Natural transmission of blueberry mosaic-associated virus (Ophiovirus vaccinii) in cultivated and wild blueberries by Olpidium virulentus and its potential role in disease epidemiology

Natural transmission of blueberry mosaic-associated virus (Ophiovirus vaccinii) in cultivated and wild blueberries by Olpidium virulentus and its potential role in disease epidemiology | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Natural transmission of blueberry mosaic-associated virus (Ophiovirus vaccinii) in cultivated and wild blueberries by Olpidium virulentus and its potential role in disease epidemiology R Akkan, F.M Tok, V Roumi, K Çağlayan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7345056/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Apr, 2026 Read the published version in European Journal of Plant Pathology → Version 1 posted 6 You are reading this latest preprint version Abstract Blueberry ( Vaccinium spp.) is the second most significant berry crop globally, and its economic importance in Türkiye has increased markedly in recent years. Blueberry mosaic-associated virus (BlMaV) has been identified as the causal agent of a significant disease known as blueberry mosaic disease (BMD) reported from several countries, including Türkiye. Recently, concerns have been raised regarding the natural spread of virus due to the presence of BlMaV both in cultivated and wild blueberries. In this study, we investigated the potential involvement of Olpidium spp. in the natural transmission of BlMaV in blueberry plantations. Several trap plants, such as lettuce, carrot, broccoli, and cucumber, were co-cultivated with virus-free in vitro propagated blueberry plants (cv. ‵Bluecrop‵) in soils collected from root zones of BlMaV-infected blueberries grown in a commercial orchard and two wild plantations in Rize province located in the Black Sea Region of Türkiye. When the samples taken from the capillary roots of all trap plants and in vitro blueberry plants were stained and examined under a light microscope, resting spores of the Olpidium species were observed on some of the lettuce, broccoli, carrot, and the adjacent in vitro blueberry roots one month after planting. All plants used in the experimental transmission trials were subjected to PCR/RT-PCR to verify the presence of both Olpidium spp. and BlMaV. The presence of Olpidium virulentus on the roots of trap plants and blueberry was confirmed by PCR analysis using both generic (ITS1/ITS4) and species specific primer pairs. While a high BlMaV infection rate was detected in the leaves of lettuce and adjacent blueberries planted in soil collected from the root zones of BlMaV-infected blueberries from all three locations, the virus could not be detected in other trap plants. However, only in location 3, two blueberry plants planted next to broccoli and one blueberry plant planted next to carrots were found to be infected by BlMaV. This study confirms the transmission of BlMaV by O. virulentus under natural conditions. Additionally, our findings indicate that BlMaV is effectively transmitted in wild blueberry plantations, which may elucidate the transmission of BlMaV from wild blueberries to cultivated plantations or vice versa. Blueberry mosaic associated virus lettuce Olpidium virulentus sequencing PCR/RT-PCR transmission Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Blueberry ( Vaccinium spp.; Ericaceae family), native to North America, is an economically important berry crop worldwide and its production has significantly increased in recent years due to the fruit's high nutritional value, high antioxidant and therapeutic properties of all parts of the plant (Lyrene & Perry, 1988 ; Kalt et al., 2020 ). Among three different cultivated species (highbush, lowbush, and rabbit-eye), highbush blueberries are common globally (Lyrene & Perry, 1988 ) and in Türkiye. Thanks to favorable soil and weather conditions, the trend continues in various parts of Türkiye, producing 10.315 tons in 2023 (Çelik, 2024 ). Adverse climate conditions, along with pests and diseases, can reduce the economic productivity of blueberry orchards. Blueberries are known to host seventeen species of viruses (Saad et al., 2021 ); some viral diseases can significantly reduce the fruit's yield and quality. Among the viruses infecting blueberries, blueberry mosaic disease (BMD) was first described in the USA during the 1950s (Varney, 1957 ). The causative agent remained unidentified for many years, leading to the estimation that the symptoms were attributable to genetic variations. When similar symptoms were observed in healthy graft-inoculated plants, it was hypothesized that they could be of viral origin (Raniere, 1960 ); however, virus purification and electron microscopy were unsuccessful for a long time (Ramsdell & Stretch, 1987). Later, the disease was detected in several U.S. states and countries, including Argentina, Canada, Chile, New Zealand, South Africa, Japan, and several European nations. (Martin et al. 2009; Thekke-Vetil et al. 2014). Mosaic disease is most prevalent in the highbush blueberry varieties, including Bluecrop, Pioneer, Rubel, Cabot, Concord, Earliblue, Jersey, and Stanley. Symptomatic plants yield late-ripening fruits of poor quality, and severe infections may result in a yield reduction of up to 15%. (Martin et al. 2009). The causal agent of blueberry mosaic disease cannot be mechanically transmitted to herbaceous plants or through tassel contact. Recently, the involvement of blueberry mosaic-associated virus (BlMaV) in the etiology of BMD has been confirmed (Thekke-Veetil et al., 2014 ). BlMaV can cause mottling and yellow mosaic symptoms that later progress to pink and red as the season advances. However, some infected plants may remain asymptomatic (Varney, 1957 ; Martin & Tzanetakis, 2017 ). BlMaV ( Ophiovirus vaccinii ) belongs to the genus Ophiovirus in the Aspiviridae family (Walker et al., 2022 ). Its genome comprises three negative-sense single-stranded RNAs (Thekke-Veetil et al., 2014 ). Since its discovery, BlMaV has been reported in Serbia (Jevremović et al., 2015 ), the USA (Gauthier et al., 2015 ), Türkiye (Çağlayan et al., 2015 ), Japan (Isogai et al., 2016 ), Poland (Cieślińska, 2020 ), and Germany (Menzel et al., 2021 ). Several wild relatives of Vaccinium spp. such as bilberry and whortleberry naturally grow around the commercial blueberry orchards in the acidic soils of the Black Sea region of Türkiye (Çelik, 2022 ). The close proximity of cultivated blueberries to wild blueberries can increase the risk of rapid transmission of both known and novel viruses (Martin et al., 2012 ). Despite the occurrence of BlMaV in several countries over the last decade, very limited data regarding its natural transmission are available. Since viruses belonging to the Ophiovirus genus are transmitted by a soil-borne obligate parasitic fungus, Olpidium spp., it has been suggested that this fungus could also serve as a potential vector for BlMaV (Martin & Tzanetakis, 2018 ). Recent experimental transmission trials have indicated that Olpidium virulentus could be a potential vector for BlMaV in the United States (Shands et al., 2017 )d rkiye (Çağlayan et al. 2021 ). Although blueberry plants have not been identified as a natural host for Olpidium spp., their resting spores can contribute to the transmission of BlMaV in blueberry plants that have been experimentally inoculated. This study aimed to investigate the transmission of BlMaV in open field conditions Several trap plants were co-cultivated with virus-free blueberry plants (cv. ‵Bluecrop‵) in soils naturally infested with Olpidium species, which were collected from the root zones of BlMaV-infected blueberries from one commercial orchard and two wild plantations located in the Black Sea Region of Türkiye. Olpidium spp. were identified using both morphological and molecular techniques. The presence of BlMaV in inoculated blueberry and trap plants was detected by RT-PCR using three different primers amplifying RNA1, RNA2, and RNA3 of the virus. Materials and Methods Collection of plant and soil samples Blueberry plants infected with BlMaV and soil samples from their root zones were collected from Rize province in the Black Sea Region of Türkiye between May and June 2020. Plant and soil samples were collected from 3 locations where three different blueberry species are grown. V. corymbosum (cv. ‵Jersey‵) and soil samples were collected from İkizdere (location 1), where commercial blueberry is grown. V. acrostaphlum and V. myrtillus were collected from Demirkapı (location 2) and Anzer (location 3), where wild blueberries are grown, respectively. BlMaV was already reported in all three locations by Çağlayan et al. ( 2015 ). A total of 60 samples, including 10 plant and 10 soil samples from each location were collected. Approximately 100 g of soil samples were taken from the root zones of BlMaV-infected plants at each location, pooled, mixed well, and dried in an air circulation cabinet at 25°C for 1 week. Subsequently, the soils were passed through a 10-mesh 2mm aperture lab standard test sieve and used for planting the trap and in vitro blueberry plants according to Herrera-Vasquez et al. (2009). Detection of Olpidium spp. by using trap plants In order to encourage Olpidium spp. development, lettuce ( Lactuca sativa L.), carrot ( Daucus carota L. subsp. sativus (Hoffm.) Arcang.), broccoli ( Brassica oleracea L. var. italica ) and cucumber ( Cucumis sativus L.) seedlings were used as trap plants. Seeds of trap plants were sown in a mixture of sterile peat, perlite, and sand (1:1:1) and allowed to grow for 10–14 days. Soils taken from the root zone of BlMaV-infected blueberry plants were mixed with sterile sand at a ratio of 1/10. The soils from each location were distributed equally in 12 pots. Then the trap plants were planted in each pot together with an in vitro propagated blueberry plant (cv. ‵Bluecrop‵). The experiment was conducted with three replications for each trap plant sown in the soil collected from each location (Fig. 1 ). Thus, 36 seedlings from each trap plant species and 36 in vitro blueberry plants were used in the experimental transmission trials. The trap plants and in vitro blueberries planted in a sterile peat and sand mixture were kept as a control. All plants were grown under controlled conditions (20°C, 70% relative humidity, and 16-hour light and 8-hour dark photoperiod). Four weeks following the transplantation of the trap plants into the soil, their roots were carefully excised using a spatula, ensuring minimal damage to the root systems. The roots of blueberry and trap plants used in the transmission trials were collected every two weeks and subjected to PCR to detect and characterize Olpidium spp. Morphological identification of Olpidium species using light microscopy The roots of BlMaV-infected blueberry plants collected from the field, the roots of the trap plants and in vitro blueberries used in the transmission trials were excised and subsequently washed with distilled water, then boiled in 10% NaOH solution for 30 minutes. The roots were immersed in a 1% HCl solution for 10 minutes, then thoroughly rinsed with distilled water. The roots were stained with a lactophenol blue solution for 20 minutes in petri dishes. The stained roots were examined under a light microscope to identify species of Olpidium according to Jorda et al. (2002). DNA extraction and detection of Olpidium species by PCR According to the manufacturer's recommendations, total DNAs were extracted from 500 mg of the root tissues using the DNA Plant Mini Kit (Qiagen, The Netherlands). DNA quantity and quality were estimated using a NanoDrop spectrophotometer (Thermo Scientific, USA). PCR was conducted using both generic (ITS1/ITS4) and Olpidium -specific primer pairs (Table 1 ). The PCR was carried out in total reaction volumes of 25 µl, which included 2 µl of cDNA, 0.5 µl of 10 mM dNTPs, 2 µl of 25 mM MgCl 2 , 2.5 µl of PCR buffer and 1 µl of 10 µM of each primer pairs and 0.5 µl of Go-Taq DNA polymerase (5 units/µl) (ThermoScientific, Lithuania). Amplification was carried out in a thermal cycler using the following parameters: initial denaturation at 94 ⁰C for 5 min, 40 cycles of amplification at 94 ⁰C for 1 min, 54 ⁰C for 1 min, 72 ⁰C for 1 min, and a final extension at 72 ⁰C for 10 min. PCR products were loaded into 1% 1×TAE agarose gel stained with a Redsafe™ nucleic acid staining solution (Intron Biotechnology, South Korea) for 1 hour at 100 V and visualized under a UV transilluminator. All PCR products were purified and directly sequenced on both strands. Table 1 List of primer pairs used in PCR/RT-PCR analysis to detect Olpidium spp. and blueberry mosaic-associated virus (BlMaV) Primer name Sequences (5’-3’) Length (bp) Target Reference ITS1 ITS4 TCCGTAGGTGAACCTGCGG 500–900 Olpidium spp. Gardes and Bruns, 1993 TCCTCCGCTTATTGATATGC OLPborF OLPR CCGAGGAAATGAGAGAGATGACA 977 O.bornovanus Herrera- Vásquez et al., 2009 TCCTCCGCTTATTGATATGCTTA OLPvirF OLPR AACCCAAGACCTGCCCCCAAAAG 579 O.virulentus TCCTCCGCTTATTGATATGCTTA OLPbraF OLPR AGCTATAGCTCACCCTCTTT 204 O. brassicae TCCTCCGCTTATTGATATGCTTA RNA 1 F CCATGTCTTCTACTCTTTCTCC 756 BlMaV Thekke-Veetil et. al., 2014 RNA 1 R GAAATTAGATTTTGTAACAATGCAGG RNA 2 F CAGAACCTGTATCAAGCATAG 1042 BlMaV This study RNA 2 R GATTGGAACCATCTCTGCAAAG RNA 3 F GCCCTTGTCAATTTCAGTGTTAA 350 BlMaV Isogai et al., 2016 RNA 3 R CAAGCGGAAACACAAGGAAA RT-PCR assay for detection of BlMaV Total RNA was extracted from leaves of the blueberries and trap plants using Qiagen RNeasy Plant Mini Kit (Qiagen, The Netherlands). The concentration and quality of RNAs were assessed using a NanoDrop spectrophotometer (Thermo Scientific, USA). Three primer pairs targeting three segments of the BlMaV were utilized for its detection via RT-PCR (Table 1 ). A two-step protocol was used for cDNA synthesis. First, five µl of RNA, one µl of random hexamer, and 8.5 µl of dH 2 O were incubated at 94 ⁰C for 5 minutes, followed by incubation at -20°C for 5 minutes. In the second step, four µl of 5X RT buffer, 0.5 µl of dNTP, and one µl of RNase enzyme were incubated at 42 ⁰C for one hour, then at 72 ⁰C for 10 minutes (Thermo Fisher Scientific, USA). PCR was conducted in a total volume of 25 µL, which included two µl cDNA, 2.5 µl 10×PCR buffer solution, two µl 25 mM MgCl 2 , 0.5 µl 10 mM dNTPs, 0.5 µl of each primer pair (10 µM), and 0.2 µl Taq DNA polymerase (5 units/µl). Amplification was carried out in a thermal cycler using the following parameters: initial denaturation at 94 ⁰C for 3 min, 35 cycles of amplification at 94 ⁰C for 20 sec, 50–55 ⁰C for 20 sec, 72 ⁰C for 1 min, and a final extension at 72 ⁰C for 10 min. Agarose gel electrophoresis, visualization, and sequencing were carried out as previously described. Sequence and Phylogenetic Analysis The obtained sequences were analyzed using the BLAST algorithm, and related sequences were retrieved from GenBank. Multiple sequence alignments of the isolates were conducted using ClustalW v1.81 (Thompson et al., 1994 ). Phylogenetic analysis was conducted by Mega X (Kumar et al., 2018 ) using the Neighbor-Joining method (Saitou & Nei, 1987 ) using 1000 bootstrap replicates. Results and Discussion RT-PCR analysis of in vitro propagated and open-field blueberries for BlMaV RT-PCR using CP- specific primers confirmed that all 30 blueberry samples collected from one commercial orchard and two wild blueberry plantations were positive for BlMaV and expected amplifications (350bp) were observed (Fig. 1 ) although the in vitro blueberry plants used in the transmission trials were negative (Fig. 2 ). Morphological identification of Olpidium species by light microscopy The roots of each trap plant and in vitro blueberry saplings planted next to them were stained to examine the presence of sporangia and resting spores of Olpidium species by light microscopy. The resting spores were present either individually or in clusters. Most of the resting spores were 8–12 µm in diameter and exhibited a pentagonal or hexagonal appearance with sharp corners. In contrast, the sporangia were characterized by an oval or spherical shape (Fig. 3 ). Although sporangia and resting spores of Olpidium spp. were observed in lettuces and adjacent blueberries planted in soils collected from all three plantations, a higher intensity of sporangia and resting spores were detected in the soils collected from the root zone of lowbush wild blueberries ( V. myrtillus) grown in Anzer district. The zoospores and resting spores from lettuce-, broccoli-, cucumber-, and carrot-infecting Olpidium isolates were morphologically indistinguishable. Due to the analysis of the ITS regions revealed consistent and significant differences between some host types of Olpidium isolates (Hartwright et al., 2009), PCR analysis was performed to discriminate fungi species. Molecular detection, sequencing, and phylogenetic analysis of Olpidium species The roots of in vitro blueberries and trap plants grown in Olpidium- infested soils were subjected to PCR using universal primers to amplify the rDNA-ITS region and also species-specific primers for Olpidium spp. The expected PCR products of 204–579 (OLPvirF/R) and 900 (ITS1-ITS4) bp were amplified from all blueberryxtrap plant combinations except the cucumber x blueberry in all locations (Table 2 , Fig. 4 ). Among sequenced 13 O. virulentus isolates, 9 were obtained from the blueberry x lettuce, 2 from the broccoli x blueberry and one from the carrot x blueberry combinations (Fig. 4 , 5 ). The multiple sequence alignment revealed that Turkish O. virulentus isolates obtained in the present study grouped together and share 99.80–100% nucleotide identity. However, they had 97% identity with several isolates from Italy (KF661296), Canada (KF493955), and Jordan (MN238817). The O. virulentus -blueberry (MW483635) and O. virulentus -lettuce (MW483627) isolates had 95.98% and 96.38% identity with four Turkish lettuce isolates already deposited in GenBank (MK054240- MK054243) (Fig. 5 ). Besides O. virulentus , only one O. brassicae (204 bp) isolate was detected from a blueberry sample co-cultivated with broccoli in location 1, while no O. bornovanus was detected in any soils. The Turkish isolate of O. brassicae shared the highest identity (99.24%) with isolates from Italy (MT596166) and Portugal (EU981906), whereas it shared the lowest identity (85.50%) with an isolate from Spain (EU981900). In the phylogenetic tree, Turkish O. brassicae isolate was clustered with the Italian and Portuguese isolates, distinct from the other isolates available in GenBank, as confirmed by a robust bootstrap (Fig. 6 ). Olpidium spp. have been recognized as economically important fungal vectors of several plant viruses, including Tombusvirus cucumis (cucumber necrosis virus (CNV)), Gammacarmovirus melonis (melon necrotic spot virus (MNSV)), Alphanecrovirus nicotianae (tobacco necrosis virus (TNV)), tobacco stunt virus (TStV: unclassified Varicosavirus ), Ophiovirus mirafioriense (mirafiori lettuce big-vein virus (MLBVV)), and Varicosavirus lactucae ( lettuce big-vein associated virus (LBVaV)) (Campbell, 1996 ). Specific host-virus associations among Olpidium species were already reported such as non-crucifer infecting Olpidium isolates could transmit MLBVV and TStV, while crucifer infecting Olpidium isolates failed (Sasaya and Koganezawa, 2006 ). The differences in ITS sequences between isolates specific to different host plants indicated that molecular tests can discriminate Olpidium isolates with distinct host preferences and virus-vectoring specificities, enabling the assessment of field soils for infection risks and the spread of critical viruses transmitted by Olpidium spp. (Hartwright et al., 2009). Additional research is essential on the virus-vector relationships of some Olpidium isolates to determine the commercial importance of differentiating between host-specific groups. Experimental transmission trials of BlMaV through trap plants All blueberries and trap plants used in the experimental transmission trials were closely monitored for the development of symptoms. Inoculated blueberry seedlings displayed virus-like symptoms such as leaf reddening and mottling within 6 months. Lettuce seedlings showed vein clearing, blistering, and mild mosaic symptoms (Fig. 7 ) while no symptoms were observed on carrot, broccoli, cucumber, or in the negative control plants. All plants used in the experimental transmission trials were subjected to PCR/RT-PCR to verify the presence of Olpidium spp. and BlMaV (Table 2 ). Table 2 Experimental transmission of BlMaV using soil contaminated with Olpidium spp. collected from the root zone of BlMaV-infected blueberries. Trap plants/Adjacent blueberries Location Number of plants tested Number of plants with Olpidium resting spores observed under the microscope Number of Olpidium spp. positive plants by PCR Number of BlMaV positive plants by RT-PCR O. vir. O.bor. O.bras. Lettuce/ Blueberry Loc 1 3/3 = 6 3/2 3/2 0/0 0/0 2/3 Loc 2 3/3 = 6 3/3 3/3 0/0 0/0 2/2 Loc 3 3/3 = 6 3/2 3/3 0/0 0/0 1/2 Broccoli/ Blueberry Loc 1 3/3 = 6 2/1 1/2 0/0 1/1 0/0 Loc 2 3/3 = 6 2/2 2/3 0/0 0/0 0/0 Loc 3 3/3 = 6 2/3 2/2 0/0 0/0 0/0 Carrot/ Blueberry Loc 1 3/3 = 6 1/1 1/1 0/0 0/0 0/0 Loc 2 3/3 = 6 2/1 2/1 0/0 0/0 0/0 Loc 3 3/3 = 6 2/2 1/0 0/0 0/0 0/1 Cucumber/ Blueberry Loc 1 3/3 = 6 1/1 0/0 0/0 0/0 0/0 Loc 2 3/3 = 6 1/2 0/0 0/0 0/0 0/0 Loc 3 3/3 = 6 2/2 0/0 0/0 0/0 0/0 In this study, 13 BlMaV isolates from experimental transmission trials were obtained by RT-PCR using primer pairs targeting the partial RNA3 gene (CP) of the virus (Table 2 ). When blueberries were planted next to lettuce in soils collected from location 1, two lettuces and three blueberries were found infected by BlMaV; two lettuces and two blueberries were found infected in location 2; and one lettuces and three blueberries were found infected in location 3 by RT-PCR using RNA3 F/R primers. When the plants in blueberry x carrot combinations tested by the same primers, only one blueberry plant was found positive for BlMaV, whereas all carrot and other blueberry plants were negative. Likewise, BlMaV was not detected in broccoli, cucumbers, and blueberries cultivated next to these plants. Multiple sequence analysis showed that the identity range among these isolates was 99–100% and the highest identity was with a Japanese isolate (LC066301) (97.81%), while they shared the lowest identity with a Serbian isolate (KP188574) (90.32%). In the phylogenetic analysis, all isolates obtained in this study were grouped together along with several isolates from Türkiye, Slovenia, Japan, and USA (Fig. 9 ). Two Ophiovirus ranunculi isolates (MZ507608 and MZ507609) were used as outgroups. RT-PCR results were confirmed by using the primer pairs targeting RNA2 (MP) and RNA3 (CP) of the virus (Fig. 8 ). When RNA1F/R primers amplifying partial RNA1 was used, 756 bp amplicon was obtained only from one blueberry plant grown next to lettuce plant. The isolate was sequenced and deposited in GeneBank (Acc. no. OK0400161). It shared 100% identity with 6 Turkish BlMaV isolates (MW889974-75, MW889977, MW889081-83) and one Japanese isolate (LC066299). In phylogenetic analysis, these isolates were clustered together and had 89.62% identity with a Serbian isolate (KP188574) and 89.77% with a German isolate (OK181783), which placed in a distinct group in the phylogenetic tree. Ophiovirus lactucae (AY535016) and O. citri (AY224663) were used as outgroups (Fig. 9 ). In the RT-PCR analyses using RNA2F/R primer pairs amplifying RNA2 of BlMaV, the amplicon of 1042 bp was successfully obtained from one blueberry and one adjacent lettuce plant. Sequence analysis revealed that these two isolates shared the highest identity (99.9%) with a Japanese BlMaV isolate (LC066300), while they had the lowest identity (92.07%) with a German isolate (OK181784). In phylogenetic analysis, these two isolates were grouped with other Turkish BlMaV isolates along with a Japanese isolate (LC066300) (Fig. 9 ). Ophiovirus ranunculi (OL472212) and Ophiovirus lactucae (ON398507) were used as outgroups. DISCUSSION Recently, blueberry production and consumption have become increasingly prevalent in Türkiye like other many countries. This has led to extensive germplasm exchange between countries and increased the risk of disease transmission, thereby emphasizing the importance of inspection and certification programs using precise and highly sensitive techniques. During the first survey study conducted 2014–2017 in Türkiye, the virus was detected in 23 out of 157 blueberry samples by RT-PCR (Çağlayan et al., 2015 ). Sequence and phylogenetic analyses indicated that Turkish BlMaV isolates shared a high degree of identity; however, they were significantly diverged from isolates originating in other countries. Our recent findings are consistent with previous studies conducted in Türkiye (Çağlayan et al., 2015 ; 2016a , b ; 2017a, b; Gazel et al., 2015 ). There has been no clear information regarding the natural transmission of BlMaV. However, recent findings suggest that Olpidium spp. may serve as a potential vector for the virus (Martin & Tzanetakis, 2018 ). Shands et al. ( 2017 ) conducted an experimental transmission assay that indicated O. virulentus may serve as a potential vector for BlMaV. Although blueberry plants have not been identified as a natural host for Olpidium spp., the resting spores of O. virulentus play a significant role in the transmission of BlMaV (Shands et al., 2017 , Çağlayan et al., 2021 ). Morphological examination and PCR analysis revealed the presence of O. virulentus in the roots of the trap plants and blueberries cultivated in the olpidium infested soils collected from where both cultivated and wild blueberries are grown. O. virulentus was detected in 22 blueberry, 13 lettuce, 2 broccoli and 1 carrot plants grown in olpidium infested soils collected from 3 different locations. O. brassicae was detected in only one blueberry planted next to broccoli. These two species cannot be differentiated by morphological techniques (Aleandri et al., 2014 ). The resting spores were 8–12 µm in diameter and exhibited a stellate appearance, while the sporangia were oval or spherical. Our results agree with Sasaya & Koganezawa ( 2006 ), who referred to lettuce-infecting isolates as O. virulentus and brassica-infecting isolates as O. brassicae . The transmission trials verified O. virulentus as a vector of BlMaV and it was successfully transmitted to lettuce and blueberry seedlings, but not to broccoli, carrot, and cucumber plants. We detected BlMaV in lettuce and adjacent blueberry plants grown in naturally olpidium infested soils by RT-PCR while no sporangia and resting spores were observed in the roots of control plants. These findings have expanded our knowledge about epidemiology and the host range of BlMaV, which can be important for developing management strategies. Using virus-free cuttings and conducting plant root and soil tests for the presence of Olpidium spp. prior to planting (Ghorbani et al., 2013 ), can contribute to effective disease management via avoiding planting susceptible crops and the establishment of profitable blueberry orchards. Declarations Data Availability Statement The sequences were deposited in GenBank and are publicly available. Conflicts of Interest The authors declare no conflicts of interest. Funding This study was supported by the Scientific and Technological Research Council of Türkiye (TÜBİTAK) (Project Number: 120O382). References Aleandri, M. P., Martignoni, D., Reda, R., Alfaro-Fernández, A., Font, M. I., Armengol, J., & Chilosi, G. (2014). First report of Olpidium bornovanus and O. virulentus on melon in Italy. Plant Disease , 98(7), 997-997. Çağlayan, K., Gazel, M., Elçi, E., Çelik, H., Gündüz, K., Mavric, I., Grubar, B., Marn, M.V., 2015. Large scale survey on virus diseases of Rubus and Vaccinium species in Turkey. 23. International Conference on Virus and other Graft Transmissible Diseases of Fruit Crops [ICVF]. 8-12, June 2015, Morioka Japan, s 66. Çağlayan, K., Gazel, M., Gündüz, K., Elçi, E., Çelik, H., Marn, M.V., 2016a. Ülkemiz Maviyemiş Plantasyonlarında Bazı Virüslerin Tespit Edilmesi ve Moleküler Karakterizasyonu. Uluslararası katılımlı Türkiye VI. Bitki Koruma Kongresi , 5-8 Eylül 2016, Konya, p 640. Çağlayan, K., Çelik, H., Gazel, M., Elçi, E., Gündüz, K., Grubar, B., Marn, M.V., 2016b. Occurrence of Vaccinium viruses in Black Sea region of Turkey. XI. International Vaccinium Symposium , Orlando-Florida, U.S.A, 10-14 April, 2016, p,170. Çaglayan, K., Gazel, M., Elçi, E., Plesko, I. M., Virscek Marn, M., 2017a. Viruses Infecting Small Fruits in Turkey.International Conference on Agriculture, Forest, Food Sciences and Technologies , Cappadocia-Turkey, 15-17 May, 2017, p,1154. Çaglayan, K., Gazel, M., Elçi, E., Viršček Marn M., Mavric Pleško, I., 2017b. Prevalance of Blueberry mosaic associated virus in cultivated Blueberries in Turkey. 24. International Conference on Virus and other Graft Transmissible Diseases of Fruit Crops [ICVF] . Thessaloniki, Greece, 5-9 June 2017, p, 130. Çağlayan, K., Akkan, R., Gazel, M., F. M. Tok. 2021. First report of the Olpidium virulentus –mediated transmission of blueberry mosaic-associated virus in blueberries in Turkey. Journal of Plant Pathology , 103, 1349. Campbell, R. N. (1996). Fungal transmission of plant viruses. Annual review of phytopathology , 34(1), 87-108. Çelik H (2022). Dünyada ve Türkiye’de maviyemiş üretimi. Tarım Gündem , 12(71): 78-86. Çelik, H. (2024). Blueberry Production and Economy. Harman Time , 12(134): 60–66. (In Turkish). Cieślińska, M., 2020. First Report of Blueberry Mosaic Associated Virus in Highbush Blueberry in Poland. Plant Disease , 104:10, 2743. Gardes, Monique, and Thomas D. Bruns. "ITS primers with enhanced specificity for basidiomycetes‐application to the identification of mycorrhizae and rusts. Molecular ecology, 2.2 (1993): 113-118. Gauthier, N. W., Polashock, J. J.Thekke-Veetil, T., Martin, R. R., Beale, J., 2015. First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky. Plant Disease , 99, 421. doi:10.1094/PDIS-09-14-0946-PDN Gazel,M., Elçi, E., Çelik, H., Gündüz, K., Plesko, I.M, Marn, M.V., Çağlayan, K., 2015. The presence of Blueberry mosaic associated virus in Vaccinium spp. in Turkey. 23. International Conference on Virus and other Graft Transmissible Diseases of Fruit Crops [ICVF]. 8-12 June 2015, Morioka Japan, s 100. Ghorbani, A., Izadpanah, K., Manzari, F., & Roumi, V. (2013). A Simple Method for Detection of Polymyxa Betae and Beet Necrotic Yellow Vein Virus in Soil. Journal of Plant Pathology , 95(3), 533–537. Hartwright, L. M., Hunter, P. J., & Walsh, J. A. (2010). A comparison of Olpidium isolates from a range of host plants using internal transcribed spacer sequence analysis and host range studies. Fungal biology , 114(1), 26-33. Herrera-Vásquez JÁ, del Carmen Cebrián M, Alfaro-Fernández A, del Carmen Córdoba M, Jordá C, 2009. Multiplex PCR assay for simultaneous detection and differentiation of Olpidium bornovanus , O. brassicae and O. virulentus . Mycological Research , 113:602–610. Isogai, M.; Matsuhashi, Y.; Suzuki, K.; Yashima, S.; Watanabe, M.; Yoshikawa, N., 2016. Occurrence of blueberry mosaic associated virus in highbush blueberry trees with blueberry mosaic disease in Japan. Journal of General Plant Pathology , 82, 177–179. Jevremović, D., Leposavić, A., Paunović, S., 2015. First report of blueberry mosaic-associated virus in highbush blueberry in Serbia. Journal of Plant Pathology, 97 (3), 541. Jordá C, Armengol J, Gisbert J, Osca JM, Lacasa A, Velásquez B, 2002. El tratamiento con microondas para la desinfección de suelos. Phytoma-España , 138, 118–21. Kalt, W., Cassidy, A., Howard, L. R., Krikorian, R., Stull, A. J., Tremblay, F., & Zamora-Ros, R. (2020). Recent Research on the Health Benefits of Blueberries and Their Anthocyanins. Advances in Nutrition , 11(2), 224–236. https://doi.org/10.1093/advances/nmz065 Kumar S, Stecher G, Li, M., Knyaz, C., Tamura K. (2018). MEGAX: Molecular Evolutionary Genetics Analysis across Computing Platforms. Molecular Biology and Evolution (MBE), 35(6): 1547-1549. https://doi.org/10.1093/molbev/msy096 Lyrene, P.M., Perry, J.L. (1988). Blueberries ( Vaccinium spp.). In: Bajaj, Y.P.S. (eds) Crops II. Biotechnology in Agriculture and Forestry , vol 6. Springer, Berlin, Heidelberg. https://doi.org/10.1007/978-3-642-73520-2_8 Martin, R. R., and Tzanetakis, I. E. 2017. Page 64 in: Compendium of Blueberry, Cranberry and Lingonberry, Diseases and Pests , APS Press, St. Paul, MN. Martin, R. R., & Tzanetakis, I. E. (2018). High risk blueberry viruses by region in north america; implications for certification, nurseries, and fruit production. Viruses , 10 (7), 342. Martin, R. R., Polashock, J. J., & Tzanetakis, I. E. (2012). New and emerging viruses of blueberry and cranberry. Viruses , 4 (11), 2831-2852. https://doi. org/10.3390/v4112831 Menzel, W., Knierim, D., Margaria, P., Winter, S., Entrop, A. P., Stremer, P., & Heupel, M. (2021). First report of Blueberry mosaic associated virus associated with mosaic symptoms of blueberry in Germany. New Disease Reports , 44 (2). https://doi.org/10.1002/ndr2.12051 Ramsdell, D. C., and A. W. Stretch. Blueberry mosaic. Agriculture handbook-United States Department of Agriculture, Combined Forest Pest Research and Development Program (USA), (1987). Raniere, L. C. (1960). Responses of cultivated high bush blueberry varieties to the known blueberry viruses. Proceedings of the Twenty-eighth Annual Blueberry Open House , 28 , 18-20. Saad, N., Olmstead, J. W., Jones, J. B., Varsani, A., & Harmon, P. F. (2021). Known and new emerging viruses infecting blueberry. Plants , 10 (10), 2172. https://doi.org/10.3390/plants10102172 Saitou, N., & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular biology and evolution , 4 (4), 406-425. Sasaya, T., & Koganezawa, H. (2006). Molecular analysis and virus transmission tests place Olpidium virulentus, a vector of Mirafiori lettuce big-vein virus and tobacco stunt virus, as a distinct species rather than a strain of Olpidium brassicae. Journal of General Plant Pathology , 72 (1), 20-25. Shands, A. C., Crandall, S. G., & Miles, T. D. (2017). First report of the ability of Olpidium virulentus to vector blueberry mosaic associated virus (BlMaV) on southern highbush blueberry in California. Plant Disease , 101 (9), 1683.https://doi.org/10.1094/PDIS-02-17-0201-PDN Thekke-Veetil, T., Ho, T., Keller, K. E., Martin, R. R., & Tzanetakis, I. E. (2014). A new ophiovirus is associated with blueberry mosaic disease. Virus Research , 189 , 92-96. https://doi.org/10.1016/j.virusres.2014.05.019 Thekke-Veetil, T., Polashock, J. J., Marn, M. V., Plesko, I. M., Schilder, A. C., Keller, K. E., ... & Tzanetakis, I. E. (2015). Population structure of blueberry mosaic associated virus: Evidence of reassortment in geographically distinct isolates. Virus Research , 201 , 79-84. Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic acids research , 22 (22), 4673-4680. Varney, E. H. (1957). Mosaic and shoestring, virus diseases of cultivated Blueberry in New Jersey. Walker, P. J., Siddell, S. G., Lefkowitz, E. J., Mushegian, A. R., Adriaenssens, E. M., Alfenas-Zerbini, P., ... & Zerbini, F. M. (2022). Recent changes to virus taxonomy ratified by the International Committee on Taxonomy of Viruses (2022). Archives of virology , 167 (11), 2429-2440. https://doi.org/10.1007/s00705-022-05516-5 Cite Share Download PDF Status: Published Journal Publication published 28 Apr, 2026 Read the published version in European Journal of Plant Pathology → Version 1 posted Editorial decision: Major revisions 06 Oct, 2025 Reviewers agreed at journal 03 Sep, 2025 Reviewers invited by journal 02 Sep, 2025 Editor invited by journal 13 Aug, 2025 Editor assigned by journal 12 Aug, 2025 First submitted to journal 11 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7345056","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":509029631,"identity":"10ea87c2-bf0c-4109-bb76-2666e345013c","order_by":0,"name":"R Akkan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABA0lEQVRIiWNgGAWjYLCCBAYGAwkGBsYHCRVAHjNzA9FamA0enAFpYSRCCwNEC5vkwzYQm4AW8/bewy8e7rAzlmw/e0AicV5tNH87UMuPim04tcicOZdmkXgm2UyaJy/BIHHb8dwZhxkbGHvO3MapRUIix8wgsY3ZRo4hxyAhcdux3AagFmbGNjxa5N+AtNTbyPG/MTiQOOdY7nyCWiR4jB8kth02k5bIMWxIbKjJ3UBQC0+OGUNi23FjyRlvjBkSjh3I3QjUchCvX9jPGH/82VZtOON8jvnPHzV1ufPOHz744EcFbi1AwCaBxDkMJg/gUw8EzB+QOHUEFI+CUTAKRsFIBABFt1u1Fq5FkwAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-0768-632X","institution":"Hatay Mustafa Kemal Üniversitesi: Hatay Mustafa Kemal Universitesi","correspondingAuthor":true,"prefix":"","firstName":"R","middleName":"","lastName":"Akkan","suffix":""},{"id":509029632,"identity":"d05102e5-7f07-4965-b87a-ff16245f53ba","order_by":1,"name":"F.M Tok","email":"","orcid":"","institution":"Hatay Mustafa Kemal Üniversitesi: Hatay Mustafa Kemal Universitesi","correspondingAuthor":false,"prefix":"","firstName":"F.M","middleName":"","lastName":"Tok","suffix":""},{"id":509029633,"identity":"b41bfe78-b863-4523-bd9d-924708247eec","order_by":2,"name":"V Roumi","email":"","orcid":"","institution":"University of Maragheh","correspondingAuthor":false,"prefix":"","firstName":"V","middleName":"","lastName":"Roumi","suffix":""},{"id":509029634,"identity":"cb956bb6-ee3a-46fd-a245-55d40e90c200","order_by":3,"name":"K Çağlayan","email":"","orcid":"","institution":"Hatay Mustafa Kemal Üniversitesi: Hatay Mustafa Kemal Universitesi","correspondingAuthor":false,"prefix":"","firstName":"K","middleName":"","lastName":"Çağlayan","suffix":""}],"badges":[],"createdAt":"2025-08-11 10:04:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7345056/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7345056/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10658-026-03235-0","type":"published","date":"2026-04-28T15:58:10+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":90918859,"identity":"8b02476d-8849-4109-8cef-e08ba433401b","added_by":"auto","created_at":"2025-09-09 14:34:42","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":68945,"visible":true,"origin":"","legend":"\u003cp\u003eThe electrophoretic patterns of RT-PCR using BlMaV 3 F/3 R primer pairs amplifying partial CP gene from cultivated and wild blueberry samples collected from Rize province. M: GeneRuler 100 bp Plus DNA Ladder (Thermo Sci., USA), 1-6: Cultivated blueberry samples, 7-12: Wild blueberry samples, +C: Positive control, W: Water control.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7345056/v1/b36f7653dbdceaeabe3d6589.jpg"},{"id":90918858,"identity":"6902001c-182e-40de-b3f5-38c7be141b9c","added_by":"auto","created_at":"2025-09-09 14:34:42","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":60131,"visible":true,"origin":"","legend":"\u003cp\u003eThe electrophoretic patterns of RT-PCR using BlMaV 3 F/3 R primer pairs amplifying partial CP gene from \u003cem\u003ein vitro\u003c/em\u003e blueberry plants. M: GeneRuler 100 bp Plus DNA Ladder (Thermo Sci., USA), B1-B12: Cultivated \u003cem\u003ein vitro\u003c/em\u003e blueberry samples, +C: Positive control, W: Water control.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7345056/v1/483fb812a0384c14d625c7a7.jpg"},{"id":90918861,"identity":"73c962c0-6ae1-4859-98ed-f5785fecc1c6","added_by":"auto","created_at":"2025-09-09 14:34:43","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":186850,"visible":true,"origin":"","legend":"\u003cp\u003eStellate resting spores (8-12µm) andsporangia of \u003cem\u003eOlpidium\u003c/em\u003e spp. (A, B, C, D) observed in roots of the inoculated blueberry plants (B, C), lettuce plants (A, D), healthy blueberry plants (E), and healthy lettuce plants (F) stained with lactophenol blue solution and examined under a light microscope.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7345056/v1/69181a06b10eff8964669aff.jpg"},{"id":90918866,"identity":"ebd957a7-a82c-49fc-a219-9d47d4e03119","added_by":"auto","created_at":"2025-09-09 14:34:43","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":72201,"visible":true,"origin":"","legend":"\u003cp\u003ePCR analysis of DNA extracted from the roots of blueberry and trap plants grown in soil collected from \u0026nbsp;wild blueberry plantations by using universal primers (ITS1/ITS4) (left) and \u003cem\u003eO. virulentus\u003c/em\u003e specific primers (OLPvir F/R) (right). M: GeneRuler 100 bp Plus DNA Ladder; DL5, DL10: lettuce isolates; DL1, DL7: blueberry isolates; DL8: carrot isolates; AÇ1, AÇ7: broccoli isolates; +C: \u003cem\u003eOlpidium virulentus\u003c/em\u003e positive control, W: Water Control.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7345056/v1/e3ebae3ff1388fdb0e363244.jpg"},{"id":90918862,"identity":"01bd57ca-b458-4543-ac78-02d2ac989ddb","added_by":"auto","created_at":"2025-09-09 14:34:43","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":118482,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree drawn from nucleotide sequences of \u003cem\u003eOlpidium virulentus\u003c/em\u003e isolates amplified using a specific OLPvirF/R primer pairs (green box) and other isolates available in GenBank. The tree was reconstructed using MEGA X software and the neighbor-joining (NJ) method. The bootstrap values are represented on the branches. Two \u003cem\u003eFusarium solani\u003c/em\u003e isolates (NR163531 and MK733312) were used as outgroups.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7345056/v1/a3a0fa28c5354e4fa788d8f1.jpg"},{"id":90918863,"identity":"1bdaa266-3fd9-443d-a8f0-43eabe62d953","added_by":"auto","created_at":"2025-09-09 14:34:43","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":90881,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree reconstructed from nucleotide sequences of \u003cem\u003eOlpidium\u003c/em\u003e \u003cem\u003ebrassicae\u003c/em\u003e isolates amplified with a specific OLPbraF/R primer pair (green box) and other isolates available in GenBank by MEGA X software using the Neighbor-joining (NJ) method. The bootstrap values are represented on the branches. Two \u003cem\u003eFusarium solani\u003c/em\u003e isolates (NR163531 and MK733312) were used as outgroups.\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7345056/v1/4372f3055ec07a628420e0a3.jpg"},{"id":90920114,"identity":"2a0039d2-bc05-41cc-937e-e3b548f38f0f","added_by":"auto","created_at":"2025-09-09 14:42:43","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":159489,"visible":true,"origin":"","legend":"\u003cp\u003eBlueberry and lettuce seedlings growing in the same pot containg soils collected from the cultivated blueberry orchards infected with BlMaV (top left); Lettuce seedlings planted in soils taken from cultivated blueberry orchard showing vein clearing, blistering and mild mosaic symptoms (top right); leaf reddening and mottling symptoms on blueberry seedlings planted in soils collected from wild blueberry location \u0026nbsp;(bottom left) and from cultivated blueberry (bottom right).\u003c/p\u003e","description":"","filename":"7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7345056/v1/7d5642c7b1ce68f2e1123cff.jpg"},{"id":90920113,"identity":"c5355407-3881-437f-b210-2e2616b384cb","added_by":"auto","created_at":"2025-09-09 14:42:43","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":35918,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of the RT-PCR analysis for detection of BlMaV with three primer pairs amplifying RNA1 (RdRp), RNA2 (MP), and RNA3 (CP) in lettuce and in vitro blueberry plants grown in the soils collected from Rize-Anzer province (Location 3). M: GeneRuler 100 bp Plus DNA Ladder (Thermo Sci., USA); 1: \u003cem\u003eIn vitro\u003c/em\u003e blueberry plants, 2: lettuce, 3- 4: Negative control (not inoculated in vitro blueberry), +C: Positive control, W: Water control\u003c/p\u003e","description":"","filename":"8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7345056/v1/027592fb04e61f28eb30b3b2.jpg"},{"id":90921904,"identity":"257242ee-de93-4eab-8ee4-66aa41e9a78d","added_by":"auto","created_at":"2025-09-09 14:58:43","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":188580,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree drawn based on nucleotide sequences of partial RdRp (top), MP (middle), and CP (bottom) genes of blueberry mosaic-associated virus isolates obtained in this study (orange box) and other isolates available in the GenBank. The Neighbor-joining (NJ) method available in MEGA X software was used for the phylogenetic analysis. The bootstrap values (70% cutoff) are shown on the branches. Location 1: Rize/ikizdere; Location 2: Rize/Demirkapi; Location 3: Rize/Anzer.\u003c/p\u003e","description":"","filename":"9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7345056/v1/3201a16f6ffb4ca7c9dab5ca.jpg"},{"id":108438006,"identity":"7ae69cf0-a1d5-4b4b-9431-fbeaacd9b0e4","added_by":"auto","created_at":"2026-05-04 16:05:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1389629,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7345056/v1/2012f03c-b1a5-4341-88a1-eda4808f2021.pdf"}],"financialInterests":"","formattedTitle":"Natural transmission of blueberry mosaic-associated virus (Ophiovirus vaccinii) in cultivated and wild blueberries by Olpidium virulentus and its potential role in disease epidemiology","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBlueberry (\u003cem\u003eVaccinium\u003c/em\u003e spp.; Ericaceae family), native to North America, is an economically important berry crop worldwide and its production has significantly increased in recent years due to the fruit's high nutritional value, high antioxidant and therapeutic properties of all parts of the plant (Lyrene \u0026amp; Perry, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1988\u003c/span\u003e; Kalt et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Among three different cultivated species (highbush, lowbush, and rabbit-eye), highbush blueberries are common globally (Lyrene \u0026amp; Perry, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1988\u003c/span\u003e) and in T\u0026uuml;rkiye. Thanks to favorable soil and weather conditions, the trend continues in various parts of T\u0026uuml;rkiye, producing 10.315 tons in 2023 (\u0026Ccedil;elik, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAdverse climate conditions, along with pests and diseases, can reduce the economic productivity of blueberry orchards. Blueberries are known to host seventeen species of viruses (Saad et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2021\u003c/span\u003e); some viral diseases can significantly reduce the fruit's yield and quality. Among the viruses infecting blueberries, blueberry mosaic disease (BMD) was first described in the USA during the 1950s (Varney, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1957\u003c/span\u003e). The causative agent remained unidentified for many years, leading to the estimation that the symptoms were attributable to genetic variations. When similar symptoms were observed in healthy graft-inoculated plants, it was hypothesized that they could be of viral origin (Raniere, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1960\u003c/span\u003e); however, virus purification and electron microscopy were unsuccessful for a long time (Ramsdell \u0026amp; Stretch, 1987). Later, the disease was detected in several U.S. states and countries, including Argentina, Canada, Chile, New Zealand, South Africa, Japan, and several European nations. (Martin et al. 2009; Thekke-Vetil et al. 2014). Mosaic disease is most prevalent in the highbush blueberry varieties, including Bluecrop, Pioneer, Rubel, Cabot, Concord, Earliblue, Jersey, and Stanley. Symptomatic plants yield late-ripening fruits of poor quality, and severe infections may result in a yield reduction of up to 15%. (Martin et al. 2009). The causal agent of blueberry mosaic disease cannot be mechanically transmitted to herbaceous plants or through tassel contact.\u003c/p\u003e\u003cp\u003eRecently, the involvement of blueberry mosaic-associated virus (BlMaV) in the etiology of BMD has been confirmed (Thekke-Veetil et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). BlMaV can cause mottling and yellow mosaic symptoms that later progress to pink and red as the season advances. However, some infected plants may remain asymptomatic (Varney, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1957\u003c/span\u003e; Martin \u0026amp; Tzanetakis, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). BlMaV (\u003cem\u003eOphiovirus vaccinii\u003c/em\u003e) belongs to the genus \u003cem\u003eOphiovirus\u003c/em\u003e in the \u003cem\u003eAspiviridae\u003c/em\u003e family (Walker et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Its genome comprises three negative-sense single-stranded RNAs (Thekke-Veetil et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Since its discovery, BlMaV has been reported in Serbia (Jevremović et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), the USA (Gauthier et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), T\u0026uuml;rkiye (\u0026Ccedil;ağlayan et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), Japan (Isogai et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), Poland (Cieślińska, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), and Germany (Menzel et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Several wild relatives of \u003cem\u003eVaccinium\u003c/em\u003e spp. such as bilberry and whortleberry naturally grow around the commercial blueberry orchards in the acidic soils of the Black Sea region of T\u0026uuml;rkiye (\u0026Ccedil;elik, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The close proximity of cultivated blueberries to wild blueberries can increase the risk of rapid transmission of both known and novel viruses (Martin et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eDespite the occurrence of BlMaV in several countries over the last decade, very limited data regarding its natural transmission are available. Since viruses belonging to the \u003cem\u003eOphiovirus\u003c/em\u003e genus are transmitted by a soil-borne obligate parasitic fungus, \u003cem\u003eOlpidium\u003c/em\u003e spp., it has been suggested that this fungus could also serve as a potential vector for BlMaV (Martin \u0026amp; Tzanetakis, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Recent experimental transmission trials have indicated that \u003cem\u003eOlpidium virulentus\u003c/em\u003e could be a potential vector for BlMaV in the United States (Shands et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2017\u003c/span\u003e)d rkiye (\u0026Ccedil;ağlayan et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Although blueberry plants have not been identified as a natural host for \u003cem\u003eOlpidium\u003c/em\u003e spp., their resting spores can contribute to the transmission of BlMaV in blueberry plants that have been experimentally inoculated.\u003c/p\u003e\u003cp\u003eThis study aimed to investigate the transmission of BlMaV in open field conditions Several trap plants were co-cultivated with virus-free blueberry plants (cv. ‵Bluecrop‵) in soils naturally infested with \u003cem\u003eOlpidium\u003c/em\u003e species, which were collected from the root zones of BlMaV-infected blueberries from one commercial orchard and two wild plantations located in the Black Sea Region of T\u0026uuml;rkiye. \u003cem\u003eOlpidium\u003c/em\u003e spp. were identified using both morphological and molecular techniques. The presence of BlMaV in inoculated blueberry and trap plants was detected by RT-PCR using three different primers amplifying RNA1, RNA2, and RNA3 of the virus.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eCollection of plant and soil samples\u003c/h2\u003e\u003cp\u003eBlueberry plants infected with BlMaV and soil samples from their root zones were collected from Rize province in the Black Sea Region of T\u0026uuml;rkiye between May and June 2020. Plant and soil samples were collected from 3 locations where three different blueberry species are grown. \u003cem\u003eV. corymbosum\u003c/em\u003e (cv. ‵Jersey‵) and soil samples were collected from İkizdere (location 1), where commercial blueberry is grown. \u003cem\u003eV. acrostaphlum\u003c/em\u003e and \u003cem\u003eV. myrtillus\u003c/em\u003e were collected from Demirkapı (location 2) and Anzer (location 3), where wild blueberries are grown, respectively. BlMaV was already reported in all three locations by \u0026Ccedil;ağlayan et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). A total of 60 samples, including 10 plant and 10 soil samples from each location were collected. Approximately 100 g of soil samples were taken from the root zones of BlMaV-infected plants at each location, pooled, mixed well, and dried in an air circulation cabinet at 25\u0026deg;C for 1 week. Subsequently, the soils were passed through a 10-mesh 2mm aperture lab standard test sieve and used for planting the trap and \u003cem\u003ein vitro\u003c/em\u003e blueberry plants according to Herrera-Vasquez et al. (2009).\u003c/p\u003e\u003cp\u003e\u003cb\u003eDetection of\u003c/b\u003e \u003cb\u003eOlpidium\u003c/b\u003e \u003cb\u003espp. by using trap plants\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn order to encourage \u003cem\u003eOlpidium\u003c/em\u003e spp. development, lettuce (\u003cem\u003eLactuca sativa\u003c/em\u003e L.), carrot (\u003cem\u003eDaucus carota\u003c/em\u003e L. subsp. \u003cem\u003esativus\u003c/em\u003e (Hoffm.) Arcang.), broccoli (\u003cem\u003eBrassica oleracea\u003c/em\u003e L. var. \u003cem\u003eitalica\u003c/em\u003e) and cucumber (\u003cem\u003eCucumis sativus\u003c/em\u003e L.) seedlings were used as trap plants. Seeds of trap plants were sown in a mixture of sterile peat, perlite, and sand (1:1:1) and allowed to grow for 10\u0026ndash;14 days. Soils taken from the root zone of BlMaV-infected blueberry plants were mixed with sterile sand at a ratio of 1/10. The soils from each location were distributed equally in 12 pots. Then the trap plants were planted in each pot together with an \u003cem\u003ein vitro\u003c/em\u003e propagated blueberry plant (cv. ‵Bluecrop‵). The experiment was conducted with three replications for each trap plant sown in the soil collected from each location (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Thus, 36 seedlings from each trap plant species and 36 \u003cem\u003ein vitro\u003c/em\u003e blueberry plants were used in the experimental transmission trials. The trap plants and \u003cem\u003ein vitro\u003c/em\u003e blueberries planted in a sterile peat and sand mixture were kept as a control. All plants were grown under controlled conditions (20\u0026deg;C, 70% relative humidity, and 16-hour light and 8-hour dark photoperiod). Four weeks following the transplantation of the trap plants into the soil, their roots were carefully excised using a spatula, ensuring minimal damage to the root systems. The roots of blueberry and trap plants used in the transmission trials were collected every two weeks and subjected to PCR to detect and characterize \u003cem\u003eOlpidium\u003c/em\u003e spp.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMorphological identification of\u003c/b\u003e \u003cb\u003eOlpidium\u003c/b\u003e \u003cb\u003especies using light microscopy\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe roots of BlMaV-infected blueberry plants collected from the field, the roots of the trap plants and \u003cem\u003ein vitro\u003c/em\u003e blueberries used in the transmission trials were excised and subsequently washed with distilled water, then boiled in 10% NaOH solution for 30 minutes. The roots were immersed in a 1% HCl solution for 10 minutes, then thoroughly rinsed with distilled water. The roots were stained with a lactophenol blue solution for 20 minutes in petri dishes. The stained roots were examined under a light microscope to identify species of \u003cem\u003eOlpidium\u003c/em\u003e according to Jorda et al. (2002).\u003c/p\u003e\u003cp\u003e\u003cb\u003eDNA extraction and detection of\u003c/b\u003e \u003cb\u003eOlpidium\u003c/b\u003e \u003cb\u003especies by PCR\u003c/b\u003e\u003c/p\u003e\u003cp\u003e According to the manufacturer's recommendations, total DNAs were extracted from 500 mg of the root tissues using the DNA Plant Mini Kit (Qiagen, The Netherlands). DNA quantity and quality were estimated using a NanoDrop spectrophotometer (Thermo Scientific, USA). PCR was conducted using both generic (ITS1/ITS4) and \u003cem\u003eOlpidium\u003c/em\u003e-specific primer pairs (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The PCR was carried out in total reaction volumes of 25 \u0026micro;l, which included 2 \u0026micro;l of cDNA, 0.5 \u0026micro;l of 10 mM dNTPs, 2 \u0026micro;l of 25 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 2.5 \u0026micro;l of PCR buffer and 1 \u0026micro;l of 10 \u0026micro;M of each primer pairs and 0.5 \u0026micro;l of Go-Taq DNA polymerase (5 units/\u0026micro;l) (ThermoScientific, Lithuania). Amplification was carried out in a thermal cycler using the following parameters: initial denaturation at 94 ⁰C for 5 min, 40 cycles of amplification at 94 ⁰C for 1 min, 54 ⁰C for 1 min, 72 ⁰C for 1 min, and a final extension at 72 ⁰C for 10 min. PCR products were loaded into 1% 1\u0026times;TAE agarose gel stained with a Redsafe\u0026trade; nucleic acid staining solution (Intron Biotechnology, South Korea) for 1 hour at 100 V and visualized under a UV transilluminator. All PCR products were purified and directly sequenced on both strands.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of primer pairs used in PCR/RT-PCR analysis to detect \u003cem\u003eOlpidium\u003c/em\u003e spp. and blueberry mosaic-associated virus (BlMaV)\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequences (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLength\u003c/p\u003e\u003cp\u003e(bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTarget\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eReference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eITS1\u003c/p\u003e\u003cp\u003eITS4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCCGTAGGTGAACCTGCGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e500\u0026ndash;900\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eOlpidium\u003c/em\u003e spp.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGardes and Bruns, 1993\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCCTCCGCTTATTGATATGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eOLPborF\u003c/p\u003e\u003cp\u003eOLPR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCGAGGAAATGAGAGAGATGACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e977\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eO.bornovanus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"5\" rowspan=\"6\"\u003e\u003cp\u003eHerrera-\u003c/p\u003e\u003cp\u003eV\u0026aacute;squez et al., 2009\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCCTCCGCTTATTGATATGCTTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eOLPvirF\u003c/p\u003e\u003cp\u003eOLPR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAACCCAAGACCTGCCCCCAAAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e579\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eO.virulentus\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCCTCCGCTTATTGATATGCTTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eOLPbraF\u003c/p\u003e\u003cp\u003eOLPR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGCTATAGCTCACCCTCTTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e204\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e\u003cem\u003eO. brassicae\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCCTCCGCTTATTGATATGCTTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRNA 1 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCATGTCTTCTACTCTTTCTCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e756\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eBlMaV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eThekke-Veetil et. al., 2014\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRNA 1 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAAATTAGATTTTGTAACAATGCAGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRNA 2 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGAACCTGTATCAAGCATAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e1042\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eBlMaV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRNA 2 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGATTGGAACCATCTCTGCAAAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRNA 3 F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCCTTGTCAATTTCAGTGTTAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e350\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eBlMaV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eIsogai et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRNA 3 R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAAGCGGAAACACAAGGAAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eRT-PCR assay for detection of BlMaV\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from leaves of the blueberries and trap plants using Qiagen RNeasy Plant Mini Kit (Qiagen, The Netherlands). The concentration and quality of RNAs were assessed using a NanoDrop spectrophotometer (Thermo Scientific, USA). Three primer pairs targeting three segments of the BlMaV were utilized for its detection via RT-PCR (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). A two-step protocol was used for cDNA synthesis. First, five \u0026micro;l of RNA, one \u0026micro;l of random hexamer, and 8.5 \u0026micro;l of dH\u003csub\u003e2\u003c/sub\u003eO were incubated at 94 ⁰C for 5 minutes, followed by incubation at -20\u0026deg;C for 5 minutes. In the second step, four \u0026micro;l of 5X RT buffer, 0.5 \u0026micro;l of dNTP, and one \u0026micro;l of RNase enzyme were incubated at 42 ⁰C for one hour, then at 72 ⁰C for 10 minutes (Thermo Fisher Scientific, USA). PCR was conducted in a total volume of 25 \u0026micro;L, which included two \u0026micro;l cDNA, 2.5 \u0026micro;l 10\u0026times;PCR buffer solution, two \u0026micro;l 25 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.5 \u0026micro;l 10 mM dNTPs, 0.5 \u0026micro;l of each primer pair (10 \u0026micro;M), and 0.2 \u0026micro;l Taq DNA polymerase (5 units/\u0026micro;l). Amplification was carried out in a thermal cycler using the following parameters: initial denaturation at 94 ⁰C for 3 min, 35 cycles of amplification at 94 ⁰C for 20 sec, 50\u0026ndash;55 ⁰C for 20 sec, 72 ⁰C for 1 min, and a final extension at 72 ⁰C for 10 min. Agarose gel electrophoresis, visualization, and sequencing were carried out as previously described.\u003c/p\u003e\n\u003ch3\u003eSequence and Phylogenetic Analysis\u003c/h3\u003e\n\u003cp\u003eThe obtained sequences were analyzed using the BLAST algorithm, and related sequences were retrieved from GenBank. Multiple sequence alignments of the isolates were conducted using ClustalW v1.81 (Thompson et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Phylogenetic analysis was conducted by Mega X (Kumar et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) using the Neighbor-Joining method (Saitou \u0026amp; Nei, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1987\u003c/span\u003e) using 1000 bootstrap replicates.\u003c/p\u003e"},{"header":"Results and Discussion","content":"\u003cp\u003e\u003cb\u003eRT-PCR analysis of\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003epropagated and open-field blueberries for BlMaV\u003c/b\u003e\u003c/p\u003e\u003cp\u003eRT-PCR using CP- specific primers confirmed that all 30 blueberry samples collected from one commercial orchard and two wild blueberry plantations were positive for BlMaV and expected amplifications (350bp) were observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) although the \u003cem\u003ein vitro\u003c/em\u003e blueberry plants used in the transmission trials were negative (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eMorphological identification of\u003c/b\u003e \u003cb\u003eOlpidium\u003c/b\u003e \u003cb\u003especies by light microscopy\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe roots of each trap plant and \u003cem\u003ein vitro\u003c/em\u003e blueberry saplings planted next to them were stained to examine the presence of sporangia and resting spores of \u003cem\u003eOlpidium\u003c/em\u003e species by light microscopy. The resting spores were present either individually or in clusters. Most of the resting spores were 8\u0026ndash;12 \u0026micro;m in diameter and exhibited a pentagonal or hexagonal appearance with sharp corners. In contrast, the sporangia were characterized by an oval or spherical shape (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Although sporangia and resting spores of \u003cem\u003eOlpidium\u003c/em\u003e spp. were observed in lettuces and adjacent blueberries planted in soils collected from all three plantations, a higher intensity of sporangia and resting spores were detected in the soils collected from the root zone of lowbush wild blueberries (\u003cem\u003eV. myrtillus)\u003c/em\u003e grown in Anzer district. The zoospores and resting spores from lettuce-, broccoli-, cucumber-, and carrot-infecting \u003cem\u003eOlpidium\u003c/em\u003e isolates were morphologically indistinguishable. Due to the analysis of the ITS regions revealed consistent and significant differences between some host types of \u003cem\u003eOlpidium\u003c/em\u003e isolates (Hartwright et al., 2009), PCR analysis was performed to discriminate fungi species.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMolecular detection, sequencing, and phylogenetic analysis of\u003c/b\u003e \u003cb\u003eOlpidium\u003c/b\u003e \u003cb\u003especies\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe roots of \u003cem\u003ein vitro\u003c/em\u003e blueberries and trap plants grown in \u003cem\u003eOlpidium-\u003c/em\u003einfested soils were subjected to PCR using universal primers to amplify the rDNA-ITS region and also species-specific primers for \u003cem\u003eOlpidium\u003c/em\u003e spp. The expected PCR products of 204\u0026ndash;579 (OLPvirF/R) and 900 (ITS1-ITS4) bp were amplified from all blueberryxtrap plant combinations except the cucumber x blueberry in all locations (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Among sequenced 13 \u003cem\u003eO. virulentus\u003c/em\u003e isolates, 9 were obtained from the blueberry x lettuce, 2 from the broccoli x blueberry and one from the carrot x blueberry combinations (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The multiple sequence alignment revealed that Turkish \u003cem\u003eO. virulentus\u003c/em\u003e isolates obtained in the present study grouped together and share 99.80\u0026ndash;100% nucleotide identity. However, they had 97% identity with several isolates from Italy (KF661296), Canada (KF493955), and Jordan (MN238817). The \u003cem\u003eO. virulentus\u003c/em\u003e-blueberry (MW483635) and \u003cem\u003eO. virulentus\u003c/em\u003e-lettuce (MW483627) isolates had 95.98% and 96.38% identity with four Turkish lettuce isolates already deposited in GenBank (MK054240- MK054243) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Besides \u003cem\u003eO. virulentus\u003c/em\u003e, only one \u003cem\u003eO. brassicae\u003c/em\u003e (204 bp) isolate was detected from a blueberry sample co-cultivated with broccoli in location 1, while no \u003cem\u003eO. bornovanus\u003c/em\u003e was detected in any soils. The Turkish isolate of \u003cem\u003eO. brassicae\u003c/em\u003e shared the highest identity (99.24%) with isolates from Italy (MT596166) and Portugal (EU981906), whereas it shared the lowest identity (85.50%) with an isolate from Spain (EU981900). In the phylogenetic tree, Turkish \u003cem\u003eO. brassicae\u003c/em\u003e isolate was clustered with the Italian and Portuguese isolates, distinct from the other isolates available in GenBank, as confirmed by a robust bootstrap (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cem\u003eOlpidium\u003c/em\u003e spp. have been recognized as economically important fungal vectors of several plant viruses, including \u003cem\u003eTombusvirus cucumis\u003c/em\u003e (cucumber necrosis virus (CNV)), \u003cem\u003eGammacarmovirus melonis\u003c/em\u003e (melon necrotic spot virus (MNSV)), \u003cem\u003eAlphanecrovirus nicotianae\u003c/em\u003e (tobacco necrosis virus (TNV)), tobacco stunt virus (TStV: unclassified \u003cem\u003eVaricosavirus\u003c/em\u003e), \u003cem\u003eOphiovirus mirafioriense\u003c/em\u003e (mirafiori lettuce big-vein virus (MLBVV)), and \u003cem\u003eVaricosavirus lactucae\u003c/em\u003e \u003cb\u003e(\u003c/b\u003elettuce big-vein associated virus (LBVaV)) (Campbell, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Specific host-virus associations among \u003cem\u003eOlpidium\u003c/em\u003e species were already reported such as non-crucifer infecting \u003cem\u003eOlpidium\u003c/em\u003e isolates could transmit MLBVV and TStV, while crucifer infecting \u003cem\u003eOlpidium\u003c/em\u003e isolates failed (Sasaya and Koganezawa, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). The differences in ITS sequences between isolates specific to different host plants indicated that molecular tests can discriminate \u003cem\u003eOlpidium\u003c/em\u003e isolates with distinct host preferences and virus-vectoring specificities, enabling the assessment of field soils for infection risks and the spread of critical viruses transmitted by \u003cem\u003eOlpidium\u003c/em\u003e spp. (Hartwright et al., 2009). Additional research is essential on the virus-vector relationships of some \u003cem\u003eOlpidium\u003c/em\u003e isolates to determine the commercial importance of differentiating between host-specific groups.\u003c/p\u003e\n\u003ch3\u003eExperimental transmission trials of BlMaV through trap plants\u003c/h3\u003e\n\u003cp\u003eAll blueberries and trap plants used in the experimental transmission trials were closely monitored for the development of symptoms. Inoculated blueberry seedlings displayed virus-like symptoms such as leaf reddening and mottling within 6 months. Lettuce seedlings showed vein clearing, blistering, and mild mosaic symptoms (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e) while no symptoms were observed on carrot, broccoli, cucumber, or in the negative control plants. All plants used in the experimental transmission trials were subjected to PCR/RT-PCR to verify the presence of \u003cem\u003eOlpidium\u003c/em\u003e spp. and BlMaV (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eExperimental transmission of BlMaV using soil contaminated with \u003cem\u003eOlpidium\u003c/em\u003e spp. collected from the root zone of BlMaV-infected blueberries.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eTrap plants/Adjacent blueberries\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eLocation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eNumber of plants tested\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eNumber of plants with \u003cem\u003eOlpidium\u003c/em\u003e resting spores observed under the microscope\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e\u003cp\u003eNumber of \u003cem\u003eOlpidium\u003c/em\u003e spp. positive plants by PCR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eNumber of BlMaV\u003c/p\u003e\u003cp\u003epositive plants by RT-PCR\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003eO. vir.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eO.bor.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e\u003cb\u003eO.bras.\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eLettuce/\u003c/p\u003e\u003cp\u003eBlueberry\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3/2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e3/2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e2/3\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3/3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e3/3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e2/2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3/2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e3/3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e1/2\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eBroccoli/\u003c/p\u003e\u003cp\u003eBlueberry\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2/1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1/2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e1/1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2/2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e2/3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2/3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e2/2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eCarrot/\u003c/p\u003e\u003cp\u003eBlueberry\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1/1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1/1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2/1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e2/1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2/2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0/1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eCucumber/\u003c/p\u003e\u003cp\u003eBlueberry\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1/1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1/2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLoc 3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3/3\u0026thinsp;=\u0026thinsp;6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2/2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0/0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn this study, 13 BlMaV isolates from experimental transmission trials were obtained by RT-PCR using primer pairs targeting the partial RNA3 gene (CP) of the virus (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). When blueberries were planted next to lettuce in soils collected from location 1, two lettuces and three blueberries were found infected by BlMaV; two lettuces and two blueberries were found infected in location 2; and one lettuces and three blueberries were found infected in location 3 by RT-PCR using RNA3 F/R primers. When the plants in blueberry x carrot combinations tested by the same primers, only one blueberry plant was found positive for BlMaV, whereas all carrot and other blueberry plants were negative. Likewise, BlMaV was not detected in broccoli, cucumbers, and blueberries cultivated next to these plants. Multiple sequence analysis showed that the identity range among these isolates was 99\u0026ndash;100% and the highest identity was with a Japanese isolate (LC066301) (97.81%), while they shared the lowest identity with a Serbian isolate (KP188574) (90.32%). In the phylogenetic analysis, all isolates obtained in this study were grouped together along with several isolates from T\u0026uuml;rkiye, Slovenia, Japan, and USA (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Two \u003cem\u003eOphiovirus ranunculi\u003c/em\u003e isolates (MZ507608 and MZ507609) were used as outgroups. RT-PCR results were confirmed by using the primer pairs targeting RNA2 (MP) and RNA3 (CP) of the virus (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWhen RNA1F/R primers amplifying partial RNA1 was used, 756 bp amplicon was obtained only from one blueberry plant grown next to lettuce plant. The isolate was sequenced and deposited in GeneBank (Acc. no. OK0400161). It shared 100% identity with 6 Turkish BlMaV isolates (MW889974-75, MW889977, MW889081-83) and one Japanese isolate (LC066299). In phylogenetic analysis, these isolates were clustered together and had 89.62% identity with a Serbian isolate (KP188574) and 89.77% with a German isolate (OK181783), which placed in a distinct group in the phylogenetic tree. \u003cem\u003eOphiovirus lactucae\u003c/em\u003e (AY535016) and \u003cem\u003eO. citri\u003c/em\u003e (AY224663) were used as outgroups (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). In the RT-PCR analyses using RNA2F/R primer pairs amplifying RNA2 of BlMaV, the amplicon of 1042 bp was successfully obtained from one blueberry and one adjacent lettuce plant. Sequence analysis revealed that these two isolates shared the highest identity (99.9%) with a Japanese BlMaV isolate (LC066300), while they had the lowest identity (92.07%) with a German isolate (OK181784). In phylogenetic analysis, these two isolates were grouped with other Turkish BlMaV isolates along with a Japanese isolate (LC066300) (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). \u003cem\u003eOphiovirus ranunculi\u003c/em\u003e (OL472212) and \u003cem\u003eOphiovirus lactucae\u003c/em\u003e (ON398507) were used as outgroups.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eRecently, blueberry production and consumption have become increasingly prevalent in T\u0026uuml;rkiye like other many countries. This has led to extensive germplasm exchange between countries and increased the risk of disease transmission, thereby emphasizing the importance of inspection and certification programs using precise and highly sensitive techniques. During the first survey study conducted 2014\u0026ndash;2017 in T\u0026uuml;rkiye, the virus was detected in 23 out of 157 blueberry samples by RT-PCR (\u0026Ccedil;ağlayan et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Sequence and phylogenetic analyses indicated that Turkish BlMaV isolates shared a high degree of identity; however, they were significantly diverged from isolates originating in other countries. Our recent findings are consistent with previous studies conducted in T\u0026uuml;rkiye (\u0026Ccedil;ağlayan et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016a\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003eb\u003c/span\u003e; 2017a, b; Gazel et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThere has been no clear information regarding the natural transmission of BlMaV. However, recent findings suggest that \u003cem\u003eOlpidium\u003c/em\u003e spp. may serve as a potential vector for the virus (Martin \u0026amp; Tzanetakis, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Shands et al. (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) conducted an experimental transmission assay that indicated \u003cem\u003eO. virulentus\u003c/em\u003e may serve as a potential vector for BlMaV. Although blueberry plants have not been identified as a natural host for \u003cem\u003eOlpidium\u003c/em\u003e spp., the resting spores of \u003cem\u003eO. virulentus\u003c/em\u003e play a significant role in the transmission of BlMaV (Shands et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, \u0026Ccedil;ağlayan et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eMorphological examination and PCR analysis revealed the presence of \u003cem\u003eO. virulentus\u003c/em\u003e in the roots of the trap plants and blueberries cultivated in the \u003cem\u003eolpidium\u003c/em\u003e infested soils collected from where both cultivated and wild blueberries are grown. \u003cem\u003eO. virulentus\u003c/em\u003e was detected in 22 blueberry, 13 lettuce, 2 broccoli and 1 carrot plants grown in \u003cem\u003eolpidium\u003c/em\u003e infested soils collected from 3 different locations. \u003cem\u003eO. brassicae\u003c/em\u003e was detected in only one blueberry planted next to broccoli. These two species cannot be differentiated by morphological techniques (Aleandri et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The resting spores were 8\u0026ndash;12 \u0026micro;m in diameter and exhibited a stellate appearance, while the sporangia were oval or spherical. Our results agree with Sasaya \u0026amp; Koganezawa (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), who referred to lettuce-infecting isolates as \u003cem\u003eO. virulentus\u003c/em\u003e and brassica-infecting isolates as \u003cem\u003eO. brassicae\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eThe transmission trials verified \u003cem\u003eO. virulentus\u003c/em\u003e as a vector of BlMaV and it was successfully transmitted to lettuce and blueberry seedlings, but not to broccoli, carrot, and cucumber plants. We detected BlMaV in lettuce and adjacent blueberry plants grown in naturally olpidium infested soils by RT-PCR while no sporangia and resting spores were observed in the roots of control plants. These findings have expanded our knowledge about epidemiology and the host range of BlMaV, which can be important for developing management strategies. Using virus-free cuttings and conducting plant root and soil tests for the presence of \u003cem\u003eOlpidium\u003c/em\u003e spp. prior to planting (Ghorbani et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), can contribute to effective disease management via avoiding planting susceptible crops and the establishment of profitable blueberry orchards.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sequences were deposited in GenBank and are publicly available.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Scientific and Technological Research Council of T\u0026uuml;rkiye (T\u0026Uuml;BİTAK) (Project Number: 120O382).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAleandri, M. P., Martignoni, D., Reda, R., Alfaro-Fern\u0026aacute;ndez, A., Font, M. I., Armengol, J., \u0026amp; Chilosi, G. (2014). First report of \u003cem\u003eOlpidium bornovanus\u003c/em\u003e and \u003cem\u003eO. virulentus\u003c/em\u003e on melon in Italy. \u003cem\u003ePlant Disease\u003c/em\u003e, 98(7), 997-997.\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;ağlayan, K., Gazel, M., El\u0026ccedil;i, E., \u0026Ccedil;elik, H., G\u0026uuml;nd\u0026uuml;z, K., Mavric, I., Grubar, B., Marn, M.V., 2015. Large scale survey on virus diseases of \u003cem\u003eRubus\u003c/em\u003e and \u003cem\u003eVaccinium\u003c/em\u003e species in Turkey. 23. \u003cem\u003eInternational Conference on Virus and other Graft Transmissible Diseases of Fruit Crops [ICVF].\u003c/em\u003e 8-12, June 2015, Morioka Japan, s 66.\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;ağlayan, K., Gazel, M., G\u0026uuml;nd\u0026uuml;z, K., El\u0026ccedil;i, E., \u0026Ccedil;elik, H., Marn, M.V., 2016a. \u0026Uuml;lkemiz Maviyemiş Plantasyonlarında Bazı Vir\u0026uuml;slerin Tespit Edilmesi ve Molek\u0026uuml;ler Karakterizasyonu. \u003cem\u003eUluslararası katılımlı T\u0026uuml;rkiye VI. Bitki Koruma Kongresi\u003c/em\u003e, 5-8 Eyl\u0026uuml;l 2016, Konya, p 640.\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;ağlayan, K., \u0026Ccedil;elik, H., Gazel, M., El\u0026ccedil;i, E., G\u0026uuml;nd\u0026uuml;z, K., Grubar, B., Marn, M.V., 2016b. Occurrence of Vaccinium viruses in Black Sea region of Turkey. \u003cem\u003eXI. International Vaccinium Symposium\u003c/em\u003e, Orlando-Florida, U.S.A, 10-14 April, 2016, p,170.\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;aglayan, K., Gazel, M., El\u0026ccedil;i, E., Plesko, I. M., Virscek Marn, M., 2017a. Viruses Infecting Small Fruits in Turkey.International Conference on Agriculture, Forest, \u003cem\u003eFood Sciences and Technologies\u003c/em\u003e, Cappadocia-Turkey, 15-17 May, 2017, p,1154.\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;aglayan, K., Gazel, M., El\u0026ccedil;i, E., Vir\u0026scaron;ček Marn M., Mavric Ple\u0026scaron;ko, I., 2017b. Prevalance of Blueberry mosaic associated virus in cultivated Blueberries in Turkey. 24. \u003cem\u003eInternational Conference on Virus and other Graft Transmissible Diseases of Fruit Crops [ICVF]\u003c/em\u003e. Thessaloniki, Greece, 5-9 June 2017, p, 130.\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;ağlayan, K., Akkan, R., Gazel, M., F. M. Tok. 2021. First report of the \u003cem\u003eOlpidium virulentus\u003c/em\u003e\u0026ndash;mediated transmission of blueberry mosaic-associated virus in blueberries in Turkey. \u003cem\u003eJournal of Plant Pathology\u003c/em\u003e, 103, 1349.\u003c/li\u003e\n\u003cli\u003eCampbell, R. N. (1996). Fungal transmission of plant viruses. \u003cem\u003eAnnual review of phytopathology\u003c/em\u003e, 34(1), 87-108.\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;elik H (2022). D\u0026uuml;nyada ve T\u0026uuml;rkiye\u0026rsquo;de maviyemiş \u0026uuml;retimi. \u003cem\u003eTarım G\u0026uuml;ndem\u003c/em\u003e, 12(71): 78-86.\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;elik, H. (2024). Blueberry Production and Economy. \u003cem\u003eHarman Time\u003c/em\u003e, 12(134): 60\u0026ndash;66. (In Turkish).\u003c/li\u003e\n\u003cli\u003eCieślińska, M., 2020. First Report of Blueberry Mosaic Associated Virus in Highbush Blueberry in Poland. \u003cem\u003ePlant Disease\u003c/em\u003e, 104:10, 2743. \u003c/li\u003e\n\u003cli\u003eGardes, Monique, and Thomas D. Bruns. \u0026quot;ITS primers with enhanced specificity for basidiomycetes‐application to the identification of mycorrhizae and rusts. \u003cem\u003eMolecular ecology,\u003c/em\u003e 2.2 (1993): 113-118.\u003c/li\u003e\n\u003cli\u003eGauthier, N. W., Polashock, J. J.Thekke-Veetil, T., Martin, R. R., Beale, J., 2015. First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky. \u003cem\u003ePlant Disease\u003c/em\u003e, 99, 421. doi:10.1094/PDIS-09-14-0946-PDN\u003c/li\u003e\n\u003cli\u003eGazel,M., El\u0026ccedil;i, E., \u0026Ccedil;elik, H., G\u0026uuml;nd\u0026uuml;z, K., Plesko, I.M, Marn, M.V., \u0026Ccedil;ağlayan, K., 2015. The presence of Blueberry mosaic associated virus in \u003cem\u003eVaccinium\u003c/em\u003e spp. in Turkey. 23. \u003cem\u003eInternational Conference on Virus and other Graft Transmissible Diseases of Fruit Crops [ICVF].\u003c/em\u003e 8-12 June 2015, Morioka Japan, s 100.\u003c/li\u003e\n\u003cli\u003eGhorbani, A., Izadpanah, K., Manzari, F., \u0026amp; Roumi, V. (2013). A Simple Method for Detection of \u003cem\u003ePolymyxa Betae\u003c/em\u003e and Beet Necrotic Yellow Vein Virus in Soil. \u003cem\u003eJournal of Plant Pathology\u003c/em\u003e, 95(3), 533\u0026ndash;537.\u003c/li\u003e\n\u003cli\u003eHartwright, L. M., Hunter, P. J., \u0026amp; Walsh, J. A. (2010). A comparison of Olpidium isolates from a range of host plants using internal transcribed spacer sequence analysis and host range studies. \u003cem\u003eFungal biology\u003c/em\u003e, 114(1), 26-33.\u003c/li\u003e\n\u003cli\u003eHerrera-V\u0026aacute;squez J\u0026Aacute;, del Carmen Cebri\u0026aacute;n M, Alfaro-Fern\u0026aacute;ndez A, del Carmen C\u0026oacute;rdoba M, Jord\u0026aacute; C, 2009. Multiplex PCR assay for simultaneous detection and differentiation of \u003cem\u003eOlpidium bornovanus\u003c/em\u003e, \u003cem\u003eO. brassicae\u003c/em\u003e and \u003cem\u003eO. virulentus\u003c/em\u003e. \u003cem\u003eMycological Research\u003c/em\u003e, 113:602\u0026ndash;610.\u003c/li\u003e\n\u003cli\u003eIsogai, M.; Matsuhashi, Y.; Suzuki, K.; Yashima, S.; Watanabe, M.; Yoshikawa, N., 2016. Occurrence of blueberry mosaic associated virus in highbush blueberry trees with blueberry mosaic disease in Japan. \u003cem\u003eJournal of General Plant Pathology\u003c/em\u003e, 82, 177\u0026ndash;179.\u003c/li\u003e\n\u003cli\u003eJevremović, D., Leposavić, A., Paunović, S., 2015. First report of blueberry mosaic-associated virus in highbush blueberry in Serbia.\u003cem\u003e Journal of Plant Pathology, \u003c/em\u003e97 (3), 541.\u003c/li\u003e\n\u003cli\u003eJord\u0026aacute; C, Armengol J, Gisbert J, Osca JM, Lacasa A, Vel\u0026aacute;squez B, 2002. El tratamiento con microondas para la desinfecci\u0026oacute;n de suelos. \u003cem\u003ePhytoma-Espa\u0026ntilde;a\u003c/em\u003e, 138, 118\u0026ndash;21.\u003c/li\u003e\n\u003cli\u003eKalt, W., Cassidy, A., Howard, L. R., Krikorian, R., Stull, A. J., Tremblay, F., \u0026amp; Zamora-Ros, R. (2020). Recent Research on the Health Benefits of Blueberries and Their Anthocyanins. \u003cem\u003eAdvances in Nutrition\u003c/em\u003e, 11(2), 224\u0026ndash;236. https://doi.org/10.1093/advances/nmz065\u003c/li\u003e\n\u003cli\u003eKumar S, Stecher G, Li, M., Knyaz, C., Tamura K. (2018). MEGAX: Molecular Evolutionary Genetics Analysis across Computing Platforms. \u003cem\u003eMolecular Biology and Evolution\u003c/em\u003e (MBE), 35(6): 1547-1549. https://doi.org/10.1093/molbev/msy096\u003c/li\u003e\n\u003cli\u003eLyrene, P.M., Perry, J.L. (1988). Blueberries (\u003cem\u003eVaccinium\u003c/em\u003e spp.). In: Bajaj, Y.P.S. (eds) Crops II. \u003cem\u003eBiotechnology in Agriculture and Forestry\u003c/em\u003e, vol 6. Springer, Berlin, Heidelberg. https://doi.org/10.1007/978-3-642-73520-2_8\u003c/li\u003e\n\u003cli\u003eMartin, R. R., and Tzanetakis, I. E. 2017. Page 64 in: Compendium of Blueberry, Cranberry and Lingonberry, \u003cem\u003eDiseases and Pests\u003c/em\u003e, APS Press, St. Paul, MN.\u003c/li\u003e\n\u003cli\u003eMartin, R. R., \u0026amp; Tzanetakis, I. E. (2018). High risk blueberry viruses by region in north america; implications for certification, nurseries, and fruit production. \u003cem\u003eViruses\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(7), 342.\u003c/li\u003e\n\u003cli\u003eMartin, R. R., Polashock, J. J., \u0026amp; Tzanetakis, I. E. (2012). New and emerging viruses of blueberry and cranberry. \u003cem\u003eViruses\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e(11), 2831-2852. https://doi. org/10.3390/v4112831\u003c/li\u003e\n\u003cli\u003eMenzel, W., Knierim, D., Margaria, P., Winter, S., Entrop, A. P., Stremer, P., \u0026amp; Heupel, M. (2021). First report of Blueberry mosaic associated virus associated with mosaic symptoms of blueberry in Germany. \u003cem\u003eNew Disease Reports\u003c/em\u003e, \u003cem\u003e44\u003c/em\u003e(2). https://doi.org/10.1002/ndr2.12051\u003c/li\u003e\n\u003cli\u003eRamsdell, D. C., and A. W. Stretch. Blueberry mosaic. \u003cem\u003eAgriculture handbook-United States Department of Agriculture, Combined Forest Pest Research and Development Program (USA),\u003c/em\u003e (1987).\u003c/li\u003e\n\u003cli\u003eRaniere, L. C. (1960). Responses of cultivated high bush blueberry varieties to the known blueberry viruses. \u003cem\u003eProceedings of the Twenty-eighth Annual Blueberry Open House\u003c/em\u003e, \u003cem\u003e28\u003c/em\u003e, 18-20.\u003c/li\u003e\n\u003cli\u003eSaad, N., Olmstead, J. W., Jones, J. B., Varsani, A., \u0026amp; Harmon, P. F. (2021). Known and new emerging viruses infecting blueberry. \u003cem\u003ePlants\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(10), 2172. https://doi.org/10.3390/plants10102172\u003c/li\u003e\n\u003cli\u003eSaitou, N., \u0026amp; Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. \u003cem\u003eMolecular biology and evolution\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e(4), 406-425.\u003c/li\u003e\n\u003cli\u003eSasaya, T., \u0026amp; Koganezawa, H. (2006). Molecular analysis and virus transmission tests place Olpidium virulentus, a vector of Mirafiori lettuce big-vein virus and tobacco stunt virus, as a distinct species rather than a strain of Olpidium brassicae. \u003cem\u003eJournal of General Plant Pathology\u003c/em\u003e, \u003cem\u003e72\u003c/em\u003e(1), 20-25.\u003c/li\u003e\n\u003cli\u003eShands, A. C., Crandall, S. G., \u0026amp; Miles, T. D. (2017). First report of the ability of Olpidium virulentus to vector blueberry mosaic associated virus (BlMaV) on southern highbush blueberry in California. \u003cem\u003ePlant Disease\u003c/em\u003e, \u003cem\u003e101\u003c/em\u003e(9), 1683.https://doi.org/10.1094/PDIS-02-17-0201-PDN \u003c/li\u003e\n\u003cli\u003eThekke-Veetil, T., Ho, T., Keller, K. E., Martin, R. R., \u0026amp; Tzanetakis, I. E. (2014). A new ophiovirus is associated with blueberry mosaic disease. \u003cem\u003eVirus Research\u003c/em\u003e, \u003cem\u003e189\u003c/em\u003e, 92-96. https://doi.org/10.1016/j.virusres.2014.05.019 \u003c/li\u003e\n\u003cli\u003eThekke-Veetil, T., Polashock, J. J., Marn, M. V., Plesko, I. M., Schilder, A. C., Keller, K. E., ... \u0026amp; Tzanetakis, I. E. (2015). Population structure of blueberry mosaic associated virus: Evidence of reassortment in geographically distinct isolates. \u003cem\u003eVirus Research\u003c/em\u003e, \u003cem\u003e201\u003c/em\u003e, 79-84.\u003c/li\u003e\n\u003cli\u003eThompson, J. D., Higgins, D. G., \u0026amp; Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. \u003cem\u003eNucleic acids research\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(22), 4673-4680.\u003c/li\u003e\n\u003cli\u003eVarney, E. H. (1957). Mosaic and shoestring, virus diseases of cultivated Blueberry in New Jersey.\u003c/li\u003e\n\u003cli\u003eWalker, P. J., Siddell, S. G., Lefkowitz, E. J., Mushegian, A. R., Adriaenssens, E. M., Alfenas-Zerbini, P., ... \u0026amp; Zerbini, F. M. (2022). Recent changes to virus taxonomy ratified by the International Committee on Taxonomy of Viruses (2022). \u003cem\u003eArchives of virology\u003c/em\u003e, \u003cem\u003e167\u003c/em\u003e(11), 2429-2440. https://doi.org/10.1007/s00705-022-05516-5\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ejpp","sideBox":"Learn more about [European Journal of Plant Pathology](http://link.springer.com/journal/10658)","snPcode":"10658","submissionUrl":"https://www.editorialmanager.com/ejpp/default2.aspx","title":"European Journal of Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Blueberry mosaic associated virus, lettuce, Olpidium virulentus, sequencing, PCR/RT-PCR, transmission","lastPublishedDoi":"10.21203/rs.3.rs-7345056/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7345056/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBlueberry (\u003cem\u003eVaccinium\u003c/em\u003e spp.) is the second most significant berry crop globally, and its economic importance in T\u0026uuml;rkiye has increased markedly in recent years. Blueberry mosaic-associated virus (BlMaV) has been identified as the causal agent of a significant disease known as blueberry mosaic disease (BMD) reported from several countries, including T\u0026uuml;rkiye. Recently, concerns have been raised regarding the natural spread of virus due to the presence of BlMaV both in cultivated and wild blueberries. In this study, we investigated the potential involvement of \u003cem\u003eOlpidium\u003c/em\u003e spp. in the natural transmission of BlMaV in blueberry plantations. Several trap plants, such as lettuce, carrot, broccoli, and cucumber, were co-cultivated with virus-free \u003cem\u003ein vitro\u003c/em\u003e propagated blueberry plants (cv. ‵Bluecrop‵) in soils collected from root zones of BlMaV-infected blueberries grown in a commercial orchard and two wild plantations in Rize province located in the Black Sea Region of T\u0026uuml;rkiye. When the samples taken from the capillary roots of all trap plants and in vitro blueberry plants were stained and examined under a light microscope, resting spores of the \u003cem\u003eOlpidium\u003c/em\u003e species were observed on some of the lettuce, broccoli, carrot, and the adjacent \u003cem\u003ein vitro\u003c/em\u003e blueberry roots one month after planting. All plants used in the experimental transmission trials were subjected to PCR/RT-PCR to verify the presence of both \u003cem\u003eOlpidium\u003c/em\u003e spp. and BlMaV. The presence of \u003cem\u003eOlpidium virulentus\u003c/em\u003e on the roots of trap plants and blueberry was confirmed by PCR analysis using both generic (ITS1/ITS4) and species specific primer pairs. While a high BlMaV infection rate was detected in the leaves of lettuce and adjacent blueberries planted in soil collected from the root zones of BlMaV-infected blueberries from all three locations, the virus could not be detected in other trap plants. However, only in location 3, two blueberry plants planted next to broccoli and one blueberry plant planted next to carrots were found to be infected by BlMaV. This study confirms the transmission of BlMaV by \u003cem\u003eO. virulentus\u003c/em\u003e under natural conditions. Additionally, our findings indicate that BlMaV is effectively transmitted in wild blueberry plantations, which may elucidate the transmission of BlMaV from wild blueberries to cultivated plantations or vice versa.\u003c/p\u003e","manuscriptTitle":"Natural transmission of blueberry mosaic-associated virus (Ophiovirus vaccinii) in cultivated and wild blueberries by Olpidium virulentus and its potential role in disease epidemiology","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-09 14:34:38","doi":"10.21203/rs.3.rs-7345056/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revisions","date":"2025-10-07T02:55:26+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-09-03T08:04:24+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-02T10:33:43+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"European Journal of Plant Pathology","date":"2025-08-13T07:50:34+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-12T12:37:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"European Journal of Plant Pathology","date":"2025-08-11T06:03:31+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ejpp","sideBox":"Learn more about [European Journal of Plant Pathology](http://link.springer.com/journal/10658)","snPcode":"10658","submissionUrl":"https://www.editorialmanager.com/ejpp/default2.aspx","title":"European Journal of Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"952833d2-d7f4-4838-9cf8-fe66765c4f6a","owner":[],"postedDate":"September 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-05-04T16:05:26+00:00","versionOfRecord":{"articleIdentity":"rs-7345056","link":"https://doi.org/10.1007/s10658-026-03235-0","journal":{"identity":"european-journal-of-plant-pathology","isVorOnly":false,"title":"European Journal of Plant Pathology"},"publishedOn":"2026-04-28 15:58:10","publishedOnDateReadable":"April 28th, 2026"},"versionCreatedAt":"2025-09-09 14:34:38","video":"","vorDoi":"10.1007/s10658-026-03235-0","vorDoiUrl":"https://doi.org/10.1007/s10658-026-03235-0","workflowStages":[]},"version":"v1","identity":"rs-7345056","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7345056","identity":"rs-7345056","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}