VALD-3 suppresses triple negative breast cancer progression via Caspase 3/GSDME-dependent pyroptosis

VALD-3 suppresses triple negative breast cancer progression via Caspase 3/GSDME-dependent pyroptosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article VALD-3 suppresses triple negative breast cancer progression via Caspase 3/GSDME-dependent pyroptosis Hongling Li, Xuhong Pan, Linyu Li, Pengfei Song, Xin Chen, Weijie Ma, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1810049/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract yroptosis, an inflammatory form of Programmed cell death (PCD) and so far, the function of Schiff base compounds in pyroptosis cell death has not been reported. Here, we show that VALD3, a Ligand derivative of Schiff base, treated Triple negative breast cancer (TNBC) cells exhibited specific pyroptotic characteristics, including cell swelling, balloon-like bubbling and inflammatory cytokine release through pore formation in the plasma membrane, eventually suppressing the tumor growth of TNBC. In addition, Western blot analysis revealed that the cleavage of Gasdermin E (GSDME),was related to the activation of caspase-3 in TNBC cells treated by VALD3. Consistent with this, treatment with zDEVD-FMK,a caspase-3 specific inhibitor,reduces VALD3-induced GSDME–N-terminal fragment cleavage and pyroptosis. Mechanistically, VALD3 elevated the level of reactive oxygen species(ROS)and c-Jun NH2-terminal kinase (JNK)phosphorylation.NAC,a ROS scavenger,reversed the pyroptosis and JNK phosphorylation in MDA-MB-468 and MDA-MB-231 treated by VALD3. Activated JNK recruited Bax to mitochondria to form a heterodimer with Bcl-2, which stimulated the release of cytochrome c into the cytoplasm, followed by caspase-3 activation and GSDME-depended pyroptosis in TNBC cells. Therefore, in TNBC cells,VALD-3 treatment induces the ROS/JNK/Bax-mitochondrial apoptosis pathway. Thereby activating Caspase-3 and inducing cleavage of GSDME to execute pyroptosis. These findings bring an unexpected concept that GSDME-dependent pyroptosis is an unrecognized mechanism by which VALD3 eradicates neoplastic cells, and provide new insights into the clinical application of anticancer therapeutics. pyroptosis VALD 3 GSDME Caspase-3 cancer therapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Female breast cancer has surpassed lung cancer as the most commonly diagnosed cancer in 2020, according to predictions from the International Agency for Research on Cancer, with an anticipated 2.3 million new cases (11.7 percent ). Breast cancer affects one out of every four women and is responsible for one out of every six cancer fatalities. [ 1 ] TNBC is a subtype of breast cancer that accounts for 15–20% of all cases. It has an aggressive phenotype and lacks estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) expression [ 2 ] . Furthermore, due to resistance to anthracyclines and taxanes, there is no preferred standard chemotherapy regimen for metastatic TNBC. Patients with TNBC have a shorter survival rate, and recurrence and distant metastasis occur significantly more frequently than patients with other types of breast cancer after treatment [ 3 ] . This is a big healthcare concern as well as a financial burden for women. As a result, it is critical to discover effective neoadjuvant chemotherapy medicines for TNBC patients who have a poor prognosis. Apoptosis, Necroptosis, Pyroptosis, and other PCD processes have distinct biological properties and are regulated by genes [ 4 ][ 5 ][ 6 ] . Zychlinsky et al originally identified pyroptosis, a lytic variant of PCD, in 1992 to separate it from apoptosis, which has a very distinct morphology [ 7 ] . Shigella dysentery may activate caspase-1 in host cells, according to Arturo Zychlinsky et al. in 1997 [ 8 ] . Further research in 1999 revealed that Caspase-1 deletion might prevent cell death induced by Salmonella [ 9 ] . Cookson et al., a University of Washington student, initially introduced the term "pyroptosis" to characterize this distinct inflammatory programmed cell death process in 2001. Pyro refers to the release of pro-inflammatory mediators and a cascade of inflammatory events, whereas "ptosis" relates to the nature of planned cell death [ 10 ] . Pyroptosis is triggered by an innate immunity-related extracellular or intracellular homeostasis disorder characterized by apoptosis-like chromatin condensation and DNA breakage in the early stages, followed by cellular swelling and cell lysis, and finally inflammatory cytokine release [ 11 ] . At the molecular level, pyroptosis is divided into two parts: the canonical caspase-1/4/5 (orthologous to Caspase-11 in mice) pathway and the non-canonical caspase-3 pathway [ 12 ][ 13 ][ 14 ] . Gasdermin D (GSDMD) is immediately cleaved by active caspase-1 or caspase-4/5/11 at its hinge region, releasing a C-terminal and an N-terminal fragment. By being dissolved in phospholipid inosine or cardiolipin liposomes or liposomes made of naturally polar liposomes, GSDMD-N can generate a wide variety of Gasdermin holes and release IL-1 and IL-18 extracellularly. GSDME, also known as DFNA5 (deafness, autosomal dominant 5), is a tumor suppressor that belongs to the Gasdermin superfamily [ 15 ][ 16 ] . Many recent investigations have showed that chemotherapy drug-activated caspase-3 can cleave GSDME to create the N- and C-terminal domain in both cancer and normal cells that express high levels of GSDME, in addition to activating the conventional pathway of caspase-1/4/5. The N-terminal domain of GSDME is comparable to that of GSDMD, resulting in pore development and pyrophosis on the plasma membrane [ 17 ] . In both MDA-MB-231 and MCF-7 cells, Yan et al. discovered that triclabendazole induced apoptosis by activating caspase-3/7/8/9 and promoting GSDME cleavage. Moreover, it was discovered that triclabendazole inhibited the growth of xenograft tumors by increasing caspase-3, GSDME, and PARP cleavage in the xenograft mode [ 18 ] . This discovery could pave the way for the future creation of tailored, precise breast cancer treatment. Schiff base, commonly known as imine, is a kind of chemical molecule that contains imine (-C = N-), which is generated via the condensation of ammonia and active carbonyl compounds. Hugo Schiff was the first to report it in 1864 [ 19 ] . Schiff base organic molecules have strong coordination ability, and several Schiff base metal complexes with different functionalities and structures can be generated by employing different types of Schiff bases as organic ligands to coordinate with different metals [ 20 ][ 21 ][ 22 ] . Schiff base and its metal complexes have antitumor, antibacterial, antioxidant, antiviral, and other activities, and have promising applications in chemical catalysis, biomedicine, functional materials, food industry, and other fields [ 23 ][ 24 ][ 25 ][ 26 ] . They also play an important role in electrochemistry. Soft ligand studies have increased in recent years, owing to the fact that flexible chain ligands are chemically stable, their structure is adaptable, and the flexible chain is customizable and replace, allowing for a variety of coordination modes, enriching the types of complexes, and demonstrating high performance and biological activity. Valdien (N1, N3-bis (3-methoxysalicylidene) diethylenetriamine (Fig. 1 ), a Schiff base, demonstrated anti-tumor actions in vivo and in vitro by triggering apoptosis [ 27 ][ 28 ] .We created a water-soluble Schiff base ligand named VALD-3 by linking hydrophilic hydroxyl(-OH) to o-vanillin to improve the schiff base ligand's water-solubility after reactions with diamine and polyamine, and found that ValD-3 has a significant inhibitory effect on tumor cell proliferation in a variety of cancer cells [ 29 ] . This study evaluated the effects of valdien-3 inhibition on breast cancer cell proliferation, migration, and invasion. The most noteworthy is that Valdien-3 was first proposed to have an anticancer effect by causing triple negative breast cancer cells to pyrophosis. Valdien-3 regulation of pyrotopia in triple negative breast cancer cells was investigated using a putative mechanism and a crucial signaling pathway. Materials And Methods Chemicals and reagents. VALD-3 (purity ≥ 98.0%) was kindly supplied by Professor Song Pengfei (Northwest Normal University, China). Fetal bovine serum (FBS) was purchased from Lonser (Shanghai, China).The antibodies against against DFNA5/GSDME (#ab215191), GSDMD (#ab215203) and Cleaved-Caspase3(#ab2302)were obtained from Abcam (Cambridge, UK). The antibodies against BCL-2(12789-1-AP),Cytochrome c(10993-1-AP), BAX(50599-2-lg),Caspase-3(19677-1-AP),JNK(24164-1-AP),P-JNK(80024-1-RR ) and GADPH(10494-1-AP ) were obtained from Proteintech Group Inc.(Chicago, IL, USA). RIPA cell buffer(R0010) were obtained from Solarbio Co., Ltd (Beijing, China). FITC Annexin V apoptosis detection kit I (#556547) was obtained from BD Biosciences Pharmingen (San Diego, CA, USA). All other reagents and plastic material were obtained from commercial sources. Cell culture Human breast cancer MCF-7,MDA-MB-231,MDA-MB-468 cell lines were purchased from the Stem Cell Bank, Chinese Academy of Sciences (Shanghai, China). The cells were cultured in complete DMEM medium (Gibco,Waltham,MA,United States) supplemented with 10% fetal bovine serum (Gibco, Waltham, MA, United States)and 50g/ml penicillin/streptomycin (HyClone) at 37°C in a humidified incubator with 5% CO2, and were routinely tested to ensure no mycoplasma contamination during the study. Cell viability assays Inhibition effects of Valdien-3 on the proliferation of MCF-7,MDA-MB-231 and MDA-MB-468 cells were measured by cell counting kit-8 assay(CCK-8, Dojindo, Kumamoto, Japan) .Cells were seed into 96-well culture plates at a density of 5000 cells /well and treated with Valdien-3 (0, 5, 10, 20 and 40 µg/mL) for 24, 48 and 72 hours. After incubation,10µl of cck-8 reagent was added to each well, and the plate was further incubated for 2 h at 37°C. The absorbance at 450nm (A450) was read on a microplate reader (Molecular Devices, Sunnyvale, USA).All experiments were conducted for three times. Observe the morphology To examine the morphology of pyroptotic cells, cells were seeded in 35-mm culture dishes and treated with VALD-3(20µg/mL) for 48h. After incubation, The pore-forming activity of VALD-3-induced pyroptosis was examined by transmission electron microscopy (TEM). Flow cytometry analysis The Annexin V-FITC Apoptosis Assay Kit (BD Biosciences, USA) was used to detect cell death following the manufacturer's introduction.Cells were seeded in 6-well plates and treated with VALD-3 for 48h, cells were harvested and washed twice with cold PBS. Then, 5µl Annexin V-FITC and 5µl PI were added and incubated in dark at room temperature for 15min. After staining,400ml 1X binding buffer was added to each sample and the cells were immediately analyzed on a flow cytometer (BD Biosciences, CA, USA).annexin V and PI double-positive cells were considered pyroptotic cells. Transwell invasion assays To test the effect of Valdien-3 on cell invasion activity, we performed Transwell invasion assays with an 8-µm pore polycarbonate filter insert coated with 0.1% gelatin (Corning, New York, NY, USA). Briefly, starved cells (1x10 4 /well) were seeded in the upper chambers of the Transwell. DMEM medium containing 10% FBS was added to the bottom chamber. The top and bottom chamber contained the same concentration of Valdien-3(0, 5, 10, 20, and 40µg/mL). After incubation for 24 h, cells that migrated or invaded through and adhered to the bottom of the membrane were fixed and stained. Images were captured using a olympus inverted microscope and five random fields were captured for each membrane,and the migratory and invasive cells were counted and averaged Wound healing assay MDA-MB-231 and MDA-MB-468 cells were incubated in a 6-well culture plate to achieve 90% confluence. Monolayer cells were wounded by scratching with a 200ul pipette tip. To remove the debris and smooth the edge of the scratch, the culture medium was removed and the wells were washed 3 times with PBS. Then, cells were treated Valdien-3 (0, 5, 10, 20 and 40 µg/mL) in different concentrations. Images were captured using a olympus inverted microscope after 48h of incubation at 37˚C and 5% CO 2 . The width of the open area was measured by image J software and the width of wound closure was used to estimate the migration capacity. LDH and IL-1β release assay Pyroptosis were quantitated by assaying the activity of LDH released into cell culture supernatants after various treatments using the CytoTox96 LDH-release kit (Servicebio,G1610-100T). 450 nm was used to measure the absorbance value. The LDH activity in the culture supernatant was expressed as a percentage of total LDH in the cell lysate. IL-1β were measured using the QuantiCyto IL-1β ELISA kit (jonln,JL13662) following the manufacturer’s instructions. The absorbance value at 450nm was then measured. Each experiment was repeated three times. Measurement of ROS The ROS levels were measured by a ROS Assay with DCFH-DA (Beyotime, Shanghai, China)following the manufacturer’s protocol. Dichloroflfluorescin diacetate (DCHF-DA) is a cell membrane permeable probe and widely used to detect intracellular ROS.DCHF-DA is hydrolyzed into 70-dichlorodihydroflfluorescin (DCHF) by intracellular esterase, which is thereby retained inside the cells. ROS-mediated oxidation of DCHF yields a highly flfluorescent compound dichloroflfluorescein (DCF). Importantly, the flfluorescence intensity is proportional to the amount of ROS produced by the cells.Briefly, TNBC cells in indicated groups were seeded at the density of 5×105 into 6-well plates,then treatment with Valdien-3 (0, 5, 10, 20 and 40 µg/mL) for 48h, cells were washed with PBS,and stained with DCFH-DA (10 µM) for 30 min at 37°C in the dark. The level of ROS was determined by fluorescence microscope(Olympus, Tokyo, Japan). Meanwhile TNBC cells were seeded in a 96-well plate at the density of 5×10 3 cells per well and incubated for 48 h at 5% CO2 and 37℃. The treated cells were loaded with 20 mM,dichloroflfluorescin diacetate (DCFH-DA) in serum-free MEM medium at 5% CO2 and 37℃ for 30 min. After the excessive DCFH-DA was removed by gently washing with 200ul PBS for three times. The flfluorescence was measured on a Packard Fusion alpha Fluorescence Microplate Reader (SpectraMax i3X,Silicon Valley,USA). ROS levels were expressed as a percentage relative to the control and microplate reader(Molecular Devices, Sunnyvale, USA). TUNEL staining The DNA fragmentation of MDA-MB-231 and MDA-MB-468 cells treated with Valdien-3(20µg/mL), or Valdien-3 + zDEVD-FMK were detected according to the manufacturer’s protocol of the TUNEL kit (Roche, Indianapolis, IN, USA). Briefly, cells were seeded onto an 6-well plate. Thereafter, cells were fixed, permeabilized, and incubated with the TUNEL reagent. DAPI (Solarbio Co., Ltd,Beijing, China) was used to recogniz nuclei and categorize cells, fluorescence microscopy was used to measure the TUNEL staining. TNBC cells that were both stained with TUNEL and DAPI were positive. Western blot analysis Cells were treated with different concentrations of Valdien-3 for 48h. Protein samples were extracted from cells for western blot analysis. The concentration of protein samples were measured using the BCA Protein Assay Kit (Solarbio,PC0020). Samples were added at 20µg/well. and then proteins of different sizes were transferred onto PVDF membranes (Millipore, USA). After blocked with 5% skim milk for 2h at room temperature, the membranes were incubated with primary antibodies targeting IL-1β, GSDME, caspase-3/-9, Bax, Bcl-2, JNK, p-JNK, cytochrome c and GAPDH overnight at 4°C. After extensive washing with 1ΧTBST (3×10 min), the membranes were incubated in horseradish peroxidase (HRP)-linked anti-biotin and the appropriate secondary antibody in TBST for 1h at room temperature. The blots were detected via the enhanced chemiluminescence (ECL,Yeasen Biotechnology,shanghai,) reaction. Quantification of protein bands were achieved by densitometric analysis using image J software. GAPDH served as an internal contro and all Western blot analyses were carried out at least three times. Quantitative real‑time RT‑PCR (qRT‑PCR). Total RNA was extracted from the harvested cells or cardiac tissues using Marple® Cell/Tissue Total RNA Kit (Yisheng Biotechnology,Shanghai,19221ES50) according to the manufacturer’s instructions. RNA was then quantified and reverse-transcribed into complementary DNAs using specific stem-loop reverse transcription primers. First-strand mRNAs were synthesized with a Hifair Ⅱ 1st Strand cDNA Synthesis Kitand for qPCR (Yisheng Biotechnology,Shanghai.11123ES60). Real-time PCR was conducted on an IQ5 instrument (Bio-Rad, CA, USA) using SYBR Green fluorescence signal detection assays (Yeasen Biotechnology,shanghai,11201ES60) with primers. The following primers were used. GSDME:Forward,5’TACTTCTTGGTCAGTGCCCTCG3’,Reverse,5’CCTTTCTGTATCTTTCAGGGGAGT3’. Caspase3:Forward,5’AGAACTGGACTGTGGCATTGAG3’,Reverse,5’CACAAAGCGACTGGATGAACC3’. IL-1β:forward,5’TACCTGTCCTGCGTGTTGAAA3’,reverse,5’GGTGCTGATGTACCAGTTGGG3’. GAPDH:Forward,5’GGAAGCTTGTCATCAATGGAAATC3’,Reverse,5’TGATGACCCTTTTGGCTCCC3’. The specific mRNA expression level was analyzed by the 2−ΔΔCT method. Statistical analysis. All experiments were performed at least three times independently. Data were analyzed by one-way analysis of variance (ANOVA) and all results were expressed as mean ± standard deviation (SD). Differences among the treatment groups were assessed by LSD-t test, using Graph Pad Prism 9 (GraphPad Software Inc., San Diego, CA, USA). p < 0.05 was considered to indicate statistical significance. Results Effects of Valdien-3 on the proliferation, invasion and migration of breast cancer cells in vitro We first looked at the possible anticancer effects of VALD3 in invasive TNBC cells because patients with TNBC are thought to be difficult to cure with standard chemotherapy, emphasizing the need and urgency of developing neoadjuvant medicines. The cytotoxicity of MCF-7, MDA-MB-231, and MDA-MB-468 cells was measured using the CCK-8 test. Three types of breast cancer cells were treated with varied doses of Valdien-3 (5, 10, 20, and 40mg/l) for 24 hours, 48 hours, and 72 hours, as shown in Fig. 1 a-c. Valdien-3 suppressed MCF7, MDA-MB-231, and MDA-MB-468 cell proliferation in a concentration- and time-dependent manner.Interestingly, the inhibition rate of VALD3 on TNBC (MDA-MB-231 ,MDA-MB-468 cells) was significantly higher than those in non-TNBC (MCF7 cells). Therefore, we selected two types of TNBC cells (MDA-MB-231 and MDA-MB-468 cells) and focused on the subsequent experiments. Tumor migration and invasion are linked to tumor worsening and development, according to a significant body of research. Using the Wound Healing assay and the Transwell Invasion assays, we investigated whether Valdien-3 altered TNBC cell invasion and migration. For the assay, MDA-MB-231 and MDA-MB-468 cells were treated for 48 hours with different doses of Valdien-3 (5, 10, 20, and 40 mg/L). VALD-3 dramatically reduced the migration and invasion of MDA-MB-231 and MDA-MB-468 cells in a concentration-dependent manner after 48 hours, as seen in Figs. 1 d-g, when compared to untreated control cells. These data show that VALD-3 has anti-migratory and anti-invasive properties in TNBC cells. The Valdien-3 induces pyroptotic cell death in triple-negative breast cancer cells The overwhelming evidence demonstrates that cytoplasmic enlargement, cell membrane pore creation, membrane rupture, and the release of IL-1 into the extracellular environment are all hallmarks of pyroptosis, as measured by flow cytometry with enhanced AnnexinV-FITC/PI double-positive cells. The dying cells had typical swelling, balloon-like bubbling, and membrane rupture (Fig. 2 a,b), which was very similar to the pyroptosis generated by the N-terminus of GSDMD/GSDME. [ 30 ] .Additionally, LDH and IL-1 studies revealed that Valdien-3 increased LDH and IL-1 release in a concentration-dependent manner (Fig. 2 c,d), implying that VALD3 therapy disrupted cell membrane integrity. To further validate the role of VALD3 in pyroptosis induction, MDA-MB-231 and MDA-MB-468 were incubated with VALD3 and pyroptosis was observed by analyses of flow cytometry of double positive for Annexin V and PI. Compared with mock treated cells, the percentage of Annexin V+/PI + cells were dramatically increased after VALD3 treatment in a concentration-dependent manner(Fig. 2 e,f). Therefore, these data together indicate that VALD3 can trigger pyroptosis in by inducing the rupture and leakage of the plasma membrane in TNBC cells. The Valdien-3 induces pyroptosis by activating caspase-3 to cleave GSDME in TNBC cells Previous studies have shown that when GSDMD is cleaved, the N-terminal fragment of GSDMD is released, it translocates to the membrane, generates membrane holes, and finally induces pyroptosis [ 16 ][ 31 ] . Unfortunately, in Valdien-3-treated MDA-MB-231 and MDA-MB-468 cells, N-terminal fragments of GSDMD were not detected (Fig. 3 a,b). As a result, we hypothesized that other members of the gasdermin family could be responsible for Valdien-3-induced pyroptosis in MDA-MB-231 and MDA-MB-468 cells. GSDME, another member of the gasdermin family that shares the same pyroptotic N-terminal domain of GSDMD, has been shown to execute pyroptosis under internal and external stimulus owing to cleavage by activated caspase-3 [ 15 ] . Thus, we hypothesized that GSDME may also have a key determinant for Valdien-3 induced pyroptosis in TNBC. Consistently,our study found that Valdien-3 treatment led to increased levels of RNA of GSDME,Caspase-3 and IL-1β in MDA-MB-231 and MDA-MB-468 cells in a concentration-dependent manner (Fig. 3 c,d). The similar trends were seen for the N-terminal domain of GSDME and the activation levels of caspase-3 by Western Blot(Fig. 3 e,f). Taken together,these data suggest that Valdien-3-induced pyroptosis is dependent on cleavage of GSDME but not GSDMD in TNBC cells. Cleaved Caspase-3 is the critical switch for GSDME-mediated Pyroptosis in TNBC cells treated with Valdien-3 Several of our previous experiments showed that valdien-3-induced Caspase-3 activation might be accomplished via death receptor or mitochondrial mechanisms. Meanwhile, Western blot analysis revealed that Valdien-3 increased GSDME cleavage and caspase-3 activation, as previously indicated (Fig. 3 c,d). We then conducted a series of tests to better understand the link between the caspase cascade and GSDME cleavage. TUNEL staining was used to track DNA damage, whereas DAPI staining was utilized to track nuclei morphology.At 48 hours after treatment with Valdien-3, the cell death rate was considerably higher than in the control group. The rise was significantly reduced in the groups treated with Z-DEVD-FMK, a caspase-3-specific inhibitor (Fig. 4 a,b). To ensure that pyroptosis was involved in this process and distinguished pyroptosis cells from apoptotic cells in the TUNEL-positive cells, we examined the results of western blot analysis indicate that z-DEVD-FMK treatment inhibited the cleavage of GSDME (Fig. 4 c,d). Furthermore, co-treatment with z-DEVD-FMK inhibited the release of LDH and IL-1 caused by Valdien-3 (Fig. 4 e,h). In accord with this, flow cytometry analysis revealed that Z-DEVD-FMK therapy dramatically reduced the proportion of Valdien-3-induced double positive cells for Annexin V and PI when compared to control (Fig. 4 i,j). These findings imply that Valdien-3 administration causes cell death by causing pyroptosis, which is dependent on caspase-3-mediated GSDME cleavage. GSDME is activated by the Valdien-3-elevated ROS/JNK signaling Next, We attempted to explore the underlying molecular mechanism that trigger GSDME-dependent pyroptosis in Valdien-3 treatment. Reactive oxygen species (ROS), active forms of oxygen, produced as a by-products by mitochondria and other cellular elements [ 32 ] . ROS have been reported to regulate cells apoptosis, autophagy and induce pyroptosis, eventually suppressing cancer progression [ 33 ][ 34 ] . However, it has not been reported whether Valdien-3-elevated ROS links to pyroptosis .To elucidate the possible role of ROS in Valdien-3-induced pyroptosis, we first determined ROS levels in breast cancer cells treated with Valdien-3 by fluorescence microscope(Fig. 5 a,b) and microplate reader (Fig. 5 c,d), and our results demonstrated that the levels of ROS in MDA-MB-231 and MDA-MB-468 cells increased after Valdien-3 treatment in a concentration-dependent manner. Interestingly, NAC, a ROS scavenger, substantially attenuated the protein levels of caspase-3/GSDME (Fig. 5 e,f). Meanwhile, NAC substantially attenuated the release of IL-1β and LDH compared with control(Fig. 5 g-k). Therefore, we hypothesized that caspase-3-GSDME axis is involved in pyroptosis mediated by cellular ROS. ROS could regulates various cellular signaling pathways such as NF-κB activation,ERK/MAPK signalling pathway [ 35 ][ 36 ] . protein kinase of the MAPK family, plays a key role in many cellular events, including the control of proliferation, differentiation, survival and migration of specific cell types [ 37 ][ 38 ] . In current study, we found that Valdien-3 stimulation markedly elevated the phosphorylation of JNK in MDA-MB-231 and MDA-MB-468 cells in a concentration-dependent manner (Fig. 6 a,b). More importantly, JNK inhibitor, SP600125, effectively reverse the cleaved of GSDME(Fig. 6 c,d), and the release of LDH and IL-1β (Fig. 6 e-h). Thus, JNK may be an upstream regulator of GSDME-dependent pyroptosis. Furthermore,ROS scavenger NAC abolished the phosphorylation of JNK induced by Valdien-3 (Fig. 6 i,j). This suggests that JNK is likely to be a downstream factor of ROS. Collectively, these results suggest that Valdien-3 induces the generation of mitochondrial ROS, thereby increasing phosphorylation of JNK, and ultimately inducing pyroptosis by activating caspase-3 to cleave GSDME. Valdien-3-Induced GSDME-Dependent Pyroptosis is downstream of the ROS/JNK/Bax-Mitochondrial apoptotic Pathway ROS/JNK signaling pathway plays an important role in cell apoptosis, especially bax - mitochondrial apoptosis pathway [ 39 ] . However, the relationship between ROS/JNK/Bax-Apoptotic Pathway and Pyroptosis requires further verification.Our study found that Valdien-3 significantly elevate the protein levels of Bcl-2 and cytochrome c, while downregulate the protein levels of Bax in MDA-MB-231 and MDA-MB-468 cells in a concentration-dependent manner (Fig. 7 a,b), which can be markedly reversed by ROS inhibitor NAC or JNK inhibitor SP600125(Fig. 7 c,d). These results revealed that GSDME-dependent pyroptosis is downstream of the ROS/JNK/Bax-mitochondrial apoptotic pathway. In conclusion, Valdien-3 increased the level of ROS and P-JNK, and activated JNK recruits Bax into the mitochondria and promotes cyt-c release into the cytoplasm, which induces caspase-3 cleavage and GSDME-dependent pyroptosis in TNBC cells. Discussion Schiff bases are mainly organic compounds containing imine or methylamine specific groups (-RC = N-), usually formed by condensation of ammonia and active carbonyl compounds.In recent years, a large number of studies have shown that Schiff base and its complexes have anti-inflammatory, antiviral and anti-tumor activities on a variety of tumor cells without any side effects. Due to its important biological significance in many fields including anti-cancer activity, people have been interested in Schiff base and its complexes [ 26 ][ 40 ][ 41 ][ 42 ] .A large number of previous studies have confirmed that Valdien has significant anti-tumor effects, belonging to the Schiff base family, on gastric cancer, liver cancer, human non-Hodgkin lymphoma and gastric cancer. Unfortunately, Valdien's poor water solubility limits its clinical use. Therefore, we synthesized Schiff base ligand from o-vanillin derivatives, identified a water-soluble Schiff base ligand (VALD-3), and studied its anti-breast tumor effect in vivo and in vitro and its possible mechanism of action [ 27 ][ 43 ][ 44 ][ 46 ] .However, the relationship between VALD-3 and Pyroptosis is still unknown. At the same time, the difference between VALD-3 induced apoptosis and Pyroptosis is not well understood.Generally, Pyroptosis can be distinguished from apoptosis by three characteristics. First, pyroptosis is usually accompanied by the release of cell contents or inflammatory cytokines ,such as LDH and IL-1 β .Second, Pyroptosis is usually performed by activation of the executors, GSDMD and/or GSDME, which results in the cleavage of their N-terminal domains (GSDMD-N or GSDME-N, respectively) [ 46 ][ 47 ] . Third, similar to apoptosis, pyroptosis also results in nuclear fragmentation, but it is not as obvious as that observed in apoptosis ,which TUNEL assay can be used to identify [ 48 ] . Pyroptosis and apoptosis are two separate types of cell death. The two are distinguished by morphology and molecular mechanism.They are not mutually exclusive, but related. Thus, pyroptosis, as a new molecular mechanism underlying the anticancer properties of VALD-3, warrants further investigation. Our data show that VALD-3 has an anticancer impact, implying that it could be a possible novel chemotherapeutic drug for TNBC therapy. In addition to the typical apoptotic morphology in human TNBC cells after long exposure to Valdien-3, tumor cells also showed swelling, balloon bubbles, and membrane integrity loss, which was consistent with the morphological hallmarks of cell pyrosis.In addition, We detected cleaved-capase-3,GSDME-N by western blotting and DNA fragmentation by TUNEL assay.Valdien-3 may have an anticancer effect by generating pyrophosis in TNBC cells, according to these findings. Pyroptosis can be induced by Caspase-1/4/5 (in humans) or Caspase − 11 (in mice) activation via GSDMD cleavage, leading to cell bubbling cellular swelling and cell lysis,and release of IL-1β and LDH [ 12 ][ 49 ] . Recently, Caspase 3/GSDME signaling pathway has also been reported as one of the signaling pathways involved in chemotherapeutic drug-induced pyroptosis [ 34 ][ 50 ][ 51 ] .GSDME expression has also been linked to a change in the sort of cancer cell death produced by chemotherapy drugs, according to research. GSDME positive cancer cells undergo pyrosis, while GSDME silent cancer cells undergo apoptosis when stimulated by chemotherapy drugs [ 52 ][ 15 ] .In this study, we found that valdien-3 inhibited the proliferation of breast cancer cells in a concentration-dependent and time-dependent manner, and this inhibitory effect was more significant on TNBC cells.Additionally, the wound healing experiment and invasion experiment showed that Valdien could significantly inhibit the migration and invasion of TNBC cells.Most importantly, we showed that, similar to other GSDME-positive cells, Valdien-3 induces GSDME cleavage through activation of Caspase 3, and Caspase 3 inhibition with the specific inhibitor Z-DEVD-FMK reversed cleavage of GSDME and subsequent pyroptosis inTNBC cells. These results suggested that caspase 3 is involved in TNBC cell pyroptosis via GSDME cleavage.But the mechanisms associated with GSDME cleavage are quite complex. Hence, further investigations are needed to clarify the precise mechanisms of GSDME regulation. The involvement of reactive oxygen species (ROS) in apoptosis has been studied in a variety of experimental setups. When intracellular levels of ROS are overly elevated, it can disrupt cellular signaling pathways, with JNK playing a key part in this process [ 53 ] . In addition to inducing apoptosis, ROS has been shown to have an essential role in pyroptosis in recent years. Yu et al., for example, discovered that lobaplatin triggered GSDME-mediated pyroptosis in colon cancer cells by stimulating the ROS/ JNK signaling pathway [ 34 ] . Tetraarsenic hexoxide, on the other hand, significantly boosted mitochondrial ROS production by blocking mitochondrial STAT3 phosphorylation, resulting in caspase-3-dependent cleavage of GSDME, which encouraged pyroptosis in TNBC cells[54]. Furthermore, iron-induced ROS enhances the oxidation of Tom20, a mitochondrial outer membrane protein, in melanoma cells through activating the Bax/caspase-3/GSDME pathway, which leads to cell pyroptosis[55]. Based on these findings, we predicted that Valdien-3 could cause pyroptosis in TNBC cells via activating the ROS/ JNK pathway. As expected, in our study, we also found that Valdien-3 induces GSDME-dependent pyroptosis through activation of the ROS/JNK pathway and is downstream of the ROS/JNK/Bax-mitochondrial apoptosis pathway. Valdien-3 upregulates intracellular ROS levels in a concentration-dependent manner, thereby increasing phosphorylation of JNK. At the same time, the expression of Bax was also increased, which promoted the transfer of Bax to mitochondria and the binding of Bcl-2, thereby promoting the release of cyc-t in mitochondria, and finally activating Caspase3 to induce GSDME-mediated pyroptosis. Considering these data, we conclude that Valdien-3 induced Caspase-3/ GSDME-dependent pyroptosis of TNBC cells is at least partially mediated by the ROS/JNK/ Bax signaling pathway. However, other molecular mechanisms of Caspase-3/ GSDME-mediated pyroptosis remain unclear. Therefore, the exact mechanism of valdien-3 induced pyroptosis needs to be further studied. In summary, our data demonstrated that the pro-pyroptosis property of Valdien-3 is primarily conferred by its ability to stimulate ROS production, activate the phosphorylation of JNK, P-JNK promotes Bax entry into mitochondria, which stimulates the mitochondria to release cyc-t into the cytosol, and ultimately result in caspase-3/GSDME-dependent pyroptosis that eventually leads to suppression of cancer progression of TNBC cells. This shifts the paradigm of understanding programmed cell death. More importantly, given that metastatic TNBC cells are often resistant to apoptosis triggered by traditional chemotherapeutic agents, therapies targeting GSDME might be envisaged a new approach in adjuvant chemotherapy for TNBC. Valdien-3 may be useful as an effective strategy for GSDME-targeted treatment of TNBC. This study may improve understanding of this process. Declarations Acknowledgements This work was supported by National Natural Science Foundation of China [grant number 81760537, 81560498], Department of Science and Technology of Gansu Province (No. 20YF8WA096) and the Internal Scientific Research Foundation of Gansu Provincial Hospital (No.19SYPYA-3). All data generated or analysed during this study are included in this published article [and its supplementary information files]. References Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021 May;71(3):209-249. doi: 10.3322/caac.21660. Epub 2021 Feb 4. PMID: 33538338. Copeland RL, Kanaan Y. New targets in triple-negative breast cancer. Nat Rev Cancer. 2021 Dec;21(12):744. doi: 10.1038/s41568-021-00415-4. PMID: 34621048. Wang X, Wang SS, Huang H, Cai L, Zhao L, Peng RJ, Lin Y, Tang J, Zeng J, Zhang LH, Ke YL, Wang XM, Liu XM, Chen QJ, Zhang AQ, Xu F, Bi XW, Huang JJ, Li JB, Pang DM, Xue C, Shi YX, He ZY, Lin HX, An X, Xia W, Cao Y, Guo Y, Su YH, Hua X, Wang XY, Hong RX, Jiang KK, Song CG, Huang ZZ, Shi W, Zhong YY, Yuan ZY; South China Breast Cancer Group (SCBCG). Effect of Capecitabine Maintenance Therapy Using Lower Dosage and Higher Frequency vs Observation on Disease-Free Survival Among Patients With Early-Stage Triple-Negative Breast Cancer Who Had Received Standard Treatment: The SYSUCC-001 Randomized Clinical Trial. JAMA. 2021 Jan 5;325(1):50-58. doi: 10.1001/jama.2020.23370. Erratum in: JAMA. 2022 Apr 22;: PMID: 33300950; PMCID: PMC7729589. Rogers C, Fernandes-Alnemri T, Mayes L, Alnemri D, Cingolani G, Alnemri ES. Cleavage of DFNA5 by caspase-3 during apoptosis mediates progression to secondary necrotic/pyroptotic cell death. Nat Commun. 2017 Jan 3;8:14128. doi: 10.1038/ncomms14128. PMID: 28045099; PMCID: PMC5216131. Khoury MK, Gupta K, Franco SR, Liu B. Necroptosis in the Pathophysiology of Disease. Am J Pathol. 2020;190(2):272-285. doi:10.1016/j.ajpath.2019.10.012 Jiang L, Poon IKH. Methods for monitoring the progression of cell death, cell disassembly and cell clearance. Apoptosis. 2019 Apr;24(3-4):208-220. doi: 10.1007/s10495-018-01511-x. PMID: 30684146. Zychlinsky A, Prevost MC, Sansonetti PJ. Shigella flexneri induces apoptosis in infected macrophages. Nature. 1992 Jul 9;358(6382):167-9. doi: 10.1038/358167a0. PMID: 1614548. Hilbi H, Chen Y, Thirumalai K, Zychlinsky A. The interleukin 1beta-converting enzyme, caspase 1, is activated during Shigella flexneri-induced apoptosis in human monocyte-derived macrophages. Infect Immun. 1997 Dec;65(12):5165-70. doi: 10.1128/iai.65.12.5165-5170.1997. PMID: 9393811; PMCID: PMC175744. Hersh D, Monack DM, Smith MR, Ghori N, Falkow S, Zychlinsky A. The Salmonella invasin SipB induces macrophage apoptosis by binding to caspase-1. Proc Natl Acad Sci U S A. 1999 Mar 2;96(5):2396-401. doi: 10.1073/pnas.96.5.2396. PMID: 10051653; PMCID: PMC26795. Cookson BT, Brennan MA. Pro-inflammatory programmed cell death. Trends Microbiol. 2001 Mar;9(3):113-4. doi: 10.1016/s0966-842x(00)01936-3. PMID: 11303500. Ruan J, Wang S, Wang J. Mechanism and regulation of pyroptosis-mediated in cancer cell death. Chem Biol Interact. 2020 May 25;323:109052. doi: 10.1016/j.cbi.2020.109052. Epub 2020 Mar 10. PMID: 32169591. Shi J, Zhao Y, Wang K, Shi X, Wang Y, Huang H, Zhuang Y, Cai T, Wang F, Shao F. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature. 2015 Oct 29;526(7575):660-5. doi: 10.1038/nature15514. Epub 2015 Sep 16. PMID: 26375003. He WT, Wan H, Hu L, Chen P, Wang X, Huang Z, Yang ZH, Zhong CQ, Han J. Gasdermin D is an executor of pyroptosis and required for interleukin-1β secretion. Cell Res. 2015 Dec;25(12):1285-98. doi: 10.1038/cr.2015.139. Epub 2015 Nov 27. PMID: 26611636; PMCID: PMC4670995. Martinon F, Burns K, Tschopp J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell. 2002 Aug;10(2):417-26. doi: 10.1016/s1097-2765(02)00599-3. PMID: 12191486. Wang Y, Gao W, Shi X, Ding J, Liu W, He H, Wang K, Shao F. Chemotherapy drugs induce pyroptosis through caspase-3 cleavage of a gasdermin. Nature. 2017 Jul 6;547(7661):99-103. doi: 10.1038/nature22393. Epub 2017 May 1. PMID: 28459430. Delmaghani S, del Castillo FJ, Michel V, Leibovici M, Aghaie A, Ron U, Van Laer L, Ben-Tal N, Van Camp G, Weil D, Langa F, Lathrop M, Avan P, Petit C. Mutations in the gene encoding pejvakin, a newly identified protein of the afferent auditory pathway, cause DFNB59 auditory neuropathy. Nat Genet. 2006 Jul;38(7):770-8. doi: 10.1038/ng1829. Epub 2006 Jun 25. PMID: 16804542. Van Laer L, Huizing EH, Verstreken M, van Zuijlen D, Wauters JG, Bossuyt PJ, Van de Heyning P, McGuirt WT, Smith RJ, Willems PJ, Legan PK, Richardson GP, Van Camp G. Nonsyndromic hearing impairment is associated with a mutation in DFNA5. Nat Genet. 1998 Oct;20(2):194-7. doi: 10.1038/2503. PMID: 9771715. Yan L, Liu Y, Ma XF, Hou D, Zhang YH, Sun Y, Shi SS, Forouzanfar T, Lin HY, Fan J, Wu G. Triclabendazole Induces Pyroptosis by Activating Caspase-3 to Cleave GSDME in Breast Cancer Cells. Front Pharmacol. 2021 Jul 8;12:670081. doi: 10.3389/fphar.2021.670081. PMID: 34305590; PMCID: PMC8297466. H. Schiff. Mittheilungen aus dem Universitatslaboratorium in Pisa: Eine neue Reihe organischer Basen[J].Annales Chemistry. 1864, 131(1):118-119.doi.org/10.1002/jlac.18641310113 Shahraki S, Heydari A. New zinc(II) N4 tetradentate Schiff base complex: A potential cytotoxic metallodrug and simple precursor for the preparation of ZnO nanoparticles. Colloids Surf B Biointerfaces. 2017;160:564-571. doi:10.1016/j.colsurfb.2017.10.026 Gao B , Zhang L , Zhang D . Effects of structures of bidentate Schiff base type bonded-ligands derived from benzaldehyde on the photoluminescence performance of polymer-rare earth complexes. Phys Chem Chem Phys. 2018;20(6):4373-4385. doi:10.1039/c7cp07590a Udhayakumari D, Inbaraj V. A Review on Schiff Base Fluorescent Chemosensors for Cell Imaging Applications. J Fluoresc. 2020;30(5):1203-1223. doi:10.1007/s10895-020-02570-7 Hameed A, Al-Rashida M, Uroos M, Abid Ali S, Khan KM. Schiff bases in medicinal chemistry: a patent review (2010-2015). Expert Opin Ther Pat. 2017;27(1):63-79. doi:10.1080/13543776.2017.1252752 Tsantis ST, Tzimopoulos DI, Holynska M, Perlepes SP. Oligonuclear Actinoid Complexes with Schiff Bases as Ligands-Older Achievements and Recent Progress. Int J Mol Sci. 2020 Jan 15;21(2):555. doi: 10.3390/ijms21020555. PMID: 31952278; PMCID: PMC7027032. Oiye ÉN, Ribeiro MFM, Katayama JMT, Tadini MC, Balbino MA, Eleotério IC, Magalhães J, Castro AS, Silva RSM, da Cruz Júnior JW, Dockal ER, de Oliveira MF. Electrochemical Sensors Containing Schiff Bases and their Transition Metal Complexes to Detect Analytes of Forensic, Pharmaceutical and Environmental Interest. A Review. Crit Rev Anal Chem. 2019;49(6):488-509. doi: 10.1080/10408347.2018.1561242. Epub 2019 Feb 15. PMID: 30767567. Matela G. Schiff Bases and Complexes: A Review on Anti-Cancer Activity. Anticancer Agents Med Chem. 2020;20(16):1908-1917. doi:10.2174/1871520620666200507091207 Li, H. L., Feng, T. X., Ge, B. & Wang, Y. H. Role of Valdien in proliferation and apoptosis of human non-Hodgkin’s lymphoma cells in vitro. Int. J. Clin. Exp. Med. 11, 13014–13023 (2018). Chen KY, Tsai HY. Synthesis, X-ray structure, spectroscopic properties and DFT studies of a novel Schiff base. Int J Mol Sci. 2014 Oct 17;15(10):18706-24. doi: 10.3390/ijms151018706. PMID: 25329613; PMCID: PMC4227241. Li H, Dang C, Tai X, Xue L, Meng Y, Ma S, Zhang J. VALD-3, a Schiff base ligand synthesized from o-vanillin derivatives, induces cell cycle arrest and apoptosis in breast cancer cells by inhibiting the Wnt/β-catenin pathway. Sci Rep. 2021 Jul 22;11(1):14985. doi: 10.1038/s41598-021-94388-x. PMID: 34294779; PMCID: PMC8298535. Ding J, Wang K, Liu W, She Y, Sun Q, Shi J, Sun H, Wang DC, Shao F. Pore-forming activity and structural autoinhibition of the gasdermin family. Nature. 2016 Jul 7;535(7610):111-6. doi: 10.1038/nature18590. Epub 2016 Jun 8. Erratum in: Nature. 2016 Dec 1;540(7631):150. PMID: 27281216. Liu X, Zhang Z, Ruan J, Pan Y, Magupalli VG, Wu H, Lieberman J. Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores. Nature. 2016 Jul 7;535(7610):153-8. doi: 10.1038/nature18629. PMID: 27383986; PMCID: PMC5539988. Fruehauf JP, Meyskens FL Jr. Reactive oxygen species: a breath of life or death? Clin Cancer Res. 2007 Feb 1;13(3):789-94. doi: 10.1158/1078-0432.CCR-06-2082. PMID: 17289868. Li HY, Zhang J, Sun LL, Li BH, Gao HL, Xie T, Zhang N, Ye ZM. Celastrol induces apoptosis and autophagy via the ROS/JNK signaling pathway in human osteosarcoma cells: an in vitro and in vivo study. Cell Death Dis. 2015 Jan 22;6(1):e1604. doi: 10.1038/cddis.2014.543. PMID: 25611379; PMCID: PMC4669742. Yu J, Li S, Qi J, Chen Z, Wu Y, Guo J, Wang K, Sun X, Zheng J. Cleavage of GSDME by caspase-3 determines lobaplatin-induced pyroptosis in colon cancer cells. Cell Death Dis. 2019 Feb 25;10(3):193. doi: 10.1038/s41419-019-1441-4. PMID: 30804337; PMCID: PMC6389936. Muniyan S, Chou YW, Tsai TJ, Thomes P, Veeramani S, Benigno BB, Walker LD, McDonald JF, Khan SA, Lin FF, Lele SM, Lin MF. p66Shc longevity protein regulates the proliferation of human ovarian cancer cells. Mol Carcinog. 2015 Aug;54(8):618-31. doi: 10.1002/mc.22129. Epub 2014 Jan 7. PMID: 24395385; PMCID: PMC4117819. Dejeans N, Glorieux C, Guenin S, Beck R, Sid B, Rousseau R, Bisig B, Delvenne P, Buc Calderon P, Verrax J. Overexpression of GRP94 in breast cancer cells resistant to oxidative stress promotes high levels of cancer cell proliferation and migration: implications for tumor recurrence. Free Radic Biol Med. 2012 Mar 15;52(6):993-1002. doi: 10.1016/j.freeradbiomed.2011.12.019. Epub 2012 Jan 2. PMID: 22245095. Avisetti DR, Babu KS, Kalivendi SV. Activation of p38/JNK pathway is responsible for embelin induced apoptosis in lung cancer cells: transitional role of reactive oxygen species. PLoS One. 2014 Jan 22;9(1):e87050. doi: 10.1371/journal.pone.0087050. PMID: 24466324; PMCID: PMC3899364. Tsujimoto Y, Shimizu S. Another way to die: autophagic programmed cell death. Cell Death Differ. 2005 Nov;12 Suppl 2:1528-34. doi: 10.1038/sj.cdd.4401777. PMID: 16247500. Deng L, Chen M, Tanaka M, Ku Y, Itoh T, Shoji I, Hotta H. HCV upregulates Bim through the ROS/JNK signalling pathway, leading to Bax-mediated apoptosis. J Gen Virol. 2015 Sep;96(9):2670-2683. doi: 10.1099/jgv.0.000221. Epub 2015 Jul 3. PMID: 26296767. Wang PH, Keck JG, Lien EJ, Lai MM. Design, synthesis, testing, and quantitative structure-activity relationship analysis of substituted salicylaldehyde Schiff bases of 1-amino-3-hydroxyguanidine tosylate as new antiviral agents against coronavirus. J Med Chem. 1990 Feb;33(2):608-14. doi: 10.1021/jm00164a023. PMID: 2153821. Shaheen MA, Feng S, Anthony M, Tahir MN, Hassan M, Seo SY, Ahmad S, Iqbal M, Saleem M, Lu C. Metal-Based Scaffolds of Schiff Bases Derived from Naproxen: Synthesis, Antibacterial Activities, and Molecular Docking Studies. Molecules. 2019 Mar 29;24(7):1237. doi: 10.3390/molecules24071237. PMID: 30934936; PMCID: PMC6480638. Tadele KT, Tsega TW. Schiff Bases and their Metal Complexes as Potential Anticancer Candidates: A Review of Recent Works. Anticancer Agents Med Chem. 2019;19(15):1786-1795. doi:10.2174/1871520619666190227171716 Wang YH, Zhou ZB, Guo CA, Zhai J, Qi FM, Li HL. Role of mimic of manganese superoxide dismutase in proliferation and apoptosis of gastric carcinoma BGC-823 cells in vitro and in vivo. Int Immunopharmacol. 2015 Jun;26(2):277-85. doi: 10.1016/j.intimp.2015.04.003. Epub 2015 Apr 15. PMID: 25889634. Li H, Meng Y, Ma S, Dang C, Xue L. VALD-3 inhibits proliferation and induces apoptosis of colorectal cancer cells via upregulating tumor suppressor activity of p53 to inhibit Wnt/β-catenin signal pathway. Anticancer Drugs. 2021;32(10):1046-1057. Li H, Dang C, Tai X, Xue L, Meng Y, Ma S, Zhang J. VALD-3, a Schiff base ligand synthesized from o-vanillin derivatives, induces cell cycle arrest and apoptosis in breast cancer cells by inhibiting the Wnt/β-catenin pathway. Sci Rep. 2021 Jul 22;11(1):14985. doi: 10.1038/s41598-021-94388-x. PMID: 34294779; PMCID: PMC8298535. Wang K, Sun Q, Zhong X, Zeng M, Zeng H, Shi X, Li Z, Wang Y, Zhao Q, Shao F, Ding J. Structural Mechanism for GSDMD Targeting by Autoprocessed Caspases in Pyroptosis. Cell. 2020 Mar 5;180(5):941-955.e20. doi: 10.1016/j.cell.2020.02.002. Epub 2020 Feb 27. PMID: 32109412. Zhang Z, Zhang Y, Xia S, Kong Q, Li S, Liu X, Junqueira C, Meza-Sosa KF, Mok TMY, Ansara J, Sengupta S, Yao Y, Wu H, Lieberman J. Gasdermin E suppresses tumour growth by activating anti-tumour immunity. Nature. 2020 Mar;579(7799):415-420. doi: 10.1038/s41586-020-2071-9. Epub 2020 Mar 11. PMID: 32188940; PMCID: PMC7123794. Brennan MA, Cookson BT. Salmonella induces macrophage death by caspase-1-dependent necrosis. Mol Microbiol. 2000;38(1):31-40. doi:10.1046/j.1365-2958.2000.02103.x Zasłona Z, Flis E, Wilk MM, Carroll RG, Palsson-McDermott EM, Hughes MM, Diskin C, Banahan K, Ryan DG, Hooftman A, Misiak A, Kearney J, Lochnit G, Bertrams W, Greulich T, Schmeck B, McElvaney OJ, Mills KHG, Lavelle EC, Wygrecka M, Creagh EM, O'Neill LAJ. Caspase-11 promotes allergic airway inflammation. Nat Commun. 2020 Feb 26;11(1):1055. doi: 10.1038/s41467-020-14945-2. PMID: 32103022; PMCID: PMC7044193. Shen X, Wang H, Weng C, Jiang H, Chen J. Caspase 3/GSDME-dependent pyroptosis contributes to chemotherapy drug-induced nephrotoxicity. Cell Death Dis. 2021 Feb 15;12(2):186. doi: 10.1038/s41419-021-03458-5. PMID: 33589596; PMCID: PMC7884686. Zhang CC, Li CG, Wang YF, Xu LH, He XH, Zeng QZ, Zeng CY, Mai FY, Hu B, Ouyang DY. Chemotherapeutic paclitaxel and cisplatin differentially induce pyroptosis in A549 lung cancer cells via caspase-3/GSDME activation. Apoptosis. 2019 Apr;24(3-4):312-325. doi: 10.1007/s10495-019-01515-1. PMID: 30710195. Lu H, Zhang S, Wu J, Chen M, Cai MC, Fu Y, Li W, Wang J, Zhao X, Yu Z, Ma P, Zhuang G. Molecular Targeted Therapies Elicit Concurrent Apoptotic and GSDME-Dependent Pyroptotic Tumor Cell Death. Clin Cancer Res. 2018 Dec 1;24(23):6066-6077. doi: 10.1158/1078-0432.CCR-18-1478. Epub 2018 Jul 30. PMID: 30061362. Li Y, Liu B, Yang F, Yu Y, Zeng A, Ye T, Yin W, Xie Y, Fu Z, Zhao C. Lobaplatin induces BGC-823 human gastric carcinoma cell apoptosis via ROS- mitochondrial apoptotic pathway and impairs cell migration and invasion. Biomed Pharmacother. 2016 Oct;83:1239-1246. doi: 10.1016/j.biopha.2016.08.053. Epub 2016 Aug 24. PMID: 27565846. An H, Heo JS, Kim P, Lian Z, Lee S, Park J, Hong E, Pang K, Park Y, Ooshima A, Lee J, Son M, Park H, Wu Z, Park KS, Kim SJ, Bae I, Yang KM. Tetraarsenic hexoxide enhances generation of mitochondrial ROS to promote pyroptosis by inducing the activation of caspase-3/GSDME in triple-negative breast cancer cells. Cell Death Dis. 2021 Feb 8;12(2):159. doi: 10.1038/s41419-021-03454-9. PMID: 33558527; PMCID: PMC7870965. Zhou B, Zhang JY, Liu XS, Chen HZ, Ai YL, Cheng K, Sun RY, Zhou D, Han J, Wu Q. Tom20 senses iron-activated ROS signaling to promote melanoma cell pyroptosis. Cell Res. 2018 Dec;28(12):1171-1185. doi: 10.1038/s41422-018-0090-y. Epub 2018 Oct 4. PMID: 30287942; PMCID: PMC6274649. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1810049","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":120364075,"identity":"2ef82f3e-c4e0-47cb-ad64-9a095980eb6e","order_by":0,"name":"Hongling Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYBACPmYeEGUBJBkbH3yosOHhZ2/Ar4UNokUCSDI3G844kyYj2XOAgBYGiBYgZm+T5mw7bGNww4GAFnbeg48LfknImPMvbJNmbDvPw3CDgfHDxxx8DuNLNp7ZJ8FjOeNhs3XBuds8jLMbmCVnbsPrFzNp3h4JHoMbBxtvzyi7zcMsc4CNmZdILQ3SPGzneNgkEojQwvMDqOV8Y5M0T9sBHh4itBgb8zaAbGEEBXIyjwTPwWa8fuHnP2P4mOePjb3B+eMPgVFpZ29/vPngh494tIABYxuQkEiAcxsIqAeBPyD7DhChcBSMglEwCkYkAABf2UsQTbMNkgAAAABJRU5ErkJggg==","orcid":"","institution":"Gansu Provincial Hospital","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Hongling","middleName":"","lastName":"Li","suffix":""},{"id":120364076,"identity":"965b0bd4-07e8-4d00-8321-5ab2cef8411b","order_by":1,"name":"Xuhong Pan","email":"","orcid":"","institution":"University of Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xuhong","middleName":"","lastName":"Pan","suffix":""},{"id":120364077,"identity":"44534b3b-d6d4-4158-be2e-bbf1976057ef","order_by":2,"name":"Linyu Li","email":"","orcid":"","institution":"University of Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Linyu","middleName":"","lastName":"Li","suffix":""},{"id":120364078,"identity":"572b9366-4a07-4770-b168-02d06543415d","order_by":3,"name":"Pengfei Song","email":"","orcid":"","institution":"Northwest Normal University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Pengfei","middleName":"","lastName":"Song","suffix":""},{"id":120364079,"identity":"8a696da0-866d-44eb-9bc1-cafa1403cc46","order_by":4,"name":"Xin Chen","email":"","orcid":"","institution":"University of Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Chen","suffix":""},{"id":120364080,"identity":"a2d91b02-300d-413b-baa5-810287329fb5","order_by":5,"name":"Weijie Ma","email":"","orcid":"","institution":"University of Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Weijie","middleName":"","lastName":"Ma","suffix":""},{"id":120364081,"identity":"a958e0fe-b4f9-4d8a-af4e-1023f6691806","order_by":6,"name":"Xiangxiang Shao","email":"","orcid":"","institution":"University of Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiangxiang","middleName":"","lastName":"Shao","suffix":""},{"id":120364082,"identity":"5b5ff33d-f789-4ce4-890c-c49eaf43d4dc","order_by":7,"name":"Yongying Wang","email":"","orcid":"","institution":"University of Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yongying","middleName":"","lastName":"Wang","suffix":""},{"id":120364083,"identity":"0a5f5a48-2063-4d3a-b068-a78a005d4108","order_by":8,"name":"Xuan Zhou","email":"","orcid":"","institution":"University of Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xuan","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2022-06-30 05:29:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1810049/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1810049/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":24055364,"identity":"8fb20744-cba1-44ae-995e-76ea2f3d8ea0","added_by":"auto","created_at":"2022-07-19 18:50:57","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":449211,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eValdien-3 suppressed cell proliferation,migration and invasion in breast cancer cells. \u003c/strong\u003eMCF-7,MDA-MB-231 and MDA-MB-468 cells were treated with different concentrations of Valdien-3(5, 10, 20 and 40 mg/L)for 24h,48h,72h. Cell viability was then determined using the CCK8 assay (a,b,c). Effects of \u0026nbsp;Valdien-3 (5, 10, 20 and 40 mg/L) on cell migration and invasion were evaluated by wound healing assay (d,e) and transwell assay (f,g). All results represent three independent experiments, and each value is the mean ± SD.\u0026nbsp;\u0026nbsp;*P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1810049/v1/30719c3c3c39f940deb17485.jpeg"},{"id":24055037,"identity":"4fe38b23-99d4-480f-8b37-b273f378b89c","added_by":"auto","created_at":"2022-07-19 18:45:57","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":401148,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe Valdien-3 induces pyroptotic cell death in triple-negative breast cancer cells\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eTransmission electron microscopy (a,b) images of MDA-MB-231 and MDA-MB-468 cells treated with 20mg/L Valdien-3 for 48h. The red arrowheads indicate the large bubbles emerging from the cell membrane. Scale bar 50 μm. The release of LDH and IL-1β from Valdien-3-treated MDA-MB-231 and MDA-MB-468 cells was measured by ELISA (c,d).\u003c/p\u003e\u003cp\u003eMDA-MB-231 and MDA-MB-468 cells were treated with different doses(5, 10, 20 and 40 mg/L) of Valdien-3 for 48h. The cells were stained using the Annexin V-FITC and PI and analyzed by flow cytometry. Annexin-V +/PI+ indicated the pyroptotic cells(e,f). All results represent three independent experiments, and each value is the mean ± SD. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1810049/v1/d3244c56877b96dfc5ba4a69.jpeg"},{"id":24055032,"identity":"b09b7b6d-1074-4897-b074-cf56f4e94b13","added_by":"auto","created_at":"2022-07-19 18:45:57","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":190376,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe Valdien-3 induces pyroptosis by activating caspase-3 to cleave GSDME in TNBC cells\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eFull-length GSDMD (GSDMD-F),GSDMD-C terminal(GSDMD-C),GSDME-N terminal (GSDME-N) and cleaved caspase-3 were detected by Western Blot in MDA-MB-231 and MDA-MB-468 cells(a,b,c,d). qPCR were used to detect expression of GSDME,caspase-3 and IL-1β(e,f,g). All results represent three independent experiments, and each value is the mean ± SD. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1810049/v1/c2d44a6391d8d792ffbf4931.jpeg"},{"id":24055818,"identity":"4bdd9dee-d1ac-47a7-aa6b-6c193bf97173","added_by":"auto","created_at":"2022-07-19 18:55:57","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":208030,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe caspase-3-specifific inhibitor zDEVD-FMK inhibits the cleavage of GSDME.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eRepresentative photomicrographs showing TUNEL staining(a,b). MDA-MB-231 and MDA-MB-468 cells were treated with 20mg/L Valdien-3 or 20mg/L Valdien-3+30 µM zDEVD-FMK, TUNEL-positive cells, green; nuclei, blue.Gel images of GSDME-F and GSDME-N expression levels in each group of MDA-MB-231 and MDA-MB-468 cells treated with Valdien-3 in the presence or absence of zDEVD-FMK (c,d). The release of LDH and IL-1β and from MDA-MB-231 and MDA-MB-468 cells was measured by ELISA(e,f,g,h). The percentage of Annexin-V +/PI+ cells treated with Valdien-3 in the presence or absence of zDEVD-FMK were detected by flow cytometry(i,j).All results represent three independent experiments, and each value is the mean ± SD. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1810049/v1/e7e40163a1fb65bc2976c920.jpeg"},{"id":24055035,"identity":"5f194107-336d-48fc-b53a-0dd52193a136","added_by":"auto","created_at":"2022-07-19 18:45:57","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":192374,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eROS is involved in GSDME-dependent pyroptosis in response to Valdien-3 ROS levels of MDA-MB-231 and MDA-MB-468.\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eCells treated with different concentrations of Valdien-3(5, 10, 20 and 40 mg/L)for 48h were measured by fluorescence microscope(a,b) and microplate reader (c,d). Gel images of GSDME-N and cleaved Caspase3 in MDA-MB-231 and MDA-MB-468 cellstreated with Valdien-3(20mg/L) in the presence or absence of NAC(e,f). The release of LDH and IL-1β from MDA-MB-231 and MDA-MB-468 cells was measured by ELISA(g,h,i,j). All results represent three independent experiments, and each value is the mean ± SD. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1810049/v1/5e7760eeece52ffeb05e17d3.jpeg"},{"id":24055365,"identity":"38fedb6c-5f5b-4da6-beb6-157b1457b6a8","added_by":"auto","created_at":"2022-07-19 18:50:57","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":199138,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eValdien-3-Induced GSDME-dependent pyroptosis is downstream of the ROS/JNK signalling. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003eGel images of p-JNK and JNK in MDA-MB-231 and MDA-MB-468 cells treated with different concentrations of Valdien-3(5, 10, 20 and 40 mg/L)for 48h(a,b).Gel images of GSDME-N and cleaved Caspase-3 in MDA-MB-231 and MDA-MB-468 cells treated with Valdien-3(20mg/L) in the presence or absence of SP6000125(c,d). The release of LDH \u0026nbsp;and IL-1β\u0026nbsp;from MDA-MB-231 and MDA-MB-468 cells was measured by ELISA(e,f,g,h). Gel images of p-JNK and JNK in MDA-MB-231 and MDA-MB-468 cells treated with Valdien-3(20mg/L) in the presenceor absence of NAC(i,j). All results represent three independent experiments, and each value is the mean ± SD. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1810049/v1/19b23c633e858e10fc8a275a.jpeg"},{"id":24055362,"identity":"9dfcef9f-a2ba-453f-929e-20d960df5ae4","added_by":"auto","created_at":"2022-07-19 18:50:57","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":161383,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eValdien-3-Induced GSDME-Dependent Pyroptosis Is Downstream of the ROS/JNK/ Bax-Mitochondrial Apoptotic Pathway. \u003c/strong\u003e\u003c/p\u003e\u003cp\u003eGel images of Bcl-2, BAX and cyc-C expression levels in MDA-MB-231 and MDA-MB-468 cells treated with different concentrations of Valdien-3(5, 10, 20 and 40 mg/L)for 48h(a,b).Gel images of Bcl-2, BAX and cyc-C expression levels in in MDA-MB-231 and MDA-MB-468 cells treated with Valdien-3(20mg/L) in the presence or absence of NAC or SP6000125(c,d).All results represent three independent experiments, and each value is the mean ± SD. ***P \u0026lt; 0.001. **P \u0026lt; 0.01. *P \u0026lt; 0.05.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-1810049/v1/be2effb1311860760c1eb652.jpeg"},{"id":25987976,"identity":"40fa6bf3-6270-4b51-bfc5-701b755ceb9e","added_by":"auto","created_at":"2022-09-02 14:59:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1519787,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1810049/v1/5cdd5394-eb3c-4609-8591-66aa2a731e8e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"VALD-3 suppresses triple negative breast cancer progression via Caspase 3/GSDME-dependent pyroptosis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFemale breast cancer has surpassed lung cancer as the most commonly diagnosed cancer in 2020, according to predictions from the International Agency for Research on Cancer, with an anticipated 2.3\u0026nbsp;million new cases (11.7 percent ). Breast cancer affects one out of every four women and is responsible for one out of every six cancer fatalities.\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e TNBC is a subtype of breast cancer that accounts for 15\u0026ndash;20% of all cases. It has an aggressive phenotype and lacks estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) expression\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Furthermore, due to resistance to anthracyclines and taxanes, there is no preferred standard chemotherapy regimen for metastatic TNBC. Patients with TNBC have a shorter survival rate, and recurrence and distant metastasis occur significantly more frequently than patients with other types of breast cancer after treatment\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. This is a big healthcare concern as well as a financial burden for women. As a result, it is critical to discover effective neoadjuvant chemotherapy medicines for TNBC patients who have a poor prognosis.\u003c/p\u003e \u003cp\u003eApoptosis, Necroptosis, Pyroptosis, and other PCD processes have distinct biological properties and are regulated by genes\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e][\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e][\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Zychlinsky et al originally identified pyroptosis, a lytic variant of PCD, in 1992 to separate it from apoptosis, which has a very distinct morphology\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Shigella dysentery may activate caspase-1 in host cells, according to Arturo Zychlinsky et al. in 1997\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Further research in 1999 revealed that Caspase-1 deletion might prevent cell death induced by Salmonella\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Cookson et al., a University of Washington student, initially introduced the term \"pyroptosis\" to characterize this distinct inflammatory programmed cell death process in 2001. Pyro refers to the release of pro-inflammatory mediators and a cascade of inflammatory events, whereas \"ptosis\" relates to the nature of planned cell death\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePyroptosis is triggered by an innate immunity-related extracellular or intracellular homeostasis disorder characterized by apoptosis-like chromatin condensation and DNA breakage in the early stages, followed by cellular swelling and cell lysis, and finally inflammatory cytokine release\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. At the molecular level, pyroptosis is divided into two parts: the canonical caspase-1/4/5 (orthologous to Caspase-11 in mice) pathway and the non-canonical caspase-3 pathway\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e][\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e][\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Gasdermin D (GSDMD) is immediately cleaved by active caspase-1 or caspase-4/5/11 at its hinge region, releasing a C-terminal and an N-terminal fragment. By being dissolved in phospholipid inosine or cardiolipin liposomes or liposomes made of naturally polar liposomes, GSDMD-N can generate a wide variety of Gasdermin holes and release IL-1 and IL-18 extracellularly. GSDME, also known as DFNA5 (deafness, autosomal dominant 5), is a tumor suppressor that belongs to the Gasdermin superfamily\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e][\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Many recent investigations have showed that chemotherapy drug-activated caspase-3 can cleave GSDME to create the N- and C-terminal domain in both cancer and normal cells that express high levels of GSDME, in addition to activating the conventional pathway of caspase-1/4/5. The N-terminal domain of GSDME is comparable to that of GSDMD, resulting in pore development and pyrophosis on the plasma membrane\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. In both MDA-MB-231 and MCF-7 cells, Yan et al. discovered that triclabendazole induced apoptosis by activating caspase-3/7/8/9 and promoting GSDME cleavage. Moreover, it was discovered that triclabendazole inhibited the growth of xenograft tumors by increasing caspase-3, GSDME, and PARP cleavage in the xenograft mode\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. This discovery could pave the way for the future creation of tailored, precise breast cancer treatment.\u003c/p\u003e \u003cp\u003eSchiff base, commonly known as imine, is a kind of chemical molecule that contains imine (-C\u0026thinsp;=\u0026thinsp;N-), which is generated via the condensation of ammonia and active carbonyl compounds. Hugo Schiff was the first to report it in 1864 \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Schiff base organic molecules have strong coordination ability, and several Schiff base metal complexes with different functionalities and structures can be generated by employing different types of Schiff bases as organic ligands to coordinate with different metals\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e][\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e][\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. Schiff base and its metal complexes have antitumor, antibacterial, antioxidant, antiviral, and other activities, and have promising applications in chemical catalysis, biomedicine, functional materials, food industry, and other fields\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e][\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e][\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e][\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. They also play an important role in electrochemistry.\u003c/p\u003e \u003cp\u003eSoft ligand studies have increased in recent years, owing to the fact that flexible chain ligands are chemically stable, their structure is adaptable, and the flexible chain is customizable and replace, allowing for a variety of coordination modes, enriching the types of complexes, and demonstrating high performance and biological activity. Valdien (N1, N3-bis (3-methoxysalicylidene) diethylenetriamine (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), a Schiff base, demonstrated anti-tumor actions in vivo and in vitro by triggering apoptosis\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e][\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e.We created a water-soluble Schiff base ligand named VALD-3 by linking hydrophilic hydroxyl(-OH) to o-vanillin to improve the schiff base ligand's water-solubility after reactions with diamine and polyamine, and found that ValD-3 has a significant inhibitory effect on tumor cell proliferation in a variety of cancer cells \u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThis study evaluated the effects of valdien-3 inhibition on breast cancer cell proliferation, migration, and invasion. The most noteworthy is that Valdien-3 was first proposed to have an anticancer effect by causing triple negative breast cancer cells to pyrophosis. Valdien-3 regulation of pyrotopia in triple negative breast cancer cells was investigated using a putative mechanism and a crucial signaling pathway.\u003c/p\u003e"},{"header":"Materials And Methods","content":" \u003ch2\u003eChemicals and reagents.\u003c/b\u003e \u003c/h2\u003e \n\u003cp\u003eVALD-3 (purity\u0026thinsp;\u0026ge;\u0026thinsp;98.0%) was kindly supplied by Professor Song Pengfei (Northwest Normal University, China). Fetal bovine serum (FBS) was purchased from Lonser (Shanghai, China).The antibodies against against DFNA5/GSDME (#ab215191), GSDMD (#ab215203) and Cleaved-Caspase3(#ab2302)were obtained from Abcam (Cambridge, UK). The antibodies against\u003c/p\u003e \u003cp\u003eBCL-2(12789-1-AP),Cytochrome c(10993-1-AP), BAX(50599-2-lg),Caspase-3(19677-1-AP),JNK(24164-1-AP),P-JNK(80024-1-RR ) and GADPH(10494-1-AP ) were obtained from Proteintech Group Inc.(Chicago, IL, USA). RIPA cell buffer(R0010) were obtained from Solarbio Co., Ltd (Beijing, China). FITC Annexin V apoptosis detection kit I (#556547) was obtained from BD Biosciences Pharmingen (San Diego, CA, USA). All other reagents and plastic material were obtained from commercial sources.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eHuman breast cancer MCF-7,MDA-MB-231,MDA-MB-468 cell lines were purchased from the Stem Cell Bank, Chinese Academy of Sciences (Shanghai, China). The cells were cultured in complete DMEM medium (Gibco,Waltham,MA,United States) supplemented with 10% fetal bovine serum (Gibco, Waltham, MA, United States)and 50g/ml penicillin/streptomycin (HyClone) at 37\u0026deg;C in a humidified incubator with 5% CO2, and were routinely tested to ensure no mycoplasma contamination during the study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assays\u003c/h2\u003e \u003cp\u003eInhibition effects of Valdien-3 on the proliferation of MCF-7,MDA-MB-231 and MDA-MB-468 cells were measured by cell counting kit-8 assay(CCK-8, Dojindo, Kumamoto, Japan) .Cells were seed into 96-well culture plates at a density of 5000 cells /well and treated with Valdien-3 (0, 5, 10, 20 and 40 \u0026micro;g/mL) for 24, 48 and 72 hours. After incubation,10\u0026micro;l of cck-8 reagent was added to each well, and the plate was further incubated for 2 h at 37\u0026deg;C. The absorbance at 450nm (A450) was read on a microplate reader (Molecular Devices, Sunnyvale, USA).All experiments were conducted for three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eObserve the morphology\u003c/h2\u003e \u003cp\u003eTo examine the morphology of pyroptotic cells, cells were seeded in 35-mm culture dishes and treated with VALD-3(20\u0026micro;g/mL) for 48h. After incubation, The pore-forming activity of VALD-3-induced pyroptosis was examined by transmission electron microscopy (TEM).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry analysis\u003c/h2\u003e \u003cp\u003eThe Annexin V-FITC Apoptosis Assay Kit (BD Biosciences, USA) was used to detect cell death following the manufacturer's introduction.Cells were seeded in 6-well plates and treated with VALD-3 for 48h, cells were harvested and washed twice with cold PBS. Then, 5\u0026micro;l Annexin V-FITC and 5\u0026micro;l PI were added and incubated in dark at room temperature for 15min. After staining,400ml 1X binding buffer was added to each sample and the cells were immediately analyzed on a flow cytometer (BD Biosciences, CA, USA).annexin V and PI double-positive cells were considered pyroptotic cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eTranswell invasion assays\u003c/h2\u003e \u003cp\u003eTo test the effect of Valdien-3 on cell invasion activity, we performed Transwell invasion assays with an 8-\u0026micro;m pore polycarbonate filter insert coated with 0.1% gelatin (Corning, New York, NY, USA). Briefly, starved cells (1x10\u003csup\u003e4\u003c/sup\u003e/well) were seeded in the upper chambers of the Transwell. DMEM medium containing 10% FBS was added to the bottom chamber. The top and bottom chamber contained the same concentration of Valdien-3(0, 5, 10, 20, and 40\u0026micro;g/mL). After incubation for 24 h, cells that migrated or invaded through and adhered to the bottom of the membrane were fixed and stained. Images were captured using a olympus inverted microscope and five random fields were captured for each membrane,and the migratory and invasive cells were counted and averaged\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWound healing assay\u003c/h2\u003e \u003cp\u003eMDA-MB-231 and MDA-MB-468 cells were incubated in a 6-well culture plate to achieve 90% confluence. Monolayer cells were wounded by scratching with a 200ul pipette tip. To remove the debris and smooth the edge of the scratch, the culture medium was removed and the wells were washed 3 times with PBS. Then, cells were treated Valdien-3 (0, 5, 10, 20 and 40 \u0026micro;g/mL) in different concentrations. Images were captured using a olympus inverted microscope after 48h of incubation at 37˚C and 5% CO\u003csub\u003e2\u003c/sub\u003e. The width of the open area was measured by image J software and the width of wound closure was used to estimate the migration capacity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eLDH and IL-1β release assay\u003c/h2\u003e \u003cp\u003ePyroptosis were quantitated by assaying the activity of LDH released into cell culture supernatants after various treatments using the CytoTox96 LDH-release kit (Servicebio,G1610-100T). 450 nm was used to measure the absorbance value. The LDH activity in the culture supernatant was expressed as a percentage of total LDH in the cell lysate. IL-1β were measured using the QuantiCyto IL-1β ELISA kit (jonln,JL13662) following the manufacturer\u0026rsquo;s instructions. The absorbance value at 450nm was then measured. Each experiment was repeated three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of ROS\u003c/h2\u003e \u003cp\u003eThe ROS levels were measured by a ROS Assay with DCFH-DA (Beyotime, Shanghai, China)following the manufacturer\u0026rsquo;s protocol. Dichloroflfluorescin diacetate (DCHF-DA) is a cell membrane permeable probe and widely used to detect intracellular ROS.DCHF-DA is hydrolyzed into 70-dichlorodihydroflfluorescin (DCHF) by intracellular esterase, which is thereby retained inside the cells. ROS-mediated oxidation of DCHF yields a highly flfluorescent compound dichloroflfluorescein (DCF). Importantly, the flfluorescence intensity is proportional to the amount of ROS produced by the cells.Briefly, TNBC cells in indicated groups were seeded at the density of 5\u0026times;105 into 6-well plates,then treatment with Valdien-3 (0, 5, 10, 20 and 40 \u0026micro;g/mL) for 48h, cells were washed with PBS,and stained with DCFH-DA (10 \u0026micro;M) for 30 min at 37\u0026deg;C in the dark. The level of ROS was determined by fluorescence microscope(Olympus, Tokyo, Japan). Meanwhile TNBC cells were seeded in a 96-well plate at the density of 5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells per well and incubated for 48 h at 5% CO2 and 37℃. The treated cells were loaded with 20 mM,dichloroflfluorescin diacetate (DCFH-DA) in serum-free MEM medium at 5% CO2 and 37℃ for 30 min. After the excessive DCFH-DA was removed by gently washing with 200ul PBS for three times. The flfluorescence was measured on a Packard Fusion alpha Fluorescence Microplate Reader (SpectraMax i3X,Silicon Valley,USA). ROS levels were expressed as a percentage relative to the control and microplate reader(Molecular Devices, Sunnyvale, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTUNEL staining\u003c/h2\u003e \u003cp\u003eThe DNA fragmentation of MDA-MB-231 and MDA-MB-468 cells treated with Valdien-3(20\u0026micro;g/mL), or Valdien-3\u0026thinsp;+\u0026thinsp;zDEVD-FMK were detected according to the manufacturer\u0026rsquo;s protocol of the TUNEL kit (Roche, Indianapolis, IN, USA). Briefly, cells were seeded onto an 6-well plate. Thereafter, cells were fixed, permeabilized, and incubated with the TUNEL reagent. DAPI (Solarbio Co., Ltd,Beijing, China) was used to recogniz nuclei and categorize cells, fluorescence microscopy was used to measure the TUNEL staining. TNBC cells that were both stained with TUNEL and DAPI were positive.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eCells were treated with different concentrations of Valdien-3 for 48h. Protein samples were extracted from cells for western blot analysis. The concentration of protein samples were measured using the BCA Protein Assay Kit (Solarbio,PC0020). Samples were added at 20\u0026micro;g/well. and then proteins of different sizes were transferred onto PVDF membranes (Millipore, USA). After blocked with 5% skim milk for 2h at room temperature, the membranes were incubated with primary antibodies targeting IL-1β, GSDME, caspase-3/-9, Bax, Bcl-2, JNK, p-JNK, cytochrome c and GAPDH overnight at 4\u0026deg;C. After extensive washing with 1ΧTBST (3\u0026times;10 min), the membranes were incubated in horseradish peroxidase (HRP)-linked anti-biotin and the appropriate secondary antibody in TBST for 1h at room temperature. The blots were detected via the enhanced chemiluminescence (ECL,Yeasen Biotechnology,shanghai,) reaction. Quantification of protein bands were achieved by densitometric analysis using image J software. GAPDH served as an internal contro and all Western blot analyses were carried out at least three times.\u003c/p\u003e \u003ch2\u003eQuantitative real‑time RT‑PCR (qRT‑PCR).\u003c/h2\u003e \u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003cp\u003eTotal RNA was extracted from the harvested cells or cardiac tissues using Marple\u0026reg; Cell/Tissue Total RNA Kit (Yisheng Biotechnology,Shanghai,19221ES50) according to the manufacturer\u0026rsquo;s instructions. RNA was then quantified and reverse-transcribed into complementary DNAs using specific stem-loop reverse transcription primers. First-strand mRNAs were synthesized with a Hifair Ⅱ 1st Strand cDNA Synthesis Kitand for qPCR (Yisheng Biotechnology,Shanghai.11123ES60). Real-time PCR was conducted on an IQ5 instrument (Bio-Rad, CA, USA) using SYBR Green fluorescence signal detection assays (Yeasen Biotechnology,shanghai,11201ES60) with primers. The following primers were used. GSDME:Forward,5’TACTTCTTGGTCAGTGCCCTCG3’,Reverse,5’CCTTTCTGTATCTTTCAGGGGAGT3’. Caspase3:Forward,5’AGAACTGGACTGTGGCATTGAG3’,Reverse,5’CACAAAGCGACTGGATGAACC3’. IL-1β:forward,5’TACCTGTCCTGCGTGTTGAAA3’,reverse,5’GGTGCTGATGTACCAGTTGGG3’. GAPDH:Forward,5’GGAAGCTTGTCATCAATGGAAATC3’,Reverse,5’TGATGACCCTTTTGGCTCCC3’. The specific mRNA expression level was analyzed by the 2−ΔΔCT method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis.\u003c/h2\u003e \u003cp\u003eAll experiments were performed at least three times independently. Data were analyzed by one-way analysis of variance (ANOVA) and all results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Differences among the treatment groups were assessed by LSD-t test, using Graph Pad Prism 9 (GraphPad Software Inc., San Diego, CA, USA). p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to indicate statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eEffects of Valdien-3 on the proliferation, invasion and migration of breast cancer cells in vitro\u003c/h2\u003e \u003cp\u003eWe first looked at the possible anticancer effects of VALD3 in invasive TNBC cells because patients with TNBC are thought to be difficult to cure with standard chemotherapy, emphasizing the need and urgency of developing neoadjuvant medicines. The cytotoxicity of MCF-7, MDA-MB-231, and MDA-MB-468 cells was measured using the CCK-8 test. Three types of breast cancer cells were treated with varied doses of Valdien-3 (5, 10, 20, and 40mg/l) for 24 hours, 48 hours, and 72 hours, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea-c. Valdien-3 suppressed MCF7, MDA-MB-231, and MDA-MB-468 cell proliferation in a concentration- and time-dependent manner.Interestingly, the inhibition rate of VALD3 on TNBC (MDA-MB-231 ,MDA-MB-468 cells) was significantly higher than those in non-TNBC (MCF7 cells). Therefore, we selected two types of TNBC cells (MDA-MB-231 and MDA-MB-468 cells) and focused on the subsequent experiments.\u003c/p\u003e \u003cp\u003eTumor migration and invasion are linked to tumor worsening and development, according to a significant body of research. Using the Wound Healing assay and the Transwell Invasion assays, we investigated whether Valdien-3 altered TNBC cell invasion and migration. For the assay, MDA-MB-231 and MDA-MB-468 cells were treated for 48 hours with different doses of Valdien-3 (5, 10, 20, and 40 mg/L). VALD-3 dramatically reduced the migration and invasion of MDA-MB-231 and MDA-MB-468 cells in a concentration-dependent manner after 48 hours, as seen in Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed-g, when compared to untreated control cells. These data show that VALD-3 has anti-migratory and anti-invasive properties in TNBC cells.\u003c/p\u003e \u003c/div\u003e\u003ch2\u003eThe Valdien-3 induces pyroptotic cell death in triple-negative breast cancer cells\u003c/h2\u003e\u003cp\u003eThe overwhelming evidence demonstrates that cytoplasmic enlargement, cell membrane pore creation, membrane rupture, and the release of IL-1 into the extracellular environment are all hallmarks of pyroptosis, as measured by flow cytometry with enhanced AnnexinV-FITC/PI double-positive cells. The dying cells had typical swelling, balloon-like bubbling, and membrane rupture (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea,b), which was very similar to the pyroptosis generated by the N-terminus of GSDMD/GSDME.\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e.Additionally, LDH and IL-1 studies revealed that Valdien-3 increased LDH and IL-1 release in a concentration-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec,d), implying that VALD3 therapy disrupted cell membrane integrity. To further validate the role of VALD3 in pyroptosis induction, MDA-MB-231 and MDA-MB-468 were incubated with VALD3 and pyroptosis was observed by analyses of flow cytometry of double positive for Annexin V and PI. Compared with mock treated cells, the percentage of Annexin V+/PI\u0026thinsp;+\u0026thinsp;cells were dramatically increased after VALD3 treatment in a concentration-dependent manner(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee,f). Therefore, these data together indicate that VALD3 can trigger pyroptosis in by inducing the rupture and leakage of the plasma membrane in TNBC cells.\u003c/p\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eThe Valdien-3 induces pyroptosis by activating caspase-3 to cleave GSDME in TNBC cells\u003c/h2\u003e \u003cp\u003ePrevious studies have shown that when GSDMD is cleaved, the N-terminal fragment of GSDMD is released, it translocates to the membrane, generates membrane holes, and finally induces pyroptosis\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e][\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Unfortunately, in Valdien-3-treated MDA-MB-231 and MDA-MB-468 cells, N-terminal fragments of GSDMD were not detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea,b). As a result, we hypothesized that other members of the gasdermin family could be responsible for Valdien-3-induced pyroptosis in MDA-MB-231 and MDA-MB-468 cells.\u003c/p\u003e \u003cp\u003eGSDME, another member of the gasdermin family that shares the same pyroptotic N-terminal domain of GSDMD, has been shown to execute pyroptosis under internal and external stimulus owing to cleavage by activated caspase-3\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Thus, we hypothesized that GSDME may also have a key determinant for Valdien-3 induced pyroptosis in TNBC. Consistently,our study found that Valdien-3 treatment led to increased levels of RNA of GSDME,Caspase-3 and IL-1β in MDA-MB-231 and MDA-MB-468 cells in a concentration-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec,d). The similar trends were seen for the N-terminal domain of GSDME and the activation levels of caspase-3 by Western Blot(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee,f). Taken together,these data suggest that Valdien-3-induced pyroptosis is dependent on cleavage of GSDME but not GSDMD in TNBC cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eCleaved Caspase-3 is the critical switch for GSDME-mediated Pyroptosis in TNBC cells treated with Valdien-3\u003c/h2\u003e \u003cp\u003eSeveral of our previous experiments showed that valdien-3-induced Caspase-3 activation might be accomplished via death receptor or mitochondrial mechanisms. Meanwhile, Western blot analysis revealed that Valdien-3 increased GSDME cleavage and caspase-3 activation, as previously indicated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec,d). We then conducted a series of tests to better understand the link between the caspase cascade and GSDME cleavage. TUNEL staining was used to track DNA damage, whereas DAPI staining was utilized to track nuclei morphology.At 48 hours after treatment with Valdien-3, the cell death rate was considerably higher than in the control group. The rise was significantly reduced in the groups treated with Z-DEVD-FMK, a caspase-3-specific inhibitor (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea,b). To ensure that pyroptosis was involved in this process and distinguished pyroptosis cells from apoptotic cells in the TUNEL-positive cells, we examined the results of western blot analysis indicate that z-DEVD-FMK treatment inhibited the cleavage of GSDME (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec,d). Furthermore, co-treatment with z-DEVD-FMK inhibited the release of LDH and IL-1 caused by Valdien-3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee,h). In accord with this, flow cytometry analysis revealed that Z-DEVD-FMK therapy dramatically reduced the proportion of Valdien-3-induced double positive cells for Annexin V and PI when compared to control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ei,j). These findings imply that Valdien-3 administration causes cell death by causing pyroptosis, which is dependent on caspase-3-mediated GSDME cleavage.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eGSDME is activated by the Valdien-3-elevated ROS/JNK signaling\u003c/h2\u003e \u003cp\u003eNext, We attempted to explore the underlying molecular mechanism that trigger GSDME-dependent pyroptosis in Valdien-3 treatment. Reactive oxygen species (ROS), active forms of oxygen, produced as a by-products by mitochondria and other cellular elements\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. ROS have been reported to regulate cells apoptosis, autophagy and induce pyroptosis, eventually suppressing cancer progression\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e][\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. However, it has not been reported whether Valdien-3-elevated ROS links to pyroptosis .To elucidate the possible role of ROS in Valdien-3-induced pyroptosis, we first determined ROS levels in breast cancer cells treated with Valdien-3 by fluorescence microscope(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea,b) and microplate reader (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec,d), and our results demonstrated that the levels of ROS in MDA-MB-231 and MDA-MB-468 cells increased after Valdien-3 treatment in a concentration-dependent manner. Interestingly, NAC, a ROS scavenger, substantially attenuated the protein levels of caspase-3/GSDME (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee,f). Meanwhile, NAC substantially attenuated the release of IL-1β and LDH compared with control(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg-k). Therefore, we hypothesized that caspase-3-GSDME axis is involved in pyroptosis mediated by cellular ROS.\u003c/p\u003e \u003cp\u003eROS could regulates various cellular signaling pathways such as NF-κB activation,ERK/MAPK signalling pathway\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e][\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. protein kinase of the MAPK family, plays a key role in many cellular events, including the control of proliferation, differentiation, survival and migration of specific cell types\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e][\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. In current study, we found that Valdien-3 stimulation markedly elevated the phosphorylation of JNK in MDA-MB-231 and MDA-MB-468 cells in a concentration-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea,b). More importantly, JNK inhibitor, SP600125, effectively reverse the cleaved of GSDME(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec,d), and the release of LDH and IL-1β (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee-h). Thus, JNK may be an upstream regulator of GSDME-dependent pyroptosis. Furthermore,ROS scavenger NAC abolished the phosphorylation of JNK induced by Valdien-3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ei,j). This suggests that JNK is likely to be a downstream factor of ROS. Collectively, these results suggest that Valdien-3 induces the generation of mitochondrial ROS, thereby increasing phosphorylation of JNK, and ultimately inducing pyroptosis by activating caspase-3 to cleave GSDME.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eValdien-3-Induced GSDME-Dependent Pyroptosis is downstream of the ROS/JNK/Bax-Mitochondrial apoptotic Pathway\u003c/h2\u003e \u003cp\u003eROS/JNK signaling pathway plays an important role in cell apoptosis, especially bax - mitochondrial apoptosis pathway\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. However, the relationship between ROS/JNK/Bax-Apoptotic Pathway and Pyroptosis requires further verification.Our study found that Valdien-3 significantly elevate the protein levels of Bcl-2 and cytochrome c, while downregulate the protein levels of Bax in MDA-MB-231 and MDA-MB-468 cells in a concentration-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea,b), which can be markedly reversed by ROS inhibitor NAC or JNK inhibitor SP600125(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ec,d). These results revealed that GSDME-dependent pyroptosis is downstream of the ROS/JNK/Bax-mitochondrial apoptotic pathway. In conclusion, Valdien-3 increased the level of ROS and P-JNK, and activated JNK recruits Bax into the mitochondria and promotes cyt-c release into the cytoplasm, which induces caspase-3 cleavage and GSDME-dependent pyroptosis in TNBC cells.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eSchiff bases are mainly organic compounds containing imine or methylamine specific groups (-RC\u0026thinsp;=\u0026thinsp;N-), usually formed by condensation of ammonia and active carbonyl compounds.In recent years, a large number of studies have shown that Schiff base and its complexes have anti-inflammatory, antiviral and anti-tumor activities on a variety of tumor cells without any side effects. Due to its important biological significance in many fields including anti-cancer activity, people have been interested in Schiff base and its complexes\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e][\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e][\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e][\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e.A large number of previous studies have confirmed that Valdien has significant anti-tumor effects, belonging to the Schiff base family, on gastric cancer, liver cancer, human non-Hodgkin lymphoma and gastric cancer. Unfortunately, Valdien's poor water solubility limits its clinical use. Therefore, we synthesized Schiff base ligand from o-vanillin derivatives, identified a water-soluble Schiff base ligand (VALD-3), and studied its anti-breast tumor effect in vivo and in vitro and its possible mechanism of action\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e][\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e][\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e][\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e.However, the relationship between VALD-3 and Pyroptosis is still unknown. At the same time, the difference between VALD-3 induced apoptosis and Pyroptosis is not well understood.Generally, Pyroptosis can be distinguished from apoptosis by three characteristics. First, pyroptosis is usually accompanied by the release of cell contents or inflammatory cytokines ,such as LDH and IL-1 β .Second, Pyroptosis is usually performed by activation of the executors, GSDMD and/or GSDME, which results in the cleavage of their N-terminal domains (GSDMD-N or GSDME-N, respectively)\u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e][\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e. Third, similar to apoptosis, pyroptosis also results in nuclear fragmentation, but it is not as obvious as that observed in apoptosis ,which TUNEL assay can be used to identify\u003csup\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e. Pyroptosis and apoptosis are two separate types of cell death. The two are distinguished by morphology and molecular mechanism.They are not mutually exclusive, but related. Thus, pyroptosis, as a new molecular mechanism underlying the anticancer properties of VALD-3, warrants further investigation.\u003c/p\u003e \u003cp\u003eOur data show that VALD-3 has an anticancer impact, implying that it could be a possible novel chemotherapeutic drug for TNBC therapy. In addition to the typical apoptotic morphology in human TNBC cells after long exposure to Valdien-3, tumor cells also showed swelling, balloon bubbles, and membrane integrity loss, which was consistent with the morphological hallmarks of cell pyrosis.In addition, We detected cleaved-capase-3,GSDME-N by western blotting and DNA fragmentation by TUNEL assay.Valdien-3 may have an anticancer effect by generating pyrophosis in TNBC cells, according to these findings.\u003c/p\u003e \u003cp\u003ePyroptosis can be induced by Caspase-1/4/5 (in humans) or Caspase \u0026minus;\u0026thinsp;11 (in mice) activation via GSDMD cleavage, leading to cell bubbling cellular swelling and cell lysis,and release of IL-1β and LDH \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e][\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e \u003cb\u003e.\u003c/b\u003eRecently, Caspase 3/GSDME signaling pathway has also been reported as one of the signaling pathways involved in chemotherapeutic drug-induced pyroptosis\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e][\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e][\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e .GSDME expression has also been linked to a change in the sort of cancer cell death produced by chemotherapy drugs, according to research. GSDME positive cancer cells undergo pyrosis, while GSDME silent cancer cells undergo apoptosis when stimulated by chemotherapy drugs\u003csup\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e][\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e.In this study, we found that valdien-3 inhibited the proliferation of breast cancer cells in a concentration-dependent and time-dependent manner, and this inhibitory effect was more significant on TNBC cells.Additionally, the wound healing experiment and invasion experiment showed that Valdien could significantly inhibit the migration and invasion of TNBC cells.Most importantly, we showed that, similar to other GSDME-positive cells, Valdien-3 induces GSDME cleavage through activation of Caspase 3, and Caspase 3 inhibition with the specific inhibitor Z-DEVD-FMK reversed cleavage of GSDME and subsequent pyroptosis inTNBC cells. These results suggested that caspase 3 is involved in TNBC cell pyroptosis via GSDME cleavage.But the mechanisms associated with GSDME cleavage are quite complex. Hence, further investigations are needed to clarify the precise mechanisms of GSDME regulation.\u003c/p\u003e \u003cp\u003eThe involvement of reactive oxygen species (ROS) in apoptosis has been studied in a variety of experimental setups. When intracellular levels of ROS are overly elevated, it can disrupt cellular signaling pathways, with JNK playing a key part in this process\u003csup\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/sup\u003e. In addition to inducing apoptosis, ROS has been shown to have an essential role in pyroptosis in recent years. Yu et al., for example, discovered that lobaplatin triggered GSDME-mediated pyroptosis in colon cancer cells by stimulating the ROS/ JNK signaling pathway\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Tetraarsenic hexoxide, on the other hand, significantly boosted mitochondrial ROS production by blocking mitochondrial STAT3 phosphorylation, resulting in caspase-3-dependent cleavage of GSDME, which encouraged pyroptosis in TNBC cells[54]. Furthermore, iron-induced ROS enhances the oxidation of Tom20, a mitochondrial outer membrane protein, in melanoma cells through activating the Bax/caspase-3/GSDME pathway, which leads to cell pyroptosis[55]. Based on these findings, we predicted that Valdien-3 could cause pyroptosis in TNBC cells via activating the ROS/ JNK pathway.\u003c/p\u003e \u003cp\u003eAs expected, in our study, we also found that Valdien-3 induces GSDME-dependent pyroptosis through activation of the ROS/JNK pathway and is downstream of the ROS/JNK/Bax-mitochondrial apoptosis pathway. Valdien-3 upregulates intracellular ROS levels in a concentration-dependent manner, thereby increasing phosphorylation of JNK. At the same time, the expression of Bax was also increased, which promoted the transfer of Bax to mitochondria and the binding of Bcl-2, thereby promoting the release of cyc-t in mitochondria, and finally activating Caspase3 to induce GSDME-mediated pyroptosis. Considering these data, we conclude that Valdien-3 induced Caspase-3/ GSDME-dependent pyroptosis of TNBC cells is at least partially mediated by the ROS/JNK/ Bax signaling pathway. However, other molecular mechanisms of Caspase-3/ GSDME-mediated pyroptosis remain unclear. Therefore, the exact mechanism of valdien-3 induced pyroptosis needs to be further studied.\u003c/p\u003e \u003cp\u003eIn summary, our data demonstrated that the pro-pyroptosis property of Valdien-3 is primarily conferred by its ability to stimulate ROS production, activate the phosphorylation of JNK, P-JNK promotes Bax entry into mitochondria, which stimulates the mitochondria to release cyc-t into the cytosol, and ultimately result in caspase-3/GSDME-dependent pyroptosis that eventually leads to suppression of cancer progression of TNBC cells. This shifts the paradigm of understanding programmed cell death. More importantly, given that metastatic TNBC cells are often resistant to apoptosis triggered by traditional chemotherapeutic agents, therapies targeting GSDME might be envisaged a new approach in adjuvant chemotherapy for TNBC. Valdien-3 may be useful as an effective strategy for GSDME-targeted treatment of TNBC. This study may improve understanding of this process.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e "},{"header":"Declarations","content":"\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThis work was supported by National Natural Science Foundation of China [grant number 81760537, 81560498], Department of Science and Technology of Gansu Province (No. 20YF8WA096) and the Internal Scientific Research Foundation of Gansu Provincial Hospital (No.19SYPYA-3).\u003c/p\u003e\u003cp\u003eAll data generated or analysed during this study are included in this published article [and its supplementary information files].\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eSung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021 May;71(3):209-249. doi: 10.3322/caac.21660. Epub 2021 Feb 4. PMID: 33538338.\u003c/li\u003e\n \u003cli\u003eCopeland RL, Kanaan Y. New targets in triple-negative breast cancer. Nat Rev Cancer. 2021 Dec;21(12):744. doi: 10.1038/s41568-021-00415-4. PMID: 34621048.\u003c/li\u003e\n \u003cli\u003eWang X, Wang SS, Huang H, Cai L, Zhao L, Peng RJ, Lin Y, Tang J, Zeng J, Zhang LH, Ke YL, Wang XM, Liu XM, Chen QJ, Zhang AQ, Xu F, Bi XW, Huang JJ, Li JB, Pang DM, Xue C, Shi YX, He ZY, Lin HX, An X, Xia W, Cao Y, Guo Y, Su YH, Hua X, Wang XY, Hong RX, Jiang KK, Song CG, Huang ZZ, Shi W, Zhong YY, Yuan ZY; South China Breast Cancer Group (SCBCG). Effect of Capecitabine Maintenance Therapy Using Lower Dosage and Higher Frequency vs Observation on Disease-Free Survival Among Patients With Early-Stage Triple-Negative Breast Cancer Who Had Received Standard Treatment: The SYSUCC-001 Randomized Clinical Trial. JAMA. 2021 Jan 5;325(1):50-58. doi: 10.1001/jama.2020.23370. Erratum in: JAMA. 2022 Apr 22;: PMID: 33300950; PMCID: PMC7729589.\u003c/li\u003e\n \u003cli\u003eRogers C, Fernandes-Alnemri T, Mayes L, Alnemri D, Cingolani G, Alnemri ES. Cleavage of DFNA5 by caspase-3 during apoptosis mediates progression to secondary necrotic/pyroptotic cell death. Nat Commun. 2017 Jan 3;8:14128. doi: 10.1038/ncomms14128. PMID: 28045099; PMCID: PMC5216131.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Khoury MK, Gupta K, Franco SR, Liu B. Necroptosis in the Pathophysiology of Disease. Am J Pathol. 2020;190(2):272-285. doi:10.1016/j.ajpath.2019.10.012\u003c/li\u003e\n \u003cli\u003eJiang L, Poon IKH. Methods for monitoring the progression of cell death, cell disassembly and cell clearance. Apoptosis. 2019 Apr;24(3-4):208-220. doi: 10.1007/s10495-018-01511-x. PMID: 30684146.\u003c/li\u003e\n \u003cli\u003eZychlinsky A, Prevost MC, Sansonetti PJ. Shigella flexneri induces apoptosis in infected macrophages. Nature. 1992 Jul 9;358(6382):167-9. doi: 10.1038/358167a0. PMID: 1614548.\u003c/li\u003e\n \u003cli\u003eHilbi H, Chen Y, Thirumalai K, Zychlinsky A. The interleukin 1beta-converting enzyme, caspase 1, is activated during Shigella flexneri-induced apoptosis in human monocyte-derived macrophages. Infect Immun. 1997 Dec;65(12):5165-70. doi: 10.1128/iai.65.12.5165-5170.1997. PMID: 9393811; PMCID: PMC175744.\u003c/li\u003e\n \u003cli\u003eHersh D, Monack DM, Smith MR, Ghori N, Falkow S, Zychlinsky A. The Salmonella invasin SipB induces macrophage apoptosis by binding to caspase-1. Proc Natl Acad Sci U S A. 1999 Mar 2;96(5):2396-401. doi: 10.1073/pnas.96.5.2396. PMID: 10051653; PMCID: PMC26795.\u003c/li\u003e\n \u003cli\u003eCookson BT, Brennan MA. Pro-inflammatory programmed cell death. Trends Microbiol. 2001 Mar;9(3):113-4. doi: 10.1016/s0966-842x(00)01936-3. PMID: 11303500.\u003c/li\u003e\n \u003cli\u003eRuan J, Wang S, Wang J. Mechanism and regulation of pyroptosis-mediated in cancer cell death. Chem Biol Interact. 2020 May 25;323:109052. doi: 10.1016/j.cbi.2020.109052. Epub 2020 Mar 10. PMID: 32169591.\u003c/li\u003e\n \u003cli\u003eShi J, Zhao Y, Wang K, Shi X, Wang Y, Huang H, Zhuang Y, Cai T, Wang F, Shao F. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature. 2015 Oct 29;526(7575):660-5. doi: 10.1038/nature15514. Epub 2015 Sep 16. PMID: 26375003.\u003c/li\u003e\n \u003cli\u003eHe WT, Wan H, Hu L, Chen P, Wang X, Huang Z, Yang ZH, Zhong CQ, Han J. Gasdermin D is an executor of pyroptosis and required for interleukin-1\u0026beta; secretion. Cell Res. 2015 Dec;25(12):1285-98. doi: 10.1038/cr.2015.139. Epub 2015 Nov 27. PMID: 26611636; PMCID: PMC4670995.\u003c/li\u003e\n \u003cli\u003eMartinon F, Burns K, Tschopp J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell. 2002 Aug;10(2):417-26. doi: 10.1016/s1097-2765(02)00599-3. PMID: 12191486.\u003c/li\u003e\n \u003cli\u003eWang Y, Gao W, Shi X, Ding J, Liu W, He H, Wang K, Shao F. Chemotherapy drugs induce pyroptosis through caspase-3 cleavage of a gasdermin. Nature. 2017 Jul 6;547(7661):99-103. doi: 10.1038/nature22393. Epub 2017 May 1. PMID: 28459430.\u003c/li\u003e\n \u003cli\u003eDelmaghani S, del Castillo FJ, Michel V, Leibovici M, Aghaie A, Ron U, Van Laer L, Ben-Tal N, Van Camp G, Weil D, Langa F, Lathrop M, Avan P, Petit C. Mutations in the gene encoding pejvakin, a newly identified protein of the afferent auditory pathway, cause DFNB59 auditory neuropathy. Nat Genet. 2006 Jul;38(7):770-8. doi: 10.1038/ng1829. Epub 2006 Jun 25. PMID: 16804542.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eVan Laer L, Huizing EH, Verstreken M, van Zuijlen D, Wauters JG, Bossuyt PJ, Van de Heyning P, McGuirt WT, Smith RJ, Willems PJ, Legan PK, Richardson GP, Van Camp G. Nonsyndromic hearing impairment is associated with a mutation in DFNA5. Nat Genet. 1998 Oct;20(2):194-7. doi: 10.1038/2503. PMID: 9771715.\u003c/li\u003e\n \u003cli\u003eYan L, Liu Y, Ma XF, Hou D, Zhang YH, Sun Y, Shi SS, Forouzanfar T, Lin HY, Fan J, Wu G.\u0026nbsp;Triclabendazole Induces Pyroptosis by Activating Caspase-3 to Cleave GSDME in Breast Cancer Cells.\u0026nbsp;Front Pharmacol. 2021 Jul 8;12:670081. doi: 10.3389/fphar.2021.670081. PMID: 34305590; PMCID: PMC8297466.\u003c/li\u003e\n \u003cli\u003eH. Schiff. Mittheilungen aus dem Universitatslaboratorium \u0026nbsp;in Pisa: Eine neue Reihe organischer Basen[J].Annales Chemistry. 1864, 131(1):118-119.doi.org/10.1002/jlac.18641310113\u003c/li\u003e\n \u003cli\u003eShahraki S, Heydari A. New zinc(II) N4 tetradentate Schiff base complex: A potential cytotoxic metallodrug and simple precursor for the preparation of ZnO nanoparticles.\u0026nbsp;Colloids Surf B Biointerfaces. 2017;160:564-571. doi:10.1016/j.colsurfb.2017.10.026\u003c/li\u003e\n \u003cli\u003eGao B , Zhang L , Zhang D . Effects of structures of bidentate Schiff base type bonded-ligands derived from benzaldehyde on the photoluminescence performance of polymer-rare earth complexes.\u0026nbsp;Phys Chem Chem Phys. 2018;20(6):4373-4385. doi:10.1039/c7cp07590a\u003c/li\u003e\n \u003cli\u003eUdhayakumari D, Inbaraj V.\u0026nbsp;A Review on Schiff Base Fluorescent Chemosensors for Cell Imaging Applications.\u0026nbsp;J Fluoresc. 2020;30(5):1203-1223. doi:10.1007/s10895-020-02570-7\u003c/li\u003e\n \u003cli\u003eHameed A, Al-Rashida M, Uroos M, Abid Ali S, Khan KM. Schiff bases in medicinal chemistry: a patent review (2010-2015).\u0026nbsp;Expert Opin Ther Pat. 2017;27(1):63-79. doi:10.1080/13543776.2017.1252752\u003c/li\u003e\n \u003cli\u003eTsantis ST, Tzimopoulos DI, Holynska M, Perlepes SP. Oligonuclear Actinoid Complexes with Schiff Bases as Ligands-Older Achievements and Recent Progress. Int J Mol Sci. 2020 Jan 15;21(2):555. doi: 10.3390/ijms21020555. PMID: 31952278; PMCID: PMC7027032.\u003c/li\u003e\n \u003cli\u003eOiye \u0026Eacute;N, Ribeiro MFM, Katayama JMT, Tadini MC, Balbino MA, Eleot\u0026eacute;rio IC, Magalh\u0026atilde;es J, Castro AS, Silva RSM, da Cruz J\u0026uacute;nior JW, Dockal ER, de Oliveira MF. Electrochemical Sensors Containing Schiff Bases and their Transition Metal Complexes to Detect Analytes of Forensic, Pharmaceutical and Environmental Interest. A Review. Crit Rev Anal Chem. 2019;49(6):488-509. doi: 10.1080/10408347.2018.1561242. Epub 2019 Feb 15. PMID: 30767567.\u003c/li\u003e\n \u003cli\u003eMatela G. Schiff Bases and Complexes: A Review on Anti-Cancer Activity.\u0026nbsp;Anticancer Agents Med Chem. 2020;20(16):1908-1917. doi:10.2174/1871520620666200507091207\u003c/li\u003e\n \u003cli\u003eLi, H. L., Feng, T. X., Ge, B. \u0026amp; Wang, Y. H. Role of Valdien in proliferation and apoptosis of human non-Hodgkin\u0026rsquo;s lymphoma cells in vitro. Int. J. Clin. Exp. Med. 11, 13014\u0026ndash;13023 (2018).\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Chen KY, Tsai HY. Synthesis, X-ray structure, spectroscopic properties and DFT studies of a novel Schiff base. Int J Mol Sci. 2014 Oct 17;15(10):18706-24. doi: 10.3390/ijms151018706. PMID: 25329613; PMCID: PMC4227241.\u003c/li\u003e\n \u003cli\u003eLi H, Dang C, Tai X, Xue L, Meng Y, Ma S, Zhang J. VALD-3, a Schiff base ligand synthesized from o-vanillin derivatives, induces cell cycle arrest and apoptosis in breast cancer cells by inhibiting the Wnt/\u0026beta;-catenin pathway. Sci Rep. 2021 Jul 22;11(1):14985. doi: 10.1038/s41598-021-94388-x. PMID: 34294779; PMCID: PMC8298535.\u003c/li\u003e\n \u003cli\u003eDing J, Wang K, Liu W, She Y, Sun Q, Shi J, Sun H, Wang DC, Shao F. Pore-forming activity and structural autoinhibition of the gasdermin family. Nature. 2016 Jul 7;535(7610):111-6. doi: 10.1038/nature18590. Epub 2016 Jun 8. Erratum in: Nature. 2016 Dec 1;540(7631):150. PMID: 27281216.\u003c/li\u003e\n \u003cli\u003eLiu X, Zhang Z, Ruan J, Pan Y, Magupalli VG, Wu H, Lieberman J. Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores. Nature. 2016 Jul 7;535(7610):153-8. doi: 10.1038/nature18629. PMID: 27383986; PMCID: PMC5539988.\u003c/li\u003e\n \u003cli\u003eFruehauf JP, Meyskens FL Jr. Reactive oxygen species: a breath of life or death? Clin Cancer Res. 2007 Feb 1;13(3):789-94. doi: 10.1158/1078-0432.CCR-06-2082. PMID: 17289868.\u003c/li\u003e\n \u003cli\u003eLi HY, Zhang J, Sun LL, Li BH, Gao HL, Xie T, Zhang N, Ye ZM. Celastrol induces apoptosis and autophagy via the ROS/JNK signaling pathway in human osteosarcoma cells: an in vitro and in vivo study. Cell Death Dis. 2015 Jan 22;6(1):e1604. doi: 10.1038/cddis.2014.543. PMID: 25611379; PMCID: PMC4669742.\u003c/li\u003e\n \u003cli\u003eYu J, Li S, Qi J, Chen Z, Wu Y, Guo J, Wang K, Sun X, Zheng J. Cleavage of GSDME by caspase-3 determines lobaplatin-induced pyroptosis in colon cancer cells. Cell Death Dis. 2019 Feb 25;10(3):193. doi: 10.1038/s41419-019-1441-4. PMID: 30804337; PMCID: PMC6389936.\u003c/li\u003e\n \u003cli\u003eMuniyan S, Chou YW, Tsai TJ, Thomes P, Veeramani S, Benigno BB, Walker LD, McDonald JF, Khan SA, Lin FF, Lele SM, Lin MF. p66Shc longevity protein regulates the proliferation of human ovarian cancer cells. Mol Carcinog. 2015 Aug;54(8):618-31. doi: 10.1002/mc.22129. Epub 2014 Jan 7. PMID: 24395385; PMCID: PMC4117819.\u003c/li\u003e\n \u003cli\u003eDejeans N, Glorieux C, Guenin S, Beck R, Sid B, Rousseau R, Bisig B, Delvenne P, Buc Calderon P, Verrax J. Overexpression of GRP94 in breast cancer cells resistant to oxidative stress promotes high levels of cancer cell proliferation and migration: implications for tumor recurrence. Free Radic Biol Med. 2012 Mar 15;52(6):993-1002. doi: 10.1016/j.freeradbiomed.2011.12.019. Epub 2012 Jan 2. PMID: 22245095.\u003c/li\u003e\n \u003cli\u003eAvisetti DR, Babu KS, Kalivendi SV. Activation of p38/JNK pathway is responsible for embelin induced apoptosis in lung cancer cells: transitional role of reactive oxygen species. PLoS One. 2014 Jan 22;9(1):e87050. doi: 10.1371/journal.pone.0087050. PMID: 24466324; PMCID: PMC3899364.\u003c/li\u003e\n \u003cli\u003eTsujimoto Y, Shimizu S. Another way to die: autophagic programmed cell death. Cell Death Differ. 2005 Nov;12 Suppl 2:1528-34. doi: 10.1038/sj.cdd.4401777. PMID: 16247500.\u003c/li\u003e\n \u003cli\u003eDeng L, Chen M, Tanaka M, Ku Y, Itoh T, Shoji I, Hotta H. HCV upregulates Bim through the ROS/JNK signalling pathway, leading to Bax-mediated apoptosis. J Gen Virol. 2015 Sep;96(9):2670-2683. doi: 10.1099/jgv.0.000221. Epub 2015 Jul 3. PMID: 26296767.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eWang PH, Keck JG, Lien EJ, Lai MM. Design, synthesis, testing, and quantitative structure-activity relationship analysis of substituted salicylaldehyde Schiff bases of 1-amino-3-hydroxyguanidine tosylate as new antiviral agents against coronavirus. J Med Chem. 1990 Feb;33(2):608-14. doi: 10.1021/jm00164a023. PMID: 2153821.\u003c/li\u003e\n \u003cli\u003eShaheen MA, Feng S, Anthony M, Tahir MN, Hassan M, Seo SY, Ahmad S, Iqbal M, Saleem M, Lu C. Metal-Based Scaffolds of Schiff Bases Derived from Naproxen: Synthesis, Antibacterial Activities, and Molecular Docking Studies. Molecules. 2019 Mar 29;24(7):1237. doi: 10.3390/molecules24071237. PMID: 30934936; PMCID: PMC6480638.\u003c/li\u003e\n \u003cli\u003eTadele KT, Tsega TW. Schiff Bases and their Metal Complexes as Potential Anticancer Candidates: A Review of Recent Works.\u0026nbsp;Anticancer Agents Med Chem. 2019;19(15):1786-1795. doi:10.2174/1871520619666190227171716\u003c/li\u003e\n \u003cli\u003eWang YH, Zhou ZB, Guo CA, Zhai J, Qi FM, Li HL. Role of mimic of manganese superoxide dismutase in proliferation and apoptosis of gastric carcinoma BGC-823 cells in vitro and in vivo. Int Immunopharmacol. 2015 Jun;26(2):277-85. doi: 10.1016/j.intimp.2015.04.003. Epub 2015 Apr 15. PMID: 25889634.\u003c/li\u003e\n \u003cli\u003eLi H, Meng Y, Ma S, Dang C, Xue L. VALD-3 inhibits proliferation and induces apoptosis of colorectal cancer cells via upregulating tumor suppressor activity of p53 to inhibit Wnt/\u0026beta;-catenin signal pathway.\u0026nbsp;Anticancer Drugs. 2021;32(10):1046-1057.\u003c/li\u003e\n \u003cli\u003eLi H, Dang C, Tai X, Xue L, Meng Y, Ma S, Zhang J. VALD-3, a Schiff base ligand synthesized from o-vanillin derivatives, induces cell cycle arrest and apoptosis in breast cancer cells by inhibiting the Wnt/\u0026beta;-catenin pathway. Sci Rep. 2021 Jul 22;11(1):14985. doi: 10.1038/s41598-021-94388-x. PMID: 34294779; PMCID: PMC8298535.\u003c/li\u003e\n \u003cli\u003eWang K, Sun Q, Zhong X, Zeng M, Zeng H, Shi X, Li Z, Wang Y, Zhao Q, Shao F, Ding J. Structural Mechanism for GSDMD Targeting by Autoprocessed Caspases in Pyroptosis. Cell. 2020 Mar 5;180(5):941-955.e20. doi: 10.1016/j.cell.2020.02.002. Epub 2020 Feb 27. PMID: 32109412.\u003c/li\u003e\n \u003cli\u003eZhang Z, Zhang Y, Xia S, Kong Q, Li S, Liu X, Junqueira C, Meza-Sosa KF, Mok TMY, Ansara J, Sengupta S, Yao Y, Wu H, Lieberman J. Gasdermin E suppresses tumour growth by activating anti-tumour immunity. Nature. 2020 Mar;579(7799):415-420. doi: 10.1038/s41586-020-2071-9. Epub 2020 Mar 11. PMID: 32188940; PMCID: PMC7123794.\u003c/li\u003e\n \u003cli\u003eBrennan MA, Cookson BT. Salmonella induces macrophage death by caspase-1-dependent necrosis. Mol Microbiol. 2000;38(1):31-40. doi:10.1046/j.1365-2958.2000.02103.x \u003c/li\u003e\n \u003cli\u003eZasłona Z, Flis E, Wilk MM, Carroll RG, Palsson-McDermott EM, Hughes MM, Diskin C, Banahan K, Ryan DG, Hooftman A, Misiak A, Kearney J, Lochnit G, Bertrams W, Greulich T, Schmeck B, McElvaney OJ, Mills KHG, Lavelle EC, Wygrecka M, Creagh EM, O\u0026apos;Neill LAJ. Caspase-11 promotes allergic airway inflammation. Nat Commun. 2020 Feb 26;11(1):1055. doi: 10.1038/s41467-020-14945-2. PMID: 32103022; PMCID: PMC7044193.\u003c/li\u003e\n \u003cli\u003eShen X, Wang H, Weng C, Jiang H, Chen J. Caspase 3/GSDME-dependent pyroptosis contributes to chemotherapy drug-induced nephrotoxicity. Cell Death Dis. 2021 Feb 15;12(2):186. doi: 10.1038/s41419-021-03458-5. PMID: 33589596; PMCID: PMC7884686.\u003c/li\u003e\n \u003cli\u003eZhang CC, Li CG, Wang YF, Xu LH, He XH, Zeng QZ, Zeng CY, Mai FY, Hu B, Ouyang DY. Chemotherapeutic paclitaxel and cisplatin differentially induce pyroptosis in A549 lung cancer cells via caspase-3/GSDME activation. Apoptosis. 2019 Apr;24(3-4):312-325. doi: 10.1007/s10495-019-01515-1. PMID: 30710195.\u003c/li\u003e\n \u003cli\u003eLu H, Zhang S, Wu J, Chen M, Cai MC, Fu Y, Li W, Wang J, Zhao X, Yu Z, Ma P, Zhuang G. Molecular Targeted Therapies Elicit Concurrent Apoptotic and GSDME-Dependent Pyroptotic Tumor Cell Death. Clin Cancer Res. 2018 Dec 1;24(23):6066-6077. doi: 10.1158/1078-0432.CCR-18-1478. Epub 2018 Jul 30. PMID: 30061362.\u003c/li\u003e\n \u003cli\u003eLi Y, Liu B, Yang F, Yu Y, Zeng A, Ye T, Yin W, Xie Y, Fu Z, Zhao C. Lobaplatin induces BGC-823 human gastric carcinoma cell apoptosis via ROS- mitochondrial apoptotic pathway and impairs cell migration and invasion. Biomed Pharmacother. 2016 Oct;83:1239-1246. doi: 10.1016/j.biopha.2016.08.053. Epub 2016 Aug 24. PMID: 27565846.\u003c/li\u003e\n \u003cli\u003eAn H, Heo JS, Kim P, Lian Z, Lee S, Park J, Hong E, Pang K, Park Y, Ooshima A, Lee J, Son M, Park H, Wu Z, Park KS, Kim SJ, Bae I, Yang KM. Tetraarsenic hexoxide enhances generation of mitochondrial ROS to promote pyroptosis by inducing the activation of caspase-3/GSDME in triple-negative breast cancer cells. Cell Death Dis. 2021 Feb 8;12(2):159. doi: 10.1038/s41419-021-03454-9. PMID: 33558527; PMCID: PMC7870965.\u003c/li\u003e\u003cli\u003eZhou B, Zhang JY, Liu XS, Chen HZ, Ai YL, Cheng K, Sun RY, Zhou D, Han J, Wu Q. Tom20 senses iron-activated ROS signaling to promote melanoma cell pyroptosis. Cell Res. 2018 Dec;28(12):1171-1185. doi: 10.1038/s41422-018-0090-y. Epub 2018 Oct 4. PMID: 30287942; PMCID: PMC6274649.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"pyroptosis, VALD 3, GSDME, Caspase-3, cancer therapy","lastPublishedDoi":"10.21203/rs.3.rs-1810049/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1810049/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e yroptosis, an inflammatory form of Programmed cell death (PCD) and so far, the function of Schiff base compounds in pyroptosis cell death has not been reported. Here, we show that VALD3, a Ligand derivative of Schiff base, treated Triple negative breast cancer (TNBC) cells exhibited specific pyroptotic characteristics, including cell swelling, balloon-like bubbling and inflammatory cytokine release through pore formation in the plasma membrane, eventually suppressing the tumor growth of TNBC. In addition, Western blot analysis revealed that the cleavage of Gasdermin E (GSDME),was related to the activation of caspase-3 in TNBC cells treated by VALD3. Consistent with this, treatment with zDEVD-FMK,a caspase-3 specific inhibitor,reduces VALD3-induced GSDME–N-terminal fragment cleavage and pyroptosis. Mechanistically, VALD3 elevated the level of reactive oxygen species(ROS)and c-Jun NH2-terminal kinase (JNK)phosphorylation.NAC,a ROS scavenger,reversed the pyroptosis and JNK phosphorylation in MDA-MB-468 and MDA-MB-231 treated by VALD3. Activated JNK recruited Bax to mitochondria to form a heterodimer with Bcl-2, which stimulated the release of cytochrome c into the cytoplasm, followed by caspase-3 activation and GSDME-depended pyroptosis in TNBC cells. Therefore, in TNBC cells,VALD-3 treatment induces the ROS/JNK/Bax-mitochondrial apoptosis pathway. Thereby activating Caspase-3 and inducing cleavage of GSDME to execute pyroptosis. These findings bring an unexpected concept that GSDME-dependent pyroptosis is an unrecognized mechanism by which VALD3 eradicates neoplastic cells, and provide new insights into the clinical application of anticancer therapeutics.\u003c/p\u003e","manuscriptTitle":"VALD-3 suppresses triple negative breast cancer progression via Caspase 3/GSDME-dependent pyroptosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-07-19 18:45:54","doi":"10.21203/rs.3.rs-1810049/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8c93b28d-f010-4f0d-90de-ee1d116f7464","owner":[],"postedDate":"July 19th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-10-17T06:59:35+00:00","versionOfRecord":[],"versionCreatedAt":"2022-07-19 18:45:54","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1810049","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1810049","identity":"rs-1810049","version":["v1"]},"buildId":"-HB7Z8yhvgn0wM9Nzuekk","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}