, flanking primers generated different sized PCR products for the NDT80 and ndt80Δ::hphMX4 alleles. To make sen1-md strains, a 2.5 kb fragment was amplified from pMJ787 containing kanMX6 133 bp upstream of PCLB2-3xHA . This fragment was designed with homologies such that it replaces the 50 bp immediately upstream of the SEN1 ATG with the CLB2 promoter. G418 R haploid transformants of both mating types were screened by colony PCR to confirm the insertion of the fragment directly upstream of SEN1 using a forward primer located 814 bp upstream of SEN1 and a reverse primer 740 bp downstream of the SEN1 start codon. The PREC8-SEN1 and PREC8-sen1-ΔN plasmids, pNH410 and pBG27, respectively, were digested with PshAI to target integration to codon 1811 of SEN1 and transformed into the sen1-md diploid, NH2667. Integration of the plasmids was confirmed by complementation of the sen1-md sporulation defect and/or immunoblots probed with α-Sen1 antibodies. The sen1-md NDT80-mid diploid, NH2667::pNH317 2 was created by transforming the haploid parents of NH2667 with the URA3 NDT80-mid integrating plasmid, pNH317, digested with SnaBI to target integration upstream of the NDT80 ORF (note that NDT80-mid is dominant to NDT80 )[ 52 ]. Proper plasmid integration was by PCR with a forward M13 primer present in the vector sequence with a reverse primer 1.9 kb upstream of the NDT80-mid ORF. Plasmids The genotypes of plasmids used are listed in S2 Table. Any sequences amplified by PCR were sequenced in the final plasmids by the Stony Brook University DNA Sequencing Facility or by Plasmidsaurus ( https://www.plasmidsaurus.com/ ). The SEN1 gene was fused to the REC8 promoter in pNH257 to make pNH410 using the NEBuilder HiFi DNA Assembly Master Mix (hereafter referred to as Gibson assembly or GA) (New England Biolabs, Cat.# E2621). A 2μ SEN1 plasmid containing a genomic fragment from chromosome XII with the coordinates 989631-1000863 was used as the template for PCR [ 128 ]. The 6696 bp SEN1 ORF was amplified as three separate fragments of approximately 2 kb. The SEN1a fragment contains 25 bp of homology to the BamHI cut site of pNH257 (immediately downstream of PREC8 ) fused to SEN1 codons 1-790. SEN1b contains codons 783-1555 and SEN1c contains codons 1547-2231 along with 210 bp of 3’ untranslated sequence and 25 bp of homology to the EcoRI cut site of pNH257. The three PCR fragments were incubated with BamHI/EcoRI- digested pNH257 in a GA reaction following the manufacturer’s instructions. The PREC8- sen1-ΔN allele in pBG27 lacks the first 1003 codons of SEN1 . pNH410 was used as the template to generate a 1691 bp PCR fragment containing homology to the EcoRI site on pNH257 along with an ATG and SEN1 codons 1004-1555. This fragment was then joined to the SEN1c fragment and ligated into pNH257 using GA as described for pNH410. The PSEN1-SEN1 plasmid, pBG28, was constructed using a SEN1a fragment that had 25 bp of homology to the NotI site in pRS306 fused to a 2.8 kb sequence containing 0.8 kb located immediately upstream of the SEN1 ORF, as well as the first 791 codons of the gene. The SEN1b fragment was the same as for pNH410, while the SEN1c fragment contained the same fragment of SEN1 with 192 bp 3’ untranslated sequence and 3’ homology to the SalI site in pRS306. Timecourses Liquid sporulation was performed as described in [ 127 ] with the following changes. Diploids were streaked out from the -80°C freezer onto YPD medium supplemented with complete powder [ 127 ] and incubated at 30°C for 2-3 days. Single colonies were inoculated into 8 mL YPD and incubated at 30°C for 24 h. 1.0 mL and 1.7 mL of inoculum were then diluted into 200 mL YPA in two 2 L flasks and incubated at 240 RPM for 18 hours at 30°C. The optical density at 660nm (OD660) of a 2-fold dilution in YPA of the culture was read using a SPECTRONIC 200 spectrophotometer. Diluted cultures with OD660 readings between 1.6 and 2.3 were pelleted, washed with water and resuspended in the volume of Spo medium required for a cell density of 3 x 10 7 cells/mL in 2 L flasks. The cells were incubated in a 30°C shaker rotating at 250 RPM. At each timepoint, cells were fixed with a 1/10 volume of 37% formaldehyde for 4’,5-diamidino-2- phenylindole (DAPI) staining. Formaldehyde-fixed cells were processed for whole cell immunofluorescence as described in (Ziesel et al. 2022). For protein and RNA sequencing samples, 5 ml sporulating culture were pelleted in a 15 ml conical tube, the supernatant was discarded, and the cell pellets stored at -80°C. For DNA physical analysis, 10 mL culture was added to 1 mL 0.5M EDTA and 10 mL 100% ethanol and stored at -20°C. For nuclear spreads, 6.7 mL of sporulating culture were immediately processed as described in [ 129 ]. Nuclear Spreads For localization of meiotic axis and central region proteins of the synaptonemal complex ( Fig 5 ) Strains homozygous for ndt80::ΔhphMX4 were cultured overnight in BYTA (1% yeast extract, 2% bactopeptone, 1% potassium acetate, 50 mM potassium phthalate) then sporulated in 1% potassium acetate for 5 hours. Nuclei from these cells were surface-spread on glass slides and imaged as described in [ 130 ]. Affinity purified rabbit anti-Zip1 (1:150), mouse anti-Gmc2 (1:800), and rabbit anti-Red1 (1:200) [ 59 ]. Secondary antibodies conjugated with Alexa Fluor dyes (Jackson ImmunoResearch) were used at a 1:200 dilution. Microscopy and image processing were performed using a Deltavision RT imaging system (General Electric) adapted to an Olympus (IX71) microscope. For localization of DNA:RNA hybrids ( Fig 7 ) Meiotic cultures were spheroplasted and their nuclei spread and immunostained as described in [ 129 ]. Slides treated with 5U of RNase H (New England Bioscience M0297L) were incubated at 37°C for 1h in a moist slide box after blocking and then washed with 1xTBS prior to incubation with antibodies. All immunostains were incubated with antibodies at 4°C in a moist slide box. Slides were first stained for DNA:RNA hybrids with mouse anti-DNA:RNA hybrids (S9.6) (Kerafast ENH001) diluted 1:1000 in 1% BSA and incubated overnight. After washing slides as described, goat α-mouse IgG-Alexa 594 (Fisher A32742) secondary antibody was diluted 1:1000 in 1% BSA was applied to slides and incubated for two hours. Micrographs were taken with a ZEISS Axio Imager.Z2 with a Zeiss Plan-Apochromat 100X objective and analyzed using ZEN 3.5 software. Physical Analysis of DSBs and Repair Products Genomic DNA was isolated from ethanol-fixed sporulation samples using the MasterPure Yeast DNA Purifiation Kit (Biosearch Technologies MPY80200) and quantified with the Qubit 1x dsDNA HS Assay Kit (Invitrogen Q33231). Digestion of samples, gel electrophoresis, Southern blotting, and hybridization with radiolabeled probe for analysis of the HIS4-LEU2 hotspot were performed as described in (Owens et al. 2018) with the following changes: the blotted membrane was incubated in prehybridization solution (0.5% SDS, 0.5 mg/mL sheared salmon sperm DNA, 6xSSC (29.22 mg/mL sodium chloride, 14.7mg/mL sodium citrate, HCl to pH 7.0)) at 68°C for 2 hours. 32 P-labeled probe with at least 1x10 6 counts per minute was added to hybridization solution (0.5% SDS, 0.5 mg/mL sheared salmon sperm DNA, 6xSSC, 0.1 mg/mL dextran sulfate) and incubated with the membrane for 16h at 68°C. The membrane was washed at 68°C three times for 30 minutes with ∼40mL of Wash Buffer 1 (2x SSC, 0.1% SDS) and then twice with Wash Buffer 2 (0.2x SSC, 0.1% SDS). It was then washed at room temperature for 5 minutes each with Wash Buffer 2 and Wash Buffer 3 (0.1x SSC). The blots were imaged using a FujiFilm FLA-7000 phosphoimager and Multi-Gage software. Antibodies The sources and conditions used for various antibodies are listed in S3 Table. The Sen1 antibody was generated by Covance Research Products (now Labcorp Drug Development) in a guinea pig using the peptide Ac-CFSDDVSFIPRNDEPEIK-amide (amino acids 2002-2019). RNA sequencing analysis After growth in YPA, the SEN1 and sen1-md diploids were transferred to Spo medium at a density of 3 X 10 7 cells/ml and 5 ml aliquots were taken at various timepoints, pelleted and frozen at -80°C. The cell pellets were sent to GENEWIZ (now Azenta) for RNA extraction and polyA RNA enrichment. The kit used to prepare the libraries was the NEBNext Ultra RNA Library Prep, PolyA (New England Biolabs). The adapter sequences used to generate the RNA sequencing data were: Read1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Read2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA The RNA sequencing data were mapped to the yeast genome using Bowtie 1.1.2 and custom Python scripts with Yeast PacBio 2016 as the reference genome ( https://yjx1217.github.io/Yeast_PacBio_2016/data/ )[ 131 ] (Langmead B et al. doi: 10.1186/gb-2009-10-3-r25). Fragments/kb transcript/million (fpkm) values were determined using TopHat2 ( https://doi.org/10.1186/gb-2013-14-4-r36 ), which were then used to calculate the standard scores (Z-scores) for each gene using the formula (fpkmn - fpkmave)/SD, where n = timepoint, fpkmave = average of the fpkm values for each timepoint and SD is the standard deviation. Genes were clustered based on their pattern of Z values using Clustal 3.0 and then visualized as a heat map plotted by JavaTree. The sen1-md strain was not weighted and these genes were “passengers” whose location was set by the WT cluster. Supporting Information S1_Data. Contains the data and calculations used for all of the numerical data presented in Figures. (XLXS) Download figure Open in new tab S1 Fig. Immunoblots using a newly developed α-Sen1 antibody. The sen1-md diploid, NH2667, was transformed with an integrating plasmid containing either PREC8- SEN1 (pNH410) or PREC8-sen1-ΔN (pBG27) and induced to undergo meiosis. Protein samples from the indicated timepoints were probed with α-Sen1 antibodies. α-Arp7 antibodies were used to detect Arp7 as a loading control. Numbers on the right indicate the positions of molecular weight markers in kiloDaltons. The black line indicates that the same samples were run on two different gels and probed with different antibodies. “Hr” refers to hours in Spo medium. (B) Timing of expression of various meiosis-specific proteins. Protein extracts from meiotic timecourses using SEN1 , sen1-md and PREC8- SEN1 strains were probed with antibodies against the indicated proteins. “pHop” and “pHed1” indicate phosphorylated Hop1 and Hed1, respectively. Download figure Open in new tab S2 Fig. Monitoring meiotic progression and nuclear fragmentation by fluorescent staining of the DNA. Cells were fixed with 3.7% formaldehyde, stained with DAPI and examined by fluorescence microscopy. Mononucleate cells are either vegetative cells or meiotic cells prior to anaphase I. White arrows indicate binucleate MI cells. Orange arrowheads indicate tetranucleate MII cells and magenta arrows indicate cells with fragmented nuclei that contain >4 DAPI foci. The first three images are WT cells (NH716) while the last image is from a mek1Δ sen1-md diploid (NH2669) View this table: View inline View popup S1 Table. Saccharomyces cerevisiae strains View this table: View inline View popup Download powerpoint S2 Table. Plasmids View this table: View inline View popup Download powerpoint S3 Table. Antibodies ACKNOWLEDGEMENTS We are grateful to Aaron Neiman for comments on the manuscript. Many thanks to Scott Keeney, Neil Hunter, Raphäelle Laureau, Nicola Silva and members of the Hollingsworth lab for helpful discussions. Craig Chen provided technical help. Neil Hunter, Aaron Neiman, and Liangran Zhang provided strains and/or plasmids. REFERENCES 1. ↵ Brickner JR , Garzon JL , Cimprich KA . Walking a tightrope: The complex balancing act of R-loops in genome stability . Mol Cell . 2022 ; 82 ( 12 ): 2267 – 97 . Epub 20220503. doi: 10.1016/j.molcel.2022.04.014 . PubMed PMID: 35508167 OpenUrl CrossRef PubMed 2. ↵ Castellano-Pozo M , Santos-Pereira JM , Rondon AG , Barroso S , Andujar E , Perez-Alegre M , et al. R loops are linked to histone H3 S10 phosphorylation and chromatin condensation . Mol Cell . 2013 ; 52 ( 4 ): 583 – 90 . Epub 20131107. doi: 10.1016/j.molcel.2013.10.006 . PubMed PMID: 24211264 . OpenUrl CrossRef PubMed Web of Science 3. ↵ Chen Y , Wang L , Zhou Q , Wei W , Wei H , Ma Y , et al. Dynamic R-loops at centromeres ensure chromosome alignment during oocyte meiotic divisions in mice . Sci Bull (Beijing ). 2025 . Epub 20250213. doi: 10.1016/j.scib.2025.02.009 . PubMed PMID: 39984387 . OpenUrl CrossRef PubMed 4. Skourti-Stathaki K , Proudfoot NJ , Gromak N . Human senataxin resolves RNA/DNA hybrids formed at transcriptional pause sites to promote Xrn2-dependent termination . Mol Cell . 2011 ; 42 ( 6 ): 794 – 805 . doi: 10.1016/j.molcel.2011.04.026 . PubMed PMID: 21700224 ; OpenUrl CrossRef PubMed Web of Science 5. ↵ Sun Q , Csorba T , Skourti-Stathaki K , Proudfoot NJ , Dean C . R-loop stabilization represses antisense transcription at the Arabidopsis FLC locus . Science . 2013 ; 340 ( 6132 ):619-21. doi: 10.1126/science.1234848 . PubMed PMID: 23641115 ; OpenUrl Abstract / FREE Full Text 6. ↵ Brambati A , Zardoni L , Nardini E , Pellicioli A , Liberi G . The dark side of RNA:DNA hybrids . Mutat Res Rev Mutat Res . 2020 ; 784 : 108300 . Epub 20200229. doi: 10.1016/j.mrrev.2020.108300 . PubMed PMID: 32430097 . OpenUrl CrossRef PubMed 7. ↵ Chan YA , Aristizabal MJ , Lu PY , Luo Z , Hamza A , Kobor MS , et al. Genome-wide profiling of yeast DNA:RNA hybrid prone sites with DRIP-chip . PLoS Genet . 2014 ; 10 ( 4 ): e1004288 . Epub 20140417. doi: 10.1371/journal.pgen.1004288 . PubMed PMID: 24743342 ; OpenUrl CrossRef PubMed 8. Costantino L , Koshland D . Genome-wide map of R-loop-induced damage reveals how a subset of R-loops contributes to genomic instability . Mol Cell . 2018 ; 71 ( 4 ): 487 – 97 e3. Epub 20180802. doi: 10.1016/j.molcel.2018.06.037 . PubMed PMID: 30078723 ; OpenUrl CrossRef PubMed 9. ↵ A. San Martin-Alonso M, Soler-Oliva ME, Garcia-Rubio M, Garcia-Muse T , Aguilera Harmful R-loops are prevented via different cell cycle-specific mechanisms . Nat Commun . 2021 ; 12 ( 1 ): 4451 . Epub 20210722. doi: 10.1038/s41467-021-24737-x . PubMed PMID: 34294712 OpenUrl CrossRef PubMed 10. ↵ Wahba L , Amon JD , Koshland D , Vuica-Ross M . RNase H and multiple RNA biogenesis factors cooperate to prevent RNA:DNA hybrids from generating genome instability . Mol Cell . 2011 ; 44 ( 6 ): 978 – 88 . doi: 10.1016/j.molcel.2011.10.017 . PubMed PMID: 22195970 OpenUrl CrossRef PubMed Web of Science 11. ↵ Liu C , Wang L , Li Y , Guo M , Hu J , Wang T , et al. RNase H1 facilitates recombinase recruitment by degrading DNA-RNA hybrids during meiosis . Nucleic Acids Res . 2023 ; 51 ( 14 ): 7357 – 75 . doi: 10.1093/nar/gkad524 . PubMed PMID: 37378420 OpenUrl CrossRef PubMed 12. Marnef A , Legube G . R-loops as Janus-faced modulators of DNA repair . Nat Cell Biol . 2021 ; 23 ( 4 ): 305 – 13 . Epub 20210409. doi: 10.1038/s41556-021-00663-4 . PubMed PMID: 33837288 . OpenUrl CrossRef PubMed 13. ↵ Ohle C , Tesorero R , Schermann G , Dobrev N , Sinning I , Fischer T . Transient RNA-DNA hybrids are required for efficient double-strand break repair . Cell . 2016 ; 167 ( 4 ): 1001 – 13 e7. Epub 20161027. doi: 10.1016/j.cell.2016.10.001 . PubMed PMID: 27881299 . OpenUrl CrossRef PubMed 14. ↵ Ortega P , Merida-Cerro JA , Rondon AG , Gomez-Gonzalez B , Aguilera A . DNA- RNA hybrids at DSBs interfere with repair by homologous recombination . Elife . 2021 ; 10 . Epub 20210708. doi: 10.7554/eLife.69881 . PubMed PMID: 34236317 ; OpenUrl CrossRef PubMed 15. Ouyang J , Yadav T , Zhang JM , Yang H , Rheinbay E , Guo H , et al. RNA transcripts stimulate homologous recombination by forming DR-loops . Nature . 2021 ; 594 ( 7862 ):283-8. Epub 20210512. doi: 10.1038/s41586-021-03538-8 . PubMed PMID: 33981036 OpenUrl CrossRef PubMed 16. ↵ Rawal CC , Zardoni L , Di Terlizzi M , Galati E , Brambati A , Lazzaro F , et al. Senataxin ortholog Sen1 limits DNA:RNA hybrid accumulation at DNA double-strand breaks to control end resection and repair fidelity . Cell Rep . 2020 ; 31 ( 5 ): 107603 . doi: 10.1016/j.celrep.2020.107603 . PubMed PMID: 32375052 . OpenUrl CrossRef PubMed 17. ↵ Yang X , Zhai B , Wang S , Kong X , Tan Y , Liu L , et al. RNA-DNA hybrids regulate meiotic recombination . Cell Rep . 2021 ; 37 ( 10 ): 110097 . doi: 10.1016/j.celrep.2021.110097 . PubMed PMID: 34879269 . OpenUrl CrossRef PubMed 18. ↵ Aguilera A , Garcia-Muse T . R loops: from transcription byproducts to threats to genome stability . Mol Cell . 2012 ; 46 ( 2 ): 115 – 24 . doi: 10.1016/j.molcel.2012.04.009 . PubMed PMID: 22541554 . OpenUrl CrossRef PubMed Web of Science 19. ↵ Yang S , Winstone L , Mondal S , Wu Y . Helicases in R-loop Formation and Resolution . J Biol Chem . 2023 ; 299 ( 11 ): 105307 . Epub 20230929. doi: 10.1016/j.jbc.2023.105307 . PubMed PMID: 37778731 OpenUrl CrossRef PubMed 20. ↵ Amon JD , Koshland D . RNase H enables efficient repair of R-loop induced DNA damage . Elife . 2016 ; 5 . Epub 20161210. doi: 10.7554/eLife.20533 . PubMed PMID: 27938663 OpenUrl CrossRef PubMed 21. ↵ Cerritelli SM , Crouch RJ . RNases H: Multiple roles in maintaining genome integrity . DNA Repair (Amst ). 2019 ; 84 : 102742 . Epub 20191030. doi: 10.1016/j.dnarep.2019.102742 . PubMed PMID: 31708455 OpenUrl CrossRef PubMed 22. ↵ Aiello U , Porrua O , Libri D . Sen1: The varied virtues of a multifaceted helicase . J Mol Biol . 2024 : 168808 . Epub 20240930. doi: 10.1016/j.jmb.2024.168808 . PubMed PMID: 39357815 . OpenUrl CrossRef PubMed 23. Giannini M , Porrua O . Senataxin: A key actor in RNA metabolism, genome integrity and neurodegeneration . Biochimie . 2024 ; 217 : 10 – 9 . Epub 20230807. doi: 10.1016/j.biochi.2023.08.001 . PubMed PMID: 37558082 . OpenUrl CrossRef PubMed 24. Martin-Tumasz S , Brow DA . Saccharomyces cerevisiae Sen1 helicase domain exhibits 5’- to 3’-helicase activity with a preference for translocation on DNA rather than RNA . J Biol Chem . 2015 ; 290 ( 38 ): 22880 – 9 . Epub 20150720. doi: 10.1074/jbc.M115.674002 . PubMed PMID: 26198638 OpenUrl Abstract / FREE Full Text 25. ↵ Winey M , Culbertson MR . Mutations affecting the tRNA-splicing endonuclease activity of Saccharomyces cerevisiae . Genetics . 1988 ; 118 ( 4 ): 609 – 17 . doi: 10.1093/genetics/118.4.609 . PubMed PMID: 3284787 OpenUrl Abstract / FREE Full Text 26. ↵ Hicks T , Koury E , McCabe C , Williams C , Crahan C , Smolikove S . R-loop- induced irreparable DNA damage evades checkpoint detection in the C. elegans germline . Nucleic Acids Res . 2022 ; 50 ( 14 ): 8041 – 59 . doi: 10.1093/nar/gkac621 . PubMed PMID: 35871299 OpenUrl CrossRef PubMed 27. ↵ Aguilera A , Klein HL . Genetic and molecular analysis of recombination events in Saccharomyces cerevisiae occurring in the presence of the hyper-recombination mutation hpr1 . Genetics . 1989 ; 122 ( 3 ): 503 – 17 . doi: 10.1093/genetics/122.3.503 . PubMed PMID: 2668113 OpenUrl Abstract / FREE Full Text 28. Jimeno S , Rondon AG , Luna R , Aguilera A . The yeast THO complex and mRNA export factors link RNA metabolism with transcription and genome instability . EMBO J . 2002 ; 21 ( 13 ): 3526 – 35 . doi: 10.1093/emboj/cdf335 . PubMed PMID: 12093753 OpenUrl Abstract / FREE Full Text 29. ↵ Schneiter R , Guerra CE , Lampl M , Gogg G , Kohlwein SD , Klein HL . The Saccharomyces cerevisiae hyperrecombination mutant hpr1Delta is synthetically lethal with two conditional alleles of the acetyl coenzyme A carboxylase gene and causes a defect in nuclear export of polyadenylated RNA . Mol Cell Biol . 1999 ; 19 ( 5 ): 3415 – 22 . doi: 10.1128/MCB.19.5.3415 . PubMed PMID: 10207065 OpenUrl Abstract / FREE Full Text 30. ↵ Castellano-Pozo M , Garcia-Muse T , Aguilera A . R-loops cause replication impairment and genome instability during meiosis . EMBO Rep . 2012 ; 13 ( 10 ): 923 – 9 . Epub 20120810. doi: 10.1038/embor.2012.119 . PubMed PMID: 22878416 OpenUrl Abstract / FREE Full Text 31. ↵ Liu C , Xu W , Wang L , Yang Z , Li K , Hu J , et al. Dual roles of R-loops in the formation and processing of programmed DNA double-strand breaks during meiosis . Cell Biosci . 2023 ; 13 ( 1 ): 82 . Epub 20230511. doi: 10.1186/s13578-023-01026-2 . PubMed PMID: 37170281 OpenUrl CrossRef PubMed 32. ↵ Boguslawski SJ , Smith DE , Michalak MA , Mickelson KE , Yehle CO , Patterson WL , et al. Characterization of monoclonal antibody to DNA.RNA and its application to immunodetection of hybrids . J Immunol Methods . 1986 ; 89 ( 1 ): 123 – 30 . doi: 10.1016/0022-1759(86)90040-2 . PubMed PMID: 2422282 . OpenUrl CrossRef PubMed Web of Science 33. ↵ Becherel OJ , Yeo AJ , Stellati A , Heng EY , Luff J , Suraweera AM , et al. Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing . PLoS Genet . 2013 ; 9 ( 4 ): e1003435 . Epub 20130411. doi: 10.1371/journal.pgen.1003435 . PubMed PMID: 23593030 OpenUrl CrossRef PubMed 34. ↵ Fujiwara Y , Saito K , Sun F , Petri S , Inoue E , Schimenti J , et al. New allele of mouse DNA/RNA helicase senataxin causes meiotic arrest and infertility . Reproduction . 2023 ; 166 ( 6 ): 437 – 50 . Epub 20231106. doi: 10.1530/REP-23-0166 . PubMed PMID: 37801077 . OpenUrl CrossRef PubMed 35. ↵ Yeo AJ , Becherel OJ , Luff JE , Graham ME , Richard D , Lavin MF . Senataxin controls meiotic silencing through ATR activation and chromatin remodeling . Cell Discov . 2015 ; 1 : 15025 . Epub 20150929. doi: 10.1038/celldisc.2015.25 . PubMed PMID: 27462424 OpenUrl CrossRef PubMed 36. ↵ Neiman AM . Sporulation in the budding yeast Saccharomyces cerevisiae . Genetics . 2011 ; 189 ( 3 ): 737 – 65 . doi: 10.1534/genetics.111.127126 . PubMed PMID: 22084423 OpenUrl Abstract / FREE Full Text 37. ↵ Chu S , DeRisi J , Eisen M , Mulholland J , Botstein D , Brown PO , et al. The transcriptional program of sporulation in budding yeast [published erratum appears in Science 1998 Nov 20;282(5393):1421] . Science . 1998 ; 282 (5389): 699 -705. OpenUrl Abstract / FREE Full Text 38. ↵ Harris A , Unal E . The transcriptional regulator Ume6 is a major driver of early gene expression during gametogenesis . Genetics . 2023 ; 225 ( 2 ). doi: 10.1093/genetics/iyad123 . PubMed PMID: 37431893 OpenUrl CrossRef PubMed 39. ↵ Kassir Y , Granot D , Simchen G . IME1 , a positive regulator of meiosis in Saccharomyces cerevisiae . Cell . 1988 ; 52 : 853 – 62 . OpenUrl CrossRef PubMed Web of Science 40. Mitchell AP . Control of meiotic gene expression in Saccharomyces cerevisiae . Microbiological Reviews . 1994 ; 58 : 56 – 70 . OpenUrl Abstract / FREE Full Text 41. ↵ Primig M , Williams RM , Winzeler EA , Tevzadze GG , Conway AR , Hwang SY , et al. The core meiotic transcriptome in budding yeasts . Nat Genet . 2000 ; 26 ( 4 ): 415 – 23 . PubMed PMID: 11101837 . OpenUrl CrossRef PubMed Web of Science 42. ↵ Brown MS , Bishop DK . DNA strand exchange and RecA homologs in meiosis . Cold Spring Harb Perspect Biol . 2014 ; 7 ( 1 ): a016659 . Epub 20141204. doi: 10.1101/cshperspect.a016659 . PubMed PMID: 25475089 OpenUrl Abstract / FREE Full Text 43. Brown MS , Grubb J , Zhang A , Rust MJ , Bishop DK . Small Rad51 and Dmc1 Complexes Often Co-occupy Both Ends of a Meiotic DNA Double Strand Break . PLoS Genet . 2015 ; 11 ( 12 ): e1005653 . Epub 2016/01/01. doi: 10.1371/journal.pgen.1005653 . PubMed PMID: 26719980 OpenUrl CrossRef PubMed 44. ↵ Keeney S . Spo11 and the formation of DNA double-strand breaks in meiosis . Genome dynamics and stability . 2008 ; 2 : 81 – 123 . Epub 2008/01/01. doi: 10.1007/7050_2007_026 . PubMed PMID: 21927624 OpenUrl CrossRef PubMed 45. ↵ Schwacha A , Kleckner N . Identification of joint molecules that form frequently between homologs but rarely between sister chromatids . Cell . 1994 ; 76 : 51 – 63 . OpenUrl CrossRef PubMed Web of Science 46. ↵ Hunter N. Meiotic Recombination. Aguilera A, Rothstein R , editors . Heidelberg : Springer-Verlag ; 2007 . 381-462 p. 47. ↵ Börner GV , Hochwagen A , MacQueen AJ . Meiosis in budding yeast . Genetics . 2023 ; 225 ( 2 ). doi: 10.1093/genetics/iyad125 . PubMed PMID: 37616582 OpenUrl CrossRef PubMed 48. ↵ MacQueen AJ , Hochwagen A . Checkpoint mechanisms: the puppet masters of meiotic prophase . Trends Cell Biol . 2011 ; 21 ( 7 ): 393 – 400 . Epub 20110429. doi: 10.1016/j.tcb.2011.03.004 . PubMed PMID: 21531561 . OpenUrl CrossRef PubMed Web of Science 49. ↵ Xu L , Weiner BM , Kleckner N . Meiotic cells monitor the status of the interhomolog recombination complex . Genes Dev . 1997 ; 11 : 106 – 18 . OpenUrl Abstract / FREE Full Text 50. ↵ Carballo JA , Johnson AL , Sedgwick SG , Cha RS . Phosphorylation of the axial element protein Hop1 by Mec1/Tel1 ensures meiotic interhomolog recombination . Cell . 2008 ; 132 : 758 – 70 . OpenUrl CrossRef PubMed Web of Science 51. ↵ Chuang CN , Cheng YH , Wang TF . Mek1 stabilizes Hop1-Thr318 phosphorylation to promote interhomolog recombination and checkpoint responses during yeast meiosis . Nucleic Acids Res . 2012 ; 40 ( 22 ): 11416 – 27 . Epub 20121009. doi: 10.1093/nar/gks920 . PubMed PMID: 23047948 OpenUrl CrossRef PubMed 52. ↵ Chen X , Gaglione R , Leong T , Bednor L , de Los Santos T , Luk E , et al. Mek1 coordinates meiotic progression with DNA break repair by directly phosphorylating and inhibiting the yeast pachytene exit regulator Ndt80 . PLoS Genet . 2018 ; 14 ( 11 ): e1007832 . Epub 2018/11/30. doi: 10.1371/journal.pgen.1007832 . PubMed PMID: 30496175 OpenUrl CrossRef PubMed 53. ↵ Prugar E , Burnett C , Chen X , Hollingsworth NM . Coordination of double strand break repair and meiotic progression in yeast by a Mek1-Ndt80 negative feedback Loop . Genetics . 2017 ; 206 ( 1 ): 497 – 512 . Epub 2017/03/03. doi: 10.1534/genetics.117.199703 . PubMed PMID: 28249986 OpenUrl Abstract / FREE Full Text 54. ↵ Sourirajan A , Lichten M . Polo-like kinase Cdc5 drives exit from pachytene during budding yeast meiosis . Genes Dev . 2008 ; 22 : 2627 – 32 . OpenUrl Abstract / FREE Full Text 55. ↵ Grandin N , Reed SI . Differential function and expression of Saccharomyces cerevisiae B-type cyclins in mitosis and meiosis . Mol Cell Biol . 1993 ; 13 : 2113 – 25 . OpenUrl Abstract / FREE Full Text 56. ↵ Lee BH , Amon A . Role of Polo-like kinase CDC5 in programming meiosis I chromosome segregation . Science . 2003 ; 300 (5618): 482 -6. PubMed PMID: 12663816 . OpenUrl Abstract / FREE Full Text 57. ↵ Chen X , Muller U , Sundling KE , Brow DA . Saccharomyces cerevisiae Sen1 as a model for the study of mutations in human Senataxin that elicit cerebellar ataxia . Genetics . 2014 ; 198 ( 2 ): 577 – 90 . Epub 20140812. doi: 10.1534/genetics.114.167585 . PubMed PMID: 25116135 OpenUrl Abstract / FREE Full Text 58. ↵ Hollingsworth NM , Ponte L , Halsey C . MSH5 , a novel MutS homolog, facilitates meiotic reciprocal recombination between homologs in Saccharomyces cerevisiae but not mismatch repair . Genes Dev . 1995 ; 9 : 1728 – 39 . OpenUrl Abstract / FREE Full Text 59. ↵ Smith AV , Roeder GS . The yeast Red1 protein localizes to the cores of meiotic chromosomes . J Cell Biol . 1997 ; 136 : 957 – 67 . OpenUrl Abstract / FREE Full Text 60. ↵ Ziesel A , Weng Q , Ahuja JS , Bhattacharya A , Dutta R , Cheng E , et al. Rad51- mediated interhomolog recombination during budding yeast meiosis is promoted by the meiotic recombination checkpoint and the conserved Pif1 helicase . PLoS Genet . 2022 ; 18 ( 12 ): e1010407 . Epub 2022/12/13. doi: 10.1371/journal.pgen.1010407 . PubMed PMID: 36508468 OpenUrl CrossRef PubMed 61. ↵ Klein F , Mahr P , Galova M , Buonomo SBC , Michaelis C , Nairz K , et al. A central role for cohesins in sister chromatid cohesion, formation of axial elements and recombination during meiosis . Cell . 1999 ; 98 : 91 – 103 . OpenUrl CrossRef PubMed Web of Science 62. Hollingsworth NM , Goetsch L , Byers B . The HOP1 gene encodes a meiosis- specific component of yeast chromosomes . Cell . 1990 ; 61 : 73 – 84 . OpenUrl CrossRef PubMed Web of Science 63. ↵ Thompson E , Roeder GS . Expression and DNA sequence of RED1 , a gene required for meiosis I chromosome segregation in yeast . Mol Gen Genet . 1989 ; 218 : 293 – 301 . OpenUrl CrossRef PubMed Web of Science 64. ↵ Chen X , Suhandynata RT , Sandhu R , Rockmill B , Mohibullah N , Niu H , et al. Phosphorylation of the synaptonemal complex protein Zip1 regulates the crossover/noncrossover decision during yeast meiosis . PLoS Biol . 2015 ; 13 ( 12 ): e1002329 . Epub 2015/12/20. doi: 10.1371/journal.pbio.1002329 . OpenUrl CrossRef PubMed 65. Grubb J , Bishop DK . Chk2 homologue Mek1 limits Exo1-dependent DNA end resection during meiotic recombination in S. cerevisiae . Genetics . 2024 . Epub 20240715. doi: 10.1093/genetics/iyae112 . PubMed PMID: 39005070 . OpenUrl CrossRef PubMed 66. Hollingsworth NM , Gaglione R . The meiotic-specific Mek1 kinase in budding yeast regulates interhomolog recombination and coordinates meiotic progression with double-strand break repair . Curr Genet . 2019 ; 65 ( 3 ): 631 – 41 . Epub 2019/01/24. doi: 10.1007/s00294-019-00937-3 . PubMed PMID: 30671596 OpenUrl CrossRef PubMed 67. ↵ Kim KP , Weiner BM , Zhang L , Jordan A , Dekker J , Kleckner N . Sister cohesion and structural axis components mediate homolog bias of meiotic recombination . Cell . 2010 ; 143 ( 6 ): 924 – 37 . Epub 2010/12/15. doi: 10.1016/j.cell.2010.11.015 . PubMed PMID: 21145459 OpenUrl CrossRef PubMed Web of Science 68. Leem S-H , Ogawa H. The MRE4 gene encodes a novel protein kinase homologue required for meiotic recombination in Saccharomyces cerevisiae . Nucl Acids Res. 1992 ;20:449-57. 69. ↵ Niu H , Wan L , Busygina V , Kwon Y , Allen JA , Li X , et al. Regulation of meiotic recombination via Mek1-mediated Rad54 phosphorylation . Mol Cell . 2009 ; 36 : 393 – 404 . OpenUrl CrossRef PubMed Web of Science 70. ↵ Rockmill B , Roeder GS . A meiosis-specific protein kinase homologue required for chromosome synapsis and recombination . Genes Dev . 1991 ; 5 : 2392 – 404 . OpenUrl Abstract / FREE Full Text 71. ↵ Busygina V , Sehorn MG , Shi IY , Tsubouchi H , Roeder GS , Sung P . Hed1 regulates Rad51-mediated recombination via a novel mechanism . Genes Dev . 2008 ; 22 : 786 – 95 . OpenUrl Abstract / FREE Full Text 72. ↵ Tsubouchi H , Roeder GS . Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired . Genes Dev . 2006 ; 20 ( 13 ): 1766 – 75 . PubMed PMID: 16818607 . OpenUrl Abstract / FREE Full Text 73. ↵ Callender TL , Laureau R , Wan L , Chen X , Sandhu R , Laljee S , et al. Mek1 down regulates Rad51 activity during yeast meiosis by phosphorylation of Hed1 . PLoS Genet . 2016 ; 12 ( 8 ): e1006226 . Epub 2016/08/03. doi: 10.1371/journal.pgen.1006226 . PubMed PMID: 27483004 OpenUrl CrossRef PubMed 74. ↵ Niu H , Wan L , Baumgartner B , Schaefer D , Loidl J , Hollingsworth NM . Partner choice during meiosis is regulated by Hop1-promoted dimerization of Mek1 . Mol Biol Cell . 2005 ; 16 : 5804 – 18 . OpenUrl Abstract / FREE Full Text 75. ↵ Wu HY , Ho HC , Burgess SM . Mek1 kinase governs outcomes of meiotic recombination and the checkpoint response . Curr Bio . 2010 ; 20 ( 19 ): 1707 – 16 . Epub 2010/10/05. doi: 10.1016/j.cub.2010.09.016 . PubMed PMID: 20888230 OpenUrl CrossRef PubMed 76. ↵ Cartagena-Lirola H , Guerini I , Manfrini N , Lucchini G , Longhese MP . Role of the Saccharomyces cerevisiae Rad53 checkpoint kinase in signaling double-strand breaks during the meiotic cell cycle . Molecular and cellular biology . 2008 ; 28 ( 14 ): 4480 – 93 . Epub 2008/05/29. doi: 10.1128/MCB.00375-08 . PubMed PMID: 18505828 OpenUrl Abstract / FREE Full Text 77. ↵ Chu S , Herskowitz I . Gametogenesis in yeast is regulated by a transcriptional cascade dependent on Ndt80 . Mol Cell . 1998 ; 1 ( 5 ): 685 – 96 . OpenUrl CrossRef PubMed Web of Science 78. ↵ Lydall D , Nikolsky Y , Bishop DK , Weinert T . A meiotic recombination checkpoint controlled by mitotic checkpoint genes . Nature . 1996 ; 383 : 840 – 3 . OpenUrl CrossRef PubMed Web of Science 79. ↵ Weng Q , Wan L , Straker GC , Deegan TD , Duncker BP , Neiman AM , et al. An acidic loop in the FHA domain of the yeast meiosis-specific kinase Mek1 interacts with a specific motif in a subset of Mek1 substrates . Genetics . 2024 . Epub 20240709. doi: 10.1093/genetics/iyae106 . PubMed PMID: 38979911 . OpenUrl CrossRef PubMed 80. ↵ Hunter N , Kleckner N . The single-end invasion: an asymmetric intermediate at the double- strand break to double-holliday junction transition of meiotic recombination . Cell . 2001 ; 106 ( 1 ): 59 – 70 . PubMed PMID: 11461702 . OpenUrl CrossRef PubMed Web of Science 81. ↵ Allers T , Lichten M . Differential timing and control of noncrossover and crossover recombination during meiosis . Cell . 2001 ; 106 ( 1 ): 47 – 57 . PubMed PMID: 11461701 . OpenUrl CrossRef PubMed Web of Science 82. McMahill MS , Sham CW , Bishop DK . Synthesis-dependent strand annealing in meiosis . PLoS Biol . 2007 ; 5 ( 11 ): e299 . doi: 10.1371/journal.pbio.0050299 . PubMed PMID: 17988174 OpenUrl CrossRef PubMed 83. ↵ Subramanian VV , MacQueen AJ , Vader G , Shinohara M , Sanchez A , Borde V , et al. Chromosome synapsis alleviates Mek1-aependent suppression of meiotic DNA repair . PLoS Biol . 2016 ; 14 ( 2 ): e1002369 . Epub 2016/02/13. doi: 10.1371/journal.pbio.1002369 . PubMed PMID: 26870961 OpenUrl CrossRef PubMed 84. ↵ Börner GV , Kleckner N , Hunter N . Crossover/noncrossover differentiation, synaptonemal complex formation, and regulatory surveillance at the leptotene/zygotene transition of meiosis . Cell . 2004 ; 117 ( 1 ): 29 – 45 . Epub 2004/04/07. PubMed PMID: 15066280 . OpenUrl CrossRef PubMed Web of Science 85. Chua PR , Roeder GS . Zip2, a meiosis-specific protein required for the initiation of chromosome synapsis . Cell . 1998 ; 93 ( 3 ): 349 – 59 . OpenUrl CrossRef PubMed Web of Science 86. De Muyt A , Pyatnitskaya A , Andreani J , Ranjha L , Ramus C , Laureau R , et al. A meiotic XPF-ERCC1-like complex recognizes joint molecule recombination intermediates to promote crossover formation . Genes Dev . 2018 ; 32 ( 3-4 ): 283 – 96 . Epub 20180209. doi: 10.1101/gad.308510.117 . PubMed PMID: 29440262 OpenUrl Abstract / FREE Full Text 87. Pyatnitskaya A , Andreani J , Guerois R , De Muyt A , Borde V . The Zip4 protein directly couples meiotic crossover formation to synaptonemal complex assembly . Genes Dev . 2022 ; 36 ( 1-2 ): 53 – 69 . Epub 20211230. doi: 10.1101/gad.348973.121 . PubMed PMID: 34969823 OpenUrl Abstract / FREE Full Text 88. ↵ Pyatnitskaya A , Borde V , De Muyt A . Crossing and zipping: molecular duties of the ZMM proteins in meiosis . Chromosoma . 2019 ; 128 ( 3 ): 181 – 98 . Epub 20190625. doi: 10.1007/s00412-019-00714-8 . PubMed PMID: 31236671 . OpenUrl CrossRef PubMed 89. ↵ Tsubouchi T , Zhao H , Roeder GS . The meiosis-specific zip4 protein regulates crossover distribution by promoting synaptonemal complex formation together with zip2 . Dev Cell . 2006 ; 10 ( 6 ): 809 – 19 . doi: 10.1016/j.devcel.2006.04.003 . PubMed PMID: 16740482 . OpenUrl CrossRef PubMed Web of Science 90. ↵ Page SL , Hawley RS . The genetics and molecular biology of the synaptonemal complex . Annu Rev Cell Dev Biol . 2004 ; 20 : 525 – 58 . doi: 10.1146/annurev.cellbio.19.111301.155141 . PubMed PMID: 15473851 . OpenUrl CrossRef PubMed Web of Science 91. ↵ Tsubouchi T , Macqueen AJ , Roeder GS . Initiation of meiotic chromosome synapsis at centromeres in budding yeast . Genes Dev . 2008 ; 22 ( 22 ): 3217 – 26 . doi: 10.1101/gad.1709408 . PubMed PMID: 19056898 OpenUrl Abstract / FREE Full Text 92. ↵ Alani E , Padmore R , Kleckner N . Analysis of wildtype and rad50 mutants of yeast suggests an intimate relationship between meiotic chromosome synapsis and recombination . Cell . 1990 ; 61 : 419 – 36 . OpenUrl CrossRef PubMed Web of Science 93. Giroux C , Dresser ME , Tiano HF . Genetic control of chromosome synapsis in yeast meiosis . Genome . 1989 ; 31 : 88 – 94 . OpenUrl CrossRef PubMed 94. A. Henderson KA , Keeney S . Tying synaptonemal complex initiation to the formation and programmed repair of DNA double-strand breaks . Proc Natl Acad Sci U S 2004 ; 101 ( 13 ): 4519 – 24 . PubMed PMID: 15070750 . OpenUrl Abstract / FREE Full Text 95. Macqueen AJ , Roeder GS . Fpr3 and Zip3 ensure that initiation of meiotic recombination precedes chromosome synapsis in budding yeast . Curr Biol . 2009 ; 19 ( 18 ): 1519 – 26 . Epub 20090917. doi: 10.1016/j.cub.2009.08.048 . PubMed PMID: 19765989 OpenUrl CrossRef PubMed Web of Science 96. Bishop DK , Park D , Xu L , Kleckner N . DMC1 : a meiosis-specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation and cell cycle progression . Cell . 1992 ; 69 : 439 – 56 . OpenUrl CrossRef PubMed Web of Science 97. Novak JE , Ross-Macdonald PB , Roeder GS . The budding yeast Msh4 protein functions in chromosome synapsis and the regulation of crossover distribution . Genetics . 2001 ; 158 ( 3 ): 1013 – 25 . PubMed PMID: 11454751 . OpenUrl Abstract / FREE Full Text 98. ↵ Rockmill B , Sym M , Scherthan H , Roeder GS . Roles for two RecA homologs in promoting meiotic chromosome synapsis . Genes Dev . 1995 ; 9 : 2684 – 95 . OpenUrl Abstract / FREE Full Text 99. ↵ Xu L , Ajimura M , Padmore R , Klein C , Kleckner N . NDT80 , a meiosis-specific gene required for exit from pachytene in Saccharomyces cerevisiae . Mol Cell Biol . 1995 ; 15 ( 12 ): 6572 – 81 . OpenUrl Abstract / FREE Full Text 100. ↵ Humphryes N , Leung WK , Argunhan B , Terentyev Y , Dvorackova M , Tsubouchi H . The Ecm11-Gmc2 complex promotes synaptonemal complex formation through assembly of transverse filaments in budding yeast . PLoS Genet . 2013 ; 9 ( 1 ): e1003194 . Epub 20130110. doi: 10.1371/journal.pgen.1003194 . PubMed PMID: 23326245 ; OpenUrl CrossRef PubMed 101. ↵ Sym M , Engebrecht J , Roeder GS . ZIP1 is a synaptonemal complex protein required for meiotic chromosome synapsis . Cell . 1993 ; 72 : 365 – 78 . OpenUrl CrossRef PubMed Web of Science 102. ↵ Atcheson CL , DiDomenico B , Frackman S , Esposito RE. Isolation , DNA sequence, and regulation of a meiosis-specific eukaryotic recombination gene . Proceedings of the National Academy of Sciences (USA ). 1987 ; 84 : 8035 – 9 . OpenUrl Abstract / FREE Full Text 103. ↵ Coluccio AE , Rodriguez RK , Kernan MJ , Neiman AM . The yeast spore wall enables spores to survive passage through the digestive tract of Drosophila . PLoS One . 2008 ; 3 ( 8 ): e2873 . Epub 20080806. doi: 10.1371/journal.pone.0002873 . PubMed PMID: 18682732 OpenUrl CrossRef PubMed 104. ↵ Honigberg SM , Purnapatre K . Signal pathway integration in the switch from the mitotic cell cycle to meiosis in yeast . J Cell Sci . 2003 ; 16 : 2137 – 47 . OpenUrl 105. ↵ Pondugala VV , Mishra K . RNA-mediated regulation of meiosis in budding yeast . Noncoding RNA . 2022 ; 8 ( 6 ). Epub 20221115. doi: 10.3390/ncrna8060077 . PubMed PMID: 36412912 OpenUrl CrossRef PubMed 106. ↵ Granot D , Margolskee JP , Simchen G . A long region upstream of the IME1 gene regulates meiosis in yeast . Mol Gen Genet . 1989 ; 218 ( 2 ): 308 – 14 . doi: 10.1007/BF00331283 . PubMed PMID: 2674657 . OpenUrl CrossRef PubMed 107. ↵ Sagee S , Sherman A , Shenhar G , Robzyk K , Ben-Doy N , Simchen G , et al. Multiple and distinct activation and repression sequences mediate the regulated transcription of IME1 , a transcriptional activator of meiosis-specific genes in Saccharomyces cerevisiae . Mol Cell Biol . 1998 ; 18 ( 4 ): 1985 – 95 . doi: 10.1128/MCB.18.4.1985 . PubMed PMID: 9528770 OpenUrl Abstract / FREE Full Text 108. ↵ van Werven FJ , Neuert G , Hendrick N , Lardenois A , Buratowski S , van Oudenaarden A , et al. Transcription of two long noncoding RNAs mediates mating-type control of gametogenesis in budding yeast . Cell . 2012 ; 150 ( 6 ): 1170 – 81 . Epub 20120906. doi: 10.1016/j.cell.2012.06.049 . PubMed PMID: 22959267 OpenUrl CrossRef PubMed Web of Science 109. ↵ Mitchell AP , Herskowitz I . Activation of meiosis and sporulation in yeast by repression of the RME1 product in yeast . Nature . 1986 ; 319 : 738 – 42 . OpenUrl CrossRef PubMed 110. ↵ Moretto F , Wood NE , Kelly G , Doncic A , van Werven FJ . A regulatory circuit of two lncRNAs and a master regulator directs cell fate in yeast . Nat Commun . 2018 ; 9 ( 1 ): 780 . Epub 20180222. doi: 10.1038/s41467-018-03213-z . PubMed PMID: 29472539 OpenUrl CrossRef PubMed 111. ↵ Hazelbaker DZ , Marquardt S , Wlotzka W , Buratowski S . Kinetic competition between RNA Polymerase II and Sen1-dependent transcription termination . Mol Cell . 2013 ; 49 ( 1 ): 55 – 66 . Epub 20121121. doi: 10.1016/j.molcel.2012.10.014 . PubMed PMID: 23177741 OpenUrl CrossRef PubMed 112. Porrua O , Libri D . A bacterial-like mechanism for transcription termination by the Sen1p helicase in budding yeast . Nat Struct Mol Biol . 2013 ; 20 ( 7 ): 884 – 91 . Epub 20130609. doi: 10.1038/nsmb.2592 . PubMed PMID: 23748379 . OpenUrl CrossRef PubMed 113. Schaughency P , Merran J , Corden JL . Genome-wide mapping of yeast RNA polymerase II termination . PLoS Genet . 2014 ; 10 ( 10 ): e1004632 . Epub 20141009. doi: 10.1371/journal.pgen.1004632 . PubMed PMID: 25299594 OpenUrl CrossRef PubMed 114. ↵ Steinmetz EJ , Warren CL , Kuehner JN , Panbehi B , Ansari AZ , Brow DA . Genome-wide distribution of yeast RNA polymerase II and its control by Sen1 helicase . Mol Cell . 2006 ; 24 ( 5 ): 735 – 46 . doi: 10.1016/j.molcel.2006.10.023 . PubMed PMID: 17157256 . OpenUrl CrossRef PubMed Web of Science 115. ↵ Haidara N , Giannini M , Porrua O . Modulated termination of non-coding transcription partakes in the regulation of gene expression . Nucleic Acids Res . 2022 ; 50 ( 3 ): 1430 – 48 . doi: 10.1093/nar/gkab1304 . PubMed PMID: 35037029 OpenUrl CrossRef PubMed 116. ↵ Steinmetz EJ , Conrad NK , Brow DA , Corden JL . RNA-binding protein Nrd1 directs poly(A)-independent 3’-end formation of RNA polymerase II transcripts . Nature . 2001 ; 413 (6853): 327 -31. doi: 10.1038/35095090 . PubMed PMID: 11565036 . OpenUrl CrossRef PubMed Web of Science 117. ↵ Alzu A , Bermejo R , Begnis M , Lucca C , Piccini D , Carotenuto W , et al. Senataxin associates with replication forks to protect fork integrity across RNA-polymerase-II- transcribed genes . Cell . 2012 ; 151 ( 4 ): 835 – 46 . doi: 10.1016/j.cell.2012.09.041 . PubMed PMID: 23141540 OpenUrl CrossRef PubMed Web of Science 118. ↵ Choudhary R , Niska-Blakie J , Adhil M , Liberi G , Achar YJ , Giannattasio M , et al. Sen1 and Rrm3 ensure permissive topological conditions for replication termination . Cell Rep . 2023 ; 42 ( 7 ): 112747 . Epub 20230704. doi: 10.1016/j.celrep.2023.112747 . PubMed PMID: 37405920 . OpenUrl CrossRef PubMed 119. Mischo HE , Gomez-Gonzalez B , Grzechnik P , Rondon AG , Wei W , Steinmetz L , et al. Yeast Sen1 helicase protects the genome from transcription-associated instability . Mol Cell . 2011 ; 41 ( 1 ): 21 – 32 . doi: 10.1016/j.molcel.2010.12.007 . PubMed PMID: 21211720 OpenUrl CrossRef PubMed Web of Science 120. ↵ Zardoni L , Nardini E , Brambati A , Lucca C , Choudhary R , Loperfido F , et al. Elongating RNA polymerase II and RNA:DNA hybrids hinder fork progression and gene expression at sites of head-on replication-transcription collisions . Nucleic Acids Res . 2021 ; 49 ( 22 ): 12769 – 84 . doi: 10.1093/nar/gkab1146 . PubMed PMID: 34878142 OpenUrl CrossRef PubMed 121. ↵ Aiello U , Challal D , Wentzinger G , Lengronne A , Appanah R , Pasero P , et al. Sen1 is a key regulator of transcription-driven conflicts . Mol Cell . 2022 ; 82 ( 16 ): 2952 – 66 e6. Epub 20220714. doi: 10.1016/j.molcel.2022.06.021 . PubMed PMID: 35839782 . OpenUrl CrossRef PubMed 122. ↵ Cha RS , Weiner BM , Keeney S , Dekker J , Kleckner N . Progression of meiotic DNA replication is modulated by interchromosomal interaction proteins, negatively by Spo11p and positively by Rec8p . Genes Dev . 2000 ; 14 ( 4 ): 493 – 503 . PubMed PMID: 10691741 . OpenUrl Abstract / FREE Full Text 123. ↵ Borde V , Goldman AS , Lichten M . Direct coupling between meiotic DNA replication and recombination initiation . Science . 2000 ; 290 (5492): 806 -9. PubMed PMID: 11052944 . OpenUrl Abstract / FREE Full Text 124. Panizza S , Mendoza MA , Berlinger M , Huang L , Nicolas A , Shirahige K , et al. Spo11-accessory proteins link double-strand break sites to the chromosome axis in early meiotic recombination . Cell . 2011 ; 146 ( 3 ): 372 – 83 . doi: 10.1016/j.cell.2011.07.003 . PubMed PMID: 21816273 . OpenUrl CrossRef PubMed Web of Science 125. ↵ Sasanuma H , Hirota K , Fukuda T , Kakusho N , Kugou K , Kawasaki Y , et al. Cdc7- dependent phosphorylation of Mer2 facilitates initiation of yeast meiotic recombination . Genes Dev . 2008 ; 22 : 398 – 410 . OpenUrl Abstract / FREE Full Text 126. ↵ Niu H , Li X , Job E , Park C , Moazed D , Gygi SP , et al. Mek1 kinase is regulated to suppress double-strand break repair between sister chromatids during budding yeast meiosis . Mol Cell Biol . 2007 ; 27 ( 15 ): 5456 – 67 . PubMed PMID: 17526735 . OpenUrl Abstract / FREE Full Text 127. ↵ Lo HC , Hollingsworth NM . Using the semi-synthetic epitope system to identify direct substrates of the meiosis-specific budding yeast kinase, Mek1 . Methods Mol Biol. 2011 ;745:135-49. doi: 10.1007/978-1-61779-129-1_9 . PubMed PMID: 21660693 ; OpenUrl CrossRef PubMed 128. ↵ Jones GM , Stalker J , Humphray S , West A , Cox T , Rogers J , et al. A systematic library for comprehensive overexpression screens in Saccharomyces cerevisiae . Nat Methods . 2008 ; 5 ( 3 ): 239 – 41 . Epub 2008/02/05. doi: 10.1038/nmeth.1181 . PubMed PMID: 18246075 . OpenUrl CrossRef PubMed Web of Science 129. ↵ Grubb J , Brown MS , Bishop DK . Surface spreading and immunostaining of yeast chromosomes . J Vis Exp . 2015 ;( 102 ): e53081 . Epub 20150809. doi: 10.3791/53081 . PubMed PMID: 26325523 OpenUrl CrossRef PubMed 130. ↵ Voelkel-Meiman K , Cheng SY , Morehouse SJ , MacQueen AJ . Synaptonemal complex proteins of budding yeast define reciprocal roles in MutSgamma-mediated crossover formation . Genetics . 2016 ; 203 ( 3 ): 1091 – 103 . Epub 20160516. doi: 10.1534/genetics.115.182923 . PubMed PMID: 27184389 OpenUrl Abstract / FREE Full Text 131. ↵ Yue JX , Li J , Aigrain L , Hallin J , Persson K , Oliver K , et al. Contrasting evolutionary genome dynamics between domesticated and wild yeasts . Nat Genet . 2017 ; 49 ( 6 ): 913 – 24 . Epub 2017/04/19. doi: 10.1038/ng.3847 . PubMed PMID: 28416820 ; OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted April 12, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following The conserved SEN1 DNA:RNA helicase has multiple functions during yeast meiosis Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share The conserved SEN1 DNA:RNA helicase has multiple functions during yeast meiosis Robert Gaglione , Jonathan Caradonna , Amy J. MacQueen , Ed Luk , Nancy M. Hollingsworth bioRxiv 2025.04.10.648140; doi: https://doi.org/10.1101/2025.04.10.648140 Share This Article: Copy Citation Tools The conserved SEN1 DNA:RNA helicase has multiple functions during yeast meiosis Robert Gaglione , Jonathan Caradonna , Amy J. MacQueen , Ed Luk , Nancy M. Hollingsworth bioRxiv 2025.04.10.648140; doi: https://doi.org/10.1101/2025.04.10.648140 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetics Subject Areas All Articles Animal Behavior and Cognition (7629) Biochemistry (17660) Bioengineering (13881) Bioinformatics (41910) Biophysics (21436) Cancer Biology (18576) Cell Biology (25480) Clinical Trials (138) Developmental Biology (13368) Ecology (19887) Epidemiology (2067) Evolutionary Biology (24302) Genetics (15598) Genomics (22482) Immunology (17726) Microbiology (40360) Molecular Biology (17163) Neuroscience (88534) Paleontology (666) Pathology (2830) Pharmacology and Toxicology (4821) Physiology (7637) Plant Biology (15129) Scientific Communication and Education (2045) Synthetic Biology (4290) Systems Biology (9817) Zoology (2269)