Influence of MHC on genetic diversity and testicular expression of linked olfactory receptor genes

Influence of MHC on genetic diversity and testicular expression of linked olfactory receptor genes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Influence of MHC on genetic diversity and testicular expression of linked olfactory receptor genes Mingue Kang, Byeongyong Ahn, Jae Yeol Shin, Hye-sun Cho, Jongan Lee, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4905052/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Feb, 2025 Read the published version in BMC Genomics → Version 1 posted 4 You are reading this latest preprint version Abstract Background Olfactory receptor (OR) genes are highly polymorphic and form extensive families that recognize a wide range of vertebrate odorants. Although OR gene clusters are dispersed across many regions of vertebrate genomes, ORs expressed in the testes exhibit major histocompatibility complex (MHC)-linked structural conservation. Results In this study, we selected nine MHC-linked OR genes based on their expression levels in pig testes and developed a sequence-based typing method for these genes. We then performed high-resolution typing of these OR genes, along with three major classical MHC class I genes (SLA-1, -2 , and − 3 ), in 48 pigs across six breeds. We observed significantly higher allelic diversity (P < 0.01) in ORs with strong linkage disequilibrium (LD) to SLA compared to those with weak or no LD, and we identified 48 SLA class I-OR haplotypes using the expectation-maximization algorithm. The genetic diversity of SLA-linked ORs was positively correlated with their expression levels in the testis. Specifically, SLA-linked ORs with higher testicular expression (FPKM ≥ 0.1) exhibited an increase in the number of codons under mutually diversifying selection with SLA compared to those with lower expression (FPKM < 0.1). Conclusions Our results suggest the presence of evolutionary interactions between the MHC and linked OR genes. These characteristics of SLA-linked ORs support the potential involvement of MHC-linked ORs in MHC-based mate selection. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Olfactory receptors (ORs) are G protein-coupled receptors (GPCRs) responsible for odorant recognition, primarily expressed in olfactory neurons [ 1 ]. OR genes are highly diverse, forming extensive gene families that recognize a wide range of odorants and are organized into clusters across multiple chromosomes in the vertebrate genome [ 2 – 5 ]. The number of OR genes and the extent of pseudogenization vary significantly among species, reflecting the importance of olfaction for their survival. For example, pigs ( Sus scrofa ), cattle ( Bos taurus ), mice ( Mus musculus ), and humans ( Homo sapiens ) possess 1,301 (14.5% pseudogenes), 1,071 (17.7% pseudogenes), 1,483 (23.1% pseudogenes), and 874 OR genes (55.5% pseudogenes), respectively [ 6 – 8 ]. Notably, marine mammals exhibit a reduced OR repertoire compared to terrestrial animals [ 9 – 12 ]. ORs are also implicated in functions beyond odor recognition and olfactory signal transduction, as they are expressed in a variety of tissues and cells, including the brain, tongue, heart, spleen, and pancreas [ 13 – 15 ]. Noncanonical OR expression has been associated with the modulation of cell-cell recognition, migration, proliferation, apoptosis, exocytosis, and pathfinding processes [ 16 – 20 ]. Furthermore, several ORs are expressed in the testes and sperm cells, where they detect specific odorant molecules that trigger Ca 2+ signals, which are crucial for changes in sperm motility and chemotaxis [ 21 – 23 ]. Intriguingly, ORs expressed in the testes are genetically linked to highly variable major histocompatibility complexes (MHC) and GABBR1 , which are involved in recognizing foreign antigens for the adaptive immune response and play a role in sperm acrosome reactions, respectively [ 15 , 24 – 27 ]. The conserved architecture of OR- GABBR1 -MHC genes across vertebrate species may contribute to MHC genotype-based mating preferences, favoring individuals with dissimilar MHC genotypes [ 28 – 32 ]. However, our understanding of this phenomenon remains limited. Although ORs expressed in the testes appear to be genetically linked to the MHC, limited information is available on the diversity of MHC-linked ORs compared to ORs located in other chromosomal regions. Some studies have reported that MHC-OR haplotypes are highly variable and that specific OR-MHC allele combinations occur more frequently than expected by chance [ 33 , 34 ]. To elucidate the genetic and functional relationships between MHC and MHC-linked ORs, we analyzed the evolutionary conservation and linkage disequilibrium (LD) between MHC and MHC-linked ORs by typing nine MHC-linked ORs and three classical MHC class I genes in pigs. We performed haplotype analysis and compared allelic diversity between MHC-linked and unlinked ORs to assess the influence of MHC genes on OR diversity. Additionally, we examined the testicular expression patterns of orthologous MHC-linked ORs in pigs and humans using transcriptome data. Results Identification of MHC-linked orthologous OR genes across humans, mice, cattle, and pigs The current genome assemblies for humans, mice, pigs, and cattle reveal that the numbers of OR genes mapped to MHC-residing chromosomes are 34, 67, 33, and 90, respectively (Supplementary Table 1). To determine the orthologous relationships of the ORs in the MHC-linked region among the four species, we identified 11 non-OR orthologous framework loci across these species using information from the NCBI Ortholog Database ( www.ncbi.nlm.nih.gov/gene ). These loci include ABT1 , ZNF322 , POM121L2 , ZNF184 , H1- 5 , ZSCAN26 , ZSCAN12 , GPX6 , GABBR1 , MOG , and ZFP57 (Fig. 1 ). Subsequently, we established the orthologous relationships of the ORs adjacent to the framework loci through interspecies pairwise BLAST analysis (Supplementary Table 2). OR gene pairs with e-values 500 between species, along with their syntenic relationships from the comparative analysis of framework loci, were identified as putative OR orthologs. The number of OR genes within each OR cluster varied among species. OR genes with multiple matches in a given species from the BLAST analysis were considered to result from recent gene duplications. We observed three OR clusters on S. scrofa chromosome 7 (SSC7) and B. taurus chromosome 23 (BTA23), whereas H. sapiens chromosome 6 (HSA6) contained two clusters. An additional OR gene located between ABT1 and ZNF322 in Euungulata, but absent in other species, indicated an expansion of MHC-linked ORs within this lineage. In contrast, a single cluster of OR genes was present on M. musculus chromosome 17 (MMU17) due to the translocation of the OR cluster onto MMU13 (Fig. 1 ). Consequently, only a GABBR1 -linked OR cluster was common to MHC-bearing chromosomes in all four species. The ORs between ZSCAN26 and H1-5 , as well as between ZSCAN12 and GPX6 , were conserved across cattle, humans, and pigs. Development of a high-resolution typing method for nine MHC-linked OR genes in pigs The high frequency of particular allele combinations at different loci may suggest the presence of LD or a functional association between them. To investigate the associations between MHC and linked ORs, we selected nine pig MHC-linked OR genes, including LOC100514111 , LOC100516618 , LOC100157348 , LOC100515036 , LOC100156552 , LOC100522686 , LOC100516811 , OLF42-3 , and OLF42-1 , based on their cluster location, testicular expression level, and the presence of human orthologs (Supplementary Table 2). To develop a comprehensive typing method for these OR genes, we designed primers corresponding to the 500 bp upstream and downstream regions of each OR gene. Through iterative primer design and confirmation of amplification specificity, we identified a set of primers that enabled comprehensive amplification of the nine ORs (Table 1 ). We then developed sequencing primers for each amplicon, resulting in a sequence-based high-resolution typing method for ORs. For allelic determination, homozygous typing results were classified as novel alleles when observed for the first time. Heterozygous samples were separated by molecular cloning and sequenced to resolve the alleles. As a result, we successfully determined the allelic status of all typing results (n = 576) without any exceptions (Supplementary Tables 3 and 4). The sequence information for OR alleles was submitted to NCBI under accession numbers PP768337 to PP768442 (Supplementary Table 3). The number of alleles for ORs ranged from 5 to 22 (Supplementary Tables 3 and 5). Typing results for LOC100515036 revealed more than two alleles per individual across multiple samples, suggesting an association between gene duplications and copy number variations (CNVs). Table 1 Primer information for typing nine SLA-linked OR and three SLA class I genes Target loci Primer usage Sequence (5' to 3') Amplicon size (bp) Annealing (℃) LOC100514111 gPCR a TTGACAGCAAGTAAATGTGTTTGT 1,302 58 GATGAGCTCTTCACCRAGTCCA Sequencing GATAGGTTTGTAGCCA - 50 GCTTCATTTGCTGTTG LOC100516618 gPCR GCTAGGTAGAGGGGCAGGGGATACA 1,620 58 CTGGCGTCCACATTCATGGTTGGTT Sequencing TCTGTAAACCTCTGCAC - 50 CCAATTARTGCTGGCATCT LOC100157348 gPCR GTTGAGTTACCTTTGCAGTTCATACA 2,323 58 TCCAAATTTTRTGTGAAAGGAACAAAAG Sequencing ACTCCACTACATGCTG - 50 TCCACTTGGTTTTTGC LOC100156552 gPCR TGGTCACTATCCCTTGCTTTCT 1,834 58 CCTTACACTGTTTTAGTGACTTMAT Sequencing ACTTGACCGCTATGC - 50 CTTGAGCAAAGGARGGAC Additional Sequencing b GCAAGCCCCTTCACTAC LOC100515036 gPCR CTCTCTCCCCTTGTCGAGC 1,803 58 AGAGAAAGTATATGTACAGCTGGG Sequencing GCCCCTTCACTACACAG - 50 TTCATTTCTCCCACAGAGT LOC100522686 gPCR GGGTGTACTTCATTCCTCCTTCA 1,242 58 CCTTGCATTTCTTGAAGGTCTCC Sequencing TGTGTGTAARCCTCTGA - 50 TCACAAAAGAAGTGGTCC LOC100516811 gPCR CAAGAGCTCACCTTTGCCCAT 1,720 58 GTGTGTGCTCACKTACTTACC Sequencing GGCCTATGACCACTA - 50 AGGTRTCTCTGCATAC OLF42-3 gPCR TACCTTCAGTGAGTCTGAGGAAC 1,700 58 GCAGGTCCTAAMACGCCTCTC Sequencing CCAACCCCTCCACTATG - 50 TGGATCTCATTGTAGGTG OLF42-1 gPCR AACCACTGACCTGCTGTAGTGCCTT 1,322 58 AAGCTTCGTCTGTTTTCCAGCGCAT Sequencing CCAACCCCTCCACTATG - 50 ACAGGRGAGTCGAATTAGA SLA-1 exon 2, 3 gPCR MTAARCTCTCCRCCCASCCGGCTCTG 1,844 65 CGGGTCACATGTGTCYTTGGAGG Sequencing TGCTATGCTGTGCGCCGARAGGAGGGT - 50 ATGCTGATTATCGCCCKCGTTGGWCGCG SLA-3 exon 2, 3 gPCR GGGGRCCCTGGCCCTGATT 1,655 65 CGGGTCACATGTGTCYTTGGAGG Sequencing CTGTGAATGCTGCTGCGCCGAGAGGAGGGT - 50 TGTGAATGCTATGGTKGGTCGYGGC Additional Sequencing b GACCCCCTTTTCCTCT SLA-2 exon 2, 3 gPCR GCCTCGACACAGAATCTCCGATATATCCAAAGATG 1,679 65 CGGGTCACATGTGTCYTTGGAGG Sequencing TGCTATGCTGTGCGCCGARAGGAGGGT - 50 GAGGGGAGATGGTGGAG Additional Sequencing b ATGCTGATTATCGCCCKCGTTGGWCGCG TTCCTGGGGATGGGGATG T7 universal Colony PCR c TAATACGACTCACTATAGGG n.a. 50 SP6 universal ATTTAGGTGACACTATAG a Primer for genomic PCR b Additional sequencing primers for indel variants c PCR primers for target clone amplification Higher genetic diversity of SLA-linked ORs compared to SLA-unlinked ORs Extreme genetic polymorphisms of the MHC can influence the diversity of linked genes. To assess the impact of LD with the MHC on the diversity of OR genes, we performed sequence-based typing of SLA-1 , SLA-2 , and SLA-3 in animals with existing OR typing data, using previously established methods [ 35 – 37 ]. High-resolution typing results were obtained for all three SLA class I genes, identifying 34, 29, and 17 alleles for SLA-1 , SLA-2 , and SLA-3 , respectively. CNV was observed in SLA-1 , consistent with previous findings [ 35 , 38 ] (Supplementary Table 4). No novel alleles were detected for SLA-1 and SLA-2 ; however, a new non-functional allele was identified for SLA-3 (PQ037598), which contains a premature stop codon. Regarding genetic diversity, the observed heterozygosity (Ho) for SLA-1 , SLA-2 , and SLA-3 ranged from 0.646 to 0.813, with a mean of 0.750, while the expected heterozygosity (He) ranged from 0.942 to 0.961, with a mean of 0.954, consistent with previously reported diversity of SLA class I genes [ 35 – 37 ] (Supplementary Table 5). When comparing the allelic diversity between nine SLA-linked ORs typed in this study and 20 SLA-unlinked ORs reported in a previous study, which examined mostly the same populations as in this study [ 39 ], the mean allele numbers for SLA-linked and SLA-unlinked ORs were 11.78 ± 5.38 and 6.65 ± 3.01, respectively (Fig. 2 , Supplementary Table 5), indicating a significant difference between the two groups (P-value < 0.05). The mean Ho and He of SLA-linked OR genes were also significantly higher than those of SLA-unlinked ORs, with Ho = 0.68 ± 0.08 vs. 0.33 ± 0.18 (P-value < 0.01) and He = 0.81 ± 0.10 vs. 0.57 ± 0.24 (P-value < 0.01) (Fig. 2 , Supplementary Table 5). Notably, three SLA-linked ORs— OLF42-1, OLF42-3 , and LOC100515036 —exhibited particularly high allele numbers. CNVs were observed in LOC100515036 , suggesting gene duplication at this locus. However, the number of alleles was also high for the SLA-unlinked OR sOR6T3 (15 alleles), indicating that the specific functions of certain ORs may also contribute to genetic diversity, although we were unable to determine functional differences among these ORs. Determination of 48 haplotypes for SLA-1, SLA-2, SLA-3 , and nine SLA-linked ORs We identified a combined total of 106 alleles for nine ORs and 80 alleles for three classical SLA class I genes by typing 48 individuals from six pig breeds (Supplementary Tables 3 and 4). The allele numbers for SLA-1 and LOC100515036 , which exhibit CNVs, ranged from 0 (null) to 2 and 1 to 3 per haplotype, respectively, while the remaining genes showed one allele per haplotype, as expected. To determine haplotypes, preliminary haplotype phasing was performed without CNV-related genes to reduce the complexity of haplotype determination, using the expectation-maximization (EM) algorithm. Subsequently, final haplotypes were manually refined by incorporating the genotypes of the CNV-related genes, following the strategy described in Supplementary Fig. 1. As a result, 48 combined haplotypes were established for SLA-1, SLA-2, SLA-3 , and nine SLA-linked ORs (Supplementary Table 6). When the haplotype sequences were translated into amino acid sequences, the number of haplotypes was reduced by only one, indicating a high rate of nonsynonymous substitutions in this region (Supplementary Table 6). Identification of five putative breakpoint hotspots at locus junctions within the SLA-OR region We identified candidate recombination breakpoint sites based on codon alignment analysis of 48 haplotype sequences within the SLA-OR region using RDP software (Fig. 3 ). Five sites emerged as prominent breakpoint hotspots with > 99% confidence, as determined by the observed haplotype patterns in the region (Fig. 3 , Supplementary Fig. 2). The deduced breakpoint hotspots within the SLA and linked OR gene regions were primarily located at the locus boundaries between LOC100516618 and LOC100157348 , LOC100156552 and LOC100522686 , and OLF42-1 and SLA genes. Consistent with these findings, when pairwise LD among three SLA class I and nine linked OR genes was estimated by calculating normalized entropy differences between two loci (ε) using eLD software, LOC100157348 , LOC100515036 , LOC100156552 , OLF42-3 , and OLF42-1 showed higher LD with SLA-1, -2 , and − 3 (mean ε ≥ 0.3) compared to other analyzed ORs (Fig. 4 ). Similarity in the testicular expression of MHC-linked ORs between humans and pigs To investigate the expression patterns of MHC-linked ORs, we analyzed the expression levels of nine SLA-linked ORs using publicly available transcriptome data from pig testes (from three 120-day-old pigs, GEO accession: GSE171756) and olfactory epithelium (OE) (from four newborn pigs, GEO accession: GSE197184) (Table 2 , Supplementary Table 7). The expression levels of OLF42-1 and OLF42-3 in the proximal OR cluster of SLA class I and LOC100515036 and LOC1001156552 in the distal OR cluster were higher (FPKM 0.102–0.742) than those of other ORs (FPKM 0–0.055; Table 2 ), indicating differential expression levels in the testis. However, this pattern differed from that of ORs expressed in OE, suggesting tissue-specific regulation of gene expression in these ORs (Table 2 , Supplementary Table 7). Additionally, we analyzed the expression patterns of putative human OR orthologs of the nine pig ORs using publicly available transcriptome data from human tissues (GEO accession: GSE30611 for human testis and GSE80249 for human OE) and compared them with their expression in pigs. The expression of OR2H1 and OR2H2 , human orthologs of pig OLF42-1 and OLF42-3 , respectively, was also higher in the human testis (mean FPKM = 0.603) compared to other ORs (mean FPKM = 0.007), reflecting a similar expression pattern to that observed in pigs. Notably, OR2B8P , the putative human ortholog corresponding to pig LOC100515036 and LOC1001156552 (likely duplicated in pigs), has been pseudogenized in humans. These results indicate that the testicular expression pattern of the analyzed functional HLA-linked ORs is similar between pigs and humans (Table 2 , Supplementary Table 7, Supplementary Fig. 3). Table 2 Comparison of SLA-linked OR expression in testis and olfactory epithelium between pigs and humans Group a Gene symbol Human ortholog Expression (FPKM) Pig Human Testis e OE f Testis g OE h Distal OR LOC100514111 OR2B2 0.055 5.717 0.003 0.003 LOC100516618 OR2W6P b 0.005 0.753 0.018 0.003 LOC100157348 OR2B7P b 0.003 0.465 0.019 0.039 LOC100515036 OR2B8P b 0.127 0.182 0.003 0.104 LOC100156552 OR2B8P b 0.102 0.107 0.003 0.104 LOC100522686 OR2E1P b 0.000 n.a. 0.003 0.188 Proximal OR LOC100516811 b OR11A1 0.000 n.a. 0.003 2.479 OLF42-3 OR2H2 0.300 0.406 0.799 0.136 OLF42-1 OR2H1 0.742 0.710 0.406 0.017 Control ACTG1 c 1106.680 1315.007 664.920 911.566 NPY d 0.012 10.273 0.870 3.028 a OR groups were categorized based on the physical distance to SLA. b Putative pseudogene c, d Housekeeping and olfactory epithelium (OE)-specific genes, respectively. e, f, g, h GEO accession numbers for data sets: GSE171756, GSE197184, GSE30611, and GSE80249, respectively. f FPKM values of pig OE were not available and indirectly calculated from read counts. Positive correlation between heterozygosity levels and testicular expression of SLA-linked ORs From the expression data of nine SLA-linked pig OR genes in regions conserved between pigs and humans, we categorized the genes into two groups based on testicular expression levels exceeding 0.1 FPKM, using the round-off mean value (mean FPKM = 0.098) for expressed ORs in pig testes (Supplementary Table 7, Supplementary Fig. 3). LOC100515036 , LOC100156552 , OLF42-3 , and OLF42-1 showed mean expression levels of ≥ 0.1 FPKM (n = 3), while LOC100514111 , LOC100516618 , LOC100157348 , LOC100522686 , and LOC100516811 had mean expression levels of < 0.1 FPKM (n = 3). When comparing these expression levels to the genetic diversity of each locus, Ho differed between the two groups, with mean Ho = 0.750 for FPKM ≥ 0.1 versus Ho = 0.617 for FPKM < 0.1 (P-value < 0.01; Fig. 2 and Supplementary Table 5). The mean Ho of ORs with FPKM ≥ 0.1 (Ho = 0.750) was similar to that of SLA class I genes (Ho = 0.750; P-value = 0.5) but differed from ORs with FPKM < 0.1 (Ho = 0.617; P-value < 0.05). Additionally, allele numbers were greater for ORs with FPKM ≥ 0.1 (mean n = 16.25) compared to those with FPKM < 0.1 (mean n = 8.20), suggesting a positive correlation between allele diversity and testicular expression levels for SLA-linked ORs. Positive correlation between testicular expression and the number of codons under diversifying selection for SLA and linked ORs We estimated selection pressure for 3,032 codons constituting nine OR and three SLA genes using a random-site model in PAML. We also calculated LD between all possible SNP pairs from 550 SNPs identified in 48 OR-SLA haplotype sequences (Supplementary Table 8). Our analysis revealed that 41 codons from nine ORs had dN/dS (ω) values > 1.00 according to both M2 and M8 models, indicating diversifying selection. Among these 41 diversifying codons, 25 were in significant LD (D’ > 0.5, LOD > 2) with diversifying codons of SLA genes (Table 3 , Supplementary Table 9). Further analysis showed that 15 out of 16 (94%) functional OR genes with FPKM ≥ 0.1 ( LOC100515036 , LOC100156552 , OLF42-3 , OLF42-1 ) were in significant LD with SLA, compared to only 10 out of 25 (40%) for ORs with FPKM < 0.1 ( LOC100514111 , LOC100516618 , LOC100157348 , LOC100522686 ), except for LOC100522686 (89%). This finding suggests a correlation between OR expression in the testis and evolutionary selection between SLA and SLA-linked ORs. Table 3 Association of the number of codons under diversifying selection with testicular expression level in SLA-linked olfactory receptor genes Gene group Loci No. of SNP (A) No. of SNP in significant LD with SLA (B) B/A ratio No. of diversifying codons (C) No. of diversifying codons in significant LD with SLA (D) D/C ratio OR with FPKM ≥ 0.1 LOC100514111 4 1 0.25 1 1 1.00 LOC100516618 25 2 0.08 9 0 0.00 LOC100157348 21 8 0.38 6 1 0.17 LOC100522686 30 23 0.77 9 8 0.89 OR with FPKM < 0.1 LOC100515036 54 36 0.67 6 5 0.83 LOC100156552 48 14 0.29 3 3 1.00 OLF42-3 59 50 0.85 6 6 1.00 OLF42-1 24 21 0.88 1 1 1.00 Total 265 155 - 41 25 - Note. Selection pressure was calculated from the codon alignment using 48 haplotypes for the SLA class I-OR region. Significant LD indicates LD with D’ > 0.5 and log-likelihood odds ratio (LOD) > 2 between SNPs. Breed differences in SLA-OR haplotypes We analyzed population differences in MHC-OR haplotype repertoires for SLA-1, -2, -3 , and nine linked OR regions among six pig breeds: Berkshire (BER), Duroc (DUR), Landrace (LAN), Yorkshire (YOR), Korean native pigs (KNP), and SNU minipigs (SNU). Principal component analysis (PCA) of 48 haplotypes showed a high degree of genetic relatedness among European breeds (BER, DUR, LAN, and YOR), whereas KNP and SNU were more distantly related to the European pig cluster (Fig. 5 ). The mean FST value was highest for SNU (mean FST = 0.265), followed by KNP (mean FST = 0.222), and BER (mean FST = 0.212), with DUR (mean FST = 0.181), YOR (mean FST = 0.172), and LAN (mean FST = 0.156) showing lower values (Supplementary Fig. 4). This indicates that BER has relatively distinct MHC-OR haplotypes compared to other European breeds. In the minimum spanning network (MSN) plot, LAN occupied a central position with the largest number of haplotypes (n = 12) among the six breeds (Supplementary Fig. 5). LAN haplotypes h1, h15, and h28 were shared with YOR and DUR. BER was closely positioned to other European breeds in its haplotype composition but did not directly share haplotypes with them. KNP shared haplotype h7 with DUR. SNU pigs had the lowest number of haplotypes in the inbred population. Discussion About 1,300 OR genes are present in the pig genome, and the increased OR gene repertoire and allelic variation may have contributed to enhancing the survival of the species [ 5 , 6 , 40 , 41 ]. In particular, 26 functional and 7 pseudogenes were annotated on pig chromosome 7 harboring SLA genes (Supplementary table 7). MHC molecules have evolved to be highly polymorphic and initiate immune responses against an almost unlimited number of foreign molecules [ 42 – 45 ]. Such evolutionary forces of MHC could affect the diversity of neighboring genes through mechanisms such as hitchhiking or functional association. Because many OR genes are present in SLA-linked regions, we investigated the genetic and evolutionary influence of MHC on the diversity of neighboring OR genes by comparing genetic variations between SLA-linked and unlinked ORs. The typing results of SLA-linked ORs in this study showed a significant increase in the genetic diversity of SLA-linked ORs compared to unlinked ORs (Fig. 2 , Supplementary table 5), suggesting MHC as a possible driving force for increasing the genetic diversity of neighboring ORs. The influence of MHC on the genetic diversity of linked ORs was also evidenced by the increased allelic diversity and observed heterozygosity of ORs with strong LD to SLA compared to those with weak or no LD to SLA (Fig. 2 , Supplementary table 5). The evolutionary conservation of OR-MHC architecture in vertebrates has been well described in previous versions of genome assemblies [ 46 ]. In this study, we conducted a comparative analysis of MHC-linked ORs using current genome assemblies and annotations, and provided an updated and more detailed picture of the comparative OR-MHC architecture among cattle, humans, mice, and pigs. For example, several OR genes within the extended MHC (xMHC) region were mapped differently in the previous genome assembly (Sscrofa10.2) than in the current genome assembly, Sscrofa11.1 (Supplementary table 10). In addition, the number of GABBR1- linked pig ORs mapped to this region appeared to be smaller than those of other species (Fig. 1 ). However, we confirmed the structural conservation of the major OR cluster linked to MHC among the four species, despite the presence of species specificity. The conservation of the major MHC-linked OR cluster linked to GABBR1 in the xMHC region of vertebrates may indicate possible functional relationships between these ORs and MHC [ 25 , 46 ]. Pig ORs, OLF42-3 and OLF42-1 , which showed higher genetic diversity and testicular expression than the other ORs, were also present in the species-conserved region. A previous study suggested that the strong genetic linkage between GABBR1 -linked ORs and HLA could be related to the functional interactions of these molecules [ 25 , 46 ]. The orthologs of pig OLF42-1 and OLF42-3 which are highly expressed in pig testes, are also expressed in human sperm [ 22 ]. HLA class I expression is observed in granulosa cells surrounding oocytes in humans [ 26 , 47 ]. These results suggested that MHC-linked ORs play a role in mate selection, showing a preference for partners with different MHC class I genotypes, as previously suggested [ 28 , 29 , 48 ]. In studies on human testicular expression of ORs, the majority of OR genes expressed in the testis were genetically linked to HLA [ 49 – 51 ]. These testicular HLA-linked OR genes show significant variations in expression levels and exhibit a non-canonical expression pattern through long-distance splicing and exon sharing among OR genes [ 24 , 52 ]. Interestingly, this promiscuous expression plays a critical role in the establishment of self-tolerance in T cells [ 53 ]. Therefore, MHC-linked ORs that are highly expressed in the testes or germ cells may play a role in mediating MHC genotypes through strong LD between MHC and OR genes. This is consistent with our results in which the frequency of diversifying codons in significant LD with SLA was much higher for functional OR genes of FPKM ≥ 0.1 than those of FPKM < 0.1 (Table 3 ). Furthermore, several testicular MHC-linked ORs are expressed in sperm [ 22 , 51 ], and GABBR1 , which is involved in OR signaling, is also expressed in the testis [ 27 , 54 ]. These findings suggest that MHC diversity plays a role in OR function in testes and sperm. A study of the human OR2E1P pseudogene and OR2H1 , the orthologs of pig LOC100522686 and OLF42-1 , respectively, revealed that OR2E1P can form spliced variant transcripts with OR2H1 [ 52 ]. Interestingly, the alternative splice sites involved in the exon splicing of OR2H1 were also conserved in porcine OLF42-1 (Supplementary Fig. 6), demonstrating the interspecies conservation of evolutionary and functional characteristics among MHC-linked ORs. Vomeronasal receptors (VRs), a class of ORs that function as pheromone receptors, recognize the diversity of MHC peptide ligands and trigger responses from vomeronasal sensory neurons expressing these receptors [ 55 , 56 ]. It has been suggested that MHC peptide ligands can serve as olfactory cues [ 57 ]. However, it is unclear whether MHC-linked OR genes expressed in the testes and sperm recognize MHC particles and elicit responses. Human OR2H1 recognizes the odor molecule methional, and spermatozoa elicit a crucial Ca 2+ signal necessary for sperm chemotaxis via this molecule [ 22 ]. Recognition of cryptic MHC by ORs may involve distinct odorant molecules, resulting in mate selection. A potential explanation regarding MHC-OR interactions could be the involvement of MHC-linked ORs in MHC-based sexual selection [ 26 , 58 ]. We identified 48 haplotypes for the nine SLA-linked ORs and three major SLA class I genes using sequence-based genotyping of 48 animals from six pig breeds (Supplementary table 3 and 4). Sampling bias can be a major cause of error in haplotype estimation using the EM algorithm [ 59 ]. To overcome the concerns of a small sample size and large number of loci for haplotype estimation in our dataset, we conducted indirect validation of our haplotype analysis results by comparing the population distribution of deduced haplotypes in this study with the outcomes of previous studies independently conducted for 20 MHC-unlinked ORs and the same set of SLA class I genes from populations of mostly overlapping breeds of pigs [ 39 , 60 , 61 ]. The allelic and haplotype distributions of SLA-linked ORs for each breed in this study were highly consistent with those of SLA-unlinked ORs reported in a previous study, supporting the reliability of our OR-SLA haplotype information. Conclusions Genetic analysis of ORs in the vertebrate genome is challenging because of the presence of high sequence homology, CNV, and pseudogenes, as well as the large number of loci in the gene family. In the present study, we developed sequence-based high-resolution typing methods for nine SLA-linked OR genes and analyzed their genetic and evolutionary characteristics in relation to MHC class I genes in pigs. Our results indicated a strong influence of SLA diversity on that of the linked OR genes, in which the allelic diversity of ORs was significantly higher than that of other chromosomal regions, and the testicular expression of more polymorphic ORs was higher than that of the less polymorphic SLA-linked ORs. We also showed the conservation of the testicular expression patterns of MHC-linked orthologous ORs between humans and pigs. Our results suggest the possibility of functional and evolutionary interactions between MHC molecules and their linked ORs during animal reproduction. The OR-MHC haplotypes defined in this study contribute to elucidating the relationship between MHC and MHC-like ORs and could be applicable to pig breeding and reproduction. Materials and Methods Animals and tissues Tissue samples of six pig breeds, BER, DUR, LAN, YOR, KNP, and SNU were collected and stored at -80°C in previous studies [ 35 , 62 ]. Eight individuals from each breed were randomly selected. All experiments were approved and performed in accordance with the guidelines and regulations set by the Institute of Animal Care and Use Committee and the Center for Research Ethics of Konkuk University. Preparation of genomic DNA Genomic DNA was extracted from tissues (0.5 g) using a standard protocol. Briefly, tissues were incubated with 700 µL lysis buffer (50 mM Tris pH 8.0, 0.1 M EDTA pH 8.0, 0.5% (w/v) sodium dodecyl sulfate, 20 µg/mL DNase-free pancreatic RNase) and 20 µL of proteinase K (20 mg/mL) at 50°C overnight. Subsequently, gDNA was purified by phenol: chloroform: isoamyl alcohol (pH 8.0) extraction, precipitated using ethanol, and dissolved in 50 mM Tris-EDTA buffer (pH 8.0). Determination of syntenic relationship The genome assemblies and annotations used in this study were GRCh38.p14, Sscrofa11.1, ARS-UCD2.0, and GRCm39 for humans, pigs, cattle, and mice, respectively. The construction of a synteny plot was carried out using the Python package “pyGenomeViz” (github.com/moshi4/pyGenomeViz) on Python version 3.8.15 ( www.python.org/ ). Primer design Primers that specifically amplify the entire coding sequence (CDS) of each of the nine MHC-linked OR genes were designed using NCBI Primer-BLAST ( www.ncbi.nlm.nih.gov/tools/primer-blast/ ). The 500-bp upstream and downstream regions of the selected OR genes, based on the pig genome assembly (NC_010449.5, Sscrofa11.1), were used as queries. The maximum product size was set to 2500 bp. Primer sites containing nucleotide variations reported for dbSNPs ( www.ncbi.nlm.nih.gov/snp/ ) were excluded. Off-target or multiple-target amplification of the primers was performed using BLAST analysis. Primer design was repeated until the optimal primers for the specific amplification of the target ORs were obtained. Primer information for the analysis of SLA-1 , -2 , and − 3 was based on previous studies [ 35 – 37 ] and is described in Table 1 . Polymerase chain reaction and sequencing For a 10 µL reaction for nine OR genes including LOC100514111, LOC100516618, LOC100157348, LOC100515036, LOC100156552, LOC100522686, LOC100516811, OLF42-3, OLF42-1 , the reaction mixture consisted of 1 µM of locus-specific primers (Table 1 ), 250 µM dNTPs, 1 unit of Supertherm™ Taq DNA polymerase (JMR Holdings, Kent, UK), 10× reaction buffer containing 15 mM MgCl 2 , and 25 ng of DNA. The amplification reaction was conducted on an ABI9700 thermocycler (Applied Biosystems, Foster City, CA) with an initial pre-denaturation step at 94°C for 3 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at the specific primer annealing temperature (Table 1 ) for 45 seconds, and elongation at 72°C for 90 seconds. Subsequently, the final elongation was conducted at 72°C for 10 min. The amplicons were electrophoresed on 1% agarose gel to confirm target amplification. To sequence OR amplicons, sequencing primers with lengths of 15–20 bp were designed at conserved regions in both the forward and reverse directions with an overlap to cover the entire CDS of each OR gene using the Primer Designer of CLC Main Workbench version 7.8.1 (CLC bio, Aarhus, Denmark) (Table 1 ). Before sequencing, 5 µL of PCR products were mixed with 0.25 U of shrimp alkaline phosphatase (USB Corporation, Cleveland, OH), 15 U of exonuclease I (Fermentas, Massachusetts, USA), and incubated at 37 ℃ for 30 min. The sequencing reaction was performed using the Applied Biosystems BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Massachusetts, USA) with 2 pmol of a sequencing primer under the conditions of pre-denaturation at 96°C for 1 min, 25 cycles of 96°C for 10 s, 50°C for 5 s, and 60°C for 4 min. The reaction products were purified using ethanol precipitation, resuspended in 10 µL of Hi-Di™ Formamide (Applied Biosystems, Massachusetts, USA), and analyzed on an ABI3730 DNA Analyzer (Applied Biosystems). Specific amplification and sequencing of SLA-1, -2 , and − 3 were conducted as previously described (Table 1 ) [ 35 – 37 ]. Allelic differentiation and haplotype determination In principle, alleles that exist as homozygotes in sequence-based typing are considered novel alleles. Alleles that existed as heterozygotes in the typing results were separated into individual alleles through TA cloning using pGEM®-T Easy Vector Systems (Promega, Wisconsin, USA). For cloning, the ligation products were transformed into DH10B competent cells (Thermo Fisher Scientific, Waltham, MA, USA) using electrotransformation. Target inserts were amplified in 10 µL of colony PCR mixture containing a piece of a single bacterial colony as a DNA template, 1 µM of T7 and SP6 universal primers (Table 1 ), 250 µM dNTP, 1U of Supertherm™ Taq DNA polymerase (JMR Holdings, Kent, UK), and 10× reaction buffer with 15 mM MgCl 2 (JMR Holdings, Kent, UK). The thermal profile for the colony PCR consisted of 5 min of pre-denaturation at 94°C, 30 cycles of denaturation at 94°C for 30 s, primer annealing at 50°C for 30 s, and elongation at 72°C for 60 s, followed by a final elongation at 72°C for 7 min. The PCR amplicons were sequenced using primers specific to each OR gene (Table 1 ). At least eight independent clones were sequenced for allelic determination using the T7 and SP6 universal primers. Allele differentiation for SLA-1 , -2 , and − 3 was conducted as described in previous studies [ 35 – 37 ]. Haplotype determination of SLA- and SLA-linked OR genes was conducted using the haplotype inference function, employing the EM algorithm provided in Arlequin version 3.5.2.2 [ 63 ]. The detailed procedure is shown in Supplementary Fig. 1. Calculation of genetic diversity The observed (Ho) and expected heterozygosities (He) of the loci were calculated using Arlequin version 3.5.2.2 [ 63 ]. Data normality and equality in variance distribution for the observed indices were tested using the Shapiro-Wilk normality test and an equal-variance test [ 64 , 65 ]. Differences in the average values of the observed indices were tested using the Student’s t-test [ 66 ]. Population genetic analyses LD index (ε) between loci was calculated after allele differentiation of genotyping results using eLD R script [ 67 ] on R version 4.1.2 ( www.r-project.org ). To generate an MSN plot, haplotype data was prepared for R library “adegenet” version 2.1.6 [ 68 ], and generation of a distance matrix and visualization was conducted using R library “poppr” version 2.9.4 [ 69 ]. A dataset for PCA was prepared using the genotype data of nine OR and three SLA class I genes from 48 individuals of six pig breeds, using the adegenet R package. PCA was conducted using the dudi.pca function of the R library “ade4” version 1.7.19 [ 70 ]. Estimation of haplotype breakpoints To generate input nucleotide sequences for haplotype codon alignment, stop codons at the end of the full-length coding sequences (CDS) for 11 genes were removed, and the sequences were sequentially connected to produce a single sequence contig relative to the chromosomal order, except LOC100516811 , a pseudogene. The input sequences were aligned using the codon alignment function of MUSCLE in MEGA version 11.0.10 [ 71 ]. The generated codon alignment was used as an input file for RDP v4.101 [ 72 ]. Haplotype breakpoints were deduced using RDP, GENECONV, MaxChi, BootScan, and SiScan in RDP software. Statistical significance of the breakpoints was tested using a breakpoint P distribution plot (1000 permutations and window size = 200bp). Breakpoints with an estimated P-value < 0.01 were suggested as breakpoint hotspots. Codon selection test and LD calculation The haplotype phylogenetic tree was constructed from the haplotype codon alignment using the "Create Tree" feature of CLC Main Workbench version 7.8.1 (CLC bio, Aarhus, Denmark). The neighbor-joining method and Kimura 80 nucleotide substitution model were applied with 5000 bootstrap replications. The created haplotype phylogenetic tree was unrooted using the R library “ape” version 5.6.2. [ 73 ] and was used as the input file for CodeML of pamlX version 1.3.1 [ 74 ]. All analysis options were set to default except for codon frequency, which was configured using the 2:F3ⅹ4 model. To test selection signatures of codons under Random-sites models, we used site models to allow the dN/dS (ω) ratio to vary among sites using Models 0, 1, 2, 7, and 8 under different assumptions on the distribution of ω ratio [ 74 ]. Empirical Bayes analysis using Models 2 and 8 was used to deduce the positively selected codons [ 75 ]. Codons with a confidence level > 95% were identified as positively selected codons. LD values between haplotype SNPs were estimated using Haploview version 4.2 from the haplotype codon alignment [ 76 ]. Comparison of OR expression Expression data for SLA-linked OR genes were obtained from the NCBI Gene Expression Omnibus database ( www.ncbi.nlm.nih.gov/geo/ ; accession numbers GSE171756 (pig testis) and GSE197184 (pig olfactory epithelium (OE)). Expression data for human ORs were retrieved from the same database with accession numbers GSE30611 (human testis) and GSE80249 (human OE). Because the OR expression data for porcine OE were available only as read counts, the values were converted to relative FPKM values for expression comparison using the following formula: $$\:\text{O}\text{R}\:\text{g}\text{e}\text{n}\text{e}\:\text{F}\text{P}\text{K}\text{M}\:\text{i}\text{n}\:\text{O}\text{E}=\:\text{O}\text{R}\:\text{g}\text{e}\text{n}\text{e}\:\text{r}\text{e}\text{a}\text{d}\:\text{c}\text{o}\text{u}\text{n}\text{t}\:\text{i}\text{n}\:\text{O}\text{E}\:\times\:\left(\frac{\text{O}\text{R}\:\text{g}\text{e}\text{n}\text{e}\:\text{F}\text{P}\text{K}\text{M}\:\text{i}\text{n}\:\text{t}\text{e}\text{s}\text{t}\text{i}\text{s}}{\text{O}\text{R}\:\text{g}\text{e}\text{n}\text{e}\:\text{r}\text{e}\text{a}\text{d}\:\text{c}\text{o}\text{u}\text{n}\text{t}\:\text{i}\text{n}\:\text{t}\text{e}\text{s}\text{t}\text{i}\text{s}\text{}}\right)\:$$ Declarations Availability of data and materials A total of 106 SLA-linked OR allele sequences analyzed in this study were submitted to the NCBI GenBank (www.ncbi.nlm.nih.gov/genbank/) under the accession numbers listed in Supplementary table 3 (PP768351-PP768442). All other information can be found in the text and supporting information. Ethics approval All experiments were approved and performed in accordance with the guidelines and regulations of the Institute of Animal Care and Use Committee and the Center for Research Ethics of Konkuk University. Consent for publication Not applicable Competing interests The authors declare no competing interests. Funding This study was supported by the Cooperative Research Program for Agriculture, Science, and Technology Development (Project No. PJ016221), Rural Development Administration, Republic of Korea. Authors' contributions Conceptualization and sample collection: M.K., B.A., and J.L. Data curation: M.K., H.C., and C.P. Bioinformatic analysis: M.K., B.A., and J.S. Methodology: M.K., and C.P. Manuscript writing: M.K. and C.P. Comments and discussion: C.P. Acknowledgements The authors have no specific acknowledgements to declare. References Buck L, Axel R. A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell. 1991;65(1):175–87. Glusman G, Bahar A, Sharon D, Pilpel Y, White J, Lancet D. The olfactory receptor gene superfamily: data mining, classification, and nomenclature. Mamm Genome. 2000;11(11):1016–23. Glusman G, Yanai I, Rubin I, Lancet D. The complete human olfactory subgenome. Genome Res. 2001;11(5):685–702. Zhang X, Firestein S. The olfactory receptor gene superfamily of the mouse. Nat Neurosci. 2002;5(2):124–33. Niimura Y. Olfactory receptor multigene family in vertebrates: from the viewpoint of evolutionary genomics. Curr Genomics. 2012;13(2):103–14. Nguyen DT, Lee K, Choi H, Choi MK, Le MT, Song N, Kim JH, Seo HG, Oh JW, Lee K, et al. The complete swine olfactory subgenome: expansion of the olfactory gene repertoire in the pig genome. BMC Genomics. 2012;13(1):584. Lee K, Nguyen DT, Choi M, Cha SY, Kim JH, Dadi H, Seo HG, Seo K, Chun T, Park C. Analysis of cattle olfactory subgenome: the first detail study on the characteristics of the complete olfactory receptor repertoire of a ruminant. BMC Genomics. 2013;14(1):596. Barnes IHA, Ibarra-Soria X, Fitzgerald S, Gonzalez JM, Davidson C, Hardy MP, Manthravadi D, Van Gerven L, Jorissen M, Zeng Z, et al. Expert curation of the human and mouse olfactory receptor gene repertoires identifies conserved coding regions split across two exons. BMC Genomics. 2020;21(1):196. Hayden S, Bekaert M, Crider TA, Mariani S, Murphy WJ, Teeling EC. Ecological adaptation determines functional mammalian olfactory subgenomes. Genome Res. 2010;20(1):1–9. McGowen MR, Clark C, Gatesy J. The vestigial olfactory receptor subgenome of odontocete whales: phylogenetic congruence between gene-tree reconciliation and supermatrix methods. Syst Biol. 2008;57(4):574–90. Kishida T, Kubota S, Shirayama Y, Fukami H. The olfactory receptor gene repertoires in secondary-adapted marine vertebrates: evidence for reduction of the functional proportions in cetaceans. Biol Lett. 2007;3(4):428–30. Liu A, He F, Shen L, Liu R, Wang Z, Zhou J. Convergent degeneration of olfactory receptor gene repertoires in marine mammals. BMC Genomics. 2019;20(1):977. Kang N, Koo J. Olfactory receptors in non-chemosensory tissues. BMB Rep. 2012;45(11):612–22. Feldmesser E, Olender T, Khen M, Yanai I, Ophir R, Lancet D. Widespread ectopic expression of olfactory receptor genes. BMC Genomics. 2006;7(1):121. Flegel C, Manteniotis S, Osthold S, Hatt H, Gisselmann G. Expression profile of ectopic olfactory receptors determined by deep sequencing. PLoS ONE. 2013;8(2):e55368. Aisenberg WH, Huang J, Zhu W, Rajkumar P, Cruz R, Santhanam L, Natarajan N, Yong HM, De Santiago B, Oh JJ, et al. Defining an olfactory receptor function in airway smooth muscle cells. Sci Rep. 2016;6(1):38231. Braun T, Voland P, Kunz L, Prinz C, Gratzl M. Enterochromaffin cells of the human gut: sensors for spices and odorants. Gastroenterology. 2007;132(5):1890–901. Manteniotis S, Wojcik S, Brauhoff P, Mollmann M, Petersen L, Gothert JR, Schmiegel W, Duhrsen U, Gisselmann G, Hatt H. Functional characterization of the ectopically expressed olfactory receptor 2AT4 in human myelogenous leukemia. Cell Death Discov. 2016;2(1):15070. Maßberg D, Hatt H. Human Olfactory Receptors: Novel Cellular Functions Outside of the Nose. Physiol Rev. 2018;98(3):1739–63. Sanz G, Leray I, Dewaele A, Sobilo J, Lerondel S, Bouet S, Grebert D, Monnerie R, Pajot-Augy E, Mir LM. Promotion of cancer cell invasiveness and metastasis emergence caused by olfactory receptor stimulation. PLoS ONE. 2014;9(1):e85110. Eisenbach M, Giojalas LC. Sperm guidance in mammals - an unpaved road to the egg. Nat Rev Mol Cell Biol. 2006;7(4):276–85. Flegel C, Vogel F, Hofreuter A, Schreiner BS, Osthold S, Veitinger S, Becker C, Brockmeyer NH, Muschol M, Wennemuth G, et al. Characterization of the Olfactory Receptors Expressed in Human Spermatozoa. Front Mol Biosci. 2015;2:73. Spehr M, Gisselmann G, Poplawski A, Riffell JA, Wetzel CH, Zimmer RK, Hatt H. Identification of a testicular odorant receptor mediating human sperm chemotaxis. Science. 2003;299(5615):2054–8. Volz A, Ehlers A, Younger R, Forbes S, Trowsdale J, Schnorr D, Beck S, Ziegler A. Complex transcription and splicing of odorant receptor genes. J Biol Chem. 2003;278(22):19691–701. Ziegler A, Santos PS, Kellermann T, Uchanska-Ziegler B. Self/nonself perception, reproduction and the extended MHC. Self Nonself. 2010;1(3):176–91. Ziegler A, Dohr G, Uchanska-Ziegler B. Possible roles for products of polymorphic MHC and linked olfactory receptor genes during selection processes in reproduction. Am J Reprod Immunol. 2002;48(1):34–42. Burrello N, Vicari E, D'Amico L, Satta A, D'Agata R, Calogero AE. Human follicular fluid stimulates the sperm acrosome reaction by interacting with the gamma-aminobutyric acid receptors. Fertil Steril. 2004;82(Suppl 3):1086–90. Andrews PW, Boyse EA. Mapping of anH-2-linked gene that influences mating preference in mice. Immunogenetics. 1978;6(1):265–8. Yamazaki K, Boyse EA, Mike V, Thaler HT, Mathieson BJ, Abbott J, Boyse J, Zayas ZA, Thomas L. Control of mating preferences in mice by genes in the major histocompatibility complex. J Exp Med. 1976;144(5):1324–35. Roberts SC, Gosling LM. Genetic similarity and quality interact in mate choice decisions by female mice. Nat Genet. 2003;35(1):103–6. Bruce HM, A BLOCK TO PREGNANCY IN THE MOUSE CAUSED BY PROXIMITY OF STRANGE MALES. Reproduction. 1960;1(1):96–103. Lovlie H, Gillingham MA, Worley K, Pizzari T, Richardson DS. Cryptic female choice favours sperm from major histocompatibility complex-dissimilar males. Proc Biol Sci. 2013;280(1769):20131296. Santos PS, Seki Uehara CJ, Ziegler A, Uchanska-Ziegler B, Bicalho Mda G. Variation and linkage disequilibrium within odorant receptor gene clusters linked to the human major histocompatibility complex. Hum Immunol. 2010;71(9):843–50. da Silva JS, Wowk PF, Poerner F, Santos PS, Bicalho Mda G. Absence of strong linkage disequilibrium between odorant receptor alleles and the major histocompatibility complex. Hum Immunol. 2013;74(12):1619–23. Le MT, Choi H, Lee H, Le VCQ, Ahn B, Ho C-S, Hong K, Song H, Kim J-H, Park C. SLA-1 Genetic Diversity in Pigs: Extensive Analysis of Copy Number Variation, Heterozygosity, Expression, and Breed Specificity. Sci Rep. 2020;10(1):1–12. Choi H, Le MT, Lee H, Choi MK, Cho HS, Nagasundarapandian S, Kwon OJ, Kim JH, Seo K, Park JK, et al. Sequence variations of the locus-specific 5' untranslated regions of SLA class I genes and the development of a comprehensive genomic DNA-based high-resolution typing method for SLA-2. Tissue Antigens. 2015;86(4):255–66. Youk S, Le MT, Kang M, Ahn B, Choi M, Kim K, Kim TH, Kim JH, Ho CS, Park C. Development of a high-resolution typing method for SLA-3, swine MHC class I antigen 3. Anim Genet. 2022;53(1):166–70. Tanaka-Matsuda M, Ando A, Rogel-Gaillard C, Chardon P, Uenishi H. Difference in number of loci of swine leukocyte antigen classical class I genes among haplotypes. Genomics. 2009;93(3):261–73. Kang M, Ahn B, Youk S, Jeon H, Soundarajan N, Cho ES, Park W, Park C. Individual and population diversity of 20 representative olfactory receptor genes in pigs. Sci Rep. 2023;13(1):18668. Niimura Y, Nei M. Extensive gains and losses of olfactory receptor genes in mammalian evolution. PLoS ONE. 2007;2(8):e708. Hoover KC. Evolution of Olfactory Receptors. In: Olfactory Receptors: Methods and Protocols. Edited by Crasto CJ. Totowa, NJ: Humana Press; 2013: 241–249. Erickson RP. Natural history of the major histocompatibility complex. Am J Hum Genet. 1987;40(5):468–9. Robinson J, Malik A, Parham P, Bodmer JG, Marsh SG. IMGT/HLA database–a sequence database for the human major histocompatibility complex. Tissue Antigens. 2000;55(3):280–7. Maccari G, Robinson J, Ballingall K, Guethlein LA, Grimholt U, Kaufman J, Ho CS, de Groot NG, Flicek P, Bontrop RE, et al. IPD-MHC 2.0: an improved inter-species database for the study of the major histocompatibility complex. Nucleic Acids Res. 2017;45(D1):D860–4. Reche PA, Reinherz EL. Sequence variability analysis of human class I and class II MHC molecules: functional and structural correlates of amino acid polymorphisms. J Mol Biol. 2003;331(3):623–41. Santos PS, Kellermann T, Uchanska-Ziegler B, Ziegler A. Genomic architecture of MHC-linked odorant receptor gene repertoires among 16 vertebrate species. Immunogenetics. 2010;62(9):569–84. Dohr GA, Motter W, Leitinger S, Desoye G, Urdl W, Winter R, Wilders-Truschnig MM, Uchanska-Ziegler B, Ziegler A. Lack of expression of HLA [corrected] class I and class II molecules on the human oocyte. J Immunol. 1987;138(11):3766–70. Egid K, Brown JL. The major histocompatibility complex and female mating preferences in mice. Anim Behav. 1989;38(3):548–9. Branscomb A, Seger J, White RL. Evolution of odorant receptors expressed in mammalian testes. Genetics. 2000;156(2):785–97. Parmentier M, Libert F, Schurmans S, Schiffmann S, Lefort A, Eggerickx D, Ledent C, Mollereau C, Gerard C, Perret J, et al. Expression of members of the putative olfactory receptor gene family in mammalian germ cells. Nature. 1992;355(6359):453–5. Vanderhaeghen P, Schurmans S, Vassart G, Parmentier M. Specific repertoire of olfactory receptor genes in the male germ cells of several mammalian species. Genomics. 1997;39(3):239–46. Younger RM, Amadou C, Bethel G, Ehlers A, Lindahl KF, Forbes S, Horton R, Milne S, Mungall AJ, Trowsdale J, et al. Characterization of clustered MHC-linked olfactory receptor genes in human and mouse. Genome Res. 2001;11(4):519–30. Kyewski B, Derbinski J, Gotter J, Klein L. Promiscuous gene expression and central T-cell tolerance: more than meets the eye. Trends Immunol. 2002;23(7):364–71. Vidal RL, Ramirez A, Castro M, Concha II, Couve A. Marlin-1 is expressed in testis and associates to the cytoskeleton and GABAB receptors. J Cell Biochem. 2008;103(3):886–95. Leinders-Zufall T, Brennan P, Widmayer P, Maul-Pavicic SPC, Jager A, Li M, Breer XH, Zufall H, Boehm F. MHC class I peptides as chemosensory signals in the vomeronasal organ. Science. 2004;306(5698):1033–7. Leinders-Zufall T, Ishii T, Mombaerts P, Zufall F, Boehm T. Structural requirements for the activation of vomeronasal sensory neurons by MHC peptides. Nat Neurosci. 2009;12(12):1551–8. Milinski M. A Review of Suggested Mechanisms of MHC Odor Signaling. Biology (Basel). 2022;11(8):1187. Ziegler A, Kentenich H, Uchanska-Ziegler B. Female choice and the MHC. Trends Immunol. 2005;26(9):496–502. Fallin D, Schork NJ. Accuracy of haplotype frequency estimation for biallelic loci, via the expectation-maximization algorithm for unphased diploid genotype data. Am J Hum Genet. 2000;67(4):947–59. Choi JW, Chung WH, Lee KT, Cho ES, Lee SW, Choi BH, Lee SH, Lim W, Lim D, Lee YG, et al. Whole-genome resequencing analyses of five pig breeds, including Korean wild and native, and three European origin breeds. DNA Res. 2015;22(4):259–67. Lee YS, Son S, Lee HK, Lee RH, Shin D. Elucidating breed-specific variants of native pigs in Korea: insights into pig breeds' genomic characteristics. Anim Cells Syst (Seoul). 2022;26(6):338–47. Jeon H, Le MT, Ahn B, Cho HS, Le VCQ, Yum J, Hong K, Kim JH, Song H, Park C. Copy number variation of PR-39 cathelicidin, and identification of PR-35, a natural variant of PR-39 with reduced mammalian cytotoxicity. Gene. 2019;692:88–93. Excoffier L, Lischer HE. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 2010;10(3):564–7. Shapiro SS, Wilk MB. An analysis of variance test for normality (complete samples). Biometrika. 1965;52(3–4):591–611. Brown MB, Forsythe AB. Robust Tests for the Equality of Variances. J Am Stat Assoc. 1974;69(346):364–7. Student. The Probable Error of a Mean. Biometrika. 1908;6(1):1–25. Okada Y. eLD: entropy-based linkage disequilibrium index between multiallelic sites. Hum Genome Var. 2018;5:29. Jombart T. adegenet: a R package for the multivariate analysis of genetic markers. Bioinformatics. 2008;24(11):1403–5. Kamvar ZN, Tabima JF, Grunwald NJ. Poppr: an R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction. PeerJ. 2014;2:e281. Dray S, Dufour A-B. Theade4Package: Implementing the Duality Diagram for Ecologists. J Stat Softw. 2007;22(4):1–20. Tamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol. 2021;38(7):3022–7. Martin DP, Murrell B, Golden M, Khoosal A, Muhire B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015;1(1):vev003. Paradis E, Schliep K. ape 5.0: an environment for modern phylogenetics and evolutionary analyses in R. Bioinformatics. 2019;35(3):526–8. Yang Z. PAML 4: phylogenetic analysis by maximum likelihood. Mol Biol Evol. 2007;24(8):1586–91. Yang Z, Wong WS, Nielsen R. Bayes empirical bayes inference of amino acid sites under positive selection. Mol Biol Evol. 2005;22(4):1107–18. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21(2):263–5. Additional Declarations No competing interests reported. Supplementary Files ORSLABMCgen.supdata.zip Cite Share Download PDF Status: Published Journal Publication published 06 Feb, 2025 Read the published version in BMC Genomics → Version 1 posted Editorial decision: Revision requested 14 Aug, 2024 Editor assigned by journal 13 Aug, 2024 Submission checks completed at journal 13 Aug, 2024 First submitted to journal 13 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4905052","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":339997759,"identity":"d0496d7f-8ff9-4100-beee-d9a08c8846c0","order_by":0,"name":"Mingue Kang","email":"","orcid":"","institution":"Konkuk University","correspondingAuthor":false,"prefix":"","firstName":"Mingue","middleName":"","lastName":"Kang","suffix":""},{"id":339997761,"identity":"a78ae692-99d6-446e-bd44-1c0940830daa","order_by":1,"name":"Byeongyong Ahn","email":"","orcid":"","institution":"Konkuk University","correspondingAuthor":false,"prefix":"","firstName":"Byeongyong","middleName":"","lastName":"Ahn","suffix":""},{"id":339997763,"identity":"d8f6a58e-45a4-4e85-b31a-d2c28497ab20","order_by":2,"name":"Jae Yeol Shin","email":"","orcid":"","institution":"Konkuk University","correspondingAuthor":false,"prefix":"","firstName":"Jae","middleName":"Yeol","lastName":"Shin","suffix":""},{"id":339997765,"identity":"417b1910-5236-4dea-a6b2-1c5138cbbc3a","order_by":3,"name":"Hye-sun Cho","email":"","orcid":"","institution":"Konkuk University","correspondingAuthor":false,"prefix":"","firstName":"Hye-sun","middleName":"","lastName":"Cho","suffix":""},{"id":339997767,"identity":"97abd8a2-a487-4f0e-9a6b-81c1c6e8d8b1","order_by":4,"name":"Jongan Lee","email":"","orcid":"","institution":"National Institute of Animal Science, Rural Development Administration","correspondingAuthor":false,"prefix":"","firstName":"Jongan","middleName":"","lastName":"Lee","suffix":""},{"id":339997769,"identity":"2279d730-b387-4b7e-a745-4c4347c5f234","order_by":5,"name":"Chankyu Park","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYDACCQYGxgYGBjkgzczAcAAkxEacFmPStSTOIFoL/+zmZw9nth1On9nee9iY5wyDPH8DW9oHvJbcOWZuuLHtcO5snnPJyTw3GAxnHGA7PAOfFgOJBDPJh0At8yRyjA/zfGBg3MDA3ozXYQYS6d9AWtLloFrsidCSYyYJdFiCNFALyGGJGxjYDuPVInEjp0xyxrl0w5k9Z4wN55yRSJ5xmC0Zrxb+GenbJHvKrOUljvcYS7w5ZmPb395mjFcLGDAiYgISo0SAP0SpGgWjYBSMgpEKAHFjRmoXxQimAAAAAElFTkSuQmCC","orcid":"","institution":"Konkuk University","correspondingAuthor":true,"prefix":"","firstName":"Chankyu","middleName":"","lastName":"Park","suffix":""}],"badges":[],"createdAt":"2024-08-13 07:47:51","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4905052/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4905052/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12864-025-11281-x","type":"published","date":"2025-02-06T15:57:39+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":64309016,"identity":"c5fb8969-f741-4db3-adae-1b273003ecfb","added_by":"auto","created_at":"2024-09-11 13:11:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":943722,"visible":true,"origin":"","legend":"\u003cp\u003eSynteny plot of the MHC and linked OR gene cluster region in mice, humans, pigs, and cattle. Chromosome numbers (MMU13 and 17 for mice, HSA6 for humans, SSC7 for pigs, and BTA23 for cattle) are shown on the left. Eleven evolutionary conserved framework (orange) and OR (black) genes are indicated with vertical lines. The OR and MHC gene clusters are indicated with light green and light blue rectangles, respectively. The syntenic relationships are traced in gray curves. The nine pig MHC-linked OR genes typed in this study and their orthologous genes across species are marked in pink and connected with pink lines. OR gene symbols of \u003cem\u003eLOC100514111, LOC100516618, LOC100157348, LOC100515036, LOC100156552, LOC100522686, LOC100516811\u003c/em\u003e, \u003cem\u003eLOC615902, \u003c/em\u003eand\u003cem\u003eLOC112443785\u003c/em\u003e for pigs or cattle are shown only with the last three-digit numbers of the genes. The gene maps were depicted relative to the size (bp) of the region for each species except the MHC region (H2, HLA, SLA, and BoLA for mice, humans, pigs, and cattle, respectively). The scale bar is shown at the bottom.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4905052/v1/5731725be91c7e44fdf605a8.png"},{"id":64310555,"identity":"70f68441-1a7a-4649-b3d8-166d6cd167e7","added_by":"auto","created_at":"2024-09-11 13:27:15","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":346255,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of allele numbers and heterozygosity among SLA and OR genes. OR genes are classified into SLA-linked and unlinked, distal and proximal to SLA class I, and FPKM ≥ 0.1 and FPKM \u0026lt; 0.1 for testicular expression. Genetic diversity was compared for the number of alleles (A), observed heterozygosity (Ho; B), and expected heterozygosity (He; C) among different groups. The group names corresponding to each bar are identical through (A), (B), and (C) and are only shown on the x-axis of (C). The y-axis indicates the mean values of the group, and the standard deviations are indicated by vertical lines above the bar. Statistical significance using Student’s t-test is indicated with horizontal lines with * and ** denoting P-value \u0026lt; 0.05 and P-value \u0026lt; 0.01, respectively.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4905052/v1/36919aab1db552d77a49269e.png"},{"id":64309015,"identity":"8642fc8d-85f0-4236-b4ee-2eb319a994e4","added_by":"auto","created_at":"2024-09-11 13:11:15","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":363150,"visible":true,"origin":"","legend":"\u003cp\u003ePrediction of recombination breakpoint hotspots for the SLA-OR haplotype-defined region. Recombination breakpoints were inferred from 48 pig SLA-OR haplotypes using haplotype codon alignment. Breakpoint positions (bp) were shown based on the sequence of a representative haplotype (h36) and indicated on the x-axis. The statistical significance of the breakpoints was tested by random permutations (n=1000) in a 200bp window. The P-values indicating statistical confidence in recombination breakpoint hotspots are shown on the y-axis. Breakpoint hotspots were defined as regions with P-value \u0026lt; 0.01. The names of OR genes including \u003cem\u003eLOC100514111, LOC100516618, LOC100157348, LOC100515036, LOC100156552, LOC100522686, OLF42-3, \u003c/em\u003eand\u003cem\u003e OLF42-1 \u003c/em\u003eare indicated on top together with\u003cem\u003e SLA-1, SLA-2\u003c/em\u003e, and \u003cem\u003eSLA-3.\u003c/em\u003e Only the last three digits of the gene symbols are shown for OR genes with the gene symbol starting with ‘LOC’. Arrows on tops indicate the chromosomal locations of the coding sequence of each gene constituting the OR-SLA haplotype in this study. Purple vertical lines below the gene names indicate variant positions in the haplotype sequence alignment.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4905052/v1/9d48600244403dc1180b9b23.png"},{"id":64309019,"identity":"8f60cec5-8fed-48a6-b264-dbcb83bdcb8d","added_by":"auto","created_at":"2024-09-11 13:11:15","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1914889,"visible":true,"origin":"","legend":"\u003cp\u003ePairwise LD plot for three SLA class I and nine OR genes. The pairwise LD levels among three SLA class I and nine OR genes were estimated according to normalized entropy differences between two loci (ε) using eLD software. The ε values for each gene pair are presented in a matrix format and shown at the intersection of the two genes. The ε values are color-coded in blue and red with gradients from low to high LD, respectively, as described in the color key on the bottom left. Gene names and chromosomal locations are indicated on the top and the genes are arranged according to their relative positions on pig chromosome 7 (NC_010449). The names of OR genes starting with “LOC” shown on the gene map are indicated only with the last three digits of the gene symbols in the LD matrix.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4905052/v1/1dac4d521e527b5ae0a05b5e.png"},{"id":64309779,"identity":"5f512b7b-598c-4afa-81f3-54d9b49bc101","added_by":"auto","created_at":"2024-09-11 13:19:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1001897,"visible":true,"origin":"","legend":"\u003cp\u003eGenetic relationships of six pig breeds from principal component analysis using the typing results of three SLA class I and nine linked ORs. The results of principle component analysis using principal components (PC) 1 and 2 are shown. The relative eigenvalues ​​of each component are indicated on the x- and y-axis, respectively. Each individual (n = 48) is represented by a dot, and different breeds are indicated by different colors, as shown on the upper left of the plot.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4905052/v1/a5fc4ae73b95eea44d2338f7.png"},{"id":75931427,"identity":"e4567931-8e5c-4479-a16f-35f73066dd18","added_by":"auto","created_at":"2025-02-10 16:14:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6782526,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4905052/v1/3121a062-09b5-4c0a-add6-b61537228a5f.pdf"},{"id":64309020,"identity":"e6ab22dc-29d5-49f8-9c94-10698f4f482b","added_by":"auto","created_at":"2024-09-11 13:11:16","extension":"zip","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":7411751,"visible":true,"origin":"","legend":"","description":"","filename":"ORSLABMCgen.supdata.zip","url":"https://assets-eu.researchsquare.com/files/rs-4905052/v1/67dfbb8cb273dce919605b3a.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Influence of MHC on genetic diversity and testicular expression of linked olfactory receptor genes","fulltext":[{"header":"Background","content":"\u003cp\u003eOlfactory receptors (ORs) are G protein-coupled receptors (GPCRs) responsible for odorant recognition, primarily expressed in olfactory neurons [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. OR genes are highly diverse, forming extensive gene families that recognize a wide range of odorants and are organized into clusters across multiple chromosomes in the vertebrate genome [\u003cspan additionalcitationids=\"CR3 CR4\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The number of OR genes and the extent of pseudogenization vary significantly among species, reflecting the importance of olfaction for their survival. For example, pigs (\u003cem\u003eSus scrofa\u003c/em\u003e), cattle (\u003cem\u003eBos taurus\u003c/em\u003e), mice (\u003cem\u003eMus musculus\u003c/em\u003e), and humans (\u003cem\u003eHomo sapiens\u003c/em\u003e) possess 1,301 (14.5% pseudogenes), 1,071 (17.7% pseudogenes), 1,483 (23.1% pseudogenes), and 874 OR genes (55.5% pseudogenes), respectively [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Notably, marine mammals exhibit a reduced OR repertoire compared to terrestrial animals [\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eORs are also implicated in functions beyond odor recognition and olfactory signal transduction, as they are expressed in a variety of tissues and cells, including the brain, tongue, heart, spleen, and pancreas [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Noncanonical OR expression has been associated with the modulation of cell-cell recognition, migration, proliferation, apoptosis, exocytosis, and pathfinding processes [\u003cspan additionalcitationids=\"CR17 CR18 CR19\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Furthermore, several ORs are expressed in the testes and sperm cells, where they detect specific odorant molecules that trigger Ca\u003csup\u003e2+\u003c/sup\u003e signals, which are crucial for changes in sperm motility and chemotaxis [\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Intriguingly, ORs expressed in the testes are genetically linked to highly variable major histocompatibility complexes (MHC) and \u003cem\u003eGABBR1\u003c/em\u003e, which are involved in recognizing foreign antigens for the adaptive immune response and play a role in sperm acrosome reactions, respectively [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan additionalcitationids=\"CR25 CR26\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The conserved architecture of OR-\u003cem\u003eGABBR1\u003c/em\u003e-MHC genes across vertebrate species may contribute to MHC genotype-based mating preferences, favoring individuals with dissimilar MHC genotypes [\u003cspan additionalcitationids=\"CR29 CR30 CR31\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. However, our understanding of this phenomenon remains limited.\u003c/p\u003e \u003cp\u003eAlthough ORs expressed in the testes appear to be genetically linked to the MHC, limited information is available on the diversity of MHC-linked ORs compared to ORs located in other chromosomal regions. Some studies have reported that MHC-OR haplotypes are highly variable and that specific OR-MHC allele combinations occur more frequently than expected by chance [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo elucidate the genetic and functional relationships between MHC and MHC-linked ORs, we analyzed the evolutionary conservation and linkage disequilibrium (LD) between MHC and MHC-linked ORs by typing nine MHC-linked ORs and three classical MHC class I genes in pigs. We performed haplotype analysis and compared allelic diversity between MHC-linked and unlinked ORs to assess the influence of MHC genes on OR diversity. Additionally, we examined the testicular expression patterns of orthologous MHC-linked ORs in pigs and humans using transcriptome data.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eIdentification of MHC-linked orthologous OR genes across humans, mice, cattle, and pigs\u003c/h2\u003e\n \u003cp\u003eThe current genome assemblies for humans, mice, pigs, and cattle reveal that the numbers of OR genes mapped to MHC-residing chromosomes are 34, 67, 33, and 90, respectively (Supplementary Table\u0026nbsp;1). To determine the orthologous relationships of the ORs in the MHC-linked region among the four species, we identified 11 non-OR orthologous framework loci across these species using information from the NCBI Ortholog Database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.ncbi.nlm.nih.gov/gene\u003c/span\u003e\u003c/span\u003e). These loci include \u003cem\u003eABT1\u003c/em\u003e, \u003cem\u003eZNF322\u003c/em\u003e, \u003cem\u003ePOM121L2\u003c/em\u003e, \u003cem\u003eZNF184\u003c/em\u003e, H1-\u003cem\u003e5\u003c/em\u003e, \u003cem\u003eZSCAN26\u003c/em\u003e, \u003cem\u003eZSCAN12\u003c/em\u003e, \u003cem\u003eGPX6\u003c/em\u003e, \u003cem\u003eGABBR1\u003c/em\u003e, \u003cem\u003eMOG\u003c/em\u003e, and \u003cem\u003eZFP57\u003c/em\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Subsequently, we established the orthologous relationships of the ORs adjacent to the framework loci through interspecies pairwise BLAST analysis (Supplementary Table\u0026nbsp;2). OR gene pairs with e-values\u0026thinsp;\u0026lt;\u0026thinsp;10\u003csup\u003e\u0026minus;\u0026thinsp;100\u003c/sup\u003e (E-100) and bit scores\u0026thinsp;\u0026gt;\u0026thinsp;500 between species, along with their syntenic relationships from the comparative analysis of framework loci, were identified as putative OR orthologs.\u003c/p\u003e\n \u003cp\u003eThe number of OR genes within each OR cluster varied among species. OR genes with multiple matches in a given species from the BLAST analysis were considered to result from recent gene duplications. We observed three OR clusters on \u003cem\u003eS. scrofa\u003c/em\u003e chromosome 7 (SSC7) and \u003cem\u003eB. taurus\u003c/em\u003e chromosome 23 (BTA23), whereas \u003cem\u003eH. sapiens\u003c/em\u003e chromosome 6 (HSA6) contained two clusters. An additional OR gene located between \u003cem\u003eABT1\u003c/em\u003e and \u003cem\u003eZNF322\u003c/em\u003e in Euungulata, but absent in other species, indicated an expansion of MHC-linked ORs within this lineage. In contrast, a single cluster of OR genes was present on \u003cem\u003eM. musculus\u003c/em\u003e chromosome 17 (MMU17) due to the translocation of the OR cluster onto MMU13 (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Consequently, only a \u003cem\u003eGABBR1\u003c/em\u003e-linked OR cluster was common to MHC-bearing chromosomes in all four species. The ORs between \u003cem\u003eZSCAN26\u003c/em\u003e and \u003cem\u003eH1-5\u003c/em\u003e, as well as between \u003cem\u003eZSCAN12\u003c/em\u003e and \u003cem\u003eGPX6\u003c/em\u003e, were conserved across cattle, humans, and pigs.\u003c/p\u003e\n \u003cp\u003e\u0026lt;Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e location\u0026gt;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003eDevelopment of a high-resolution typing method for nine MHC-linked OR genes in pigs\u003c/h2\u003e\n \u003cp\u003eThe high frequency of particular allele combinations at different loci may suggest the presence of LD or a functional association between them. To investigate the associations between MHC and linked ORs, we selected nine pig MHC-linked OR genes, including \u003cem\u003eLOC100514111\u003c/em\u003e, \u003cem\u003eLOC100516618\u003c/em\u003e, \u003cem\u003eLOC100157348\u003c/em\u003e, \u003cem\u003eLOC100515036\u003c/em\u003e, \u003cem\u003eLOC100156552\u003c/em\u003e, \u003cem\u003eLOC100522686\u003c/em\u003e, \u003cem\u003eLOC100516811\u003c/em\u003e, \u003cem\u003eOLF42-3\u003c/em\u003e, and \u003cem\u003eOLF42-1\u003c/em\u003e, based on their cluster location, testicular expression level, and the presence of human orthologs (Supplementary Table 2). To develop a comprehensive typing method for these OR genes, we designed primers corresponding to the 500 bp upstream and downstream regions of each OR gene. Through iterative primer design and confirmation of amplification specificity, we identified a set of primers that enabled comprehensive amplification of the nine ORs (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). We then developed sequencing primers for each amplicon, resulting in a sequence-based high-resolution typing method for ORs. For allelic determination, homozygous typing results were classified as novel alleles when observed for the first time. Heterozygous samples were separated by molecular cloning and sequenced to resolve the alleles. As a result, we successfully determined the allelic status of all typing results (n\u0026thinsp;=\u0026thinsp;576) without any exceptions (Supplementary Tables 3 and 4). The sequence information for OR alleles was submitted to NCBI under accession numbers PP768337 to PP768442 (Supplementary Table 3). The number of alleles for ORs ranged from 5 to 22 (Supplementary Tables 3 and 5). Typing results for \u003cem\u003eLOC100515036\u003c/em\u003e revealed more than two alleles per individual across multiple samples, suggesting an association between gene duplications and copy number variations (CNVs).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimer information for typing nine SLA-linked OR and three SLA class I genes\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"5\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTarget loci\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer usage\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence (5\u0026apos; to 3\u0026apos;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAmplicon size (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAnnealing (℃)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100514111\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTGACAGCAAGTAAATGTGTTTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,302\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGATGAGCTCTTCACCRAGTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGATAGGTTTGTAGCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTTCATTTGCTGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100516618\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTAGGTAGAGGGGCAGGGGATACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,620\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTGGCGTCCACATTCATGGTTGGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCTGTAAACCTCTGCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCAATTARTGCTGGCATCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100157348\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTTGAGTTACCTTTGCAGTTCATACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e2,323\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCAAATTTTRTGTGAAAGGAACAAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACTCCACTACATGCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCACTTGGTTTTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"5\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100156552\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGGTCACTATCCCTTGCTTTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,834\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCTTACACTGTTTTAGTGACTTMAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACTTGACCGCTATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTTGAGCAAAGGARGGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAdditional Sequencing\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCAAGCCCCTTCACTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100515036\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCTCTCCCCTTGTCGAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,803\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGAGAAAGTATATGTACAGCTGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCCCTTCACTACACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTCATTTCTCCCACAGAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100522686\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGGTGTACTTCATTCCTCCTTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,242\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCTTGCATTTCTTGAAGGTCTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGTGTGTAARCCTCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCACAAAAGAAGTGGTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100516811\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAAGAGCTCACCTTTGCCCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,720\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTGTGTGCTCACKTACTTACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCCTATGACCACTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGTRTCTCTGCATAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cem\u003eOLF42-3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTACCTTCAGTGAGTCTGAGGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,700\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCAGGTCCTAAMACGCCTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCAACCCCTCCACTATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGGATCTCATTGTAGGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cem\u003eOLF42-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAACCACTGACCTGCTGTAGTGCCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,322\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAGCTTCGTCTGTTTTCCAGCGCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCAACCCCTCCACTATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACAGGRGAGTCGAATTAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e\u003cem\u003eSLA-1\u003c/em\u003e exon 2, 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMTAARCTCTCCRCCCASCCGGCTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,844\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e65\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGGTCACATGTGTCYTTGGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGCTATGCTGTGCGCCGARAGGAGGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGCTGATTATCGCCCKCGTTGGWCGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"5\"\u003e\n \u003cp\u003e\u003cem\u003eSLA-3\u003c/em\u003e exon 2, 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGGGRCCCTGGCCCTGATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,655\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e65\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGGTCACATGTGTCYTTGGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTGTGAATGCTGCTGCGCCGAGAGGAGGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGTGAATGCTATGGTKGGTCGYGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAdditional Sequencing\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGACCCCCTTTTCCTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"6\"\u003e\n \u003cp\u003e\u003cem\u003eSLA-2\u003c/em\u003e exon 2, 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003egPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCTCGACACAGAATCTCCGATATATCCAAAGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e1,679\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e65\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGGTCACATGTGTCYTTGGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGCTATGCTGTGCGCCGARAGGAGGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAGGGGAGATGGTGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eAdditional Sequencing\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGCTGATTATCGCCCKCGTTGGWCGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTCCTGGGGATGGGGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT7 universal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eColony PCR\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTAATACGACTCACTATAGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003en.a.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSP6 universal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATTTAGGTGACACTATAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003csup\u003ea\u003c/sup\u003e Primer for genomic PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003csup\u003eb\u003c/sup\u003e Additional sequencing primers for indel variants\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003csup\u003ec\u003c/sup\u003e PCR primers for target clone amplification\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u0026lt;Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e location\u0026gt;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003eHigher genetic diversity of SLA-linked ORs compared to SLA-unlinked ORs\u003c/h2\u003e\n \u003cp\u003eExtreme genetic polymorphisms of the MHC can influence the diversity of linked genes. To assess the impact of LD with the MHC on the diversity of OR genes, we performed sequence-based typing of \u003cem\u003eSLA-1\u003c/em\u003e, \u003cem\u003eSLA-2\u003c/em\u003e, and \u003cem\u003eSLA-3\u003c/em\u003e in animals with existing OR typing data, using previously established methods [\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e]. High-resolution typing results were obtained for all three SLA class I genes, identifying 34, 29, and 17 alleles for \u003cem\u003eSLA-1\u003c/em\u003e, \u003cem\u003eSLA-2\u003c/em\u003e, and \u003cem\u003eSLA-3\u003c/em\u003e, respectively. CNV was observed in \u003cem\u003eSLA-1\u003c/em\u003e, consistent with previous findings [\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e] (Supplementary Table 4). No novel alleles were detected for \u003cem\u003eSLA-1\u003c/em\u003e and \u003cem\u003eSLA-2\u003c/em\u003e; however, a new non-functional allele was identified for \u003cem\u003eSLA-3\u003c/em\u003e (PQ037598), which contains a premature stop codon. Regarding genetic diversity, the observed heterozygosity (Ho) for \u003cem\u003eSLA-1\u003c/em\u003e, \u003cem\u003eSLA-2\u003c/em\u003e, and \u003cem\u003eSLA-3\u003c/em\u003e ranged from 0.646 to 0.813, with a mean of 0.750, while the expected heterozygosity (He) ranged from 0.942 to 0.961, with a mean of 0.954, consistent with previously reported diversity of SLA class I genes [\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e] (Supplementary Table\u0026nbsp;5).\u003c/p\u003e\n \u003cp\u003eWhen comparing the allelic diversity between nine SLA-linked ORs typed in this study and 20 SLA-unlinked ORs reported in a previous study, which examined mostly the same populations as in this study [\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e], the mean allele numbers for SLA-linked and SLA-unlinked ORs were 11.78\u0026thinsp;\u0026plusmn;\u0026thinsp;5.38 and 6.65\u0026thinsp;\u0026plusmn;\u0026thinsp;3.01, respectively (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Supplementary Table 5), indicating a significant difference between the two groups (P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The mean Ho and He of SLA-linked OR genes were also significantly higher than those of SLA-unlinked ORs, with Ho\u0026thinsp;=\u0026thinsp;0.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08 vs. 0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18 (P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and He\u0026thinsp;=\u0026thinsp;0.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10 vs. 0.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24 (P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Supplementary Table\u0026nbsp;5). Notably, three SLA-linked ORs\u0026mdash;\u003cem\u003eOLF42-1, OLF42-3\u003c/em\u003e, and \u003cem\u003eLOC100515036\u003c/em\u003e\u0026mdash;exhibited particularly high allele numbers. CNVs were observed in \u003cem\u003eLOC100515036\u003c/em\u003e, suggesting gene duplication at this locus. However, the number of alleles was also high for the SLA-unlinked OR \u003cem\u003esOR6T3\u003c/em\u003e (15 alleles), indicating that the specific functions of certain ORs may also contribute to genetic diversity, although we were unable to determine functional differences among these ORs.\u003c/p\u003e\n \u003cp\u003e\u0026lt;Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e location\u0026gt;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eDetermination of 48 haplotypes for\u003c/strong\u003e \u003cstrong\u003eSLA-1, SLA-2, SLA-3\u003c/strong\u003e, \u003cstrong\u003eand nine SLA-linked ORs\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eWe identified a combined total of 106 alleles for nine ORs and 80 alleles for three classical SLA class I genes by typing 48 individuals from six pig breeds (Supplementary Tables\u0026nbsp;3 and 4). The allele numbers for \u003cem\u003eSLA-1\u003c/em\u003e and \u003cem\u003eLOC100515036\u003c/em\u003e, which exhibit CNVs, ranged from 0 (null) to 2 and 1 to 3 per haplotype, respectively, while the remaining genes showed one allele per haplotype, as expected. To determine haplotypes, preliminary haplotype phasing was performed without CNV-related genes to reduce the complexity of haplotype determination, using the expectation-maximization (EM) algorithm. Subsequently, final haplotypes were manually refined by incorporating the genotypes of the CNV-related genes, following the strategy described in Supplementary Fig.\u0026nbsp;1. As a result, 48 combined haplotypes were established for \u003cem\u003eSLA-1, SLA-2, SLA-3\u003c/em\u003e, and nine SLA-linked ORs (Supplementary Table\u0026nbsp;6). When the haplotype sequences were translated into amino acid sequences, the number of haplotypes was reduced by only one, indicating a high rate of nonsynonymous substitutions in this region (Supplementary Table\u0026nbsp;6).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003eIdentification of five putative breakpoint hotspots at locus junctions within the SLA-OR region\u003c/h2\u003e\n \u003cp\u003eWe identified candidate recombination breakpoint sites based on codon alignment analysis of 48 haplotype sequences within the SLA-OR region using RDP software (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Five sites emerged as prominent breakpoint hotspots with \u0026gt;\u0026thinsp;99% confidence, as determined by the observed haplotype patterns in the region (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, Supplementary Fig. 2). The deduced breakpoint hotspots within the SLA and linked OR gene regions were primarily located at the locus boundaries between \u003cem\u003eLOC100516618\u003c/em\u003e and \u003cem\u003eLOC100157348\u003c/em\u003e, \u003cem\u003eLOC100156552\u003c/em\u003e and \u003cem\u003eLOC100522686\u003c/em\u003e, and \u003cem\u003eOLF42-1\u003c/em\u003e and SLA genes. Consistent with these findings, when pairwise LD among three SLA class I and nine linked OR genes was estimated by calculating normalized entropy differences between two loci (\u0026epsilon;) using eLD software, \u003cem\u003eLOC100157348\u003c/em\u003e, \u003cem\u003eLOC100515036\u003c/em\u003e, \u003cem\u003eLOC100156552\u003c/em\u003e, \u003cem\u003eOLF42-3\u003c/em\u003e, and \u003cem\u003eOLF42-1\u003c/em\u003e showed higher LD with \u003cem\u003eSLA-1, -2\u003c/em\u003e, and \u003cem\u003e\u0026minus;\u0026thinsp;3\u003c/em\u003e (mean \u0026epsilon;\u0026thinsp;\u0026ge;\u0026thinsp;0.3) compared to other analyzed ORs (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003e\u0026lt;Figure \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e location\u0026gt;\u003c/p\u003e\n \u003cp\u003e\u0026lt;Figure \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e location\u0026gt;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003eSimilarity in the testicular expression of MHC-linked ORs between humans and pigs\u003c/h2\u003e\n \u003cp\u003eTo investigate the expression patterns of MHC-linked ORs, we analyzed the expression levels of nine SLA-linked ORs using publicly available transcriptome data from pig testes (from three 120-day-old pigs, GEO accession: GSE171756) and olfactory epithelium (OE) (from four newborn pigs, GEO accession: GSE197184) (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Supplementary Table 7). The expression levels of \u003cem\u003eOLF42-1\u003c/em\u003e and \u003cem\u003eOLF42-3\u003c/em\u003e in the proximal OR cluster of SLA class I and \u003cem\u003eLOC100515036\u003c/em\u003e and \u003cem\u003eLOC1001156552\u003c/em\u003e in the distal OR cluster were higher (FPKM 0.102\u0026ndash;0.742) than those of other ORs (FPKM 0\u0026ndash;0.055; Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e), indicating differential expression levels in the testis. However, this pattern differed from that of ORs expressed in OE, suggesting tissue-specific regulation of gene expression in these ORs (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Supplementary Table 7). Additionally, we analyzed the expression patterns of putative human OR orthologs of the nine pig ORs using publicly available transcriptome data from human tissues (GEO accession: GSE30611 for human testis and GSE80249 for human OE) and compared them with their expression in pigs. The expression of \u003cem\u003eOR2H1\u003c/em\u003e and \u003cem\u003eOR2H2\u003c/em\u003e, human orthologs of pig \u003cem\u003eOLF42-1\u003c/em\u003e and \u003cem\u003eOLF42-3\u003c/em\u003e, respectively, was also higher in the human testis (mean FPKM\u0026thinsp;=\u0026thinsp;0.603) compared to other ORs (mean FPKM\u0026thinsp;=\u0026thinsp;0.007), reflecting a similar expression pattern to that observed in pigs. Notably, \u003cem\u003eOR2B8P\u003c/em\u003e, the putative human ortholog corresponding to pig \u003cem\u003eLOC100515036\u003c/em\u003e and \u003cem\u003eLOC1001156552\u003c/em\u003e (likely duplicated in pigs), has been pseudogenized in humans. These results indicate that the testicular expression pattern of the analyzed functional HLA-linked ORs is similar between pigs and humans (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Supplementary Table 7, Supplementary Fig. 3).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eComparison of SLA-linked OR expression in testis and olfactory epithelium between pigs and humans\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"8\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eGroup\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eGene symbol\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eHuman ortholog\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"5\"\u003e\n \u003cp\u003eExpression (FPKM)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003ePig\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eHuman\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTestis\u003csup\u003ee\u003c/sup\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eOE\u003csup\u003ef\u003c/sup\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTestis\u003csup\u003eg\u003c/sup\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eOE\u003csup\u003eh\u003c/sup\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"6\"\u003e\n \u003cp\u003eDistal OR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100514111\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOR2B2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.055\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.717\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100516618\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOR2W6P\u003c/em\u003e\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.005\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.753\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.018\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100157348\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOR2B7P\u003c/em\u003e\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.465\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.039\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100515036\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOR2B8P\u003c/em\u003e\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.127\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.182\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.104\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100156552\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOR2B8P\u003c/em\u003e\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.102\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.107\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.104\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100522686\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOR2E1P\u003c/em\u003e\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003en.a.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.188\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eProximal OR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100516811\u003c/em\u003e\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOR11A1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003en.a.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.479\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOLF42-3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOR2H2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.406\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.799\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.136\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOLF42-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOR2H1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.742\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.710\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.406\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.017\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eControl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eACTG1\u003c/em\u003e\u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1106.680\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1315.007\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e664.920\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e911.566\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003eNPY\u003c/em\u003e\u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.012\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.273\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.870\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.028\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"8\"\u003e\n \u003cp\u003e\u003csup\u003ea\u003c/sup\u003e OR groups were categorized based on the physical distance to SLA.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"8\"\u003e\n \u003cp\u003e\u003csup\u003eb\u003c/sup\u003e Putative pseudogene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"8\"\u003e\n \u003cp\u003e\u003csup\u003ec, d\u003c/sup\u003e Housekeeping and olfactory epithelium (OE)-specific genes, respectively.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"8\"\u003e\n \u003cp\u003e\u003csup\u003ee, f, g, h\u003c/sup\u003e GEO accession numbers for data sets: GSE171756, GSE197184, GSE30611, and GSE80249, respectively.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"8\"\u003e\n \u003cp\u003e\u003csup\u003ef\u003c/sup\u003e FPKM values of pig OE were not available and indirectly calculated from read counts.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u0026lt;Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e location\u0026gt;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003ePositive correlation between heterozygosity levels and testicular expression of SLA-linked ORs\u003c/h2\u003e\n \u003cp\u003eFrom the expression data of nine SLA-linked pig OR genes in regions conserved between pigs and humans, we categorized the genes into two groups based on testicular expression levels exceeding 0.1 FPKM, using the round-off mean value (mean FPKM\u0026thinsp;=\u0026thinsp;0.098) for expressed ORs in pig testes (Supplementary Table\u0026nbsp;7, Supplementary Fig.\u0026nbsp;3). \u003cem\u003eLOC100515036\u003c/em\u003e, \u003cem\u003eLOC100156552\u003c/em\u003e, \u003cem\u003eOLF42-3\u003c/em\u003e, and \u003cem\u003eOLF42-1\u003c/em\u003e showed mean expression levels of \u0026ge;\u0026thinsp;0.1 FPKM (n\u0026thinsp;=\u0026thinsp;3), while \u003cem\u003eLOC100514111\u003c/em\u003e, \u003cem\u003eLOC100516618\u003c/em\u003e, \u003cem\u003eLOC100157348\u003c/em\u003e, \u003cem\u003eLOC100522686\u003c/em\u003e, and \u003cem\u003eLOC100516811\u003c/em\u003e had mean expression levels of \u0026lt;\u0026thinsp;0.1 FPKM (n\u0026thinsp;=\u0026thinsp;3). When comparing these expression levels to the genetic diversity of each locus, Ho differed between the two groups, with mean Ho\u0026thinsp;=\u0026thinsp;0.750 for FPKM\u0026thinsp;\u0026ge;\u0026thinsp;0.1 versus Ho\u0026thinsp;=\u0026thinsp;0.617 for FPKM\u0026thinsp;\u0026lt;\u0026thinsp;0.1 (P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and Supplementary Table\u0026nbsp;5). The mean Ho of ORs with FPKM\u0026thinsp;\u0026ge;\u0026thinsp;0.1 (Ho\u0026thinsp;=\u0026thinsp;0.750) was similar to that of SLA class I genes (Ho\u0026thinsp;=\u0026thinsp;0.750; P-value\u0026thinsp;=\u0026thinsp;0.5) but differed from ORs with FPKM\u0026thinsp;\u0026lt;\u0026thinsp;0.1 (Ho\u0026thinsp;=\u0026thinsp;0.617; P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Additionally, allele numbers were greater for ORs with FPKM\u0026thinsp;\u0026ge;\u0026thinsp;0.1 (mean n\u0026thinsp;=\u0026thinsp;16.25) compared to those with FPKM\u0026thinsp;\u0026lt;\u0026thinsp;0.1 (mean n\u0026thinsp;=\u0026thinsp;8.20), suggesting a positive correlation between allele diversity and testicular expression levels for SLA-linked ORs.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003ePositive correlation between testicular expression and the number of codons under diversifying selection for SLA and linked ORs\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eWe estimated selection pressure for 3,032 codons constituting nine OR and three SLA genes using a random-site model in PAML. We also calculated LD between all possible SNP pairs from 550 SNPs identified in 48 OR-SLA haplotype sequences (Supplementary Table 8). Our analysis revealed that 41 codons from nine ORs had dN/dS (\u0026omega;) values\u0026thinsp;\u0026gt;\u0026thinsp;1.00 according to both M2 and M8 models, indicating diversifying selection. Among these 41 diversifying codons, 25 were in significant LD (D\u0026rsquo; \u0026gt; 0.5, LOD\u0026thinsp;\u0026gt;\u0026thinsp;2) with diversifying codons of SLA genes (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, Supplementary Table\u0026nbsp;9). Further analysis showed that 15 out of 16 (94%) functional OR genes with FPKM\u0026thinsp;\u0026ge;\u0026thinsp;0.1 (\u003cem\u003eLOC100515036\u003c/em\u003e, \u003cem\u003eLOC100156552\u003c/em\u003e, \u003cem\u003eOLF42-3\u003c/em\u003e, \u003cem\u003eOLF42-1\u003c/em\u003e) were in significant LD with SLA, compared to only 10 out of 25 (40%) for ORs with FPKM\u0026thinsp;\u0026lt;\u0026thinsp;0.1 (\u003cem\u003eLOC100514111\u003c/em\u003e, \u003cem\u003eLOC100516618\u003c/em\u003e, \u003cem\u003eLOC100157348\u003c/em\u003e, \u003cem\u003eLOC100522686\u003c/em\u003e), except for \u003cem\u003eLOC100522686\u003c/em\u003e (89%). This finding suggests a correlation between OR expression in the testis and evolutionary selection between SLA and SLA-linked ORs.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eAssociation of the number of codons under diversifying selection with testicular expression level in SLA-linked olfactory receptor genes\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"8\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene group\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eLoci\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNo. of SNP (A)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNo. of SNP in significant LD\u003c/p\u003e\n \u003cp\u003ewith SLA (B)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eB/A ratio\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNo. of diversifying\u003c/p\u003e\n \u003cp\u003ecodons (C)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNo. of diversifying codons in significant LD with SLA (D)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eD/C ratio\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003eOR with FPKM\u0026thinsp;\u0026ge;\u0026thinsp;0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100514111\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100516618\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e25\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100157348\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e21\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.17\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100522686\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e30\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.89\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"4\"\u003e\n \u003cp\u003eOR with FPKM\u0026thinsp;\u0026lt;\u0026thinsp;0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100515036\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e54\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.83\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLOC100156552\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e48\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOLF42-3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e59\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eOLF42-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e24\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.88\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e265\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e155\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"8\"\u003eNote. Selection pressure was calculated from the codon alignment using 48 haplotypes for the SLA class I-OR region. Significant LD indicates LD with D\u0026rsquo; \u0026gt; 0.5 and log-likelihood odds ratio (LOD)\u0026thinsp;\u0026gt;\u0026thinsp;2 between SNPs.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u0026lt;Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e location\u0026gt;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003eBreed differences in SLA-OR haplotypes\u003c/h2\u003e\n \u003cp\u003eWe analyzed population differences in MHC-OR haplotype repertoires for \u003cem\u003eSLA-1, -2, -3\u003c/em\u003e, and nine linked OR regions among six pig breeds: Berkshire (BER), Duroc (DUR), Landrace (LAN), Yorkshire (YOR), Korean native pigs (KNP), and SNU minipigs (SNU). Principal component analysis (PCA) of 48 haplotypes showed a high degree of genetic relatedness among European breeds (BER, DUR, LAN, and YOR), whereas KNP and SNU were more distantly related to the European pig cluster (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). The mean FST value was highest for SNU (mean FST\u0026thinsp;=\u0026thinsp;0.265), followed by KNP (mean FST\u0026thinsp;=\u0026thinsp;0.222), and BER (mean FST\u0026thinsp;=\u0026thinsp;0.212), with DUR (mean FST\u0026thinsp;=\u0026thinsp;0.181), YOR (mean FST\u0026thinsp;=\u0026thinsp;0.172), and LAN (mean FST\u0026thinsp;=\u0026thinsp;0.156) showing lower values (Supplementary Fig. 4). This indicates that BER has relatively distinct MHC-OR haplotypes compared to other European breeds. In the minimum spanning network (MSN) plot, LAN occupied a central position with the largest number of haplotypes (n\u0026thinsp;=\u0026thinsp;12) among the six breeds (Supplementary Fig. 5). LAN haplotypes h1, h15, and h28 were shared with YOR and DUR. BER was closely positioned to other European breeds in its haplotype composition but did not directly share haplotypes with them. KNP shared haplotype h7 with DUR. SNU pigs had the lowest number of haplotypes in the inbred population.\u003c/p\u003e\n \u003cp\u003e\u0026lt;Figure \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e location\u0026gt;\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAbout 1,300 OR genes are present in the pig genome, and the increased OR gene repertoire and allelic variation may have contributed to enhancing the survival of the species [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In particular, 26 functional and 7 pseudogenes were annotated on pig chromosome 7 harboring SLA genes (Supplementary table 7). MHC molecules have evolved to be highly polymorphic and initiate immune responses against an almost unlimited number of foreign molecules [\u003cspan additionalcitationids=\"CR43 CR44\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Such evolutionary forces of MHC could affect the diversity of neighboring genes through mechanisms such as hitchhiking or functional association. Because many OR genes are present in SLA-linked regions, we investigated the genetic and evolutionary influence of MHC on the diversity of neighboring OR genes by comparing genetic variations between SLA-linked and unlinked ORs.\u003c/p\u003e \u003cp\u003eThe typing results of SLA-linked ORs in this study showed a significant increase in the genetic diversity of SLA-linked ORs compared to unlinked ORs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Supplementary table 5), suggesting MHC as a possible driving force for increasing the genetic diversity of neighboring ORs. The influence of MHC on the genetic diversity of linked ORs was also evidenced by the increased allelic diversity and observed heterozygosity of ORs with strong LD to SLA compared to those with weak or no LD to SLA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Supplementary table 5).\u003c/p\u003e \u003cp\u003eThe evolutionary conservation of OR-MHC architecture in vertebrates has been well described in previous versions of genome assemblies [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In this study, we conducted a comparative analysis of MHC-linked ORs using current genome assemblies and annotations, and provided an updated and more detailed picture of the comparative OR-MHC architecture among cattle, humans, mice, and pigs. For example, several OR genes within the extended MHC (xMHC) region were mapped differently in the previous genome assembly (Sscrofa10.2) than in the current genome assembly, Sscrofa11.1 (Supplementary table 10). In addition, the number of \u003cem\u003eGABBR1-\u003c/em\u003elinked pig ORs mapped to this region appeared to be smaller than those of other species (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). However, we confirmed the structural conservation of the major OR cluster linked to MHC among the four species, despite the presence of species specificity.\u003c/p\u003e \u003cp\u003eThe conservation of the major MHC-linked OR cluster linked to \u003cem\u003eGABBR1\u003c/em\u003e in the xMHC region of vertebrates may indicate possible functional relationships between these ORs and MHC [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Pig ORs, \u003cem\u003eOLF42-3\u003c/em\u003e and \u003cem\u003eOLF42-1\u003c/em\u003e, which showed higher genetic diversity and testicular expression than the other ORs, were also present in the species-conserved region. A previous study suggested that the strong genetic linkage between \u003cem\u003eGABBR1\u003c/em\u003e-linked ORs and HLA could be related to the functional interactions of these molecules [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The orthologs of pig \u003cem\u003eOLF42-1\u003c/em\u003e and \u003cem\u003eOLF42-3\u003c/em\u003e which are highly expressed in pig testes, are also expressed in human sperm [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. HLA class I expression is observed in granulosa cells surrounding oocytes in humans [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. These results suggested that MHC-linked ORs play a role in mate selection, showing a preference for partners with different MHC class I genotypes, as previously suggested [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn studies on human testicular expression of ORs, the majority of OR genes expressed in the testis were genetically linked to HLA [\u003cspan additionalcitationids=\"CR50\" citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. These testicular HLA-linked OR genes show significant variations in expression levels and exhibit a non-canonical expression pattern through long-distance splicing and exon sharing among OR genes [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Interestingly, this promiscuous expression plays a critical role in the establishment of self-tolerance in T cells [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Therefore, MHC-linked ORs that are highly expressed in the testes or germ cells may play a role in mediating MHC genotypes through strong LD between MHC and OR genes. This is consistent with our results in which the frequency of diversifying codons in significant LD with SLA was much higher for functional OR genes of FPKM\u0026thinsp;\u0026ge;\u0026thinsp;0.1 than those of FPKM\u0026thinsp;\u0026lt;\u0026thinsp;0.1 (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Furthermore, several testicular MHC-linked ORs are expressed in sperm [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], and \u003cem\u003eGABBR1\u003c/em\u003e, which is involved in OR signaling, is also expressed in the testis [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. These findings suggest that MHC diversity plays a role in OR function in testes and sperm.\u003c/p\u003e \u003cp\u003eA study of the human \u003cem\u003eOR2E1P\u003c/em\u003e pseudogene and \u003cem\u003eOR2H1\u003c/em\u003e, the orthologs of pig \u003cem\u003eLOC100522686\u003c/em\u003e and \u003cem\u003eOLF42-1\u003c/em\u003e, respectively, revealed that \u003cem\u003eOR2E1P\u003c/em\u003e can form spliced variant transcripts with \u003cem\u003eOR2H1\u003c/em\u003e [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Interestingly, the alternative splice sites involved in the exon splicing of \u003cem\u003eOR2H1\u003c/em\u003e were also conserved in porcine \u003cem\u003eOLF42-1\u003c/em\u003e (Supplementary Fig.\u0026nbsp;6), demonstrating the interspecies conservation of evolutionary and functional characteristics among MHC-linked ORs.\u003c/p\u003e \u003cp\u003eVomeronasal receptors (VRs), a class of ORs that function as pheromone receptors, recognize the diversity of MHC peptide ligands and trigger responses from vomeronasal sensory neurons expressing these receptors [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. It has been suggested that MHC peptide ligands can serve as olfactory cues [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. However, it is unclear whether MHC-linked OR genes expressed in the testes and sperm recognize MHC particles and elicit responses. Human \u003cem\u003eOR2H1\u003c/em\u003e recognizes the odor molecule methional, and spermatozoa elicit a crucial Ca\u003csup\u003e2+\u003c/sup\u003e signal necessary for sperm chemotaxis via this molecule [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Recognition of cryptic MHC by ORs may involve distinct odorant molecules, resulting in mate selection. A potential explanation regarding MHC-OR interactions could be the involvement of MHC-linked ORs in MHC-based sexual selection [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe identified 48 haplotypes for the nine SLA-linked ORs and three major SLA class I genes using sequence-based genotyping of 48 animals from six pig breeds (Supplementary table 3 and 4). Sampling bias can be a major cause of error in haplotype estimation using the EM algorithm [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. To overcome the concerns of a small sample size and large number of loci for haplotype estimation in our dataset, we conducted indirect validation of our haplotype analysis results by comparing the population distribution of deduced haplotypes in this study with the outcomes of previous studies independently conducted for 20 MHC-unlinked ORs and the same set of SLA class I genes from populations of mostly overlapping breeds of pigs [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. The allelic and haplotype distributions of SLA-linked ORs for each breed in this study were highly consistent with those of SLA-unlinked ORs reported in a previous study, supporting the reliability of our OR-SLA haplotype information.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eGenetic analysis of ORs in the vertebrate genome is challenging because of the presence of high sequence homology, CNV, and pseudogenes, as well as the large number of loci in the gene family. In the present study, we developed sequence-based high-resolution typing methods for nine SLA-linked OR genes and analyzed their genetic and evolutionary characteristics in relation to MHC class I genes in pigs. Our results indicated a strong influence of SLA diversity on that of the linked OR genes, in which the allelic diversity of ORs was significantly higher than that of other chromosomal regions, and the testicular expression of more polymorphic ORs was higher than that of the less polymorphic SLA-linked ORs. We also showed the conservation of the testicular expression patterns of MHC-linked orthologous ORs between humans and pigs. Our results suggest the possibility of functional and evolutionary interactions between MHC molecules and their linked ORs during animal reproduction. The OR-MHC haplotypes defined in this study contribute to elucidating the relationship between MHC and MHC-like ORs and could be applicable to pig breeding and reproduction.\u003c/p\u003e"},{"header":"Materials and Methods","content":" \u003ch2\u003eAnimals and tissues\u003c/h2\u003e \u003cp\u003eTissue samples of six pig breeds, BER, DUR, LAN, YOR, KNP, and SNU were collected and stored at -80\u0026deg;C in previous studies [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. Eight individuals from each breed were randomly selected. All experiments were approved and performed in accordance with the guidelines and regulations set by the Institute of Animal Care and Use Committee and the Center for Research Ethics of Konkuk University.\u003c/p\u003e \u003ch2\u003ePreparation of genomic DNA\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted from tissues (0.5 g) using a standard protocol. Briefly, tissues were incubated with 700 \u0026micro;L lysis buffer (50 mM Tris pH 8.0, 0.1 M EDTA pH 8.0, 0.5% (w/v) sodium dodecyl sulfate, 20 \u0026micro;g/mL DNase-free pancreatic RNase) and 20 \u0026micro;L of proteinase K (20 mg/mL) at 50\u0026deg;C overnight. Subsequently, gDNA was purified by phenol: chloroform: isoamyl alcohol (pH 8.0) extraction, precipitated using ethanol, and dissolved in 50 mM Tris-EDTA buffer (pH 8.0).\u003c/p\u003e \u003ch2\u003eDetermination of syntenic relationship\u003c/h2\u003e \u003cp\u003eThe genome assemblies and annotations used in this study were GRCh38.p14, Sscrofa11.1, ARS-UCD2.0, and GRCm39 for humans, pigs, cattle, and mice, respectively. The construction of a synteny plot was carried out using the Python package \u0026ldquo;pyGenomeViz\u0026rdquo; (github.com/moshi4/pyGenomeViz) on Python version 3.8.15 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.python.org/\u003c/span\u003e\u003cspan address=\"http://www.python.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003ch2\u003ePrimer design\u003c/h2\u003e \u003cp\u003ePrimers that specifically amplify the entire coding sequence (CDS) of each of the nine MHC-linked OR genes were designed using NCBI Primer-BLAST (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.ncbi.nlm.nih.gov/tools/primer-blast/\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/tools/primer-blast/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The 500-bp upstream and downstream regions of the selected OR genes, based on the pig genome assembly (NC_010449.5, Sscrofa11.1), were used as queries. The maximum product size was set to 2500 bp. Primer sites containing nucleotide variations reported for dbSNPs (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.ncbi.nlm.nih.gov/snp/\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/snp/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) were excluded. Off-target or multiple-target amplification of the primers was performed using BLAST analysis. Primer design was repeated until the optimal primers for the specific amplification of the target ORs were obtained. Primer information for the analysis of \u003cem\u003eSLA-1\u003c/em\u003e, \u003cem\u003e-2\u003c/em\u003e, and \u003cem\u003e\u0026minus;\u0026thinsp;3\u003c/em\u003e was based on previous studies [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] and is described in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003ch2\u003ePolymerase chain reaction and sequencing\u003c/h2\u003e \u003cp\u003eFor a 10 \u0026micro;L reaction for nine OR genes including \u003cem\u003eLOC100514111, LOC100516618, LOC100157348, LOC100515036, LOC100156552, LOC100522686, LOC100516811, OLF42-3, OLF42-1\u003c/em\u003e, the reaction mixture consisted of 1 \u0026micro;M of locus-specific primers (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), 250 \u0026micro;M dNTPs, 1 unit of Supertherm\u0026trade; Taq DNA polymerase (JMR Holdings, Kent, UK), 10\u0026times; reaction buffer containing 15 mM MgCl\u003csub\u003e2\u003c/sub\u003e, and 25 ng of DNA. The amplification reaction was conducted on an ABI9700 thermocycler (Applied Biosystems, Foster City, CA) with an initial pre-denaturation step at 94\u0026deg;C for 3 minutes, followed by 30 cycles of denaturation at 94\u0026deg;C for 30 seconds, annealing at the specific primer annealing temperature (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) for 45 seconds, and elongation at 72\u0026deg;C for 90 seconds. Subsequently, the final elongation was conducted at 72\u0026deg;C for 10 min. The amplicons were electrophoresed on 1% agarose gel to confirm target amplification. To sequence OR amplicons, sequencing primers with lengths of 15\u0026ndash;20 bp were designed at conserved regions in both the forward and reverse directions with an overlap to cover the entire CDS of each OR gene using the Primer Designer of CLC Main Workbench version 7.8.1 (CLC bio, Aarhus, Denmark) (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Before sequencing, 5 \u0026micro;L of PCR products were mixed with 0.25 U of shrimp alkaline phosphatase (USB Corporation, Cleveland, OH), 15 U of exonuclease I (Fermentas, Massachusetts, USA), and incubated at 37 ℃ for 30 min. The sequencing reaction was performed using the Applied Biosystems BigDye\u0026reg; Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Massachusetts, USA) with 2 pmol of a sequencing primer under the conditions of pre-denaturation at 96\u0026deg;C for 1 min, 25 cycles of 96\u0026deg;C for 10 s, 50\u0026deg;C for 5 s, and 60\u0026deg;C for 4 min. The reaction products were purified using ethanol precipitation, resuspended in 10 \u0026micro;L of Hi-Di\u0026trade; Formamide (Applied Biosystems, Massachusetts, USA), and analyzed on an ABI3730 DNA Analyzer (Applied Biosystems). Specific amplification and sequencing of \u003cem\u003eSLA-1, -2\u003c/em\u003e, and \u003cem\u003e\u0026minus;\u0026thinsp;3\u003c/em\u003e were conducted as previously described (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003ch2\u003eAllelic differentiation and haplotype determination\u003c/h2\u003e \u003cp\u003eIn principle, alleles that exist as homozygotes in sequence-based typing are considered novel alleles. Alleles that existed as heterozygotes in the typing results were separated into individual alleles through TA cloning using pGEM\u0026reg;-T Easy Vector Systems (Promega, Wisconsin, USA). For cloning, the ligation products were transformed into DH10B competent cells (Thermo Fisher Scientific, Waltham, MA, USA) using electrotransformation. Target inserts were amplified in 10 \u0026micro;L of colony PCR mixture containing a piece of a single bacterial colony as a DNA template, 1 \u0026micro;M of T7 and SP6 universal primers (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), 250 \u0026micro;M dNTP, 1U of Supertherm\u0026trade; Taq DNA polymerase (JMR Holdings, Kent, UK), and 10\u0026times; reaction buffer with 15 mM MgCl\u003csub\u003e2\u003c/sub\u003e (JMR Holdings, Kent, UK). The thermal profile for the colony PCR consisted of 5 min of pre-denaturation at 94\u0026deg;C, 30 cycles of denaturation at 94\u0026deg;C for 30 s, primer annealing at 50\u0026deg;C for 30 s, and elongation at 72\u0026deg;C for 60 s, followed by a final elongation at 72\u0026deg;C for 7 min. The PCR amplicons were sequenced using primers specific to each OR gene (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). At least eight independent clones were sequenced for allelic determination using the T7 and SP6 universal primers. Allele differentiation for \u003cem\u003eSLA-1\u003c/em\u003e, \u003cem\u003e-2\u003c/em\u003e, and \u003cem\u003e\u0026minus;\u0026thinsp;3\u003c/em\u003e was conducted as described in previous studies [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Haplotype determination of SLA- and SLA-linked OR genes was conducted using the haplotype inference function, employing the EM algorithm provided in Arlequin version 3.5.2.2 [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. The detailed procedure is shown in Supplementary Fig. 1.\u003c/p\u003e \u003ch2\u003eCalculation of genetic diversity\u003c/h2\u003e \u003cp\u003eThe observed (Ho) and expected heterozygosities (He) of the loci were calculated using Arlequin version 3.5.2.2 [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Data normality and equality in variance distribution for the observed indices were tested using the Shapiro-Wilk normality test and an equal-variance test [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. Differences in the average values of the observed indices were tested using the Student\u0026rsquo;s t-test [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e].\u003c/p\u003e \u003ch2\u003ePopulation genetic analyses\u003c/h2\u003e \u003cp\u003eLD index (ε) between loci was calculated after allele differentiation of genotyping results using eLD R script [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e] on R version 4.1.2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.r-project.org\u003c/span\u003e\u003cspan address=\"http://www.r-project.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). To generate an MSN plot, haplotype data was prepared for R library \u0026ldquo;adegenet\u0026rdquo; version 2.1.6 [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e], and generation of a distance matrix and visualization was conducted using R library \u0026ldquo;poppr\u0026rdquo; version 2.9.4 [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. A dataset for PCA was prepared using the genotype data of nine OR and three SLA class I genes from 48 individuals of six pig breeds, using the adegenet R package. PCA was conducted using the dudi.pca function of the R library \u0026ldquo;ade4\u0026rdquo; version 1.7.19 [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e].\u003c/p\u003e \u003ch2\u003eEstimation of haplotype breakpoints\u003c/h2\u003e \u003cp\u003eTo generate input nucleotide sequences for haplotype codon alignment, stop codons at the end of the full-length coding sequences (CDS) for 11 genes were removed, and the sequences were sequentially connected to produce a single sequence contig relative to the chromosomal order, except \u003cem\u003eLOC100516811\u003c/em\u003e, a pseudogene. The input sequences were aligned using the codon alignment function of MUSCLE in MEGA version 11.0.10 [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]. The generated codon alignment was used as an input file for RDP v4.101 [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. Haplotype breakpoints were deduced using RDP, GENECONV, MaxChi, BootScan, and SiScan in RDP software. Statistical significance of the breakpoints was tested using a breakpoint P distribution plot (1000 permutations and window size\u0026thinsp;=\u0026thinsp;200bp). Breakpoints with an estimated P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.01 were suggested as breakpoint hotspots.\u003c/p\u003e \u003ch2\u003eCodon selection test and LD calculation\u003c/h2\u003e \u003cp\u003eThe haplotype phylogenetic tree was constructed from the haplotype codon alignment using the \"Create Tree\" feature of CLC Main Workbench version 7.8.1 (CLC bio, Aarhus, Denmark). The neighbor-joining method and Kimura 80 nucleotide substitution model were applied with 5000 bootstrap replications. The created haplotype phylogenetic tree was unrooted using the R library \u0026ldquo;ape\u0026rdquo; version 5.6.2. [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e] and was used as the input file for CodeML of pamlX version 1.3.1 [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e]. All analysis options were set to default except for codon frequency, which was configured using the 2:F3ⅹ4 model. To test selection signatures of codons under Random-sites models, we used site models to allow the dN/dS (ω) ratio to vary among sites using Models 0, 1, 2, 7, and 8 under different assumptions on the distribution of ω ratio [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e]. Empirical Bayes analysis using Models 2 and 8 was used to deduce the positively selected codons [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. Codons with a confidence level\u0026thinsp;\u0026gt;\u0026thinsp;95% were identified as positively selected codons. LD values between haplotype SNPs were estimated using Haploview version 4.2 from the haplotype codon alignment [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e].\u003c/p\u003e \u003ch2\u003eComparison of OR expression\u003c/h2\u003e \u003cp\u003eExpression data for SLA-linked OR genes were obtained from the NCBI Gene Expression Omnibus database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.ncbi.nlm.nih.gov/geo/\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/geo/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; accession numbers GSE171756 (pig testis) and GSE197184 (pig olfactory epithelium (OE)). Expression data for human ORs were retrieved from the same database with accession numbers GSE30611 (human testis) and GSE80249 (human OE). Because the OR expression data for porcine OE were available only as read counts, the values were converted to relative FPKM values for expression comparison using the following formula:\n$$\\:\\text{O}\\text{R}\\:\\text{g}\\text{e}\\text{n}\\text{e}\\:\\text{F}\\text{P}\\text{K}\\text{M}\\:\\text{i}\\text{n}\\:\\text{O}\\text{E}=\\:\\text{O}\\text{R}\\:\\text{g}\\text{e}\\text{n}\\text{e}\\:\\text{r}\\text{e}\\text{a}\\text{d}\\:\\text{c}\\text{o}\\text{u}\\text{n}\\text{t}\\:\\text{i}\\text{n}\\:\\text{O}\\text{E}\\:\\times\\:\\left(\\frac{\\text{O}\\text{R}\\:\\text{g}\\text{e}\\text{n}\\text{e}\\:\\text{F}\\text{P}\\text{K}\\text{M}\\:\\text{i}\\text{n}\\:\\text{t}\\text{e}\\text{s}\\text{t}\\text{i}\\text{s}}{\\text{O}\\text{R}\\:\\text{g}\\text{e}\\text{n}\\text{e}\\:\\text{r}\\text{e}\\text{a}\\text{d}\\:\\text{c}\\text{o}\\text{u}\\text{n}\\text{t}\\:\\text{i}\\text{n}\\:\\text{t}\\text{e}\\text{s}\\text{t}\\text{i}\\text{s}\\text{}}\\right)\\:$$\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003eAvailability of data and materials\u003c/p\u003e\n\u003cp\u003eA total of 106 SLA-linked OR allele sequences analyzed in this study were submitted to the NCBI GenBank (www.ncbi.nlm.nih.gov/genbank/) under\u0026nbsp;the accession numbers listed in\u0026nbsp;Supplementary table 3 (PP768351-PP768442). All other information can be found in the text and supporting information.\u003c/p\u003e\n\u003cp\u003eEthics approval\u003c/p\u003e\n\u003cp\u003eAll experiments were approved and performed in accordance with the guidelines and regulations of the Institute of Animal Care and Use Committee and\u0026nbsp;the Center for Research Ethics of\u0026nbsp;Konkuk University.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Cooperative Research Program for Agriculture, Science, and Technology Development (Project No. PJ016221), Rural Development Administration, Republic of Korea.\u003c/p\u003e\n\u003cp\u003eAuthors\u0026apos; contributions\u003c/p\u003e\n\u003cp\u003eConceptualization and sample collection: M.K., B.A., and J.L. Data curation: M.K., H.C., and C.P. Bioinformatic analysis: M.K., B.A., and J.S. Methodology: M.K., and C.P. Manuscript writing: M.K. and C.P. Comments and discussion: C.P.\u003c/p\u003e\n\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eThe authors have no specific acknowledgements to declare.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBuck L, Axel R. A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell. 1991;65(1):175\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlusman G, Bahar A, Sharon D, Pilpel Y, White J, Lancet D. The olfactory receptor gene superfamily: data mining, classification, and nomenclature. Mamm Genome. 2000;11(11):1016\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlusman G, Yanai I, Rubin I, Lancet D. The complete human olfactory subgenome. Genome Res. 2001;11(5):685\u0026ndash;702.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Firestein S. The olfactory receptor gene superfamily of the mouse. Nat Neurosci. 2002;5(2):124\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiimura Y. Olfactory receptor multigene family in vertebrates: from the viewpoint of evolutionary genomics. Curr Genomics. 2012;13(2):103\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNguyen DT, Lee K, Choi H, Choi MK, Le MT, Song N, Kim JH, Seo HG, Oh JW, Lee K, et al. The complete swine olfactory subgenome: expansion of the olfactory gene repertoire in the pig genome. BMC Genomics. 2012;13(1):584.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee K, Nguyen DT, Choi M, Cha SY, Kim JH, Dadi H, Seo HG, Seo K, Chun T, Park C. Analysis of cattle olfactory subgenome: the first detail study on the characteristics of the complete olfactory receptor repertoire of a ruminant. BMC Genomics. 2013;14(1):596.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarnes IHA, Ibarra-Soria X, Fitzgerald S, Gonzalez JM, Davidson C, Hardy MP, Manthravadi D, Van Gerven L, Jorissen M, Zeng Z, et al. Expert curation of the human and mouse olfactory receptor gene repertoires identifies conserved coding regions split across two exons. BMC Genomics. 2020;21(1):196.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHayden S, Bekaert M, Crider TA, Mariani S, Murphy WJ, Teeling EC. Ecological adaptation determines functional mammalian olfactory subgenomes. Genome Res. 2010;20(1):1\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcGowen MR, Clark C, Gatesy J. The vestigial olfactory receptor subgenome of odontocete whales: phylogenetic congruence between gene-tree reconciliation and supermatrix methods. Syst Biol. 2008;57(4):574\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKishida T, Kubota S, Shirayama Y, Fukami H. The olfactory receptor gene repertoires in secondary-adapted marine vertebrates: evidence for reduction of the functional proportions in cetaceans. Biol Lett. 2007;3(4):428\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu A, He F, Shen L, Liu R, Wang Z, Zhou J. Convergent degeneration of olfactory receptor gene repertoires in marine mammals. BMC Genomics. 2019;20(1):977.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang N, Koo J. Olfactory receptors in non-chemosensory tissues. BMB Rep. 2012;45(11):612\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeldmesser E, Olender T, Khen M, Yanai I, Ophir R, Lancet D. Widespread ectopic expression of olfactory receptor genes. BMC Genomics. 2006;7(1):121.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlegel C, Manteniotis S, Osthold S, Hatt H, Gisselmann G. Expression profile of ectopic olfactory receptors determined by deep sequencing. PLoS ONE. 2013;8(2):e55368.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAisenberg WH, Huang J, Zhu W, Rajkumar P, Cruz R, Santhanam L, Natarajan N, Yong HM, De Santiago B, Oh JJ, et al. Defining an olfactory receptor function in airway smooth muscle cells. Sci Rep. 2016;6(1):38231.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBraun T, Voland P, Kunz L, Prinz C, Gratzl M. Enterochromaffin cells of the human gut: sensors for spices and odorants. Gastroenterology. 2007;132(5):1890\u0026ndash;901.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManteniotis S, Wojcik S, Brauhoff P, Mollmann M, Petersen L, Gothert JR, Schmiegel W, Duhrsen U, Gisselmann G, Hatt H. Functional characterization of the ectopically expressed olfactory receptor 2AT4 in human myelogenous leukemia. Cell Death Discov. 2016;2(1):15070.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa\u0026szlig;berg D, Hatt H. Human Olfactory Receptors: Novel Cellular Functions Outside of the Nose. Physiol Rev. 2018;98(3):1739\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanz G, Leray I, Dewaele A, Sobilo J, Lerondel S, Bouet S, Grebert D, Monnerie R, Pajot-Augy E, Mir LM. Promotion of cancer cell invasiveness and metastasis emergence caused by olfactory receptor stimulation. PLoS ONE. 2014;9(1):e85110.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEisenbach M, Giojalas LC. Sperm guidance in mammals - an unpaved road to the egg. Nat Rev Mol Cell Biol. 2006;7(4):276\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlegel C, Vogel F, Hofreuter A, Schreiner BS, Osthold S, Veitinger S, Becker C, Brockmeyer NH, Muschol M, Wennemuth G, et al. Characterization of the Olfactory Receptors Expressed in Human Spermatozoa. Front Mol Biosci. 2015;2:73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpehr M, Gisselmann G, Poplawski A, Riffell JA, Wetzel CH, Zimmer RK, Hatt H. Identification of a testicular odorant receptor mediating human sperm chemotaxis. Science. 2003;299(5615):2054\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVolz A, Ehlers A, Younger R, Forbes S, Trowsdale J, Schnorr D, Beck S, Ziegler A. Complex transcription and splicing of odorant receptor genes. J Biol Chem. 2003;278(22):19691\u0026ndash;701.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZiegler A, Santos PS, Kellermann T, Uchanska-Ziegler B. Self/nonself perception, reproduction and the extended MHC. Self Nonself. 2010;1(3):176\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZiegler A, Dohr G, Uchanska-Ziegler B. Possible roles for products of polymorphic MHC and linked olfactory receptor genes during selection processes in reproduction. Am J Reprod Immunol. 2002;48(1):34\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurrello N, Vicari E, D'Amico L, Satta A, D'Agata R, Calogero AE. Human follicular fluid stimulates the sperm acrosome reaction by interacting with the gamma-aminobutyric acid receptors. Fertil Steril. 2004;82(Suppl 3):1086\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndrews PW, Boyse EA. Mapping of anH-2-linked gene that influences mating preference in mice. Immunogenetics. 1978;6(1):265\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamazaki K, Boyse EA, Mike V, Thaler HT, Mathieson BJ, Abbott J, Boyse J, Zayas ZA, Thomas L. Control of mating preferences in mice by genes in the major histocompatibility complex. J Exp Med. 1976;144(5):1324\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts SC, Gosling LM. Genetic similarity and quality interact in mate choice decisions by female mice. Nat Genet. 2003;35(1):103\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruce HM, A BLOCK TO PREGNANCY IN THE MOUSE CAUSED BY PROXIMITY OF STRANGE MALES. Reproduction. 1960;1(1):96\u0026ndash;103.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLovlie H, Gillingham MA, Worley K, Pizzari T, Richardson DS. Cryptic female choice favours sperm from major histocompatibility complex-dissimilar males. Proc Biol Sci. 2013;280(1769):20131296.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos PS, Seki Uehara CJ, Ziegler A, Uchanska-Ziegler B, Bicalho Mda G. Variation and linkage disequilibrium within odorant receptor gene clusters linked to the human major histocompatibility complex. Hum Immunol. 2010;71(9):843\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eda Silva JS, Wowk PF, Poerner F, Santos PS, Bicalho Mda G. Absence of strong linkage disequilibrium between odorant receptor alleles and the major histocompatibility complex. Hum Immunol. 2013;74(12):1619\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe MT, Choi H, Lee H, Le VCQ, Ahn B, Ho C-S, Hong K, Song H, Kim J-H, Park C. SLA-1 Genetic Diversity in Pigs: Extensive Analysis of Copy Number Variation, Heterozygosity, Expression, and Breed Specificity. Sci Rep. 2020;10(1):1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi H, Le MT, Lee H, Choi MK, Cho HS, Nagasundarapandian S, Kwon OJ, Kim JH, Seo K, Park JK, et al. Sequence variations of the locus-specific 5' untranslated regions of SLA class I genes and the development of a comprehensive genomic DNA-based high-resolution typing method for SLA-2. Tissue Antigens. 2015;86(4):255\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYouk S, Le MT, Kang M, Ahn B, Choi M, Kim K, Kim TH, Kim JH, Ho CS, Park C. Development of a high-resolution typing method for SLA-3, swine MHC class I antigen 3. Anim Genet. 2022;53(1):166\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanaka-Matsuda M, Ando A, Rogel-Gaillard C, Chardon P, Uenishi H. Difference in number of loci of swine leukocyte antigen classical class I genes among haplotypes. Genomics. 2009;93(3):261\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang M, Ahn B, Youk S, Jeon H, Soundarajan N, Cho ES, Park W, Park C. Individual and population diversity of 20 representative olfactory receptor genes in pigs. Sci Rep. 2023;13(1):18668.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiimura Y, Nei M. Extensive gains and losses of olfactory receptor genes in mammalian evolution. PLoS ONE. 2007;2(8):e708.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoover KC. Evolution of Olfactory Receptors. In: \u003cem\u003eOlfactory Receptors: Methods and Protocols.\u003c/em\u003e Edited by Crasto CJ. Totowa, NJ: Humana Press; 2013: 241\u0026ndash;249.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErickson RP. Natural history of the major histocompatibility complex. Am J Hum Genet. 1987;40(5):468\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobinson J, Malik A, Parham P, Bodmer JG, Marsh SG. IMGT/HLA database\u0026ndash;a sequence database for the human major histocompatibility complex. Tissue Antigens. 2000;55(3):280\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaccari G, Robinson J, Ballingall K, Guethlein LA, Grimholt U, Kaufman J, Ho CS, de Groot NG, Flicek P, Bontrop RE, et al. IPD-MHC 2.0: an improved inter-species database for the study of the major histocompatibility complex. Nucleic Acids Res. 2017;45(D1):D860\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReche PA, Reinherz EL. Sequence variability analysis of human class I and class II MHC molecules: functional and structural correlates of amino acid polymorphisms. J Mol Biol. 2003;331(3):623\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos PS, Kellermann T, Uchanska-Ziegler B, Ziegler A. Genomic architecture of MHC-linked odorant receptor gene repertoires among 16 vertebrate species. Immunogenetics. 2010;62(9):569\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDohr GA, Motter W, Leitinger S, Desoye G, Urdl W, Winter R, Wilders-Truschnig MM, Uchanska-Ziegler B, Ziegler A. Lack of expression of HLA [corrected] class I and class II molecules on the human oocyte. J Immunol. 1987;138(11):3766\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEgid K, Brown JL. The major histocompatibility complex and female mating preferences in mice. Anim Behav. 1989;38(3):548\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBranscomb A, Seger J, White RL. Evolution of odorant receptors expressed in mammalian testes. Genetics. 2000;156(2):785\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParmentier M, Libert F, Schurmans S, Schiffmann S, Lefort A, Eggerickx D, Ledent C, Mollereau C, Gerard C, Perret J, et al. Expression of members of the putative olfactory receptor gene family in mammalian germ cells. Nature. 1992;355(6359):453\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVanderhaeghen P, Schurmans S, Vassart G, Parmentier M. Specific repertoire of olfactory receptor genes in the male germ cells of several mammalian species. Genomics. 1997;39(3):239\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYounger RM, Amadou C, Bethel G, Ehlers A, Lindahl KF, Forbes S, Horton R, Milne S, Mungall AJ, Trowsdale J, et al. Characterization of clustered MHC-linked olfactory receptor genes in human and mouse. Genome Res. 2001;11(4):519\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKyewski B, Derbinski J, Gotter J, Klein L. Promiscuous gene expression and central T-cell tolerance: more than meets the eye. Trends Immunol. 2002;23(7):364\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVidal RL, Ramirez A, Castro M, Concha II, Couve A. Marlin-1 is expressed in testis and associates to the cytoskeleton and GABAB receptors. J Cell Biochem. 2008;103(3):886\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeinders-Zufall T, Brennan P, Widmayer P, Maul-Pavicic SPC, Jager A, Li M, Breer XH, Zufall H, Boehm F. MHC class I peptides as chemosensory signals in the vomeronasal organ. Science. 2004;306(5698):1033\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeinders-Zufall T, Ishii T, Mombaerts P, Zufall F, Boehm T. Structural requirements for the activation of vomeronasal sensory neurons by MHC peptides. Nat Neurosci. 2009;12(12):1551\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMilinski M. A Review of Suggested Mechanisms of MHC Odor Signaling. Biology (Basel). 2022;11(8):1187.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZiegler A, Kentenich H, Uchanska-Ziegler B. Female choice and the MHC. Trends Immunol. 2005;26(9):496\u0026ndash;502.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFallin D, Schork NJ. Accuracy of haplotype frequency estimation for biallelic loci, via the expectation-maximization algorithm for unphased diploid genotype data. Am J Hum Genet. 2000;67(4):947\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi JW, Chung WH, Lee KT, Cho ES, Lee SW, Choi BH, Lee SH, Lim W, Lim D, Lee YG, et al. Whole-genome resequencing analyses of five pig breeds, including Korean wild and native, and three European origin breeds. DNA Res. 2015;22(4):259\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee YS, Son S, Lee HK, Lee RH, Shin D. Elucidating breed-specific variants of native pigs in Korea: insights into pig breeds' genomic characteristics. Anim Cells Syst (Seoul). 2022;26(6):338\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeon H, Le MT, Ahn B, Cho HS, Le VCQ, Yum J, Hong K, Kim JH, Song H, Park C. Copy number variation of PR-39 cathelicidin, and identification of PR-35, a natural variant of PR-39 with reduced mammalian cytotoxicity. Gene. 2019;692:88\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eExcoffier L, Lischer HE. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 2010;10(3):564\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShapiro SS, Wilk MB. An analysis of variance test for normality (complete samples). Biometrika. 1965;52(3\u0026ndash;4):591\u0026ndash;611.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown MB, Forsythe AB. Robust Tests for the Equality of Variances. J Am Stat Assoc. 1974;69(346):364\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStudent. The Probable Error of a Mean. Biometrika. 1908;6(1):1\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkada Y. eLD: entropy-based linkage disequilibrium index between multiallelic sites. Hum Genome Var. 2018;5:29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJombart T. adegenet: a R package for the multivariate analysis of genetic markers. Bioinformatics. 2008;24(11):1403\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamvar ZN, Tabima JF, Grunwald NJ. Poppr: an R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction. PeerJ. 2014;2:e281.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDray S, Dufour A-B. Theade4Package: Implementing the Duality Diagram for Ecologists. J Stat Softw. 2007;22(4):1\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol. 2021;38(7):3022\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin DP, Murrell B, Golden M, Khoosal A, Muhire B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015;1(1):vev003.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParadis E, Schliep K. ape 5.0: an environment for modern phylogenetics and evolutionary analyses in R. Bioinformatics. 2019;35(3):526\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Z. PAML 4: phylogenetic analysis by maximum likelihood. Mol Biol Evol. 2007;24(8):1586\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Z, Wong WS, Nielsen R. Bayes empirical bayes inference of amino acid sites under positive selection. Mol Biol Evol. 2005;22(4):1107\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21(2):263\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4905052/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4905052/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eOlfactory receptor (OR) genes are highly polymorphic and form extensive families that recognize a wide range of vertebrate odorants. Although OR gene clusters are dispersed across many regions of vertebrate genomes, ORs expressed in the testes exhibit major histocompatibility complex (MHC)-linked structural conservation.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn this study, we selected nine MHC-linked OR genes based on their expression levels in pig testes and developed a sequence-based typing method for these genes. We then performed high-resolution typing of these OR genes, along with three major classical MHC class I genes \u003cem\u003e(SLA-1, -2\u003c/em\u003e, and \u003cem\u003e\u0026minus;\u0026thinsp;3\u003c/em\u003e), in 48 pigs across six breeds. We observed significantly higher allelic diversity (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) in ORs with strong linkage disequilibrium (LD) to SLA compared to those with weak or no LD, and we identified 48 SLA class I-OR haplotypes using the expectation-maximization algorithm. The genetic diversity of SLA-linked ORs was positively correlated with their expression levels in the testis. Specifically, SLA-linked ORs with higher testicular expression (FPKM\u0026thinsp;\u0026ge;\u0026thinsp;0.1) exhibited an increase in the number of codons under mutually diversifying selection with SLA compared to those with lower expression (FPKM\u0026thinsp;\u0026lt;\u0026thinsp;0.1).\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eOur results suggest the presence of evolutionary interactions between the MHC and linked OR genes. These characteristics of SLA-linked ORs support the potential involvement of MHC-linked ORs in MHC-based mate selection.\u003c/p\u003e","manuscriptTitle":"Influence of MHC on genetic diversity and testicular expression of linked olfactory receptor genes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-11 13:11:10","doi":"10.21203/rs.3.rs-4905052/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-14T04:03:14+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-14T01:46:24+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-14T01:45:21+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Genomics","date":"2024-08-13T07:46:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-genomics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gics","sideBox":"Learn more about [BMC Genomics](http://bmcgenomics.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gics","title":"BMC Genomics","twitterHandle":"#BMCGenomics","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1fdcd6bf-bc0c-4e5e-9d20-bc6865dfc3cd","owner":[],"postedDate":"September 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-02-10T16:11:39+00:00","versionOfRecord":{"articleIdentity":"rs-4905052","link":"https://doi.org/10.1186/s12864-025-11281-x","journal":{"identity":"bmc-genomics","isVorOnly":false,"title":"BMC Genomics"},"publishedOn":"2025-02-06 15:57:39","publishedOnDateReadable":"February 6th, 2025"},"versionCreatedAt":"2024-09-11 13:11:10","video":"","vorDoi":"10.1186/s12864-025-11281-x","vorDoiUrl":"https://doi.org/10.1186/s12864-025-11281-x","workflowStages":[]},"version":"v1","identity":"rs-4905052","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4905052","identity":"rs-4905052","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}