Influence of LED light on seed germination, growth, and health-promoting compounds in red and green lettuce cultivars | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Influence of LED light on seed germination, growth, and health-promoting compounds in red and green lettuce cultivars Saeed Omrani, Mahvash Afshari, Sanghyeob Lee This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6664304/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Jan, 2026 Read the published version in Acta Physiologiae Plantarum → Version 1 posted 4 You are reading this latest preprint version Abstract This study investigated the influence of specific light-emitting diodes (LEDs) on lettuce seed germination, growth, and the accumulation of health-promoting compounds. The results revealed that LED lights significantly impacted both red (Jeok Chi Ma) and green (Cheong Chi Ma) lettuce cultivars and compared to natural light. Red-blue light combinations accelerated germination in the red cultivar, while red light alone had the opposite effect in the green cultivar. Red light enhanced shoot fresh weight (SFW) for both cultivars, with the combination of red-blue light showing promising results as well. Blue light promoted root growth in both cultivars, followed by white light. Red light maximized root length (RL), while blue and white light were most effective for root volume (RV). Blue light significantly increased the levels of health-promoting compounds like phenolic compounds (PCs), anthocyanins (ANTs), and chlorophyll a (Chl a) and chlorophyll b (Chl b) in both cultivars. Red light, on the other hand, maximized carotenoids (CARs) content. Natural light resulted in the lowest levels of these compounds. Blue and red light respectively stimulated the expression of key genes in the ANTs and CARs biosynthetic pathways, with varying responses observed between the red and green cultivars. Overall, this study highlights the potential of utilizing specific LED light wavelengths to optimize lettuce growth and enhance the accumulation of health-promoting compounds. The findings suggest that tailoring light spectrums based on cultivar type can be a valuable strategy for controlled environment agriculture. LED Lettuce Gene expression Metabolites Anthocyanins Carotenoids Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1 Introduction Lettuce ( Lactuca sativa L.) is a widely consumed leafy vegetable that enjoys global popularity due to its distinct flavor, affordability, and impressive nutritional composition. Its importance extends beyond culinary use, as the seedling stage plays a pivotal role in determining the overall success of agricultural production. As highlighted by Min Shi et al. ( 2022 ), cultivating robust and healthy seedlings is essential to unlocking the full yield potential and ensuring a productive crop cycle. This is particularly critical for lettuce, as its rapid growth and short cultivation period make it an ideal candidate for studying the interactions between plants and light, a key environmental factor that significantly influences plant growth and development (Carotti et al. 2021 ; Jaya et al. 2023 ). Despite the importance of light in lettuce growth, there remains a dearth of research exploring the effects of various light spectra on lettuce seedling germination and development, and how these factors subsequently affect key agrophysiological traits and the yield of mature plants (Kim et al. 2024 ; Hernández Adasme et al. 2022). In controlled agricultural environments, light supplementation is crucial for promoting optimal vegetable growth and maturation. As a primary environmental factor, light not only provides the energy required for photosynthesis but also triggers numerous essential physiological processes in plants (Lauria et al. 2024 ). Light can be categorized into three primary parameters: intensity (measured in µmol m⁻² s⁻¹), photoperiod (the duration of light and dark cycles), and spectrum (the range of wavelengths in nanometers). These parameters influence plant growth and development in distinct ways (Flores et al. 2024 ). Light-emitting diodes (LEDs) have emerged as a preferred lighting solution in indoor farming systems, owing to their energy efficiency, long lifespan, and reduced environmental impact when compared to traditional lighting systems. Moreover, LEDs offer precise control over light spectra, enabling optimal energy management and significantly enhancing both plant productivity and quality (Olajiga et al. 2024 ). The spectral distribution of LED light plays a critical role in plant physiology and morphology, as different wavelengths of light evoke specific responses in plants (Flores et al. 2022 ). Numerous studies have explored the effects of light spectra on lettuce seed germination. For instance, red (R) light has been shown to promote germination in certain lettuce genotypes (Hernández Adasme et al. 2022). Furthermore, research has focused on the influence of LED lighting on various physiological aspects of lettuce, including biomass accumulation, morphological changes, and pigment composition (Brazaitytė et al. 2021 ; Toscano et al. 2021 ; Demir et al. 2023 ). During the seedling stage, blue (B) light is generally considered beneficial, while R light proves to be more effective in enhancing vegetative growth after transplanting (Flores et al. 2024 ). A study by Kang et al. ( 2021 ) found that combination of red-blue (RB) lighting improved various morphological parameters and photosynthetic pigment levels in cucumber seedlings, with B light enhancing chlorophyll (Chl) content and promoting higher rates of photosynthesis (PS). To fully understand plant physiology and optimize both yield and the production of functional compounds, it is essential to analyze the effects of each lighting parameter, including light intensity, spectrum, and photoperiod, in isolation. Among these parameters, spectrum and intensity are particularly influential in determining vegetable quality, with B and R lights ranges being particularly effective in stimulating PS (Brazaitytė et al. 2021 ; Rahman et al. 2021 ). Recent studies have shown that B light significantly influences the production of phenolic compounds (PCs) and flavonoids (FLs). For instance, B light has been found to enhance the accumulation of PCs such as chlorogenic acid, caffeic acid, and quercetin in Nasturtium officinale (Klimek-Szczykutowicz et al. 2022 ). Similarly, B light promotes the biosynthesis of FLs in Hedyotis corymbose (Le et al. 2021 ) and Scutellaria baicalensis (Ma et al. 2024 ). However, B light plays a critical role in promoting fresh weight and hypocotyl elongation in microgreens such as mustard and kale (Brazaitytė et al. 2021 ). Additionally, B light increases the accumulation of anthocyanins (ANTs) and carotenoids (CARs), both of which are vital compounds in plants. In contrast, R light primarily contributes to the enhancement of biomass production and cotyledon growth in various microgreen species (Brazaitytė et al. 2021 ; Flores et al. 2024 ). For mature lettuce, a combination of RB light proves to be the most effective for boosting both fresh and dry weight. R light, in particular, has been found to exert the most significant effects on green and red lettuce cultivars (Naznin et al. 2019 ; Hernández Adasme et al. 2022). ANTs, which are potent antioxidants, play an important role in enhancing a plant's resistance to stress and also offer potential health benefits, including cancer prevention and cardiovascular protection (Kowalczyk et al. 2024 ). The biosynthesis of ANTs is tightly regulated by light wavelengths, with B light being a key trigger for the expression of ANTs-related genes in certain fruits, such as grapes (Zhang et al. 2021 ). Similarly, CARs accumulation is governed by the regulation of gene expression in both the biosynthesis and degradation pathways, which ultimately enhances the nutritional value of crops (Sun et al. 2022 ). This study seeks to provide a comprehensive understanding of how various LED light wavelengths impact both the morphological development and biochemical composition of lettuce. By examining these effects alongside the accumulation of key metabolites such as ANTs, CARs, FLs, and PCs, we aim to uncover valuable insights that can help optimize LED lighting systems for improved plant growth, yield, and quality in controlled agricultural environments. Additionally, the use of both red and green lettuce cultivars in this study allows us to explore cultivar-specific responses to different light wavelengths, providing a deeper understanding of how these lighting conditions may vary across different lettuce types. Ultimately, this research seeks to offer practical guidance for tailoring lighting strategies to enhance the growth and nutritional quality of lettuce, based on the specific needs of different cultivars. 2 Materials and methods 2. 1 Experimental conditions for lettuce seed germination Two lettuce cultivars, green (Cheong Chi Ma) and red (Jeok Chi Ma), were germinated in petri dishes containing water-soaked paper, with 50 seeds per cultivar. The dishes were placed in a growth chamber set at 22 ± 2°C, 50 ± 5% relative humidity, and exposed to different LED light treatments: 100% B, 100% R, 100% white (W), a 1:1 combination of RB, natural light (N), and darkness (D). Germination was considered successful when the seeds produced a radicle of at least 3 mm in length, in accordance with the guidelines of the International Seed Testing Association (ISTA 1999). 2.2 Measurement of seed germination-related traits Germination percentage (GP) were determined using the following formula: GP = (N/Nt) × 100 (1) Where ‘ N ’ is the number of seeds germinated per day, and ' Nt ' is the total number of seeds sown. Coefficient of the velocity of germination (CVG) was used to assess how quickly maximum germination was achieved, calculated using: CVG = Σ (Ni · Di)/Σ Ni (2) Where ' Ni ' is the number of seeds germinated on day ' i ' and ' Di ' is the time in days. The velocity of germination (VG) measured the daily seed germination rate: VG = Σ (Ni)/Σt (3) Where ' Ni ' is the number of seeds germinated on day ' i ' and ' t ' is the germination time from sowing to the final germination. 2.3 Cultivation conditions for lettuce growing Two lettuce cultivars were first germinated in 50-cell seedling trays filled with a peat-perlite mix (3:1 ratio) and transferred to pots after 20 days of germination. The seedlings were then placed in a growth chamber (Hanil, Seoul, Korea) and exposed to different LED light wavelengths (Lumenlux, Seoul, Korea). The light treatments included natural light (N), white light (W), B, R, and a 1:1 combination of RB for 9 days. The growth chamber maintained a 16-h photoperiod, a CO 2 concentration of 1000 ± 300 µmol mol⁻¹, and a temperature of 23 ± 3°C. 2.4 Shoot and root measurements The seedlings were gently removed from the pots, and the shoot fresh weight (SFW) was accurately measured using an Ohaus PAG214C scale (Parsippany, NJ, USA). The roots were cleaned, and the root fresh weight (RFW) was similarly measured. 2.5 Measurement of ANTs, FLs, PCs, and pigments The collected seedlings were ground in liquid nitrogen for analysis. ANTs content was determined using 100 mg of lettuce powder in 1 mL of 70% ethanol, sonicated for 1 hour, and incubated at 55°C for 16 h. PCs and FLs were extracted with 80% methanol. Photosynthetic pigments (Chl, CARs and ANTs) were extracted with 80% acetone. PCs was determined using the Folin-Ciocalteu method (Zhou et al. 2013 ), with gallic acid (Sigma-Aldrich, St. Louis, MO, USA) as the standard. Absorbance was measured at 760 nm using a UV/Vis spectrophotometer (Biochrom-Libra S22, UK), and results were expressed as µg of gallic acid equivalent (GAE) per gram of dry weight (µg GAE/g DW). A calibration curve was constructed with gallic acid concentrations ranging from 7 to 250 µg/mL. FLs was assessed using a colorimetric method (Willet 2002). Absorbance was recorded at 415 nm using a UV/Vis spectrophotometer, and results were expressed as µg of quercetin equivalent (QUE) per gram of dry weight (µg QUE/g DW). The quercetin calibration curve ranged from 2 to 100 µg/mL. Photosynthetic pigments, including chlorophyll a (Chl a), chlorophyll b (Chl b), and CARs, were quantified based on absorbance readings at 663 nm, 645 nm, and 470 nm, respectively, using the equations ( 4 – 6 ) of Lichtenthaler and Welburn (1983). $$\:\:\:\:\text{C}\text{h}\text{l}\:\text{a}=\left(12.21\:\times\:A663\right)-(2.81\:\times\:A645)$$ 4 $$\:\:\:\:\text{C}\text{h}\text{l}\:\text{b}=\left(20.13\:\times\:A645\right)-(5.03\:\times\:A663)$$ 5 $$\:\:\:\:\text{C}\text{A}\text{R}\text{s}=\frac{[\left(1000\:\times\:A470\right)-\left(3.27\:\times\:\:Chl\:a\right)-\left(104\:\times\:\:Chl\:b\right)]}{227}$$ 6 Where A represents the optical absorption at various wavelengths (λ = 663, 645, and 470). ANTs was determined using the pH differential method (Lee et al. 2005 ), with absorbance measured at 520 nm and 700 nm. The concentrations were expressed as mg cyanidin-3-glucoside equivalent (C3G) per gram dry weight (mg C3G/g DW) and calculated using Eq. (7). ANTs = \(\:\:\frac{\text{A}\:\times\:\:\text{M}\text{W}\:\times\:\:\text{D}\text{F}\:\times\:\:{10}^{3}\:}{\epsilon\:\:\times\:\:l\:\times\:\:\text{W}}\:\) (7) Where A = (A 520nm – A 700nm ) pH 1.0 – (A 520nm – A 700nm ) pH 4.5; MW (molecular weight) = 449.2 g/mol for cyanidin-3-glucoside (cyd-3-glu); DF = dilution factor; 103 = factor for conversion from g to mg; ε = 26,900 M extinction coefficient in L/mol cm for cyd-3-glu; l = path length in cm, and W = sample weight (mg). 2.6 Identification of genes involved in ANTs and CARs biosynthesis in lettuce Homologous genes in lettuce were identified through tBLASTn searches using query sequences from known proteins involved in ANTs and CARs biosynthesis in chrysanthemum ( Chrysanthemum indicum ), apple (Malus domestica), and Arabidopsis, utilizing the lettuce genome project ( https://lgr.genomecenter.ucdavis.edu/Links.php ). This study focuses on five genes involved in ANTs biosynthesis; chalcone synthase ( CHS ), flavonoid 3-hydroxylase ( F3H ), dihydroflavonol 4-reductase ( DFR ), anthocyanidin synthase ( ANS ), and UDP-glucose: flavonoid 3-O-glucosyltransferase ( UFGT ). Additionally, six genes involved in CARs biosynthesis were included; 1-deoxy-D-xylulose-5-phosphate synthase ( DXS ), 1-deoxy-D-xylulose-5-phosphate reductoisomerase ( DXR ), phytoene synthase 1 ( PSY1 ), ζ-carotene desaturase ( ZDS ), carotenoid isomerase ( CRTISO ), and violaxanthin de-epoxidase ( VDE ). 2.7 Expression analysis of the genes in the biosynthesis of ANTs and CARs To examine the expression levels of these genes, leaf samples were collected from lettuce plants at two time points: 3 and 9 days after the application of W, R, B, and a RB combination, with N light serving as the control. For each plant, three leaves were harvested to ensure a representative sample, and the collected samples were immediately flash-frozen in liquid nitrogen to preserve the RNA integrity. Total RNA was extracted from the frozen leaf samples using the RiboEx Total RNA kit (GeneAll, Seoul, South Korea), which is designed for efficient RNA extraction. Following RNA extraction, complementary DNA (cDNA) synthesis was performed using 2.5 µg of total RNA and the SuperiorScript III Master Mix (Enzynomics, Seoul, South Korea). Gene expression was evaluated using quantitative real-time PCR (qRT-PCR) with specifically designed primers. A total of twelve forward and reverse primer pairs, including Actin ( ACT ) as the control gene, were used for the analysis (Table 2 ). The experiment was performed in triplicate to ensure accuracy and reproducibility, minimizing errors and increasing the reliability of the results. Table 2 The specific primer sets of the studied anthocyanin and carotenoids biosynthesis pathway genes used for real-time PCR analysis. Pathway Gene name Accession number Product length Name Primer Primer sequence (5' − 3') Anthocyanin ACT AB359898 113 bp LsACT F TGGTAGGTATGGGCCAGAAA R GTCATCCCAGTTGCTCACAA CHS AB525909 169 bp LsCHS F GGAGGTGGGGCTAACTTTTC R GAGCTCCACCTGGTCCAATA F3H AB525910 210 bp LsF3H F CTACTCAAGGTGGCCCGATA R AATGTGAGATCGGGTTGAGG DFR CV700105 105 bp LsDFR F GGGAATGAGGGAGTGATGAA R ATTGGCAGAAAAAGCAGCAT ANS AB525912 117 bp LsANS F CTCCCCACCATCGACTTAAA R ATGGTTGACGAGATGCATGA UFGT AB525911 203 bp LsUFGT F AAGAGACCAGAACCCCGTTT R AGCTCCAATGCTCTCCGATA Carotenoids DXS AB205044 149 bp LsDXS F CGCCATTGATGACAGACCCAG R GCCCTTCCAGCATTATTCGC DXR AB205045 192 bp LsDXR F AGAAACGAATCTTTGGTTGAAG R TCACACAATCAGGATGACGG PSY1 DY974614 168 bp LsPSY1 F ACGACATCGTACACCATCTGCTC R TTCCAGGGTTGTGGTGGCTAAC ZDS DY960874 155 bp LsZDS F ATCCACCTCATGCCCTTGATCC R TATCATAGGTGCTGGCCTTGCTG CRTISO AB205043 173 bp LsCRTISO F ATCTGTGATGTTGCGATTCAGC R ACGGTGGTTGGATCGGGTATC VDE AB205051 184 bp LsVDE F ACTCGCAACAATCGTCCTGAC R GGGCACACATTTCTTTCGG 2.8 Statistical analysis Variance homogeneity was tested using the Levene test in R version 4.2.2 (R Core Team 2022), and data normality was assessed using the Kolmogorov-Smirnov test in SAS Ver. 9.4 ( https://www.sas.com/ ). Analysis of variance (ANOVA) was performed using SAS's GLM procedure, with post hoc testing via the least significant difference (LSD) method ( P < 0.05). Figures were generated using GraphPad Prism Ver. 9.0 ( https://www.graphpad.com/ ). 3 Results 3.1 The effect of LED wavelengths on lettuce seed germination The GP, CVG, and VG for two lettuce cultivars, Red (Jeok Chi Ma) and Green (Cheong Chi Ma), were assessed under different LED light treatments, as presented in Table 1 . Table 1 Values of germination (GP), coefficient of the velocity of germination (CVG), and velocity of germination (VG) of two lettuce cultivars seeds under different light treatments Cultivar LED color GP (%) CVG (days) VG (N° seeds/days) Red (Jeok Chi Ma) D 90 ± 0.3 b 1.4 ± 0.1 a 15 ± 0.8 c N 80 ± 0.5 c 1.3 ± 0.2 b 22 ± 2.2 a W 80 ± 0.3 c 1.5 ± 0.2 a 13.4 ± 0.9 d R 90 ± 0.4 b 1.2 ± 0.1 c 15 ± 1.1 c B 90 ± 0.3 b 1.1 ± 0.2 d 22.5 ± 1.8 a RB 100 ± 0.0 a 1.3 ± 0.1 b 16.7 ± 0.9 b Green (Cheong Chi Ma) D 96 ± 0.3 a 1.2 ± 0.2 b 23.8 ± 1.7 c N 96 ± 0.2 a 1 ± 0.1 d 47.5 ± 3.4 a W 96 ± 0.1 a 1.1 ± 0.2 c 45 ± 4.0 b R 90 ± 0.2 b 1.1 ± 0.1 c 22.5 ± 2.2 d B 96 ± 0.3 a 1.4 ± 0.2 a 15.9 ± 0.8 e RB 96 ± 0.2 a 1.1 ± 0.1 c 23.8 ± 1.5 c D: darkness as control, N: natural light, W: 100% white, R: 100% red, B: 100% blue, RB: combination of red and blue; The values presented as mean values ± SD derived from three replicates. Different letters indicate a significant difference between samples ( p < 0.05). For the red cultivar, the highest GP (100%) was observed under the combination of RB light, followed by treatments D, R, and B, all of which had a GP of 90%, whereas the lowest GP (80%) was recorded under N and W light. The highest CVG (1.5 days) occurred under W light, while the lowest (1.1 days) was under B light. The VG showed significant differences, with the fastest germination (22 seeds/days) under N and B light, while the slowest (13.4 seeds/days) was observed under W light. In the green cultivar, the GP remained consistently high (96%) under most light treatments (D, N, W, B, RB), except under R light, which had a slightly lower GP of 90%. The highest CVG (1.4 days) was seen with B light, while the lowest (1 day) was recorded under N light. The VG varied significantly, with the fastest germination rate (47.5 seeds/days) under N light and the slowest (15.9 seeds/days) under B light. Overall, the RB light produced the highest GP in the red cultivar, while N light enhanced the VG in the green cultivar. Different light wavelengths significantly affected the germination rates and velocities in both lettuce cultivars ( P < 0.05). 3.2 The effect of LED treatment on lettuce growth The biomass, including SFW, and root morphology, RFW, RL, and RV of green and red lettuce seedlings, are presented in Fig. 1 . The SFW of the seedlings was notably affected by the light treatments over time. Compared to N light (control), both cultivars showed significant increases in SFW under LED light. R light had the most pronounced effect on the biomass of both cultivars, followed by the combination of RB light, which also performed well. The RFW of the seedlings was similarly influenced by the LED light treatments. B light had the greatest impact on root weight in both cultivars, followed by W light, which also had a noticeable effect. The least root development was observed under N light conditions. Regarding RL, R light had the strongest effect on both cultivars, followed by W light, which also significantly impacted RL in the lettuce plants. B and W light treatments significantly influenced RV, with N light showing the least effect. 3.3 Effect of LED treatments on PCs content in lettuce The PCs content in lettuce was significantly influenced by both light treatments and cultivars ( P RB > W > R > N. Specifically, the highest PCs content was observed under B light, followed by a RB light, with N light resulting in the lowest content (Fig. 2 A, B). The red cultivar showed the highest PCs content across all LED light treatments (Fig. 2 A). Compared to the control, the PCs content in red lettuce increased significantly under B (2.22%), RB (2.04%), W (1.73%), and R (1.51%) light treatments, relative to N light (Fig. 2 A). Similarly, in green lettuce, the PCs content increased with B (3.77%), RB (1.98%), W (1.83%), and R (1.40%) light treatments, compared to N light (Fig. 2 B). 3.4 Effect of LED treatments on FLs content in lettuce FLs contents in lettuce was significantly influenced by both light treatments and cultivars ( P W > RB > R > N, with B light resulting in the highest FLs content and N light the lowest. Notably, the red cultivar consistently showed higher FLs content under all LED treatments compared to the green cultivar (Fig. 2 C). When compared to the N light control, FLs content in red lettuce increased significantly under B (1.53%), W (1.31%), RB (1.16%), and R (1.05%) light treatments (Fig. 2 C). Similarly, green lettuce displayed a significant increase in FLs content under B (1.71%), W (1.27%), RB (1.14%), and R (1.03%) light treatments relative to the control (Fig. 2 D). 3.5 Effect of LED treatments on pigment content in lettuce All pigment contents in the lettuce samples, including ANTs, Chl a, Chl b, and CARs, were significantly influenced by both light treatments and cultivars ( P < 0.01), indicating that the environmental conditions (specifically the type of light) and genetic factors (the cultivar type) both play crucial roles in pigment production. There was a noticeable progressive increase in ANTs content in both the red and green lettuce cultivars, with a more pronounced increase observed under the different LED light treatments (Fig. 3 A, B). The ranking of ANTs content across the light treatments was as follows: B > W > RB > R > N, with B light treatment inducing the highest ANTs content and N light resulting in the lowest. This suggests that B light is particularly effective in stimulating the production of ANTs. Interestingly, the red cultivar consistently exhibited higher ANTs content compared to the green cultivar across all light treatments. This could be attributed to the genetic characteristics of the red cultivar, which might be more predisposed to produce higher levels of ANTs. For both cultivars, the ANTs content increased significantly under B light (3.20% in red and 3.27% in green) compared to the N light control, demonstrating the strong influence of B light on ANTs production. W light also significantly boosted ANTs content in both cultivars, followed by the combination of RB light, with R light being less effective. The levels of Chl a and Chl b progressivel increased in both cultivars under LED treatments (Fig. 3 C-F), indicating enhanced photosynthetic activity under the various LED light treatments. The Chl content ranking across the light treatments was B > W > RB > R > N, with B light promoting the highest Chl levels and N light resulting in the lowest. This trend suggests that B light is not only crucial for stimulating ANTs production but also plays an essential role in promoting Chl synthesis, which is vital for PS and overall plant growth. Notably, the green cultivar consistently exhibited higher Chl content under all LED treatments compared to the red cultivar. This may reflect the N characteristics of green-leafed plants, which often have a higher Chl concentration to optimize light absorption for PS. In both cultivars, Chl a and Chl b content significantly increased under B light compared to the N light control, with increases in Chl a ranging from 1.55% in red to 1.48% in green lettuce, and Chl b increases ranging from 1.78% in red to 1.37% in green lettuce. W light also significantly enhanced both Chl types in both cultivars. The CARs content in both cultivars increased progressively, with the following ranking across light treatments: R > N > RB > W > B (Fig. 3 G, H). R light, in particular, induced the highest CARs content, whereas B light resulted in the lowest CARs content. As with the other pigments, the red cultivar consistently exhibited higher CARs content across all LED treatments compared to the green cultivar. This could be due to the higher levels of CARs typically found in red-leaved plants. For both cultivars, CARs content significantly increased under R light, with the highest increase observed in green lettuce (1.36%) and the lowest in red lettuce under B light (0.74%). RB light and W light also increased CARs content, but to a lesser extent. 3.6 Impact of LED treatments on gene expression in ANTs and CARs biosynthesis in lettuce To evaluate the impact of LED treatments on the expression of key enzymes involved in the biosynthesis of ANTs and CARs, we analyzed the mRNA levels of relevant genes in lettuce leaves at 3 and 9 days after treatment. Our findings revealed a significant positive correlation between B light exposure and the expression of all five genes associated with ANTs biosynthesis— CHS , DFR , UFGT , F3H , and ANS . Under B light irradiation, there were substantial increases in the expression levels of these genes (Fig. 4 ). Notably, we observed cultivar-specific differences in gene responses to B light. In the green lettuce cultivar, the genes CHS , DFR , and UFGT exhibited the most pronounced upregulation under B light, while in the red cultivar, the genes F3H and ANS showed the highest expression levels under the same conditions. In terms of gene expression levels, B light treatment led to the highest expression, followed by W and RB treatments, while R and N light treatments resulted in the lowest expression levels of these genes, consistent with the accumulation of ANTs (Fig. 3 A, B). We also assessed the expression of six genes involved in the CARs biosynthetic pathway— DXS , DXR , PSY1 , ZDS , CRTISO , and VDE . The results demonstrated that all six genes exhibited a significant positive correlation with R light exposure, with marked increases in their expression levels under R light irradiation (Fig. 5 ). Similar to the ANTs biosynthetic genes, cultivar-specific differences were observed in the response of these genes to R light. In the red lettuce cultivar, the genes DXR , PSY1 , CRTISO, and VDE showed the strongest correlation with R light, with substantial increases in their expression levels under this treatment. Conversely, the genes DXS and ZDS showed distinct expression patterns in response to R light, with variations depending on the duration of exposure and cultivar. Following R light, the expression of these genes was ranked in the order: N light, RB combination, W light, and B light, which closely mirrored the accumulation of CARs under different light treatments (Fig. 3 G, H). Overall, our results highlight how LED light treatments influence the expression of key biosynthetic genes in lettuce, with light wavelength, cultivar, and gene-specific responses playing a crucial role in the modulation of ANTs and CARs production. 4 Discussion 4.1 The effect of LED wavelengths on lettuce seed germination Lettuce is highly sensitive to light, with seed germination significantly influenced by both the presence and quality of light exposure (Hwang et al. 2008 ). While R light is typically reported to promote germination, and far-R light to inhibit it (Carpita and Nabors 1976 ), recent studies, such as Lim et al. ( 2023 ), have confirmed the inhibitory effect of far-R light on germination. However, some research challenges this view. Hernández Adasme et al. (2022) found that B light stimulated germination, while R light suppressed it, suggesting that light’s effects on germination are more complex. In our study, the combination of RB light enhanced germination only in the red cultivar, indicating a cultivar-specific response. W and B light also had different effects depending on the cultivar; W light significantly boosted germination in the red cultivar, while B light was more effective in the green cultivar. Additionally, VG increased under N and B lights in the red cultivar, and under N light alone in the green cultivar. These results highlight the complexity of light’s role in germination. Our findings emphasize that lettuce germination responses to light wavelengths vary by cultivar, supporting similar observations by Frąszczak and Kula-Maximenko ( 2021 ) and Lozano-Castellanos et al. ( 2025 ), who noted cultivar-specific responses to light. Hernández Adasme et al. (2022) and Liu et al. ( 2022 ) also found that red and green cultivars exhibit different light sensitivities during germination, suggesting a genetic basis for these variations. In conclusion, our study demonstrates that light effects on lettuce seed germination are highly cultivar-specific. Tailoring light conditions to specific cultivars can enhance germination rates, offering valuable insights for optimizing lettuce production in controlled environments. Further research into the genetic mechanisms underlying these differential responses could improve germination protocols for various lettuce cultivars. 4.2 The effect of LED treatment on lettuce growth This study demonstrated that LED light treatments, in combination with lettuce cultivar type, significantly influenced SFW. Both red and green lettuce cultivars showed the highest SFW under R, followed by RB combination, W, B, and N light (Fig. 1 A and B). Unlike the germination response, where light effects varied by cultivar, the increase in SFW under R light was consistent across both cultivars, supporting previous findings. Bi et al. ( 2024 ) reported that R light promoted lettuce growth, while Battistoni et al. ( 2021 ) observed similar effects in spinach. Additionally, Ju et al. ( 2023 ) found that R light favored leaf cell expansion, promoting shoot elongation and hypocotyl growth in lettuce. The combination RB light also enhanced SFW, though to a lesser extent than R light alone. Several studies have shown that RB light combinations regulate stomatal conductance and improve photosynthetic efficiency, leading to increased biomass in crops like cucumber and tomato (Ouzounis et al. 2016 ; Wang et al. 2024 ; Li et al. 2023 ). This synergy between R and B light impacts stomatal behavior, contributing to the enhanced SFW observed under R and combination of RB light. In contrast, B light inhibits hypocotyl elongation in lettuce and soybean seedlings, resulting in decreased SFW, which aligns with our observations (Vaštakaitė-Kairienė et al. 2022 ; Lim et al. 2023 ). Root growth responses to light wavelengths showed distinct patterns, with B light producing the most significant increase in RFW, followed by W, RB, R, and N light (Fig. 1 C, D). A similar trend was observed for RV, although W light led to greater RV than B light. For RL, R light produced the longest roots, followed by W, RB, B, and N light. These findings suggest that RFW influenced RV more than RL. Light wavelength effects on RFW, RL, and RV were consistent across different lettuce cultivars. Roots, like shoots, contain photoreceptors that sense light (Mo et al. 2015 ). R light activates phytochrome B (PhyB) and PhyA in roots, promoting gibberellic acid (GA)-induced root elongation, a phenomenon observed in our study (Kiss et al., 2003 ; Ramon et al., 2023 ). Mutations in PhyB result in reduced root growth and lateral root formation under light exposure (Silva-Navas et al. 2015 ). R light also modulates hormones like auxins and increases PS, providing energy for root development (Spaninks et al. 2020 ). Conversely, B light shortens roots and reduces lateral root formation compared to dark-grown roots (Moni et al. 2015 ; Silva-Navas et al. 2015 ). B and W light also induce negative phototropism in roots, mediated by phototropin family photoreceptors, while R light induces positive phototropism in Arabidopsis roots (Kiss et al. 2003 ). Double mutants for B-light photoreceptors (cry1/cry2 and phot1/phot2) show increased root growth and lateral root numbers in response to light. These findings help explain our results (Fig. 1 E, F, G, H). Kiss et al. ( 2003 ) found that B light overrides R light’s effects on phototropism, mediated by PhyA and PhyB. However, our results suggest that the RB light combination produces effects similar to those of R and B light exposures individually, particularly for RV and RL. In terms of RFW, the RB combination produces intermediate effects compared to R and B light individually. These results indicate that root growth and development are differentially regulated by specific wavelengths and their combinations. 4.3 Effect of LED treatments on PCs and FLs content in lettuce Research consistently demonstrates that light exposure plays a crucial role in promoting the production of secondary metabolites such as ANTs, polyamines, polyphenols, and phenylpropanoids (Shin et al. 2003 ; Szopa et al. 2018 ; Kubica et al. 2020 ; Arias et al. 2016 ; Thongtip et al. 2024 ; Klimek-Szczykutowicz et al. 2022 ; Park et al. 2024 ). Our study further underscores that light wavelengths, particularly B light, significantly influence the accumulation of these compounds. Specifically, B light was most effective in enhancing the accumulation of PCs and FLs, surpassing the effects of other light wavelengths (Fig. 2 A, B, C, D). Both red and green lettuce cultivars showed increased PCs under B light, although the intensity of this effect varied, with the red cultivar displaying a greater response. For FLs, the accumulation under B light was similar for both cultivars, with comparable increases. However, the combination of RB light had an effect on FLs similar to R light alone, differing from the response observed with PCs. These findings align with previous research showing that B light enhances the accumulation of PCs and FLs in various species, including lentil, basil, strawberry, tea plants, and hairy root cultures of Astragalus membranaceus (Wang et al. 2020 ; Gai et al. 2023 ; Malekzadeh et al. 2024 ; Park et al. 2024 ; Thongtip et al. 2024 ). This growing body of evidence emphasizes the importance of B light in modulating secondary metabolite biosynthesis, offering valuable insights for optimizing growth conditions in controlled environments. However, other studies have reported conflicting results regarding the influence of light on secondary metabolite production. For instance, Aris et al. (2016) found that cell suspension cultures of Thevetia peruviana grown in darkness had higher phenolic content and antioxidant capacity compared to those grown under light. Additionally, W light has been shown to promote greater production of PCs and FLs than other wavelengths, including R, B, green, and yellow, in various experimental models such as callus cultures of Lepidium sativum , shoot cultures of Moringa oleifera , and callus cultures of Ocimum basilicum (Nadeem and Ahmad 2019 ; Ullah et al. 2019 ). These contrasting findings suggest that the effects of light on secondary metabolite production are complex, influenced by plant species, tissue type, and experimental conditions. Further research is necessary to better understand the relationship between light quality and plant metabolic responses. 4.4 Effect of LED treatments on pigment content in lettuce The photosynthetically active radiation (PAR) spectrum plays a crucial role in Chl biosynthesis, which is essential for plant growth and photosynthetic efficiency. In this study, we observed that both lettuce cultivars exhibited significantly higher levels of Chl a and Chl b when grown under B light, compared to R and N light (Fig. 3 C, D, E, F). These results align with previous studies on lettuce (Hernández Adasme et al. 2022) and cucumbers (Wang et al. 2024 ), which showed that B light enhances Chl production. B light stimulates the production of enzymes involved in Chl biosynthesis (Biswal et al. 2012 ), and Chl b, which absorbs B and purple wavelengths, is integral to the light-harvesting complex. Seedlings exposed to B light showed improved light absorption efficiency due to increased light-harvesting complexes per reaction center (Cammarisano et al. 2021 ). In contrast, R and N light led to the lowest Chl values, highlighting the need for a balanced light spectrum to optimize Chl production. R light has been associated with reduced Chl content in plants such as lettuce, basil, and spinach (Naznin et al. 2019 ). This study also found that seedlings grown under R light had significantly lower Chl content (Fig. 3 C, D, E, F), corroborating findings by Fan et al. ( 2013 ), who reported low levels of Chl biosynthesis precursors under R light. Additionally, seedlings exposed to N light exhibited lower Chl content, likely due to higher light intensity compared to the controlled LED treatments (Yong et al. 2024 ). CARs are crucial in protecting Chl from photodamage and mitigating excessive light exposure. In this study, both lettuce cultivars exhibited increased CARs content under R light compared to other light conditions (Fig. 3 G, H), aligning with previous studies showing enhanced CARs accumulation under R light in various species (Xu and Harvey 2019 ). R light activates enzymes like phytoene synthase and phytoene desaturase, which are key to CARs biosynthesis (Frede et al. 2018 ). The red lettuce cultivar showed higher CARs content than the green cultivar, both in seedlings and post-transplantation plants, suggesting species-specific responses to light intensity (Samuolienė et al. 2021 ). B light was found to enhance ANTs accumulation in both red and green lettuce seedlings (Fig. 3 A, B), supporting previous research highlighting B light's role in promoting ANTs biosynthesis in plants (Li and Kubota 2009 ; Ma et al. 2021 ). In contrast, R light was less effective than B light in promoting ANTs accumulation, though it has been shown to contribute to ANTs accumulation in strawberry fruit (Shao et al. 2022 ). Research also suggests that ANTs accumulation under R light may serve a photoprotective function against high light stress in apple leaves (Zhao et al. 2022 ). Overall, our study highlights the significant role of light conditions, particularly B and R light, in shaping plant pigment profiles, including Chl, CARs, and ANTs. These findings provide valuable insights into optimizing light conditions for enhancing pigment accumulation and improving plant quality. 4.5 The expression levels of genes associated with the biosynthesis of ANTs and CARs Our study demonstrated a significant upregulation of key genes involved in ANTs biosynthesis in lettuce leaves exposed to B light. The expression of genes such as CHS , F3H , DFR , ANS , and UFGT increased under B light, suggesting that B light is more effective in inducing the expression of these genes compared to other light sources (Fig. 4 ). This finding supports previous research by Zhang et al. ( 2018 ), which highlighted B light’s role in activating the ANTs biosynthesis pathway across various plant species. ANTs, important for plant coloration, stress response, and antioxidant properties, accumulate more under B light, improving both the visual appeal and antioxidant content of plants. Zhang et al. ( 2018 ) demonstrated that B light activates ANTs-related genes via photoreceptors like cryptochromes ( CRY ) and phototropins ( PHOT ), which upregulate this pathway. Though the exact mechanism remains under investigation, these findings underscore the importance of B light in regulating ANTs production, offering a potential method for increasing ANTs levels in crops through light manipulation. Additionally, our study showed significant upregulation of genes involved in CARs biosynthesis, including DXS , DXR , PSY1 , ZDS , CRTISO , and VDE , in lettuce leaves exposed to R light (Fig. 5 ). This finding supports previous research (Frede et al. 2019 ), which indicated that R light enhances CARs accumulation by activating genes in the methylerythritol 4-phosphate (MEP) pathway. The increased expression of DXS , DXR , and PSY1 suggests that R light directly influences CARs production. Phytochromes, photoreceptors for R light, likely play a role in this process by triggering signaling pathways that activate transcription factors responsible for CARs biosynthesis (Frascogna et al. 2023 ). Overall, our results highlight the crucial role of light wavelengths in regulating both ANTs and CARs biosynthesis, with potential applications for improving the nutritional and antioxidant properties of crops. Optimizing light conditions, particularly the spectral composition, could enhance pigment accumulation, offering benefits for crop quality and market value. The differential regulation of genes in response to light wavelengths also reveals how plants adapt their biosynthetic pathways to environmental cues, influencing not only pigment production but also growth, development, and stress resilience. 5 Conclusion This study examines how different LED wavelengths affect lettuce seed germination, seedling growth, and phytochemical contents. B and R lights were found to significantly influence germination rates, shoot and root development, and biomass. B light sped up germination in the red cultivar, while red light increased seedling fresh weight and shoot growth in both cultivars. B light also promoted root growth, while R light affected hypocotyl elongation, showing that these wavelengths have distinct effects. Light exposure also influenced pigment accumulation. B light increased PCs and FLs, while R light raised CARs levels. B light also boosted ANTs biosynthesis. Gene expression analysis showed that B light upregulated genes in the ANTs biosynthetic pathway ( CHS , F3H , DFR , ANS , and UFGT ), while red light enhanced CARs biosynthesis genes ( DXS , DXR , PSY1 , ZDS , CRTISO , and VDE ). These findings offer useful insights for optimizing light conditions in indoor agriculture to improve crop yield and nutritional quality. They also provide a foundation for future research on light-driven strategies to boost plant productivity and pigment content in vegetable crops. Declarations Conflict of interest The authors declare that they have no conflicts of interest. Funding This work was supported by the Cooperative Research Program for Agriculture Science and Technology Development (RS-2024-00322321) of the Rural Development Administration (RDA) of Korea. Authors contributions SO conducted the investigation, wrote the original draft, and curated the data together with MA, who also contributed to writing the original draft and data curation. SL supervised the project, acquired funding, conceptualized the study, and contributed to writing through review and editing. Data availability The data are available from the corresponding author upon reasonable request. References Arias JP, Zapata K, Rojano B, Arias M (2016) Effect of light wavelength on cell growth, content of phenolic compounds and antioxidant activity in cell suspension cultures of Thevetia peruviana . J Photochem Photobiol B 163:87-91. https://doi.org/10.1016/j.jphotobiol.2016.08.014 Battistoni B, Amorós A, Tapia ML, Escalona VH (2021) Effect of blue, green or red LED light on the functional quality of spinach ( Spinacia oleracea L.). Rev Fac Cienc Agrar, Univ Nac Cuyo 53:98-108. https://doi.org/10.48162/rev.39.010 Bi X, Xu H, Yang C, Zhang H, Li W, Su W, Zheng M, Lei B (2024) Investigating the influence of varied ratios of red and far-red light on lettuce ( Lactuca sativa ): effects on growth, photosynthetic characteristics and chlorophyll fluorescence. Front Plant Sci 15:1430241. https://doi.org/10.3389/fpls.2024.1430241 Biswal AK, Pattanayak GK, Pandey SS, Leelavathi S, Reddy VS, Govindjee-Tripathy BC (2012) Light intensity-dependent modulation of chlorophyll b biosynthesis and photosynthesis by overexpression of chlorophyllide a oxygenase in tobacco. Plant Physiol 159:433-449. https://doi.org/10.1104/pp.112.195859 Brazaitytė A, Miliauskienė J, Vaštakaitė-Kairienė V, Sutulienė R, Laužikė K, Duchovskis P, Małek S (2021) Effect of different ratios of blue and red led light on brassicaceae microgreens under a controlled environment. Plants 10:801.https://doi.org/10.3390/plants10040801 Cammarisano L, Donnison IS, Robson PR (2021) The effect of red & blue rich LEDs vs fluorescent light on Lollo rosso lettuce morphology and physiology. Front Plant Sci 12:603411. https://doi.org/10.3389/fpls.2021.603411 Carotti L, Potente G, Pennisi G, Ruiz KB, Biondi S, Crepaldi A, Orsini F, Gianquinto G, Antognoni F (2021) Pulsed LED light: exploring the balance between energy use and nutraceutical properties in indoor-grown lettuce. Agronomy 11:1106. https://doi.org/10.3390/agronomy11061106 Carpita NC, Nabors MW (1976) Effects of 35 C heat treatments on photosensitive Grand Rapids lettuce seed germination. Plant Physiol 57:612-616. https://doi.org/10.1104/pp.57.4.612 Demir K, Sarıkamış G, Seyrek GÇ (2023) Effect of LED lights on the growth, nutritional quality and glucosinolate content of broccoli, cabbage and radish microgreens. Food Chem 401:134088.https://doi.org/10.1016/j.foodchem.2022.134088 Fan X, Zang J, Xu Z, Guo S, Jiao X, Liu X, Gao Y (2013) Effects of different light quality on growth, chlorophyll concentration and chlorophyll biosynthesis precursors of non-heading Chinese cabbage ( Brassica campestris L.). Acta Physiol Plant 35:2721-2726. https://doi.org/10.1007/s11738-013-1304-z Flores M, Hernández-Adasme C, Guevara MJ, Escalona VH (2024) Effect of different light intensities on agronomic characteristics and antioxidant compounds of Brassicaceae microgreens in a vertical farm system. Front Sustain Food Syst 8:1349423. https://doi.org/10.3389/fsufs.2024.1349423 Flores M, Urrestarazu M, Amorós A, Escalona V (2022) High intensity and red enriched LED lights increased the growth of lettuce and endive. Ital J Agron 17:1915. https://doi.org/10.4081/ija.2021.1915 Frascogna F, Ledermann B, Hartmann J, Pérez Patallo E, Zeqiri F, Hofmann E, Frankenberg-Dinkel N (2023) On the evolution of the plant phytochrome chromophore biosynthesis. Plant Physiol 193:246-258. https://doi.org/10.1093/plphys/kiad327 Frąszczak B, Kula-Maximenko M (2021) The preferences of different cultivars of lettuce seedlings ( Lactuca sativa L.) for the spectral composition of light. Agronomy 11:1211. https://doi.org/10.3390/agronomy11061211 Frede K, Schreiner M, Baldermann S (2019) Light quality-induced changes of carotenoid composition in pak choi Brassica rapa ssp. chinensis. J Photochem Photobiol B 193:18-30. https://doi.org/10.1016/j.jphotobiol.2019.02.001 Frede K, Schreiner M, Zrenner R, Graefe J, Baldermann S (2018) Carotenoid biosynthesis of pak choi ( Brassica rapa ssp. chinensis) sprouts grown under different light-emitting diodes during the diurnal course. Photochem Photobiol Sci 17:1289-1300. https://doi.org/10.1039/c8pp00136g Gai QY, Feng X, Jiao J, Xu XJ, Fu JX, He XJ, Fu YJ (2023) Blue LED light promoting the growth, accumulation of high-value isoflavonoids and astragalosides, antioxidant response, and biosynthesis gene expression in Astragalus membranaceu s (Fisch.) Bunge hairy root cultures. Plant Cell Tissue Organ Cult 153:511-523. https://doi.org/10.1007/s11240-023-02486-7 Hernández-Adasme C, Silva H, Escalona V (2022) In-door germination and seedling growth of green and red lettuce under LED-light spectrum and subsequent effect on baby leaf lettuce. Ital J Agron 17:1982. https://doi.org/10.4081/ija.2022.1982 Hwang HJ, Lee JM, Kim SY, Choi GW (2008) Seed germination in lettuce affected by light quality and plant growth regulators. J Bio-Env Con 17:51-59. International seed testing association (ISTA), (1999) International rules for seed testing. Seed Sci Technol 23:1-269. Jaya MHIS, Putra SD, Sofi'i I (2023) Effect of light spectrum LED lettuce on loT-based indoor farming. Biotropika: J Trop Biol 11:38-43. https://doi.org/10.21776/ub.biotropika.2023.011.01.05 Ju J, Zhang S, Hu Y, Zhang M, He R, Li Y, Liu X, Liu H (2023)Effects of supplemental red and far-red light at different growth stages on the growth and nutritional properties of lettuce. Agronomy 14:55. https://doi.org/10.3390/agronomy14010055 Kang C, Zhang Y, Cheng R, Kaiser E, Yang Q, Li T (2021) Acclimating cucumber plants to blue supplemental light promotes growth in full sunlight. Front Plant Sci 12:782465. https://doi.org/10.3389/fpls.2021.782465 Kim HD, Choi YJ, Bae EY, Je BI, Song SM, Kang JS (2024) Effect of artificial light source on the growth and quality of lettuce. J Environ Sci Int 33:383-402. https://doi.org/10.5322/JESI.2024.33.6.383 Kiss JZ, Mullen JL, Correll MJ, Hangarter RP (2003) Phytochromes A and B mediate red-light-induced positive phototropism in roots. Plant Physiol 131:1411-1417. https://doi.org/10.1104/pp.013847 Klimek-Szczykutowicz M, Prokopiuk B, Dziurka K, Pawłowska B, Ekiert H, Szopa A (2022) The influence of different wavelengths of LED light on the production of glucosinolates and phenolic compounds and the antioxidant potential in in vitro cultures of Nasturtium officinale (watercress). Plant Cell Tissue Organ Cult 149:113-122. https://doi.org/10.1007/s11240-021-02148-6 Kowalczyk T, Muskała M, Merecz-Sadowska A, Sikora J, Picot L, Sitarek P (2024) Anti-inflammatory and anticancer effects of anthocyanins in in vitro and in vivo studies. Antioxidants 13:1143-1178. https://doi.org/10.3390/antiox13091143 Kubica P, Szopa A, Prokopiuk B, Komsta Ł, Pawłowska B, Ekiert H (2020) The influence of light quality on the production of bioactive metabolites–verbascoside, isoverbascoside and phenolic acids and the content of photosynthetic pigments in biomass of Verbena officinalis L. cultured in vitro . J Photochem Photobiol B 203:111768. https://doi.org/10.1016/j.jphotobiol.2019.111768 Lauria G, Ceccanti C, Lo Piccolo E, El Horri H, Guidi L, Lawson T, Landi M (2024) “Metabolight”: how light spectra shape plant growth, development and metabolism. Physiol Plant 176:e14587. https://doi.org/10.1111/ppl.14587 Le AT, Phan NH, Do TK (2021) Effect of blue light on the photosynthesis and flavonoid accumulation in leaves of ( Hedyotis corymbosa L.) Lam. Plant Sci Today 8:955-962. https://doi.org/10.14719/pst.2021.8.4.1238 Lee J, Durst RW, Wrolstad RE (2005) Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: col-laborative study. J AOAC Int 88:1269-1278. https://doi.org/10.1093/jaoac/88.5.1269 Lichtenthaler HK, Wellburn AR (1983) Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Biochem Soc Trans 11:591-592. https://doi.org/10.1042/bst0110591 Lim E, Kim JO, Oh MM (2023) Optimizing the photon ratio of red, green, and blue LEDs for lettuce seedlings: a mixture design approach. Plant Methods 19:121. https://doi.org/10.1186/s13007-023-01098-8 Lim YJ, Kwon SJ, Eom SH (2023) Red and blue light-specific metabolic changes in soybean seedlings. Front Plant Sci 14:1128001. https://doi.org/10.3389/fpls.2023.1128001 Li Q, Kubota C (2009) Effects of supplemental light quality on growth and phytochemicals of baby leaf lettuce. Environ Exp Bot 67:59-64. https://doi.org/10.1016/j.envexpbot.2009.06.011 Liu Y, Schouten RE, Tikunov Y, Liu X, Visser RG, Tan F, Bovy A, Marcelis LF (2022) Blue light increases anthocyanin content and delays fruit ripening in purple pepper fruit. Postharvest Biol Technol 192:112024. https://doi.org/10.1016/j.postharvbio.2022.112024 Li Y, Huang Y, Wang M, Zhao Y (2023) An improved U-Net-based in situ root system phenotype segmentation method for plants. Front Plant Sci 14:1115713. https://doi.org/10.3389/fpls.2023.1115713 Lozano-Castellanos LF, Sánchez-Hernández E, Navas-Gracia LM, Martín-Ramos P, Correa-Guimaraes A (2025) Effects of different types of artificial light on the phytochemicals of Lactuca sativa L. variety great lakes 118 cultivated under aeroponic system. Food Biosci 105950. https://doi.org/10.1016/j.fbio.2025.105950 Ma J, Zhang J, Xie L, Ye J, Zhou L, Yu D, Wang QW (2024) Light quality regulates growth and flavonoid content in a widespread forest understorey medicinal species Scutellaria Baicalensis Georgi. Front Plant Sci 15:1488649. https://doi.org/10.3389/fpls.2024.1488649 Malekzadeh MR, Roosta HR, Kalaji HM (2024) Enhancing strawberry resilience to saline, alkaline, and combined stresses with light spectra: impacts on growth, enzymatic activity, nutrient uptake, and osmotic regulation. BMC Plant Biol 24:1038. https://doi.org/10.1186/s12870-024-05755-5 Ma Y, Ma X, Gao X, Wu W, Zhou B (2021) Light induced regulation pathway of anthocyanin biosynthesis in plants. Int J Mol Sci 22:11116. https://doi.org/10.3390/ijms222011116 Mo M, Yokawa K, Wan Y, Baluška F (2015) How and why do root apices sense light under the soil surface. Front Plant Sci 6:775. https://doi.org/10.3389/fpls.2015.00775 Moni A, Lee AY, Briggs WR, Han IS (2015) The blue light receptor Phototropin 1 suppresses lateral root growth by controlling cell elongation. Plant Biol 17:34-40. https://doi.org/10.1111/plb.12187 Nadeem H, Ahmad F (2019) Prospects for the use of plant cell culture as alternatives to produce secondary metabolites. Natural bio-active compounds: volume 3: Biotechnology, Bioengineering, and Molecular approaches, 153-182. https://doi.org/10.1007/978-981-13-7438-8_6 Naznin MT, Lefsrud M, Gravel V, Azad MOK (2019)Blue light added with red LEDs enhance growth characteristics, pigments content, and antioxidant capacity in lettuce, spinach, kale, basil, and sweet pepper in a controlled environment. Plants 8:93. https://doi.org/10.3390/plants8040093 Olajiga OK, Ani EC, Sikhakane ZQ, Olatunde TM (2024) A comprehensive review of energy-efficient lighting technologies and trends. Eng Sci Technol Int J 5:1097-1111. https://doi.org/10.51594/estj.v5i3.973 Ouzounis T, Heuvelink E, Ji Y, Schouten HJ, Visser RGF, Marcelis LFM (2016) Blue and red LED lighting effects on plant biomass, stomatal conductance, and metabolite content in nine tomato genotypes. In VIII International Symposium on Light in Horticulture, 1134:251-258. https://doi.org/10.17660/ActaHortic.2016.1134.34 Park YR, Kwon SJ, Kim JH, Duan S, Eom SH (2024) Light-induced antioxidant phenolic changes among the sprouts of lentil cultivar. Antioxidants 13:399. https://doi.org/10.3390/antiox13040399 Rahman MM, Field DL, Ahmed SM, Hasan MT, Basher MK, Alameh K (2021) LED illumination for high-quality high-yield crop growth in protected cropping environments. Plants 10:2470.https://doi.org/10.3390/plants10112470 Ramon U, Adiri A, Cheriker H, Burko Y, Nir I, Weiss D (2023) Light perception by the root is essential for gibberellin-induced primary-root elongation in tomato. BioRxiv 2023-08. https://doi.org/10.1101/2023.08.20.554010 Samuolienė G, Viršilė A, Miliauskienė J, Haimi PJ, Laužikė K, Brazaitytė A, Duchovskis P (2021) The physiological response of lettuce to red and blue light dynamics over different photoperiods. Front Plant Sci 11:610174. https://doi.org/10.3389/fpls.2020.610174 Shao D, Zhu QH, Liang Q, Wang X, Li Y, Sun Y, Zhang X, Liu F, Xue F, Sun J (2022) Transcriptome analysis reveals differences in anthocyanin accumulation in cotton ( Gossypium hirsutum L.) induced by red and blue light. Front Plant Sci 13:788828. https://doi.org/10.3389/fpls.2022.788828 Shi M, Gu J, Wu H, Rauf A, Emran TB, Khan Z, Mitra S, Aljohani AS, Alhumaydhi FA, Al-Awthan YS, Bahattab O (2022) Phytochemicals, nutrition, metabolism, bioavailability, and health benefits in lettuce—A comprehensive review. Antioxidants 11:1158. https://doi.org/10.1126/science.1071055 Shin KS, Murthy HN, Heo JW, Paek KY (2003) Induction of betalain pigmentation in hairy roots of red beet under different radiation sources. Biol Plant 47:149-152. https://doi.org/10.1023/A:1027313805930 Silva‐Navas J, Moreno‐Risueno MA, Manzano C, Pallero‐Baena M, Navarro‐Neila S, Téllez‐Robledo B, Garcia‐Mina JM, Baigorri R, Gallego FJ, del Pozo JC (2015) D‐Root: a system for cultivating plants with the roots in darkness or under different light conditions. Plant J 47:244-255. https://doi.org/10.1111/tpj.12998 Spaninks K, Van Lieshout J, Van Ieperen W, Offringa R (2020) Regulation of early plant development by red and blue light: A comparative analysis between Arabidopsis thaliana and Solanum lycopersicum . Front Plant Sci 11:599982. https://doi.org/10.3389/fpls.2020.599982 Sun T, Rao S, Zhou X, Li L (2022) Plant carotenoids: recent advances and future perspectives. Mol Hortic 2:3. https://doi.org/10.1186/s43897-022-00023-2 Szopa A, Starzec A, Ekiert H (2018) The importance of monochromatic lights in the production of phenolic acids and flavonoids in shoot cultures of Aronia melanocarpa , Aronia arbutifolia and Aronia× prunifolia . J Photochem Photobiol B 179:91-97. https://doi.org/10.1016/j.jphotobiol.2018.01.005 Thongtip A, Mosaleeyanon K, Janta S, Wanichananan P, Chutimanukul P, Thepsilvisut O, Chutimanukul P (2024) Assessing light spectrum impact on growth and antioxidant properties of basil family microgreens. Sci Rep 14:27875. https://doi.org/10.1038/s41598-024-79529-2 Toscano S, Cavallaro V, Ferrante A, Romano D, Patané C (2021) Effects of different light spectra on final biomass production and nutritional quality of two microgreens. Plants 10:1584.https://doi.org/10.3390/plants10081584 Ullah MA, Tungmunnithum D, Garros L, Hano C, Abbasi BH (2019) Monochromatic lights-induced trends in antioxidant and antidiabetic polyphenol accumulation in in vitro callus cultures of Lepidium sativum L. J Photochem Photobiol B 196:111505. https://doi.org/10.1016/j.jphotobiol.2019.05.002 Vaštakaitė-Kairienė V, Samuolienė G, Šveikauskas V, Laužikė K, Jurkonienė S (2022) The influence of end-of-day blue light on the growth, photosynthetic, and metabolic parameters of lettuce at different development stages. Plants 11:2798. https://doi.org/10.3390/plants11202798 Wang P, Chen S, Gu M, Chen X, Chen X, Yang J, Zhao F, Ye N (2020) Exploration of the effects of different blue LED light intensities on flavonoid and lipid metabolism in tea plants via transcriptomics and metabolomics. Int J Mol Sci 21:4606. https://doi.org/10.3390/ijms21134606 Wang T, Sun Q, Zheng Y, Xu Y, Liu B, Li Q (2024) Effects of red and blue light on the growth, photosynthesis, and subsequent growth under fluctuating light of cucumber seedlings. Plants 13:1668. https://doi.org/10.3390/plants13121668 Willett WC (2002) Balancing life-style and genomics research for disease prevention. Science 296 (5568): 695-698. https://doi.org/10.1126/science.1071055 Xu Y, Harvey PJ (2019) Carotenoid production by Dunaliella salina under red light. Antioxidants 8:123. https://doi.org/10.3390/antiox8050123 Yong S, Chen Q, Xu F, Fu H, Liang G, Guo Q (2024) Exploring the interplay between angiosperm chlorophyll metabolism and environmental factors. Planta 260:25. https://doi.org/10.1007/s00425-024-04437-8 Zhang P, Lu S, Liu Z, Zheng T, Dong T, Jin H, Jia H, Fang J (2021) Transcriptomic and metabolomic profiling reveals the effect of LED light quality on fruit ripening and anthocyanin accumulation in cabernet sauvignon grape. Front Nutr 8:790697. https://doi.org/10.3389/fnut.2021.790697 Zhang Y, Jiang L, Li Y, Chen Q, Ye Y, Zhang Y, Luo Y, Sun B, Wang X, Tang H (2018) Effect of red and blue light on anthocyanin accumulation and differential gene expression in strawberry ( Fragaria×ananassa ). Molecules 23:820. https://doi.org/10.3390/molecules23040820 Zhang Y, Xu S, Cheng Y, Peng Z, Han J (2018)Transcriptome profiling of anthocyanin-related genes reveals effects of light intensity on anthocyanin biosynthesis in red leaf lettuce. PeerJ 6:e4607. https://doi.org/ 10.7717/peerj.4607 Zhao S, Blum JA, Ma F, Wang Y, Borejsza-Wysocka E, Ma F, Cheng L, Li P (2022) Anthocyanin accumulation provides protection against high light stress while reducing photosynthesis in apple leaves. Int J Mol Sci 23:12616. https://doi.org/10.3390/ijms232012616 Zhou C, Zhu Y, Luo Y (2013) Effects of sulfur fertilization on the accumulation of health-promoting phytochemicals in radish sprouts. J Agric Food Chem 61:7552-7559. https://doi.org/10.1021/jf402174f Cite Share Download PDF Status: Published Journal Publication published 21 Jan, 2026 Read the published version in Acta Physiologiae Plantarum → Version 1 posted Reviewers agreed at journal 07 Jul, 2025 Reviewers invited by journal 16 Jun, 2025 Editor assigned by journal 16 May, 2025 First submitted to journal 14 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6664304","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":471755827,"identity":"0e4abd1d-3005-4864-860b-8ff88b4fc338","order_by":0,"name":"Saeed Omrani","email":"","orcid":"","institution":"Sejong University College of Life Science","correspondingAuthor":false,"prefix":"","firstName":"Saeed","middleName":"","lastName":"Omrani","suffix":""},{"id":471755828,"identity":"74102990-fc69-4487-8175-1252b1558e78","order_by":1,"name":"Mahvash Afshari","email":"","orcid":"","institution":"Sejong University College of Life Science","correspondingAuthor":false,"prefix":"","firstName":"Mahvash","middleName":"","lastName":"Afshari","suffix":""},{"id":471755829,"identity":"40547555-6aa9-4951-be39-f0ace67d13d2","order_by":2,"name":"Sanghyeob Lee","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8ElEQVRIiWNgGAWjYLCCBwwMckAqAcplI0ILUK0x6VoSGxBcAlrk288efpFQYZM+v73h4eOCXwzy/A1saR/waTE4k5dmkXAmLXfDmQPJxjP7GAxnHGA7PAOvFoYcM4PEtsO5GyQS0qR5exgYNzCwN+N3WP8boJZ//9Pl5z8Aa7EnqIXhRo7xg8SGAwkMNxjSpHl+MCRuYGA7jFeHwY03ZgwJx5INN5xJSDbmbZBInnGYLZmAw3KMP3yosZOXbz+T+Jjnj41tf3ubMX6HAaNBAkLzJDAwtgHZzIQ0AJVAY4H9AAPDH8LKR8EoGAWjYOQBANuiSTGnRT/NAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-7684-2325","institution":"Dept. of Bioindustry and Bioresource Engineering, Sejong University","correspondingAuthor":true,"prefix":"","firstName":"Sanghyeob","middleName":"","lastName":"Lee","suffix":""}],"badges":[],"createdAt":"2025-05-14 12:45:49","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6664304/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6664304/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11738-026-03886-w","type":"published","date":"2026-01-21T15:58:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":84875918,"identity":"108967bb-cc5e-4ddc-8a4c-fa02f1ed50d7","added_by":"auto","created_at":"2025-06-18 09:49:01","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1085417,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of LED light on shoot fresh weight (SFW), root fresh weight (RFW), root length (RL), and root volume (RV) for two lettuce cultivars. A, C, E, and G display results for red lettuce (Jeok Chi Ma), while panels B, D, F, and H present results for green lettuce (Cheong Chi Ma). The light treatments include N (natural light), W (100% white), R (100% red), B (100% blue), and RB (1:1 combination of red and blue). The column charts represent mean values ± SD from three replicates. Different letters indicate statistically significant differences between samples (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05). The X-axis represents the number of days after LED light treatment, and the Y-axis shows the measurements of SFW, RFW, RL, and RV.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6664304/v1/741d212edb2c682a8697f5a3.jpg"},{"id":84875917,"identity":"9635a56f-6c4f-4b33-abd3-e7b35e60bbc1","added_by":"auto","created_at":"2025-06-18 09:49:01","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":602447,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of LED light on the contents of phenolic compounds (PCs) and flavonoids (FLs) in two lettuce cultivars. A and C correspond to red lettuce (Jeok Chi Ma), while B and D correspond to green lettuce (Cheong Chi Ma). The light treatments include N (natural light), W (100% white), R (100% red), B (100% blue), and RB (1:1 combination of red and blue). The column charts represent mean values ± SD from three replicates. Different letters indicate statistically significant differences between samples (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05). The X-axis represents the number of days following the LED light treatment, while the Y-axis displays the measurements of phenolic compounds (PCs) and flavonoids (FLs).\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6664304/v1/d90c073154b00a2a4bec311d.jpg"},{"id":84876814,"identity":"f83a60a8-fdfb-4e2e-b654-38681160e6a3","added_by":"auto","created_at":"2025-06-18 09:57:01","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1313246,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of LED light on the phytochemical content. Total anthocyanins (ANTs), chlorophyll a (Chl a), chlorophyll b (Chl b), and carotenoids (CARs), in two lettuce cultivars is shown on the Y-axis. The X-axis represents the number of days following the LED light treatment. A, C, E, and G represent red lettuce (Jeok Chi Ma), while B, D, F, and H represent green lettuce (Cheong Chi Ma). The light treatments include N (natural light), W (100% white), R (100% red), B (100% blue), and RB (1:1 combination of red and blue). The column charts display mean values ± SD from three replicates, with different letters indicating statistically significant differences between samples (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6664304/v1/c4e7bd764a9d19e9cfe15d99.jpg"},{"id":84875919,"identity":"d0bf0d44-e1ee-4c55-a1a7-8dd7c1303c70","added_by":"auto","created_at":"2025-06-18 09:49:01","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":800788,"visible":true,"origin":"","legend":"\u003cp\u003eExpression analysis of key genes in ANTs biosynthesis. The light treatments, including N (natural light), W (100% white), R (100% red), B (100% blue), and RB (1:1 combination of red and blue), are shown on the X-axis, while the Y-axis represents both lettuce cultivars and the LED treatment durations, indicated as d3 and d9 (3 and 9 days after treatment). Heatmap colors illustrate relative expression levels normalized to Actin, with corresponding values displayed on the right Y-axis. Abbreviations: \u003cem\u003ePAL\u003c/em\u003e, \u003cem\u003ephenylalanine ammonia-lyase\u003c/em\u003e; \u003cem\u003eC4H\u003c/em\u003e, \u003cem\u003ecinnamic acid 4-hydroxylase\u003c/em\u003e; \u003cem\u003e4CL\u003c/em\u003e, \u003cem\u003e4-coumaric acid\u003c/em\u003e: \u003cem\u003eCoA ligase\u003c/em\u003e; \u003cem\u003eCHS\u003c/em\u003e, \u003cem\u003echalcone synthase\u003c/em\u003e; \u003cem\u003eCHI\u003c/em\u003e, \u003cem\u003echalcone isomerase\u003c/em\u003e; \u003cem\u003eUFGT\u003c/em\u003e, \u003cem\u003eUDP glucose-flavonoid 3-O-glucosyl\u003c/em\u003e \u003cem\u003etransferase\u003c/em\u003e; \u003cem\u003eF3H\u003c/em\u003e, \u003cem\u003eflavanone 3-hydroxylase\u003c/em\u003e; \u003cem\u003eF3'H\u003c/em\u003e, \u003cem\u003eflavonoid 3'-hydroxylase\u003c/em\u003e; \u003cem\u003eDFR\u003c/em\u003e, \u003cem\u003edihydroflavonol 4-reductase\u003c/em\u003e; \u003cem\u003eANS\u003c/em\u003e, \u003cem\u003eanthocyanidin synthase\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6664304/v1/788b36f54a3be54a5e85fed1.jpg"},{"id":84875922,"identity":"3a505d80-4e41-4923-803d-da4575d1f56b","added_by":"auto","created_at":"2025-06-18 09:49:01","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":521629,"visible":true,"origin":"","legend":"\u003cp\u003eExpression analysis of key genes in CARs biosynthesis. The light treatments, including N (natural light), W (100% white), R (100% red), B (100% blue), and RB (1:1 combination of red and blue), are shown on the X-axis, while the Y-axis represents both lettuce cultivars and the LED treatment durations, indicated as d3 and d9 (3 and 9 days after treatment). Heatmap colors illustrate relative expression levels normalized to Actin, with corresponding values displayed on the right Y-axis. Abbreviations: \u003cem\u003eGA3P\u003c/em\u003e, \u003cem\u003eglyceraldehyde-3-phosphate\u003c/em\u003e; \u003cem\u003eDXS\u003c/em\u003e, \u003cem\u003e1-deoxyxylulose 5-phosphate synthase\u003c/em\u003e; \u003cem\u003eDOXP\u003c/em\u003e, \u003cem\u003eD-1-deoxyxylulose-5-phosphate\u003c/em\u003e; \u003cem\u003eDXR\u003c/em\u003e, \u003cem\u003e1-deoxyxylulose 5-phosphate reductoisomerase\u003c/em\u003e; \u003cem\u003eMEP\u003c/em\u003e, \u003cem\u003e2-C methyl-D-erythritol-2,4- cyclodiphosphate\u003c/em\u003e; \u003cem\u003eIPP\u003c/em\u003e, \u003cem\u003eisopentenyl diphosphate\u003c/em\u003e; \u003cem\u003eIPI\u003c/em\u003e, \u003cem\u003eIPP isomerase\u003c/em\u003e; \u003cem\u003eGGPP\u003c/em\u003e, \u003cem\u003egeranylgeranyl diphosphate\u003c/em\u003e; \u003cem\u003eGGPS\u003c/em\u003e, \u003cem\u003eGGPP synthase\u003c/em\u003e; \u003cem\u003ePSY1\u003c/em\u003e, \u003cem\u003ephytoene synthase\u003c/em\u003e; \u003cem\u003ePDS\u003c/em\u003e, \u003cem\u003ephytoene desaturase\u003c/em\u003e; \u003cem\u003eZDS\u003c/em\u003e, \u003cem\u003eζ-carotene desaturase\u003c/em\u003e; \u003cem\u003eCRTISO\u003c/em\u003e, \u003cem\u003ecarotenoid isomerase\u003c/em\u003e; \u003cem\u003eLCY-B\u003c/em\u003e, \u003cem\u003elycopene β-cyclase\u003c/em\u003e; \u003cem\u003eLCY-E\u003c/em\u003e, \u003cem\u003elycopene ε-cyclase\u003c/em\u003e; \u003cem\u003eCHYB\u003c/em\u003e, \u003cem\u003eβ-ring hydroxylase\u003c/em\u003e; \u003cem\u003eCHYE\u003c/em\u003e, \u003cem\u003eε-ring hydroxylase\u003c/em\u003e; \u003cem\u003eVDE\u003c/em\u003e, \u003cem\u003eviolaxanthin deepoxidase\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6664304/v1/79218754b3d17b50a2961e5c.jpg"},{"id":101152118,"identity":"831edef6-a482-4ed9-bc58-d9736b803a98","added_by":"auto","created_at":"2026-01-26 16:10:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5570071,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6664304/v1/733c5ab4-ba01-4e14-87a9-6f12e5cded24.pdf"}],"financialInterests":"","formattedTitle":"Influence of LED light on seed germination, growth, and health-promoting compounds in red and green lettuce cultivars","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eLettuce (\u003cem\u003eLactuca sativa\u003c/em\u003e L.) is a widely consumed leafy vegetable that enjoys global popularity due to its distinct flavor, affordability, and impressive nutritional composition. Its importance extends beyond culinary use, as the seedling stage plays a pivotal role in determining the overall success of agricultural production. As highlighted by Min Shi et al. (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), cultivating robust and healthy seedlings is essential to unlocking the full yield potential and ensuring a productive crop cycle. This is particularly critical for lettuce, as its rapid growth and short cultivation period make it an ideal candidate for studying the interactions between plants and light, a key environmental factor that significantly influences plant growth and development (Carotti et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Jaya et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Despite the importance of light in lettuce growth, there remains a dearth of research exploring the effects of various light spectra on lettuce seedling germination and development, and how these factors subsequently affect key agrophysiological traits and the yield of mature plants (Kim et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Hern\u0026aacute;ndez Adasme et al. 2022).\u003c/p\u003e \u003cp\u003eIn controlled agricultural environments, light supplementation is crucial for promoting optimal vegetable growth and maturation. As a primary environmental factor, light not only provides the energy required for photosynthesis but also triggers numerous essential physiological processes in plants (Lauria et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Light can be categorized into three primary parameters: intensity (measured in \u0026micro;mol m⁻\u0026sup2; s⁻\u0026sup1;), photoperiod (the duration of light and dark cycles), and spectrum (the range of wavelengths in nanometers). These parameters influence plant growth and development in distinct ways (Flores et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Light-emitting diodes (LEDs) have emerged as a preferred lighting solution in indoor farming systems, owing to their energy efficiency, long lifespan, and reduced environmental impact when compared to traditional lighting systems. Moreover, LEDs offer precise control over light spectra, enabling optimal energy management and significantly enhancing both plant productivity and quality (Olajiga et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The spectral distribution of LED light plays a critical role in plant physiology and morphology, as different wavelengths of light evoke specific responses in plants (Flores et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNumerous studies have explored the effects of light spectra on lettuce seed germination. For instance, red (R) light has been shown to promote germination in certain lettuce genotypes (Hern\u0026aacute;ndez Adasme et al. 2022). Furthermore, research has focused on the influence of LED lighting on various physiological aspects of lettuce, including biomass accumulation, morphological changes, and pigment composition (Brazaitytė et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Toscano et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Demir et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). During the seedling stage, blue (B) light is generally considered beneficial, while R light proves to be more effective in enhancing vegetative growth after transplanting (Flores et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). A study by Kang et al. (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) found that combination of red-blue (RB) lighting improved various morphological parameters and photosynthetic pigment levels in cucumber seedlings, with B light enhancing chlorophyll (Chl) content and promoting higher rates of photosynthesis (PS). To fully understand plant physiology and optimize both yield and the production of functional compounds, it is essential to analyze the effects of each lighting parameter, including light intensity, spectrum, and photoperiod, in isolation. Among these parameters, spectrum and intensity are particularly influential in determining vegetable quality, with B and R lights ranges being particularly effective in stimulating PS (Brazaitytė et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Rahman et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRecent studies have shown that B light significantly influences the production of phenolic compounds (PCs) and flavonoids (FLs). For instance, B light has been found to enhance the accumulation of PCs such as chlorogenic acid, caffeic acid, and quercetin in \u003cem\u003eNasturtium officinale\u003c/em\u003e (Klimek-Szczykutowicz et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Similarly, B light promotes the biosynthesis of FLs in \u003cem\u003eHedyotis corymbose\u003c/em\u003e (Le et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and \u003cem\u003eScutellaria baicalensis\u003c/em\u003e (Ma et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). However, B light plays a critical role in promoting fresh weight and hypocotyl elongation in microgreens such as mustard and kale (Brazaitytė et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Additionally, B light increases the accumulation of anthocyanins (ANTs) and carotenoids (CARs), both of which are vital compounds in plants. In contrast, R light primarily contributes to the enhancement of biomass production and cotyledon growth in various microgreen species (Brazaitytė et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Flores et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). For mature lettuce, a combination of RB light proves to be the most effective for boosting both fresh and dry weight. R light, in particular, has been found to exert the most significant effects on green and red lettuce cultivars (Naznin et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Hern\u0026aacute;ndez Adasme et al. 2022).\u003c/p\u003e \u003cp\u003eANTs, which are potent antioxidants, play an important role in enhancing a plant's resistance to stress and also offer potential health benefits, including cancer prevention and cardiovascular protection (Kowalczyk et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The biosynthesis of ANTs is tightly regulated by light wavelengths, with B light being a key trigger for the expression of ANTs-related genes in certain fruits, such as grapes (Zhang et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Similarly, CARs accumulation is governed by the regulation of gene expression in both the biosynthesis and degradation pathways, which ultimately enhances the nutritional value of crops (Sun et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThis study seeks to provide a comprehensive understanding of how various LED light wavelengths impact both the morphological development and biochemical composition of lettuce. By examining these effects alongside the accumulation of key metabolites such as ANTs, CARs, FLs, and PCs, we aim to uncover valuable insights that can help optimize LED lighting systems for improved plant growth, yield, and quality in controlled agricultural environments. Additionally, the use of both red and green lettuce cultivars in this study allows us to explore cultivar-specific responses to different light wavelengths, providing a deeper understanding of how these lighting conditions may vary across different lettuce types. Ultimately, this research seeks to offer practical guidance for tailoring lighting strategies to enhance the growth and nutritional quality of lettuce, based on the specific needs of different cultivars.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\n\u003ch3\u003e2. 1 Experimental conditions for lettuce seed germination\u003c/h3\u003e\n\u003cp\u003eTwo lettuce cultivars, green (Cheong Chi Ma) and red (Jeok Chi Ma), were germinated in petri dishes containing water-soaked paper, with 50 seeds per cultivar. The dishes were placed in a growth chamber set at 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, 50\u0026thinsp;\u0026plusmn;\u0026thinsp;5% relative humidity, and exposed to different LED light treatments: 100% B, 100% R, 100% white (W), a 1:1 combination of RB, natural light (N), and darkness (D). Germination was considered successful when the seeds produced a radicle of at least 3 mm in length, in accordance with the guidelines of the International Seed Testing Association (ISTA 1999).\u003c/p\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Measurement of seed germination-related traits\u003c/h2\u003e \u003cp\u003eGermination percentage (GP) were determined using the following formula:\u003c/p\u003e \u003cp\u003e \u003cem\u003eGP = (N/Nt) \u0026times; 100\u003c/em\u003e (1)\u003c/p\u003e \u003cp\u003eWhere \u0026lsquo;\u003cem\u003eN\u003c/em\u003e\u0026rsquo; is the number of seeds germinated per day, and '\u003cem\u003eNt\u003c/em\u003e' is the total number of seeds sown.\u003c/p\u003e \u003cp\u003eCoefficient of the velocity of germination (CVG) was used to assess how quickly maximum germination was achieved, calculated using:\u003c/p\u003e \u003cp\u003e \u003cem\u003eCVG\u0026thinsp;=\u0026thinsp;Σ (Ni \u0026middot; Di)/Σ Ni\u003c/em\u003e (2)\u003c/p\u003e \u003cp\u003eWhere '\u003cem\u003eNi\u003c/em\u003e' is the number of seeds germinated on day '\u003cem\u003ei\u003c/em\u003e' and '\u003cem\u003eDi\u003c/em\u003e' is the time in days.\u003c/p\u003e \u003cp\u003eThe velocity of germination (VG) measured the daily seed germination rate:\u003c/p\u003e \u003cp\u003e \u003cem\u003eVG\u0026thinsp;=\u0026thinsp;Σ (Ni)/Σt\u003c/em\u003e (3)\u003c/p\u003e \u003cp\u003eWhere '\u003cem\u003eNi\u003c/em\u003e' is the number of seeds germinated on day '\u003cem\u003ei\u003c/em\u003e' and '\u003cem\u003et\u003c/em\u003e' is the germination time from sowing to the final germination.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Cultivation conditions for lettuce growing\u003c/h2\u003e \u003cp\u003eTwo lettuce cultivars were first germinated in 50-cell seedling trays filled with a peat-perlite mix (3:1 ratio) and transferred to pots after 20 days of germination. The seedlings were then placed in a growth chamber (Hanil, Seoul, Korea) and exposed to different LED light wavelengths (Lumenlux, Seoul, Korea). The light treatments included natural light (N), white light (W), B, R, and a 1:1 combination of RB for 9 days. The growth chamber maintained a 16-h photoperiod, a CO\u003csub\u003e2\u003c/sub\u003e concentration of 1000\u0026thinsp;\u0026plusmn;\u0026thinsp;300 \u0026micro;mol mol⁻\u0026sup1;, and a temperature of 23\u0026thinsp;\u0026plusmn;\u0026thinsp;3\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Shoot and root measurements\u003c/h2\u003e \u003cp\u003eThe seedlings were gently removed from the pots, and the shoot fresh weight (SFW) was accurately measured using an Ohaus PAG214C scale (Parsippany, NJ, USA). The roots were cleaned, and the root fresh weight (RFW) was similarly measured.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Measurement of ANTs, FLs, PCs, and pigments\u003c/h2\u003e \u003cp\u003eThe collected seedlings were ground in liquid nitrogen for analysis. ANTs content was determined using 100 mg of lettuce powder in 1 mL of 70% ethanol, sonicated for 1 hour, and incubated at 55\u0026deg;C for 16 h. PCs and FLs were extracted with 80% methanol. Photosynthetic pigments (Chl, CARs and ANTs) were extracted with 80% acetone. PCs was determined using the Folin-Ciocalteu method (Zhou et al. \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), with gallic acid (Sigma-Aldrich, St. Louis, MO, USA) as the standard. Absorbance was measured at 760 nm using a UV/Vis spectrophotometer (Biochrom-Libra S22, UK), and results were expressed as \u0026micro;g of gallic acid equivalent (GAE) per gram of dry weight (\u0026micro;g GAE/g DW). A calibration curve was constructed with gallic acid concentrations ranging from 7 to 250 \u0026micro;g/mL. FLs was assessed using a colorimetric method (Willet 2002). Absorbance was recorded at 415 nm using a UV/Vis spectrophotometer, and results were expressed as \u0026micro;g of quercetin equivalent (QUE) per gram of dry weight (\u0026micro;g QUE/g DW). The quercetin calibration curve ranged from 2 to 100 \u0026micro;g/mL. Photosynthetic pigments, including chlorophyll a (Chl a), chlorophyll b (Chl b), and CARs, were quantified based on absorbance readings at 663 nm, 645 nm, and 470 nm, respectively, using the equations (\u003cspan refid=\"Equ1\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Equ3\" class=\"InternalRef\"\u003e6\u003c/span\u003e) of Lichtenthaler and Welburn (1983).\u003cdiv id=\"Equ1\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equ1\" name=\"EquationSource\"\u003e\n$$\\:\\:\\:\\:\\text{C}\\text{h}\\text{l}\\:\\text{a}=\\left(12.21\\:\\times\\:A663\\right)-(2.81\\:\\times\\:A645)$$\u003c/div\u003e\u003cdiv class=\"EquationNumber\"\u003e4\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Equ2\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equ2\" name=\"EquationSource\"\u003e\n$$\\:\\:\\:\\:\\text{C}\\text{h}\\text{l}\\:\\text{b}=\\left(20.13\\:\\times\\:A645\\right)-(5.03\\:\\times\\:A663)$$\u003c/div\u003e\u003cdiv class=\"EquationNumber\"\u003e5\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Equ3\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equ3\" name=\"EquationSource\"\u003e\n$$\\:\\:\\:\\:\\text{C}\\text{A}\\text{R}\\text{s}=\\frac{[\\left(1000\\:\\times\\:A470\\right)-\\left(3.27\\:\\times\\:\\:Chl\\:a\\right)-\\left(104\\:\\times\\:\\:Chl\\:b\\right)]}{227}$$\u003c/div\u003e\u003cdiv class=\"EquationNumber\"\u003e6\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eWhere A represents the optical absorption at various wavelengths (λ\u0026thinsp;=\u0026thinsp;663, 645, and 470).\u003c/p\u003e \u003cp\u003eANTs was determined using the pH differential method (Lee et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), with absorbance measured at 520 nm and 700 nm. The concentrations were expressed as mg cyanidin-3-glucoside equivalent (C3G) per gram dry weight (mg C3G/g DW) and calculated using Eq.\u0026nbsp;(7).\u003c/p\u003e \u003cp\u003eANTs =\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\:\\frac{\\text{A}\\:\\times\\:\\:\\text{M}\\text{W}\\:\\times\\:\\:\\text{D}\\text{F}\\:\\times\\:\\:{10}^{3}\\:}{\\epsilon\\:\\:\\times\\:\\:l\\:\\times\\:\\:\\text{W}}\\:\\)\u003c/span\u003e\u003c/span\u003e (7)\u003c/p\u003e \u003cp\u003eWhere A = (A\u003csub\u003e520nm\u003c/sub\u003e \u0026ndash; A\u003csub\u003e700nm\u003c/sub\u003e) pH 1.0 \u0026ndash; (A\u003csub\u003e520nm\u003c/sub\u003e \u0026ndash; A\u003csub\u003e700nm\u003c/sub\u003e) pH 4.5; MW (molecular weight)\u0026thinsp;=\u0026thinsp;449.2 g/mol for cyanidin-3-glucoside (cyd-3-glu); DF\u0026thinsp;=\u0026thinsp;dilution factor; 103\u0026thinsp;=\u0026thinsp;factor for conversion from g to mg; ε\u0026thinsp;=\u0026thinsp;26,900 M extinction coefficient in L/mol cm for cyd-3-glu; l\u0026thinsp;=\u0026thinsp;path length in cm, and W\u0026thinsp;=\u0026thinsp;sample weight (mg).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Identification of genes involved in ANTs and CARs biosynthesis in lettuce\u003c/h2\u003e \u003cp\u003eHomologous genes in lettuce were identified through tBLASTn searches using query sequences from known proteins involved in ANTs and CARs biosynthesis in chrysanthemum (\u003cem\u003eChrysanthemum indicum\u003c/em\u003e), apple (Malus domestica), and Arabidopsis, utilizing the lettuce genome project (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://lgr.genomecenter.ucdavis.edu/Links.php\u003c/span\u003e\u003cspan address=\"https://lgr.genomecenter.ucdavis.edu/Links.php\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). This study focuses on five genes involved in ANTs biosynthesis; \u003cem\u003echalcone synthase\u003c/em\u003e (\u003cem\u003eCHS\u003c/em\u003e), \u003cem\u003eflavonoid 3-hydroxylase\u003c/em\u003e (\u003cem\u003eF3H\u003c/em\u003e), \u003cem\u003edihydroflavonol 4-reductase\u003c/em\u003e (\u003cem\u003eDFR\u003c/em\u003e), \u003cem\u003eanthocyanidin synthase\u003c/em\u003e (\u003cem\u003eANS\u003c/em\u003e), and \u003cem\u003eUDP-glucose: flavonoid 3-O-glucosyltransferase\u003c/em\u003e (\u003cem\u003eUFGT\u003c/em\u003e). Additionally, six genes involved in CARs biosynthesis were included; \u003cem\u003e1-deoxy-D-xylulose-5-phosphate synthase\u003c/em\u003e (\u003cem\u003eDXS\u003c/em\u003e), \u003cem\u003e1-deoxy-D-xylulose-5-phosphate reductoisomerase\u003c/em\u003e (\u003cem\u003eDXR\u003c/em\u003e), \u003cem\u003ephytoene synthase 1\u003c/em\u003e (\u003cem\u003ePSY1\u003c/em\u003e), \u003cem\u003eζ-carotene desaturase\u003c/em\u003e (\u003cem\u003eZDS\u003c/em\u003e), \u003cem\u003ecarotenoid isomerase\u003c/em\u003e (\u003cem\u003eCRTISO\u003c/em\u003e), \u003cem\u003eand violaxanthin de-epoxidase\u003c/em\u003e (\u003cem\u003eVDE\u003c/em\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Expression analysis of the genes in the biosynthesis of ANTs and CARs\u003c/h2\u003e \u003cp\u003eTo examine the expression levels of these genes, leaf samples were collected from lettuce plants at two time points: 3 and 9 days after the application of W, R, B, and a RB combination, with N light serving as the control. For each plant, three leaves were harvested to ensure a representative sample, and the collected samples were immediately flash-frozen in liquid nitrogen to preserve the RNA integrity. Total RNA was extracted from the frozen leaf samples using the RiboEx Total RNA kit (GeneAll, Seoul, South Korea), which is designed for efficient RNA extraction. Following RNA extraction, complementary DNA (cDNA) synthesis was performed using 2.5 \u0026micro;g of total RNA and the SuperiorScript III Master Mix (Enzynomics, Seoul, South Korea). Gene expression was evaluated using quantitative real-time PCR (qRT-PCR) with specifically designed primers. A total of twelve forward and reverse primer pairs, including \u003cem\u003eActin\u003c/em\u003e (\u003cem\u003eACT\u003c/em\u003e) as the control gene, were used for the analysis (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The experiment was performed in triplicate to ensure accuracy and reproducibility, minimizing errors and increasing the reliability of the results.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe specific primer sets of the studied anthocyanin and carotenoids biosynthesis pathway genes used for real-time PCR analysis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePathway\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProduct length\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePrimer sequence (5' \u0026minus;\u0026thinsp;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"11\" rowspan=\"12\"\u003e \u003cp\u003eAnthocyanin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eACT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAB359898\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e113 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsACT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTGGTAGGTATGGGCCAGAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGTCATCCCAGTTGCTCACAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCHS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAB525909\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e169 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsCHS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGGAGGTGGGGCTAACTTTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGAGCTCCACCTGGTCCAATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eF3H\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAB525910\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e210 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsF3H\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCTACTCAAGGTGGCCCGATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAATGTGAGATCGGGTTGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eDFR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCV700105\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e105 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsDFR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGGGAATGAGGGAGTGATGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eATTGGCAGAAAAAGCAGCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eANS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAB525912\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e117 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsANS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCTCCCCACCATCGACTTAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eATGGTTGACGAGATGCATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eUFGT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAB525911\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e203 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsUFGT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAAGAGACCAGAACCCCGTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAGCTCCAATGCTCTCCGATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"11\" rowspan=\"12\"\u003e \u003cp\u003eCarotenoids\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eDXS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAB205044\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e149 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsDXS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCGCCATTGATGACAGACCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGCCCTTCCAGCATTATTCGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eDXR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAB205045\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e192 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsDXR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAGAAACGAATCTTTGGTTGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTCACACAATCAGGATGACGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePSY1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDY974614\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e168 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsPSY1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eACGACATCGTACACCATCTGCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTTCCAGGGTTGTGGTGGCTAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eZDS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDY960874\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e155 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsZDS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eATCCACCTCATGCCCTTGATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTATCATAGGTGCTGGCCTTGCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCRTISO\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAB205043\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e173 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsCRTISO\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eATCTGTGATGTTGCGATTCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eACGGTGGTTGGATCGGGTATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eVDE\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAB205051\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e184 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLsVDE\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eACTCGCAACAATCGTCCTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGGGCACACATTTCTTTCGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Statistical analysis\u003c/h2\u003e \u003cp\u003eVariance homogeneity was tested using the Levene test in R version 4.2.2 (R Core Team 2022), and data normality was assessed using the Kolmogorov-Smirnov test in SAS Ver. 9.4 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.sas.com/\u003c/span\u003e\u003cspan address=\"https://www.sas.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Analysis of variance (ANOVA) was performed using SAS's GLM procedure, with post hoc testing via the least significant difference (LSD) method (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Figures were generated using GraphPad Prism Ver. 9.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.graphpad.com/\u003c/span\u003e\u003cspan address=\"https://www.graphpad.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.1 The effect of LED wavelengths on lettuce seed germination\u003c/h2\u003e \u003cp\u003eThe GP, CVG, and VG for two lettuce cultivars, Red (Jeok Chi Ma) and Green (Cheong Chi Ma), were assessed under different LED light treatments, as presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eValues of germination (GP), coefficient of the velocity of germination (CVG), and velocity of germination (VG) of two lettuce cultivars seeds under different light treatments \u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLED color\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGP (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCVG (days)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eVG (N\u0026deg; seeds/days)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003eRed\u003c/p\u003e \u003cp\u003e(Jeok Chi Ma)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.8 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.8 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003eGreen\u003c/p\u003e \u003cp\u003e(Cheong Chi Ma)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e23.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.7 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e47.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.4 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e45\u0026thinsp;\u0026plusmn;\u0026thinsp;4.0 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e22.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.8 \u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e23.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\u003cp\u003eD: darkness as control, N: natural light, W: 100% white, R: 100% red, B: 100% blue, RB: combination of red and blue; The values presented as mean values\u0026thinsp;\u0026plusmn;\u0026thinsp;SD derived from three replicates. Different letters indicate a significant difference between samples (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003eFor the red cultivar, the highest GP (100%) was observed under the combination of RB light, followed by treatments D, R, and B, all of which had a GP of 90%, whereas the lowest GP (80%) was recorded under N and W light. The highest CVG (1.5 days) occurred under W light, while the lowest (1.1 days) was under B light. The VG showed significant differences, with the fastest germination (22 seeds/days) under N and B light, while the slowest (13.4 seeds/days) was observed under W light.\u003c/p\u003e \u003cp\u003eIn the green cultivar, the GP remained consistently high (96%) under most light treatments (D, N, W, B, RB), except under R light, which had a slightly lower GP of 90%. The highest CVG (1.4 days) was seen with B light, while the lowest (1 day) was recorded under N light. The VG varied significantly, with the fastest germination rate (47.5 seeds/days) under N light and the slowest (15.9 seeds/days) under B light.\u003c/p\u003e \u003cp\u003eOverall, the RB light produced the highest GP in the red cultivar, while N light enhanced the VG in the green cultivar. Different light wavelengths significantly affected the germination rates and velocities in both lettuce cultivars (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.2 The effect of LED treatment on lettuce growth\u003c/h2\u003e \u003cp\u003eThe biomass, including SFW, and root morphology, RFW, RL, and RV of green and red lettuce seedlings, are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The SFW of the seedlings was notably affected by the light treatments over time. Compared to N light (control), both cultivars showed significant increases in SFW under LED light. R light had the most pronounced effect on the biomass of both cultivars, followed by the combination of RB light, which also performed well. The RFW of the seedlings was similarly influenced by the LED light treatments. B light had the greatest impact on root weight in both cultivars, followed by W light, which also had a noticeable effect. The least root development was observed under N light conditions. Regarding RL, R light had the strongest effect on both cultivars, followed by W light, which also significantly impacted RL in the lettuce plants. B and W light treatments significantly influenced RV, with N light showing the least effect.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Effect of LED treatments on PCs content in lettuce\u003c/h2\u003e \u003cp\u003eThe PCs content in lettuce was significantly influenced by both light treatments and cultivars (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), with an increase observed in both cultivars (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The order of PCs content in the leaves was as follows: B\u0026thinsp;\u0026gt;\u0026thinsp;RB\u0026thinsp;\u0026gt;\u0026thinsp;W\u0026thinsp;\u0026gt;\u0026thinsp;R\u0026thinsp;\u0026gt;\u0026thinsp;N. Specifically, the highest PCs content was observed under B light, followed by a RB light, with N light resulting in the lowest content (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B). The red cultivar showed the highest PCs content across all LED light treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Compared to the control, the PCs content in red lettuce increased significantly under B (2.22%), RB (2.04%), W (1.73%), and R (1.51%) light treatments, relative to N light (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Similarly, in green lettuce, the PCs content increased with B (3.77%), RB (1.98%), W (1.83%), and R (1.40%) light treatments, compared to N light (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Effect of LED treatments on FLs content in lettuce\u003c/h2\u003e \u003cp\u003eFLs contents in lettuce was significantly influenced by both light treatments and cultivars (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). FLs content increased steadily in both cultivars (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-D). The FLs content ranking across the light treatments was as follows: B\u0026thinsp;\u0026gt;\u0026thinsp;W\u0026thinsp;\u0026gt;\u0026thinsp;RB\u0026thinsp;\u0026gt;\u0026thinsp;R\u0026thinsp;\u0026gt;\u0026thinsp;N, with B light resulting in the highest FLs content and N light the lowest. Notably, the red cultivar consistently showed higher FLs content under all LED treatments compared to the green cultivar (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). When compared to the N light control, FLs content in red lettuce increased significantly under B (1.53%), W (1.31%), RB (1.16%), and R (1.05%) light treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Similarly, green lettuce displayed a significant increase in FLs content under B (1.71%), W (1.27%), RB (1.14%), and R (1.03%) light treatments relative to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Effect of LED treatments on pigment content in lettuce\u003c/h2\u003e \u003cp\u003eAll pigment contents in the lettuce samples, including ANTs, Chl a, Chl b, and CARs, were significantly influenced by both light treatments and cultivars (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating that the environmental conditions (specifically the type of light) and genetic factors (the cultivar type) both play crucial roles in pigment production.\u003c/p\u003e \u003cp\u003eThere was a noticeable progressive increase in ANTs content in both the red and green lettuce cultivars, with a more pronounced increase observed under the different LED light treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). The ranking of ANTs content across the light treatments was as follows: B\u0026thinsp;\u0026gt;\u0026thinsp;W\u0026thinsp;\u0026gt;\u0026thinsp;RB\u0026thinsp;\u0026gt;\u0026thinsp;R\u0026thinsp;\u0026gt;\u0026thinsp;N, with B light treatment inducing the highest ANTs content and N light resulting in the lowest. This suggests that B light is particularly effective in stimulating the production of ANTs.\u003c/p\u003e \u003cp\u003eInterestingly, the red cultivar consistently exhibited higher ANTs content compared to the green cultivar across all light treatments. This could be attributed to the genetic characteristics of the red cultivar, which might be more predisposed to produce higher levels of ANTs. For both cultivars, the ANTs content increased significantly under B light (3.20% in red and 3.27% in green) compared to the N light control, demonstrating the strong influence of B light on ANTs production. W light also significantly boosted ANTs content in both cultivars, followed by the combination of RB light, with R light being less effective.\u003c/p\u003e \u003cp\u003eThe levels of Chl a and Chl b progressivel increased in both cultivars under LED treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-F), indicating enhanced photosynthetic activity under the various LED light treatments. The Chl content ranking across the light treatments was B\u0026thinsp;\u0026gt;\u0026thinsp;W\u0026thinsp;\u0026gt;\u0026thinsp;RB\u0026thinsp;\u0026gt;\u0026thinsp;R\u0026thinsp;\u0026gt;\u0026thinsp;N, with B light promoting the highest Chl levels and N light resulting in the lowest. This trend suggests that B light is not only crucial for stimulating ANTs production but also plays an essential role in promoting Chl synthesis, which is vital for PS and overall plant growth.\u003c/p\u003e \u003cp\u003eNotably, the green cultivar consistently exhibited higher Chl content under all LED treatments compared to the red cultivar. This may reflect the N characteristics of green-leafed plants, which often have a higher Chl concentration to optimize light absorption for PS. In both cultivars, Chl a and Chl b content significantly increased under B light compared to the N light control, with increases in Chl a ranging from 1.55% in red to 1.48% in green lettuce, and Chl b increases ranging from 1.78% in red to 1.37% in green lettuce. W light also significantly enhanced both Chl types in both cultivars.\u003c/p\u003e \u003cp\u003eThe CARs content in both cultivars increased progressively, with the following ranking across light treatments: R\u0026thinsp;\u0026gt;\u0026thinsp;N\u0026thinsp;\u0026gt;\u0026thinsp;RB\u0026thinsp;\u0026gt;\u0026thinsp;W\u0026thinsp;\u0026gt;\u0026thinsp;B (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG, H). R light, in particular, induced the highest CARs content, whereas B light resulted in the lowest CARs content. As with the other pigments, the red cultivar consistently exhibited higher CARs content across all LED treatments compared to the green cultivar. This could be due to the higher levels of CARs typically found in red-leaved plants. For both cultivars, CARs content significantly increased under R light, with the highest increase observed in green lettuce (1.36%) and the lowest in red lettuce under B light (0.74%). RB light and W light also increased CARs content, but to a lesser extent.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Impact of LED treatments on gene expression in ANTs and CARs biosynthesis in lettuce\u003c/h2\u003e \u003cp\u003eTo evaluate the impact of LED treatments on the expression of key enzymes involved in the biosynthesis of ANTs and CARs, we analyzed the mRNA levels of relevant genes in lettuce leaves at 3 and 9 days after treatment.\u003c/p\u003e \u003cp\u003eOur findings revealed a significant positive correlation between B light exposure and the expression of all five genes associated with ANTs biosynthesis\u0026mdash;\u003cem\u003eCHS\u003c/em\u003e, \u003cem\u003eDFR\u003c/em\u003e, \u003cem\u003eUFGT\u003c/em\u003e, \u003cem\u003eF3H\u003c/em\u003e, and \u003cem\u003eANS\u003c/em\u003e. Under B light irradiation, there were substantial increases in the expression levels of these genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Notably, we observed cultivar-specific differences in gene responses to B light. In the green lettuce cultivar, the genes \u003cem\u003eCHS\u003c/em\u003e, \u003cem\u003eDFR\u003c/em\u003e, and \u003cem\u003eUFGT\u003c/em\u003e exhibited the most pronounced upregulation under B light, while in the red cultivar, the genes \u003cem\u003eF3H\u003c/em\u003e and \u003cem\u003eANS\u003c/em\u003e showed the highest expression levels under the same conditions. In terms of gene expression levels, B light treatment led to the highest expression, followed by W and RB treatments, while R and N light treatments resulted in the lowest expression levels of these genes, consistent with the accumulation of ANTs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B).\u003c/p\u003e \u003cp\u003eWe also assessed the expression of six genes involved in the CARs biosynthetic pathway\u0026mdash;\u003cem\u003eDXS\u003c/em\u003e, \u003cem\u003eDXR\u003c/em\u003e, \u003cem\u003ePSY1\u003c/em\u003e, \u003cem\u003eZDS\u003c/em\u003e, \u003cem\u003eCRTISO\u003c/em\u003e, and \u003cem\u003eVDE\u003c/em\u003e. The results demonstrated that all six genes exhibited a significant positive correlation with R light exposure, with marked increases in their expression levels under R light irradiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Similar to the ANTs biosynthetic genes, cultivar-specific differences were observed in the response of these genes to R light. In the red lettuce cultivar, the genes \u003cem\u003eDXR\u003c/em\u003e, \u003cem\u003ePSY1\u003c/em\u003e, CRTISO, and VDE showed the strongest correlation with R light, with substantial increases in their expression levels under this treatment. Conversely, the genes \u003cem\u003eDXS\u003c/em\u003e and \u003cem\u003eZDS\u003c/em\u003e showed distinct expression patterns in response to R light, with variations depending on the duration of exposure and cultivar. Following R light, the expression of these genes was ranked in the order: N light, RB combination, W light, and B light, which closely mirrored the accumulation of CARs under different light treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG, H).\u003c/p\u003e \u003cp\u003eOverall, our results highlight how LED light treatments influence the expression of key biosynthetic genes in lettuce, with light wavelength, cultivar, and gene-specific responses playing a crucial role in the modulation of ANTs and CARs production.\u003c/p\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e4.1 The effect of LED wavelengths on lettuce seed germination\u003c/h2\u003e \u003cp\u003eLettuce is highly sensitive to light, with seed germination significantly influenced by both the presence and quality of light exposure (Hwang et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). While R light is typically reported to promote germination, and far-R light to inhibit it (Carpita and Nabors \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1976\u003c/span\u003e), recent studies, such as Lim et al. (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), have confirmed the inhibitory effect of far-R light on germination. However, some research challenges this view. Hern\u0026aacute;ndez Adasme et al. (2022) found that B light stimulated germination, while R light suppressed it, suggesting that light\u0026rsquo;s effects on germination are more complex.\u003c/p\u003e \u003cp\u003eIn our study, the combination of RB light enhanced germination only in the red cultivar, indicating a cultivar-specific response. W and B light also had different effects depending on the cultivar; W light significantly boosted germination in the red cultivar, while B light was more effective in the green cultivar. Additionally, VG increased under N and B lights in the red cultivar, and under N light alone in the green cultivar. These results highlight the complexity of light\u0026rsquo;s role in germination.\u003c/p\u003e \u003cp\u003eOur findings emphasize that lettuce germination responses to light wavelengths vary by cultivar, supporting similar observations by Frąszczak and Kula-Maximenko (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and Lozano-Castellanos et al. (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), who noted cultivar-specific responses to light. Hern\u0026aacute;ndez Adasme et al. (2022) and Liu et al. (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) also found that red and green cultivars exhibit different light sensitivities during germination, suggesting a genetic basis for these variations.\u003c/p\u003e \u003cp\u003eIn conclusion, our study demonstrates that light effects on lettuce seed germination are highly cultivar-specific. Tailoring light conditions to specific cultivars can enhance germination rates, offering valuable insights for optimizing lettuce production in controlled environments. Further research into the genetic mechanisms underlying these differential responses could improve germination protocols for various lettuce cultivars.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e4.2 The effect of LED treatment on lettuce growth\u003c/h2\u003e \u003cp\u003eThis study demonstrated that LED light treatments, in combination with lettuce cultivar type, significantly influenced SFW. Both red and green lettuce cultivars showed the highest SFW under R, followed by RB combination, W, B, and N light (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B). Unlike the germination response, where light effects varied by cultivar, the increase in SFW under R light was consistent across both cultivars, supporting previous findings. Bi et al. (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) reported that R light promoted lettuce growth, while Battistoni et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) observed similar effects in spinach. Additionally, Ju et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) found that R light favored leaf cell expansion, promoting shoot elongation and hypocotyl growth in lettuce.\u003c/p\u003e \u003cp\u003eThe combination RB light also enhanced SFW, though to a lesser extent than R light alone. Several studies have shown that RB light combinations regulate stomatal conductance and improve photosynthetic efficiency, leading to increased biomass in crops like cucumber and tomato (Ouzounis et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). This synergy between R and B light impacts stomatal behavior, contributing to the enhanced SFW observed under R and combination of RB light. In contrast, B light inhibits hypocotyl elongation in lettuce and soybean seedlings, resulting in decreased SFW, which aligns with our observations (Vaštakaitė-Kairienė et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Lim et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRoot growth responses to light wavelengths showed distinct patterns, with B light producing the most significant increase in RFW, followed by W, RB, R, and N light (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D). A similar trend was observed for RV, although W light led to greater RV than B light. For RL, R light produced the longest roots, followed by W, RB, B, and N light. These findings suggest that RFW influenced RV more than RL. Light wavelength effects on RFW, RL, and RV were consistent across different lettuce cultivars.\u003c/p\u003e \u003cp\u003eRoots, like shoots, contain photoreceptors that sense light (Mo et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). R light activates phytochrome B (PhyB) and PhyA in roots, promoting gibberellic acid (GA)-induced root elongation, a phenomenon observed in our study (Kiss et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Ramon et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Mutations in PhyB result in reduced root growth and lateral root formation under light exposure (Silva-Navas et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). R light also modulates hormones like auxins and increases PS, providing energy for root development (Spaninks et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eConversely, B light shortens roots and reduces lateral root formation compared to dark-grown roots (Moni et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Silva-Navas et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). B and W light also induce negative phototropism in roots, mediated by phototropin family photoreceptors, while R light induces positive phototropism in Arabidopsis roots (Kiss et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Double mutants for B-light photoreceptors (cry1/cry2 and phot1/phot2) show increased root growth and lateral root numbers in response to light. These findings help explain our results (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, F, G, H).\u003c/p\u003e \u003cp\u003eKiss et al. (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2003\u003c/span\u003e) found that B light overrides R light\u0026rsquo;s effects on phototropism, mediated by PhyA and PhyB. However, our results suggest that the RB light combination produces effects similar to those of R and B light exposures individually, particularly for RV and RL. In terms of RFW, the RB combination produces intermediate effects compared to R and B light individually. These results indicate that root growth and development are differentially regulated by specific wavelengths and their combinations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e4.3 Effect of LED treatments on PCs and FLs content in lettuce\u003c/h2\u003e \u003cp\u003eResearch consistently demonstrates that light exposure plays a crucial role in promoting the production of secondary metabolites such as ANTs, polyamines, polyphenols, and phenylpropanoids (Shin et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Szopa et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kubica et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Arias et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Thongtip et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Klimek-Szczykutowicz et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Park et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Our study further underscores that light wavelengths, particularly B light, significantly influence the accumulation of these compounds. Specifically, B light was most effective in enhancing the accumulation of PCs and FLs, surpassing the effects of other light wavelengths (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B, C, D). Both red and green lettuce cultivars showed increased PCs under B light, although the intensity of this effect varied, with the red cultivar displaying a greater response. For FLs, the accumulation under B light was similar for both cultivars, with comparable increases. However, the combination of RB light had an effect on FLs similar to R light alone, differing from the response observed with PCs.\u003c/p\u003e \u003cp\u003eThese findings align with previous research showing that B light enhances the accumulation of PCs and FLs in various species, including lentil, basil, strawberry, tea plants, and hairy root cultures of \u003cem\u003eAstragalus membranaceus\u003c/em\u003e (Wang et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Gai et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Malekzadeh et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Park et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Thongtip et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). This growing body of evidence emphasizes the importance of B light in modulating secondary metabolite biosynthesis, offering valuable insights for optimizing growth conditions in controlled environments.\u003c/p\u003e \u003cp\u003eHowever, other studies have reported conflicting results regarding the influence of light on secondary metabolite production. For instance, Aris et al. (2016) found that cell suspension cultures of \u003cem\u003eThevetia peruviana\u003c/em\u003e grown in darkness had higher phenolic content and antioxidant capacity compared to those grown under light. Additionally, W light has been shown to promote greater production of PCs and FLs than other wavelengths, including R, B, green, and yellow, in various experimental models such as callus cultures of \u003cem\u003eLepidium sativum\u003c/em\u003e, shoot cultures of \u003cem\u003eMoringa oleifera\u003c/em\u003e, and callus cultures of \u003cem\u003eOcimum basilicum\u003c/em\u003e (Nadeem and Ahmad \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ullah et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These contrasting findings suggest that the effects of light on secondary metabolite production are complex, influenced by plant species, tissue type, and experimental conditions. Further research is necessary to better understand the relationship between light quality and plant metabolic responses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e4.4 Effect of LED treatments on pigment content in lettuce\u003c/h2\u003e \u003cp\u003eThe photosynthetically active radiation (PAR) spectrum plays a crucial role in Chl biosynthesis, which is essential for plant growth and photosynthetic efficiency. In this study, we observed that both lettuce cultivars exhibited significantly higher levels of Chl a and Chl b when grown under B light, compared to R and N light (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, D, E, F). These results align with previous studies on lettuce (Hern\u0026aacute;ndez Adasme et al. 2022) and cucumbers (Wang et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), which showed that B light enhances Chl production. B light stimulates the production of enzymes involved in Chl biosynthesis (Biswal et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), and Chl b, which absorbs B and purple wavelengths, is integral to the light-harvesting complex. Seedlings exposed to B light showed improved light absorption efficiency due to increased light-harvesting complexes per reaction center (Cammarisano et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In contrast, R and N light led to the lowest Chl values, highlighting the need for a balanced light spectrum to optimize Chl production.\u003c/p\u003e \u003cp\u003eR light has been associated with reduced Chl content in plants such as lettuce, basil, and spinach (Naznin et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). This study also found that seedlings grown under R light had significantly lower Chl content (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, D, E, F), corroborating findings by Fan et al. (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), who reported low levels of Chl biosynthesis precursors under R light. Additionally, seedlings exposed to N light exhibited lower Chl content, likely due to higher light intensity compared to the controlled LED treatments (Yong et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCARs are crucial in protecting Chl from photodamage and mitigating excessive light exposure. In this study, both lettuce cultivars exhibited increased CARs content under R light compared to other light conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG, H), aligning with previous studies showing enhanced CARs accumulation under R light in various species (Xu and Harvey \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). R light activates enzymes like phytoene synthase and phytoene desaturase, which are key to CARs biosynthesis (Frede et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The red lettuce cultivar showed higher CARs content than the green cultivar, both in seedlings and post-transplantation plants, suggesting species-specific responses to light intensity (Samuolienė et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eB light was found to enhance ANTs accumulation in both red and green lettuce seedlings (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B), supporting previous research highlighting B light's role in promoting ANTs biosynthesis in plants (Li and Kubota \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Ma et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In contrast, R light was less effective than B light in promoting ANTs accumulation, though it has been shown to contribute to ANTs accumulation in strawberry fruit (Shao et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Research also suggests that ANTs accumulation under R light may serve a photoprotective function against high light stress in apple leaves (Zhao et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOverall, our study highlights the significant role of light conditions, particularly B and R light, in shaping plant pigment profiles, including Chl, CARs, and ANTs. These findings provide valuable insights into optimizing light conditions for enhancing pigment accumulation and improving plant quality.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e4.5 The expression levels of genes associated with the biosynthesis of ANTs and CARs\u003c/h2\u003e \u003cp\u003eOur study demonstrated a significant upregulation of key genes involved in ANTs biosynthesis in lettuce leaves exposed to B light. The expression of genes such as \u003cem\u003eCHS\u003c/em\u003e, \u003cem\u003eF3H\u003c/em\u003e, \u003cem\u003eDFR\u003c/em\u003e, \u003cem\u003eANS\u003c/em\u003e, and \u003cem\u003eUFGT\u003c/em\u003e increased under B light, suggesting that B light is more effective in inducing the expression of these genes compared to other light sources (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This finding supports previous research by Zhang et al. (\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), which highlighted B light\u0026rsquo;s role in activating the ANTs biosynthesis pathway across various plant species.\u003c/p\u003e \u003cp\u003eANTs, important for plant coloration, stress response, and antioxidant properties, accumulate more under B light, improving both the visual appeal and antioxidant content of plants. Zhang et al. (\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) demonstrated that B light activates ANTs-related genes via \u003cem\u003ephotoreceptors like cryptochromes\u003c/em\u003e (\u003cem\u003eCRY\u003c/em\u003e) and \u003cem\u003ephototropins\u003c/em\u003e (\u003cem\u003ePHOT\u003c/em\u003e), which upregulate this pathway. Though the exact mechanism remains under investigation, these findings underscore the importance of B light in regulating ANTs production, offering a potential method for increasing ANTs levels in crops through light manipulation.\u003c/p\u003e \u003cp\u003eAdditionally, our study showed significant upregulation of genes involved in CARs biosynthesis, including \u003cem\u003eDXS\u003c/em\u003e, \u003cem\u003eDXR\u003c/em\u003e, \u003cem\u003ePSY1\u003c/em\u003e, \u003cem\u003eZDS\u003c/em\u003e, \u003cem\u003eCRTISO\u003c/em\u003e, and \u003cem\u003eVDE\u003c/em\u003e, in lettuce leaves exposed to R light (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). This finding supports previous research (Frede et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), which indicated that R light enhances CARs accumulation by activating genes in the methylerythritol 4-phosphate (MEP) pathway. The increased expression of \u003cem\u003eDXS\u003c/em\u003e, \u003cem\u003eDXR\u003c/em\u003e, and \u003cem\u003ePSY1\u003c/em\u003e suggests that R light directly influences CARs production. Phytochromes, photoreceptors for R light, likely play a role in this process by triggering signaling pathways that activate transcription factors responsible for CARs biosynthesis (Frascogna et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOverall, our results highlight the crucial role of light wavelengths in regulating both ANTs and CARs biosynthesis, with potential applications for improving the nutritional and antioxidant properties of crops. Optimizing light conditions, particularly the spectral composition, could enhance pigment accumulation, offering benefits for crop quality and market value. The differential regulation of genes in response to light wavelengths also reveals how plants adapt their biosynthetic pathways to environmental cues, influencing not only pigment production but also growth, development, and stress resilience.\u003c/p\u003e \u003c/div\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eThis study examines how different LED wavelengths affect lettuce seed germination, seedling growth, and phytochemical contents. B and R lights were found to significantly influence germination rates, shoot and root development, and biomass. B light sped up germination in the red cultivar, while red light increased seedling fresh weight and shoot growth in both cultivars. B light also promoted root growth, while R light affected hypocotyl elongation, showing that these wavelengths have distinct effects. Light exposure also influenced pigment accumulation. B light increased PCs and FLs, while R light raised CARs levels. B light also boosted ANTs biosynthesis. Gene expression analysis showed that B light upregulated genes in the ANTs biosynthetic pathway (\u003cem\u003eCHS\u003c/em\u003e, \u003cem\u003eF3H\u003c/em\u003e, \u003cem\u003eDFR\u003c/em\u003e, \u003cem\u003eANS\u003c/em\u003e, and \u003cem\u003eUFGT\u003c/em\u003e), while red light enhanced CARs biosynthesis genes (\u003cem\u003eDXS\u003c/em\u003e, \u003cem\u003eDXR\u003c/em\u003e, \u003cem\u003ePSY1\u003c/em\u003e, \u003cem\u003eZDS\u003c/em\u003e, \u003cem\u003eCRTISO\u003c/em\u003e, and \u003cem\u003eVDE\u003c/em\u003e). These findings offer useful insights for optimizing light conditions in indoor agriculture to improve crop yield and nutritional quality. They also provide a foundation for future research on light-driven strategies to boost plant productivity and pigment content in vegetable crops.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eConflict of interest\u003c/strong\u003e \u003cp\u003eThe authors declare that they have no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the Cooperative Research Program for Agriculture Science and Technology Development (RS-2024-00322321) of the Rural Development Administration (RDA) of Korea.\u003c/p\u003e\u003ch2\u003eAuthors contributions\u003c/h2\u003e \u003cp\u003eSO conducted the investigation, wrote the original draft, and curated the data together with MA, who also contributed to writing the original draft and data curation. SL supervised the project, acquired funding, conceptualized the study, and contributed to writing through review and editing.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe data are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eArias JP, Zapata K, Rojano B, Arias M (2016) Effect of light wavelength on cell growth, content of phenolic compounds and antioxidant activity in cell suspension cultures of \u003cem\u003eThevetia peruviana\u003c/em\u003e. J Photochem Photobiol B 163:87-91. https://doi.org/10.1016/j.jphotobiol.2016.08.014\u003c/li\u003e\n\u003cli\u003eBattistoni B, Amor\u0026oacute;s A, Tapia ML, Escalona VH (2021) Effect of blue, green or red LED light on the functional quality of spinach (\u003cem\u003eSpinacia oleracea \u003c/em\u003eL.). Rev Fac Cienc Agrar, Univ Nac Cuyo 53:98-108. https://doi.org/10.48162/rev.39.010 \u003c/li\u003e\n\u003cli\u003eBi X, Xu H, Yang C, Zhang H, Li W, Su W, Zheng M, Lei B (2024) Investigating the influence of varied ratios of red and far-red light on lettuce (\u003cem\u003eLactuca sativa\u003c/em\u003e): effects on growth, photosynthetic characteristics and chlorophyll fluorescence. Front Plant Sci 15:1430241. https://doi.org/10.3389/fpls.2024.1430241\u003c/li\u003e\n\u003cli\u003eBiswal AK, Pattanayak GK, Pandey SS, Leelavathi S, Reddy VS, Govindjee-Tripathy BC (2012) Light intensity-dependent modulation of chlorophyll b biosynthesis and photosynthesis by overexpression of chlorophyllide a oxygenase in tobacco. Plant Physiol 159:433-449. https://doi.org/10.1104/pp.112.195859\u003c/li\u003e\n\u003cli\u003eBrazaitytė A, Miliauskienė J, Va\u0026scaron;takaitė-Kairienė V, Sutulienė R, Laužikė K, Duchovskis P, Małek S (2021) Effect of different ratios of blue and red led light on brassicaceae microgreens under a controlled environment. Plants 10:801.https://doi.org/10.3390/plants10040801\u003c/li\u003e\n\u003cli\u003eCammarisano L, Donnison IS, Robson PR (2021) The effect of red \u0026amp; blue rich LEDs vs fluorescent light on Lollo rosso lettuce morphology and physiology. Front Plant Sci 12:603411. https://doi.org/10.3389/fpls.2021.603411 \u003c/li\u003e\n\u003cli\u003eCarotti L, Potente G, Pennisi G, Ruiz KB, Biondi S, Crepaldi A, Orsini F, Gianquinto G, Antognoni F (2021) Pulsed LED light: exploring the balance between energy use and nutraceutical properties in indoor-grown lettuce. Agronomy 11:1106. https://doi.org/10.3390/agronomy11061106\u003c/li\u003e\n\u003cli\u003eCarpita NC, Nabors MW (1976) Effects of 35 C heat treatments on photosensitive Grand Rapids lettuce seed germination. Plant Physiol 57:612-616. https://doi.org/10.1104/pp.57.4.612\u003c/li\u003e\n\u003cli\u003eDemir K, Sarıkamış G, Seyrek G\u0026Ccedil; (2023) Effect of LED lights on the growth, nutritional quality and glucosinolate content of broccoli, cabbage and radish microgreens. Food Chem 401:134088.https://doi.org/10.1016/j.foodchem.2022.134088\u003c/li\u003e\n\u003cli\u003eFan X, Zang J, Xu Z, Guo S, Jiao X, Liu X, Gao Y (2013) Effects of different light quality on growth, chlorophyll concentration and chlorophyll biosynthesis precursors of non-heading Chinese cabbage (\u003cem\u003eBrassica campestris \u003c/em\u003eL.). Acta Physiol Plant 35:2721-2726. https://doi.org/10.1007/s11738-013-1304-z\u003c/li\u003e\n\u003cli\u003eFlores M, Hern\u0026aacute;ndez-Adasme C, Guevara MJ, Escalona VH (2024) Effect of different light intensities on agronomic characteristics and antioxidant compounds of Brassicaceae microgreens in a vertical farm system. Front Sustain Food Syst 8:1349423. https://doi.org/10.3389/fsufs.2024.1349423 \u003c/li\u003e\n\u003cli\u003eFlores M, Urrestarazu M, Amor\u0026oacute;s A, Escalona V (2022) High intensity and red enriched LED lights increased the growth of lettuce and endive. Ital J Agron 17:1915.\u003cu\u003ehttps://doi.org/10.4081/ija.2021.1915\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003eFrascogna F, Ledermann B, Hartmann J, P\u0026eacute;rez Patallo E, Zeqiri F, Hofmann E, Frankenberg-Dinkel N (2023) On the evolution of the plant phytochrome chromophore biosynthesis. Plant Physiol 193:246-258. https://doi.org/10.1093/plphys/kiad327\u003c/li\u003e\n\u003cli\u003eFrąszczak B, Kula-Maximenko M (2021) The preferences of different cultivars of lettuce seedlings (\u003cem\u003eLactuca sativa\u003c/em\u003e L.) for the spectral composition of light. Agronomy 11:1211. https://doi.org/10.3390/agronomy11061211\u003c/li\u003e\n\u003cli\u003eFrede K, Schreiner M, Baldermann S (2019) Light quality-induced changes of carotenoid composition in pak choi \u003cem\u003eBrassica rapa\u003c/em\u003e ssp. chinensis. J Photochem Photobiol B 193:18-30. \u003cu\u003ehttps://doi.org/10.1016/j.jphotobiol.2019.02.001\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003eFrede K, Schreiner M, Zrenner R, Graefe J, Baldermann S (2018) Carotenoid biosynthesis of pak choi (\u003cem\u003eBrassica rapa \u003c/em\u003essp. chinensis) sprouts grown under different light-emitting diodes during the diurnal course. Photochem Photobiol Sci 17:1289-1300. \u003cu\u003ehttps://doi.org/10.1039/c8pp00136g\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003eGai QY, Feng X, Jiao J, Xu XJ, Fu JX, He XJ, Fu YJ (2023) Blue LED light promoting the growth, accumulation of high-value isoflavonoids and astragalosides, antioxidant response, and biosynthesis gene expression in Astragalus membranaceu s (Fisch.) Bunge hairy root cultures. Plant Cell Tissue Organ Cult 153:511-523. https://doi.org/10.1007/s11240-023-02486-7\u003c/li\u003e\n\u003cli\u003eHern\u0026aacute;ndez-Adasme C, Silva H, Escalona V (2022) In-door germination and seedling growth of green and red lettuce under LED-light spectrum and subsequent effect on baby leaf lettuce. Ital J Agron 17:1982. \u003cu\u003ehttps://doi.org/10.4081/ija.2022.1982\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003eHwang HJ, Lee JM, Kim SY, Choi GW (2008) Seed germination in lettuce affected by light quality and plant growth regulators. J Bio-Env Con 17:51-59.\u003c/li\u003e\n\u003cli\u003eInternational seed testing association (ISTA), (1999) International rules for seed testing. Seed Sci Technol 23:1-269.\u003c/li\u003e\n\u003cli\u003eJaya MHIS, Putra SD, Sofi\u0026apos;i I (2023) Effect of light spectrum LED lettuce on loT-based indoor farming. Biotropika: J Trop Biol 11:38-43. https://doi.org/10.21776/ub.biotropika.2023.011.01.05 \u003c/li\u003e\n\u003cli\u003eJu J, Zhang S, Hu Y, Zhang M, He R, Li Y, Liu X, Liu H (2023)Effects of supplemental red and far-red light at different growth stages on the growth and nutritional properties of lettuce. Agronomy 14:55. https://doi.org/10.3390/agronomy14010055\u003c/li\u003e\n\u003cli\u003eKang C, Zhang Y, Cheng R, Kaiser E, Yang Q, Li T (2021) Acclimating cucumber plants to blue supplemental light promotes growth in full sunlight. Front Plant Sci 12:782465. https://doi.org/10.3389/fpls.2021.782465 \u003c/li\u003e\n\u003cli\u003eKim HD, Choi YJ, Bae EY, Je BI, Song SM, Kang JS (2024) Effect of artificial light source on the growth and quality of lettuce. J Environ Sci Int 33:383-402. https://doi.org/10.5322/JESI.2024.33.6.383\u003c/li\u003e\n\u003cli\u003eKiss JZ, Mullen JL, Correll MJ, Hangarter RP (2003) Phytochromes A and B mediate red-light-induced positive phototropism in roots. Plant Physiol 131:1411-1417. https://doi.org/10.1104/pp.013847\u003c/li\u003e\n\u003cli\u003eKlimek-Szczykutowicz M, Prokopiuk B, Dziurka K, Pawłowska B, Ekiert H, Szopa A (2022) The influence of different wavelengths of LED light on the production of glucosinolates and phenolic compounds and the antioxidant potential in \u003cem\u003ein vitro\u003c/em\u003e cultures of \u003cem\u003eNasturtium officinale\u003c/em\u003e (watercress). Plant Cell Tissue Organ Cult 149:113-122. https://doi.org/10.1007/s11240-021-02148-6\u003c/li\u003e\n\u003cli\u003eKowalczyk T, Muskała M, Merecz-Sadowska A, Sikora J, Picot L, Sitarek P (2024) Anti-inflammatory and anticancer effects of anthocyanins in \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e studies. Antioxidants 13:1143-1178. \u003cu\u003ehttps://doi.org/10.3390/antiox13091143\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003eKubica P, Szopa A, Prokopiuk B, Komsta Ł, Pawłowska B, Ekiert H (2020) The influence of light quality on the production of bioactive metabolites\u0026ndash;verbascoside, isoverbascoside and phenolic acids and the content of photosynthetic pigments in biomass of \u003cem\u003eVerbena officinalis\u003c/em\u003e L. cultured \u003cem\u003ein vitro\u003c/em\u003e. J Photochem Photobiol B 203:111768. https://doi.org/10.1016/j.jphotobiol.2019.111768\u003c/li\u003e\n\u003cli\u003eLauria G, Ceccanti C, Lo Piccolo E, El Horri H, Guidi L, Lawson T, Landi M (2024) \u0026ldquo;Metabolight\u0026rdquo;: how light spectra shape plant growth, development and metabolism. Physiol Plant 176:e14587. https://doi.org/10.1111/ppl.14587\u003c/li\u003e\n\u003cli\u003eLe AT, Phan NH, Do TK (2021) Effect of blue light on the photosynthesis and flavonoid accumulation in leaves of (\u003cem\u003eHedyotis corymbosa \u003c/em\u003eL.) Lam. Plant Sci Today 8:955-962. \u003cu\u003ehttps://doi.org/10.14719/pst.2021.8.4.1238\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003eLee J, Durst RW, Wrolstad RE (2005) Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: col-laborative study. J AOAC Int 88:1269-1278. https://doi.org/10.1093/jaoac/88.5.1269\u003c/li\u003e\n\u003cli\u003eLichtenthaler HK, Wellburn AR (1983) Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Biochem Soc Trans 11:591-592. https://doi.org/10.1042/bst0110591\u003c/li\u003e\n\u003cli\u003eLim E, Kim JO, Oh MM (2023) Optimizing the photon ratio of red, green, and blue LEDs for lettuce seedlings: a mixture design approach. Plant Methods 19:121. https://doi.org/10.1186/s13007-023-01098-8\u003c/li\u003e\n\u003cli\u003eLim YJ, Kwon SJ, Eom SH (2023) Red and blue light-specific metabolic changes in soybean seedlings. Front Plant Sci 14:1128001. https://doi.org/10.3389/fpls.2023.1128001\u003c/li\u003e\n\u003cli\u003eLi Q, Kubota C (2009) Effects of supplemental light quality on growth and phytochemicals of baby leaf lettuce. Environ Exp Bot 67:59-64. https://doi.org/10.1016/j.envexpbot.2009.06.011\u003c/li\u003e\n\u003cli\u003eLiu Y, Schouten RE, Tikunov Y, Liu X, Visser RG, Tan F, Bovy A, Marcelis LF (2022) Blue light increases anthocyanin content and delays fruit ripening in purple pepper fruit. Postharvest Biol Technol 192:112024. https://doi.org/10.1016/j.postharvbio.2022.112024\u003c/li\u003e\n\u003cli\u003eLi Y, Huang Y, Wang M, Zhao Y (2023) An improved U-Net-based \u003cem\u003ein situ\u003c/em\u003e root system phenotype segmentation method for plants. Front Plant Sci 14:1115713. https://doi.org/10.3389/fpls.2023.1115713\u003c/li\u003e\n\u003cli\u003eLozano-Castellanos LF, S\u0026aacute;nchez-Hern\u0026aacute;ndez E, Navas-Gracia LM, Mart\u0026iacute;n-Ramos P, Correa-Guimaraes A (2025) Effects of different types of artificial light on the phytochemicals of \u003cem\u003eLactuca sativa\u003c/em\u003e L. variety great lakes 118 cultivated under aeroponic system. Food Biosci 105950. https://doi.org/10.1016/j.fbio.2025.105950\u003c/li\u003e\n\u003cli\u003eMa J, Zhang J, Xie L, Ye J, Zhou L, Yu D, Wang QW (2024) Light quality regulates growth and flavonoid content in a widespread forest understorey medicinal species Scutellaria Baicalensis Georgi. Front Plant Sci 15:1488649. https://doi.org/10.3389/fpls.2024.1488649\u003c/li\u003e\n\u003cli\u003eMalekzadeh MR, Roosta HR, Kalaji HM (2024) Enhancing strawberry resilience to saline, alkaline, and combined stresses with light spectra: impacts on growth, enzymatic activity, nutrient uptake, and osmotic regulation. BMC Plant Biol 24:1038. https://doi.org/10.1186/s12870-024-05755-5\u003c/li\u003e\n\u003cli\u003eMa Y, Ma X, Gao X, Wu W, Zhou B (2021) Light induced regulation pathway of anthocyanin biosynthesis in plants. Int J Mol Sci 22:11116. https://doi.org/10.3390/ijms222011116\u003c/li\u003e\n\u003cli\u003eMo M, Yokawa K, Wan Y, Balu\u0026scaron;ka F (2015) How and why do root apices sense light under the soil surface. Front Plant Sci 6:775. https://doi.org/10.3389/fpls.2015.00775\u003c/li\u003e\n\u003cli\u003eMoni A, Lee AY, Briggs WR, Han IS (2015) The blue light receptor Phototropin 1 suppresses lateral root growth by controlling cell elongation. Plant Biol 17:34-40. https://doi.org/10.1111/plb.12187\u003c/li\u003e\n\u003cli\u003eNadeem H, Ahmad F (2019) Prospects for the use of plant cell culture as alternatives to produce secondary metabolites. Natural bio-active compounds: volume 3: Biotechnology, Bioengineering, and Molecular approaches, 153-182. https://doi.org/10.1007/978-981-13-7438-8_6\u003c/li\u003e\n\u003cli\u003eNaznin MT, Lefsrud M, Gravel V, Azad MOK (2019)Blue light added with red LEDs enhance growth characteristics, pigments content, and antioxidant capacity in lettuce, spinach, kale, basil, and sweet pepper in a controlled environment. Plants 8:93. https://doi.org/10.3390/plants8040093\u003c/li\u003e\n\u003cli\u003eOlajiga OK, Ani EC, Sikhakane ZQ, Olatunde TM (2024) A comprehensive review of energy-efficient lighting technologies and trends. Eng Sci Technol Int J 5:1097-1111. https://doi.org/10.51594/estj.v5i3.973 \u003c/li\u003e\n\u003cli\u003eOuzounis T, Heuvelink E, Ji Y, Schouten HJ, Visser RGF, Marcelis LFM (2016) Blue and red LED lighting effects on plant biomass, stomatal conductance, and metabolite content in nine tomato genotypes. In VIII International Symposium on Light in Horticulture, 1134:251-258. https://doi.org/10.17660/ActaHortic.2016.1134.34\u003c/li\u003e\n\u003cli\u003ePark YR, Kwon SJ, Kim JH, Duan S, Eom SH (2024) Light-induced antioxidant phenolic changes among the sprouts of lentil cultivar. Antioxidants 13:399.\u003cu\u003e \u003c/u\u003ehttps://doi.org/10.3390/antiox13040399\u003c/li\u003e\n\u003cli\u003eRahman MM, Field DL, Ahmed SM, Hasan MT, Basher MK, Alameh K (2021) LED illumination for high-quality high-yield crop growth in protected cropping environments. Plants 10:2470.https://doi.org/10.3390/plants10112470\u003c/li\u003e\n\u003cli\u003eRamon U, Adiri A, Cheriker H, Burko Y, Nir I, Weiss D (2023) Light perception by the root is essential for gibberellin-induced primary-root elongation in tomato. BioRxiv 2023-08. https://doi.org/10.1101/2023.08.20.554010\u003c/li\u003e\n\u003cli\u003eSamuolienė G, Vir\u0026scaron;ilė A, Miliauskienė J, Haimi PJ, Laužikė K, Brazaitytė A, Duchovskis P (2021) The physiological response of lettuce to red and blue light dynamics over different photoperiods. Front Plant Sci 11:610174. https://doi.org/10.3389/fpls.2020.610174 \u003c/li\u003e\n\u003cli\u003eShao D, Zhu QH, Liang Q, Wang X, Li Y, Sun Y, Zhang X, Liu F, Xue F, Sun J (2022) Transcriptome analysis reveals differences in anthocyanin accumulation in cotton (\u003cem\u003eGossypium hirsutum\u003c/em\u003e L.) induced by red and blue light. Front Plant Sci 13:788828. https://doi.org/10.3389/fpls.2022.788828\u003c/li\u003e\n\u003cli\u003eShi M, Gu J, Wu H, Rauf A, Emran TB, Khan Z, Mitra S, Aljohani AS, Alhumaydhi FA, Al-Awthan YS, Bahattab O (2022) Phytochemicals, nutrition, metabolism, bioavailability, and health benefits in lettuce\u0026mdash;A comprehensive review. Antioxidants 11:1158. https://doi.org/10.1126/science.1071055\u003c/li\u003e\n\u003cli\u003eShin KS, Murthy HN, Heo JW, Paek KY (2003) Induction of betalain pigmentation in hairy roots of red beet under different radiation sources. Biol Plant 47:149-152. https://doi.org/10.1023/A:1027313805930\u003c/li\u003e\n\u003cli\u003eSilva‐Navas J, Moreno‐Risueno MA, Manzano C, Pallero‐Baena M, Navarro‐Neila S, T\u0026eacute;llez‐Robledo B, Garcia‐Mina JM, Baigorri R, Gallego FJ, del Pozo JC (2015) D‐Root: a system for cultivating plants with the roots in darkness or under different light conditions. Plant J 47:244-255. https://doi.org/10.1111/tpj.12998\u003c/li\u003e\n\u003cli\u003eSpaninks K, Van Lieshout J, Van Ieperen W, Offringa R (2020) Regulation of early plant development by red and blue light: A comparative analysis between \u003cem\u003eArabidopsis thaliana\u003c/em\u003e and \u003cem\u003eSolanum lycopersicum\u003c/em\u003e. Front Plant Sci 11:599982. https://doi.org/10.3389/fpls.2020.599982 \u003c/li\u003e\n\u003cli\u003eSun T, Rao S, Zhou X, Li L (2022) Plant carotenoids: recent advances and future perspectives. Mol Hortic 2:3. \u003cu\u003ehttps://doi.org/10.1186/s43897-022-00023-2\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003eSzopa A, Starzec A, Ekiert H (2018) The importance of monochromatic lights in the production of phenolic acids and flavonoids in shoot cultures of \u003cem\u003eAronia melanocarpa\u003c/em\u003e, \u003cem\u003eAronia arbutifolia\u003c/em\u003e and \u003cem\u003eAronia\u0026times; prunifolia\u003c/em\u003e. J Photochem Photobiol B 179:91-97. https://doi.org/10.1016/j.jphotobiol.2018.01.005\u003c/li\u003e\n\u003cli\u003eThongtip A, Mosaleeyanon K, Janta S, Wanichananan P, Chutimanukul P, Thepsilvisut O, Chutimanukul P (2024) Assessing light spectrum impact on growth and antioxidant properties of basil family microgreens. Sci Rep 14:27875. https://doi.org/10.1038/s41598-024-79529-2\u003c/li\u003e\n\u003cli\u003eToscano S, Cavallaro V, Ferrante A, Romano D, Patan\u0026eacute; C (2021) Effects of different light spectra on final biomass production and nutritional quality of two microgreens. Plants 10:1584.https://doi.org/10.3390/plants10081584\u003c/li\u003e\n\u003cli\u003eUllah MA, Tungmunnithum D, Garros L, Hano C, Abbasi BH (2019) Monochromatic lights-induced trends in antioxidant and antidiabetic polyphenol accumulation in \u003cem\u003ein vitro\u003c/em\u003e callus cultures of \u003cem\u003eLepidium sativum\u003c/em\u003e L. J Photochem Photobiol B 196:111505. https://doi.org/10.1016/j.jphotobiol.2019.05.002\u003c/li\u003e\n\u003cli\u003eVa\u0026scaron;takaitė-Kairienė V, Samuolienė G, \u0026Scaron;veikauskas V, Laužikė K, Jurkonienė S (2022) The influence of end-of-day blue light on the growth, photosynthetic, and metabolic parameters of lettuce at different development stages. Plants 11:2798. https://doi.org/10.3390/plants11202798\u003c/li\u003e\n\u003cli\u003eWang P, Chen S, Gu M, Chen X, Chen X, Yang J, Zhao F, Ye N (2020) Exploration of the effects of different blue LED light intensities on flavonoid and lipid metabolism in tea plants via transcriptomics and metabolomics. Int J Mol Sci 21:4606. https://doi.org/10.3390/ijms21134606\u003c/li\u003e\n\u003cli\u003eWang T, Sun Q, Zheng Y, Xu Y, Liu B, Li Q (2024) Effects of red and blue light on the growth, photosynthesis, and subsequent growth under fluctuating light of cucumber seedlings. Plants 13:1668. https://doi.org/10.3390/plants13121668\u003c/li\u003e\n\u003cli\u003eWillett WC (2002) Balancing life-style and genomics research for disease prevention. Science 296 (5568): 695-698. https://doi.org/10.1126/science.1071055\u003c/li\u003e\n\u003cli\u003eXu Y, Harvey PJ (2019) Carotenoid production by \u003cem\u003eDunaliella salina\u003c/em\u003e under red light. Antioxidants 8:123. https://doi.org/10.3390/antiox8050123\u003c/li\u003e\n\u003cli\u003eYong S, Chen Q, Xu F, Fu H, Liang G, Guo Q (2024) Exploring the interplay between angiosperm chlorophyll metabolism and environmental factors. Planta 260:25. https://doi.org/10.1007/s00425-024-04437-8\u003c/li\u003e\n\u003cli\u003eZhang P, Lu S, Liu Z, Zheng T, Dong T, Jin H, Jia H, Fang J (2021) Transcriptomic and metabolomic profiling reveals the effect of LED light quality on fruit ripening and anthocyanin accumulation in cabernet sauvignon grape. Front Nutr 8:790697. \u003cu\u003ehttps://doi.org/10.3389/fnut.2021.790697\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003eZhang Y, Jiang L, Li Y, Chen Q, Ye Y, Zhang Y, Luo Y, Sun B, Wang X, Tang H (2018) Effect of red and blue light on anthocyanin accumulation and differential gene expression in strawberry (\u003cem\u003eFragaria\u0026times;ananassa\u003c/em\u003e). Molecules 23:820. https://doi.org/10.3390/molecules23040820\u003c/li\u003e\n\u003cli\u003eZhang Y, Xu S, Cheng Y, Peng Z, Han J (2018)Transcriptome profiling of anthocyanin-related genes reveals effects of light intensity on anthocyanin biosynthesis in red leaf lettuce. PeerJ 6:e4607. \u003cu\u003ehttps://doi.org/\u003c/u\u003e10.7717/peerj.4607\u003c/li\u003e\n\u003cli\u003eZhao S, Blum JA, Ma F, Wang Y, Borejsza-Wysocka E, Ma F, Cheng L, Li P (2022) Anthocyanin accumulation provides protection against high light stress while reducing photosynthesis in apple leaves. Int J Mol Sci 23:12616. https://doi.org/10.3390/ijms232012616\u003c/li\u003e\n\u003cli\u003eZhou C, Zhu Y, Luo Y (2013) Effects of sulfur fertilization on the accumulation of health-promoting phytochemicals in radish sprouts. J Agric Food Chem 61:7552-7559. https://doi.org/10.1021/jf402174f\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"acta-physiologiae-plantarum","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"acpp","sideBox":"Learn more about [Acta Physiologiae Plantarum](http://link.springer.com/journal/11738)","snPcode":"11738","submissionUrl":"https://www.editorialmanager.com/acpp/default2.aspx","title":"Acta Physiologiae Plantarum","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"LED, Lettuce, Gene expression, Metabolites, Anthocyanins, Carotenoids","lastPublishedDoi":"10.21203/rs.3.rs-6664304/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6664304/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study investigated the influence of specific light-emitting diodes (LEDs) on lettuce seed germination, growth, and the accumulation of health-promoting compounds. The results revealed that LED lights significantly impacted both red (Jeok Chi Ma) and green (Cheong Chi Ma) lettuce cultivars and compared to natural light. Red-blue light combinations accelerated germination in the red cultivar, while red light alone had the opposite effect in the green cultivar. Red light enhanced shoot fresh weight (SFW) for both cultivars, with the combination of red-blue light showing promising results as well. Blue light promoted root growth in both cultivars, followed by white light. Red light maximized root length (RL), while blue and white light were most effective for root volume (RV). Blue light significantly increased the levels of health-promoting compounds like phenolic compounds (PCs), anthocyanins (ANTs), and chlorophyll a (Chl a) and chlorophyll b (Chl b) in both cultivars. Red light, on the other hand, maximized carotenoids (CARs) content. Natural light resulted in the lowest levels of these compounds. Blue and red light respectively stimulated the expression of key genes in the ANTs and CARs biosynthetic pathways, with varying responses observed between the red and green cultivars. Overall, this study highlights the potential of utilizing specific LED light wavelengths to optimize lettuce growth and enhance the accumulation of health-promoting compounds. The findings suggest that tailoring light spectrums based on cultivar type can be a valuable strategy for controlled environment agriculture.\u003c/p\u003e","manuscriptTitle":"Influence of LED light on seed germination, growth, and health-promoting compounds in red and green lettuce cultivars","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-18 09:48:56","doi":"10.21203/rs.3.rs-6664304/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-07-07T06:46:42+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-16T06:59:47+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-16T11:43:48+00:00","index":"","fulltext":""},{"type":"submitted","content":"Acta Physiologiae Plantarum","date":"2025-05-14T08:45:34+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"acta-physiologiae-plantarum","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"acpp","sideBox":"Learn more about [Acta Physiologiae Plantarum](http://link.springer.com/journal/11738)","snPcode":"11738","submissionUrl":"https://www.editorialmanager.com/acpp/default2.aspx","title":"Acta Physiologiae Plantarum","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"e8915bd5-61c9-4be5-9b86-5956d2f02223","owner":[],"postedDate":"June 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-01-26T16:06:28+00:00","versionOfRecord":{"articleIdentity":"rs-6664304","link":"https://doi.org/10.1007/s11738-026-03886-w","journal":{"identity":"acta-physiologiae-plantarum","isVorOnly":false,"title":"Acta Physiologiae Plantarum"},"publishedOn":"2026-01-21 15:58:00","publishedOnDateReadable":"January 21st, 2026"},"versionCreatedAt":"2025-06-18 09:48:56","video":"","vorDoi":"10.1007/s11738-026-03886-w","vorDoiUrl":"https://doi.org/10.1007/s11738-026-03886-w","workflowStages":[]},"version":"v1","identity":"rs-6664304","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6664304","identity":"rs-6664304","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.