Direct sampling and bioanalyses of atmospheric bioaerosols via an unmanned aerial vehicle over S17 Base, East Antarctica

Direct sampling and bioanalyses of atmospheric bioaerosols via an unmanned aerial vehicle over S17 Base, East Antarctica | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Direct sampling and bioanalyses of atmospheric bioaerosols via an unmanned aerial vehicle over S17 Base, East Antarctica F. Kobayashi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7725332/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Atmospheric bioaerosol aerosol sampling is being extensively conducted in Antarctica. In this study, bioaerosol sampling was conducted at a 900-m altitude over S17 Base in the coastal region of Antarctica using an unmanned aerial vehicle (UAV) on January 10, 2019. Based on the metrological data collected using the UAV, bioaerosol samples were obtained from a high mixed layer and/or the low free troposphere. Bacteria belonging to the class Chloroplast were detected in the upper air. Those were also observed at an altitude of about 1,000 m over Syowa Station in 2013 (Kobayashi, 2022 a), suggesting that they may be persistent in the upper atmosphere over East Antarctica. In the upper air, bacteria belonging to the genera Arcobacter , Finegoldia , and Methyloversatilis were particularly detected. Backward trajectory analyses of the air mass, revealed that these bacteria may have been transported long distances from outside the Antarctic continent by dynamic atmospheric phenomena such as polar circulation. Atmospheric bioaerosol Antarctica Unmanned aerial vehicle Amplicon analysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Atmospheric bioaerosols include diverse biological entities suspended in the air, such as organisms, pollen, fungi, bacteria, spores, and viruses. In Antarctica, atmospheric bioaerosol research is garnering international attention (Pearce et.al., 2016 ). The focus of Antarctic atmospheric bioaerosol research is as follows: (1) assessing the effects of the atmospheric ecosystem on the region’s terrestrial and aquatic ecosystems within its challenging ecological environment; (2) substantiating the atmospheric origins of microbes found in Antarctic ice cores, which may be tens of thousands of years old; (3) elucidating the relationship between bioaerosols and Antarctic meteorological dynamics, such as polar circulation, the polar vortex, and katabatic winds; (4) investigating the long-distance transport of bioaerosols from South America, Australia, and Africa; and (5) conducting inaugural observations of atmospheric bioaerosols in Antarctica. We previously observed atmospheric bioaerosols at Hukuro Cove in association with Adélie penguin research, at Syowa Station using a tethered balloon, and others on 2013 (Kobayashi et al., 2016 ; Kobayashi, 2022 a; 2022 b; Kobayashi & Hayashi, 2022 ). Specifically, efforts to determine the direct origins of bioaerosols involved observations at the Adélie penguin nesting site in the ecologically challenging Antarctic environment (Kobayashi et al., 2016 ). Employing a custom-made bioaerosol sampler at Hukuro Cove, samples were collected both upwind and downwind of the penguin colony, followed by amplicon analysis via massively parallel sequencing. Downwind, Bacilli class bacteria levels were 19.4-fold higher than those detected upwind. Amplicon analysis of penguin feces revealed a predominance of Clostridia class bacteria (78.7%) with the remainder belonging to the Bacilli class (20.1%). These findings indicate the release of Bacilli class bacteria from penguin excrement, dispersing downwind as bioaerosols. Although the study was originally intended for ecological air observations, medical researchers’ inquiries into wind velocity and similar factors arose owing to the implications for airborne transmission of viruses, such as COVID-19, from fecal matter, impacting fields such as public health. This type of analysis is challenging in tropical regions due to high background levels but represents a distinctive research opportunity in Antarctica’s impoverished ecosystem. Atmospheric bioaerosol research above Antarctica involves a tethered balloon sampling at Syowa Station collecting samples approximately 1,000 m above sea level (Kobayashi, 2022 a). Notably, bacterial species associated with chloroplasts were found at markedly higher levels in airborne samples from Syowa Station compared with similar ground-based observations. Backward trajectory analysis indicated an air mass origin from West Antarctica, opposite Syowa Station, at an altitude exceeding 4,000 m, i.e., the free troposphere, likely introducing these bacteria from other continents and its surrounding oceanic regions, considering the polar vortex. Thus, it is evident that atmospheric bioaerosols traverse continents over vast distances in dynamic global air currents. However, owing to logistical constraints, only one-year of samples is available, with current data lacking scientific robustness. To refine data accuracy, multiyear studies are imperative. Furthermore, tethered balloons are difficult to operate in Antarctic observations where air currents change abruptly. In the present study, I have newly developed an unmanned aerial vehicle (UAV) for atmospheric bioaerosol sampling because UAVs can withstand sudden changes in airflow to a certain extent, direct sampling of atmospheric bioaerosols was conducted at high altitudes via improved UAV over S17 Base in inland eastern Antarctica. Sampled DNA was extracted directly from filter membrane samples and subjected to amplicon analysis. I attempted to identify bacteria specific to the upper atmosphere by comparing them with samples from the ice sheet. Furthermore, we investigated the origin of these bacteria using Backward trajectories analyses. 2. Material and methods 2.1. Sampling and observation site The atmospheric bioaerosol sampling was conducted over the Syowa Station in 2013 (Kobayashi, 2022 a). At Syowa Station, the population can reach nearly 100 people during the summer (local season). Even at high altitudes, the sheer number of atmospheric bioaerosols in Antarctica is low, making the potential for anthropogenic impact impossible to ignore. The Antarctic region experiences poleward flow in the free troposphere and is subject to katabatic winds (gliding winds), i.e., cool air caused by radiative cooling descending due to gravity over the continental ice sheet, flowing along the ice sheet surface toward the outer continent. To elucidate the mechanism of bioaerosol long-range transport to Antarctica, it is necessary to compare bioaerosols within the katabatic wind with those in the free troposphere above. This requires conducting sampling on the ice sheet within the Antarctic continent. Therefore, we decided to conduct it at the S17 Base, which only has personnel for one month and a mere six members. Furthermore, while Syowa Station is located on a coastal island, S17 Base is situated on the mainland, albeit in a peripheral area, making it well-suited for observing the Antarctic continent. Figure 1 shows a map of Antarctica, delineating the locations of S17 Base on the Antarctic coast (69° 01' S, 40° 05' E; elevation: 580 m) and Syowa Station on East Ongul Island (69° 00' S, 39° 35' E; elevation: 28.8 m). This island lies 4 km from the continent’s edge on the eastern shore of Lützow-Holm Bay, East Antarctica. The S17 Base is located on the continental ice sheet, approximately 20 km east of Syowa Station, comprising a generator shed and a mess hall on a jack-up trestle. 2.2. Sampling and observation via the UAV New type of UAV for bioaerosol sampling was developed as follows. The kite plane UAV [Fig. 2 ( a )], equipped with a two-cylinder 80 cc gasoline engine, measured 2,305 mm in length, 2,780 mm in width, and 1,195 mm in height, and had a weight of 15 kg, a payload weight of 5 kg, and a maximum altitude of 3 km. It maintained a cruising speed of approximately 40 km/h, with a flight duration equivalent to 1.5 km travel. The photo in Fig. 2 ( b ) shows the two inlets installed at the front of the UAV: one coupled to a bioaerosol sampler unit specifically developed for the UAV and the other linked to an optical particle counter (OPC) for measuring aerosol number concentration (Particle Counter HHPC3+, MET ONE Co., Ltd.). The bioaerosol sampler for the UAV was modified to activate via a switch on the controller for radio control, allowing sampling initiation during both manual and automatic flight. Given the low temperatures above Antarctica, the battery was insulated with metal cold-resistant tape to maintain its electric capacity. A membrane filter for atmospheric bioaerosol sampling with a pore size of 0.45 µm and a diameter of 47 mm, made of sterilized hydrophilic polyvinylidene fluoride (Advantech, Durapore HVLP04700), was used. The sampling suction system connected the sterilized filter holder (Merck Millipore, XX4304700) containing the sterilized filter membrane as noted above to an electrically conductive tube, which was then attached to one of the two inlets on the UAV. The other port connected to two lightweight, high-performance diaphragm pumps and is installed on the UAV [Fig. 2 ( b )]. Sterilization of filter holders and electrically conductive tubes was performed using a portable autoclave brought into the S17 Base facility. Suction was performed for one hour at a rate of approximately 720 L/h. Air temperature, relative humidity, wind direction, and wind speed were measured using radiosondes (RS-11G, Meisei Electric Co., Ltd.) attached to the UAV. The UAV was manually controlled by a kite controller (radio controlled) until takeoff, and subsequently automatically navigated along a predetermined route via an onboard autopilot upon reaching the sampling altitude. Once at the target altitude, the autopilot autonomously guided the aircraft along a preset route using GPS, with the route programmed via a personal computer installed in the snow mobile[(Fig. 2 ( a )]. Before takeoff, while preparing, the shutter was closed and the interior was completely sterile. Upon reaching the target altitude, the snowmobile transmits a radio signal via remote control to activate the pump and open the shutter for suction and sampling. This navigation prevented sample contamination by the kite plane’s engine exhaust. Post observation, the sample was landed manually, The atmospheric bioaerosol samplings in this study was carried out as follows. This aircraft took off at 14:47 (local time) on January 10, 2019, for 1h (from 15:08 to 16:08) at a 900 m altitude (approximately 300 m above the ice sheet), and landed at 16:20 (local time). After landing on the ice sheet, seal the filter holder while maintaining sterility, transport it to the S17 Base observation sled, remove the membrane filter sample inside the sled's sterile clean booth, place it in a gamma-irradiated plastic tube, and store it in the freezer. On the ice sheet, we used the same sampling device (spare) to sample during the same period, creating ice samples. It was processed and stored in the same methods as bioaerosol sample on the upper air. Sterilizations of filter membrane, filter holder, and electrically conductive tube were performed in a small autoclave within the habitation caboose. All operations requiring sterility were performed within the sterile clean booth installed inside the habitation caboose. 2.3. DNA extraction and amplicon analyses Membrane filter samples were folded to remove excess water, washed with sterile water, and subjected to bacterial collection in microcentrifuge tubes via centrifugation at 5,000 g (7,500 rpm) for 10 min. DNA was extracted directly using a DNeasy Blood and Tissue Kit (QIAGEN Co. Ltd.). The membrane filter solution was subjected to bacteriolysis incubation at 37°C overnight, performed by adding protease K and extraction buffer from a DNA extraction kit (ISOTISSUE, Nippon Gene Co., Ltd.). After the sample solution was treated with RNase, DNA was collected using phenol–chloroform extraction and butanol precipitation. The first polymerase chain reaction (PCR) step was performed using the 515F and 806R primers. Tag sequences targeted in the second PCR amplification were incorporated into the 16S rDNA universal sequences, i.e., TGTGCCAGCMGCCGCGGTAA and GGACTACHVGGGTWTCTAAT (Caporaso et al., 2012 ). PCR conditions in the first step included initial denaturation at 95°C for 1 min, followed by 23 cycles of 95°C for 1 min, 52°C for 2 min, and 72°C for 2 min, with a final elongation step at 72°C for 1 min. PCR amplicons were purified using AMPure XP Beads (Beckman Coulter Co., Ltd.). For the second round of PCR, the following primers were used: F5 (5´-AATGATACGGCGACC ACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGACGC-3´), F6 (5´-AATGATACG GCGACCACCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGC-3´), and R2 (5´-CAAGCAGAAGACGGCATACGAGATACGAATTCGTGACTGGAGTTCAGACGTGTG-3´). PCR conditions in the second round comprised initial denaturation at 98°C for 30 s, followed by 12 cycles of 98°C for 1 min, 60°C for 2 min, and 72°C for 2 min, with a final elongation step at 72°C for 1 min. Ex Taq HS (TaKaRa Co., Ltd) was employed as the PCR enzyme. Sequencing of all samples was performed on Illumina’s MiSeq sequencer using the 500-Cycle MiSeq Reagent Kit v2 (Illumina Inc.). This protocol yielded read lengths of approximately 400 bp, covering the variable region V4 of the 16S rRNA gene enabling accurate taxonomy assignment to at least the family level of microorganism composition (Liu et al., 2008 ). Prior to bacterial community structure analysis, sequences shorter than 200 bp, those with a Phred-equivalent quality score below 25, those containing ambiguous characters, those with uncorrectable barcodes, and those with primer sequences were filtered out. Remaining sequences were clustered into phylotypes using QIIME 2 2021.11, with a minimum coverage of 99% and a minimum identity of 97%. Phylotype bacterial composition was analyzed via comparison against the DNA Data Bank of Japan (DDBJ) using BLAST. All sequencing data were deposited in the DDBJ under the accession number PRJDB17672. 2.4. Air mass backward trajectories To trace the origin of atmospheric bioaerosols, backward trajectories of air mass were computed at five altitudes: 0, 500, 1,000, 1,500, and 2,000 m. These were calculated using kinematic and isentropic trajectory models developed at the National Institute of Polar Research (NIPR) (Suzuki et al., 2008 ; Tomikawa and Sato, 2005 ). 3. Results and discussion 3.1. Weather condition and aerosol number concentration measured over S17 Base via the UAV In 2013, we collected atmospheric bioaerosols using tethered balloons (Kobayashi, 2022 a). Tethered balloons are well-suited for meteorological observations and direst atmospheric bioaerosol sampling because they can minimize relative wind speed. However, most of Antarctica's surface is covered in ice, resulting in an extremely low coefficient of friction with the atmosphere. Consequently, changes in airflow directly affect wind direction and speed [Fig. 3 ( c ) and ( d )]. In areas where wind direction and speed change abruptly, tethered balloon operations become extremely difficult and require considerable skill, making them unsuitable for observations or bioaerosol sampling in Antarctica. Based on the above, this study attempted bioaerosol sampling via UAV that are easy to operate even with some changes in wind direction and speed. Additionally, UAV capable of autopilot operation from the snowmobile where the interior is not cold are well-suited for bioaerosol collection in the extreme cold of Antarctica. Figure 3 shows the relationships between the altitude range 600–900 m and temperature (a), relative humidity (b), wind direction (c), and wind speed (d) over S17 Base, as measured by the UAV with observation equipment. Temperature declined gradually from approximately − 3°C to − 5°C with increasing altitude. Relative humidity remained stable at around 75% at 600–800 m altitude, decreasing to 60% up to 900 m altitude. Wind direction exhibited substantial variation at 600–900 m altitudes. Wind speed displayed notable fluctuations up to an altitude of 800 m, stabilizing at 5 m/s for altitudes of 800–900 m. These findings suggest that the boundary layer extends beyond an altitude of 900 m, indicating that bioaerosol sampling at approximately 900 m corresponds to a high mixed layer and/or the low free troposphere. Particle concentration measurements were obtained using an OPC apparatus mounted on the UAV. Figure 4 shows the vertical profiles of aerosol number concentration. The number of particles larger than 0.3 µm considered fine particles, decreased from around 5.0 × 10 6 m − 3 at 600 m to approximately 3.0 ×10 6 m − 3 at 900 m [Fig. 4 ( a )]. Similarly, the number of particles larger than 1.0 µm decreased from around 5.5 × 10 4 m − 3 at 600 m to approximately 3.0 × 10 4 m − 3 at 900 m [Fig. 4 ( b )]. The number of particles larger than 5.0 µm decreased from approximately 2.0 × 10 3 m − 3 at 600 m to approximately 1.0 × 10 3 m − 3 at 900 m [Fig. 4 ( c )]. Particle concentrations of all sizes decreased with increasing altitude, approximately halving in number. Additionally, aerobiological particles decreased with altitude. In the previous study, the concentration particle (D p >0.3 µm) was on the order of 10 5 m − 3 at approximately 1,000 m altitude using a tethered balloon over Syowa Station in 2013 (Kobayashi, 2022 a). The ground-based aerosol measurements (D p >0.3 µm) obtained by an OPC at Syowa Station in 2005 had range of 2.0 × 10 5 – 2.0 × 10 8 m − 3 (mean, 8.9 × 10 6 m − 3 ; median 3.5 × 10 6 m − 3 ) (Osada et al., 2010 ; Hara et al., 2011 ). The particles sample and measurement in the present study are reasonable values. 3.2 Class-level sequence distributions in air samples collected via the UAV over S17 Base Figure 5 shows the class-level distribution of bioaerosol sequences observed in the high mixed layer and/or low free troposphere at an altitude of approximately 900 m as well as on the ice sheet (approximately 600 m). In both samples, The ratio of bacteria belonging to the classes Flavobacteria (around 35%), β-proteobacteria (around 12%), and α-proteobacteria (around 8%) were the dominant bacterial classes. The ratio of bacteria belonging to classes Clostridia, δ-proteobacteria, and Chloroplast showed slightly increases with altitude from 0.6%, 9.2%, and 1.0% to 2.3%, 10.5%, and 1.3%, respectively. The bacteria belonging to class Clostridia are commonly found in various environmental settings, especially in soil, and some are human pathogens. The bacteria belonging to the class δ-proteobacteria are gram negative and include several pathogenic bacteria. Notably, Bacteria belonging to class Chloroplast was also observed using a tethered balloon in 2013 at an altitude of approximately 1,000 m over Syowa Station (Kobayashi, 2022 a). Niederberger et al. (2015) examined the microbial community composition of transiently wetted Antarctic Dry Valley soils, where the bacterium belonging to the class Chloroplast signatures associated with Streptophyta were prevalent in wet soils. Therefore, the Chloroplast observed at high altitudes in the present study likely originated from the Antarctic Dry Valley in West Antarctica. The bacterium of the class Chloroplast may be permanently present at approximately 1,000 m above the surface of East Antarctica. To deepen the analysis beyond the class comparison shown in Fig. 5 , we examined recent comparisons at the genus level. The ratios in upper air of bacteria belonging to the genera Arcobacter , Finegoldia , and Methyloversatilis (0.20, 0.36, and 0.15%) were approximately 5.0, 3.0, and 2.1 times higher than those on the ice surface (0.04, 0.12, and 0.07%). These strains were considered to be specific bioaerosols in and are thought to be transported from elsewhere. The bacteria belonging to the genus Arcobacter is Gram-negative, spiral-shaped bacteria in the class ε-proteobacteria. Species of the genus Arcobacter are found in both animal and environmental sources, making them unique among the Campylobacterota. Unlike other Campylobacter species, it has the characteristic ability to grow at lower temperatures (15°C) and even in air (Vamdemberg, et al., 2004). The ability to grow at low temperature and in air may be the reason it was detected frequently in upper air. The bacteria belonging to the genus Finegoldia is Gram-positive bacteria and anaerobic cocci of the class Clostridia. In Fig. 5 , the higher ratio of class Clostridia in the upper atmosphere compared to near the ice sheet is thought to be due to the abundance of this genus Finegoldia . It is an opportunistic human pathogen that normally colonizes skin and mucous membranes. It's interesting that bacteria found on the skin can be detected in the upper atmosphere. The bacteria belonging to the genus Methyloversatilis is a Gram-negative, nonmotile rod-shaped bacterium in the class β-proteobacteria. These bacteria possess the ability to utilize single-carbon compounds (such as methanol) and play important roles in various environments. 3.3 Backward trajectory analyses Figure 6 presents air mass backward trajectories at altitudes of 900 m. These trajectories calculated using kinematic and isentropic trajectory models developed at the NIPR (Suzuki et al., 2008 ; Tomikawa and Sato, 2005 ), cover the seven days from 15:00 on January 10, 2019, to 15:00 on January 3, 2019 (local time). Air mass history is investigated to understand the transport processes, sources, and sinks of bioaerosols. In the present study, air masses originating from the inland area located at 100°E longitude and 70°S latitude in West Antarctica traversed through the coastal region [Fig. 6 ( a )]. As seen in Fig. 6 ( a ), at the shoreline, the bacteria belonging to the class Chloroplast stirred up by Antarctic Ocean strong waves may have been transported long distances to the air mass above S17 Base. The air mass altitude reached approximately 4,500 m, well within the free troposphere [Fig. 6 ( b )]. From these data, bacteria belonging to the genera Arcobacter , Finegoldia , and Methyloversatilis detected in the high mixed layer and/or low free troposphere at an altitude of approximately 900 m over East Antarctica, as they do not thrive in this environment of Antarctic, transformed long-distance from some other continents by dynamic atmospheric phenomena such as polar circulation. 4. Conclusions Atmospheric bioaerosols were successfully sampled and analyzed using a UAV on January 10, 2019. Analysis, including massively parallel sequencing, yielded the following results: (1) successful sampling of atmospheric bioaerosols were achieved at an altitude of approximately 900 m using the UAV over S17 Base, East Antarctica; (2) metrological data for the sampling day indicated that the bioaerosol sample was obtained from a high mixed layer and/or the low free troposphere, with air mass backward trajectories suggesting inland transportation across Antarctica at an altitude of around 4,500 m; (3) the bacteria belonging to the class Chloroplast may be persistent in the upper atmosphere over East Antarctica from the data of bioaerosol sampling using tethered balloon over Syowa Station, 2013 (Kobayashi, 2022 a); (4) the bacteria belonging to the genera Arcobacter , Finegoldia , and Methyloversatilis were specially detected from the upper atmosphere; (5) From backward trajectory analyses of the air mass, revealed that these bacteria may have been transported long distances from outside the Antarctic continent by dynamic atmospheric phenomena such as polar circulation. Declarations Conflict of interest The author declares no competing interests. Author Contribution F.Kobayashi wrote the all manuscript text and all figures. F.Kobayashi reviewed the manuscript. Acknowledgement I thank the 60th Japanese Antarctic Research Expedition (JARE60) members (Prof. Masaki Tsutsumi, JARE60 leader, and Prof. Naomi Harada, JARE60 assistant reader), particularly Mr. Katsumi Saga, Mr. Ryohei Haraguchi, Mr. Kouki Saito, and Mr. Masataka Tsutsumi (Tsutsumi Bravo) as Meteorology and Glaciology Group members, for their support in operating the UAV. References Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens, S. M., Betley, J., Fraser, I., Bauer, M., Gormley, N., Gilbert, J. A., Smith, G., & Knight, R. (2012). Ultra-high-throughput microbial community analysis on the illumina Hiseq and Miseq platforms. ISME J . 6, 1624-1624. https://www.nature.com/articles/ismej20128 Hara, K., Osada, K., Nishida-Hara, C., & Yamanouchi, T. (2011). Seasonal variations and vertical features of aerosol particles in the Antarctic troposphere. Atmos. Chem. Phys. 11, 5471-5784. https://doi.org/10.5194/acp-11-5471-2011 Kobayashi, F., Maki, T., Kakikawa, M., Noda, T., Mitamura, H., Takahashi, A., Imura, S., & Iwasaka, Y. (2016). Atmospheric bioaerosols originating from Adelie penguins ( Pygoscelis adeliae ): ecological obaservations of airborne bacteria at Hukuro Cove, Langhovde, Antarctica, Pol. Sci. 10, 71-78. https://doi.org/10.1016/j.polar.2015.12.002 Kobayashi, F. (2022a). Direct sampling and bioanalyses of atmospheric bioaerosols using a tethered balloon over Syowa Station, Antarctica, Pol. Sci. 32, 100842-100848. https://doi.org/10.1016/ j.polar.2022.100842 Kobayashi, F. (2022b). Novel environmental observation in Antarctica -variations in bacterial communities of bioaerosols at the Syowa Station and Langovde Yukidori Valley-, Kankyo Kagaku Kaishi , 35, 113-120. https://doi.org/10.11353/sesj.35.113 Kobayashi, F. & Hayashi, M. (2022). Atmosphere bioaerosol observation using a tethered balloon and kite plane over the Antarctica, Earozoru Kenkyu , 37, 109-116. https://www.jstage.jst.go.jp/article/ jar/37/2/37_370205/_pdf/-char/ja Liu. Z., DcSantis, T. Z., Andersen, G. L., & Knight, R. (2008). Accurate taxonomy assignments from 16S rRNA sequences produced by highly parallel pyrosequencers. Nucleic Acids Res ., 36, e120_1-e12011. https://pubmed.ncbi.nlm.nih.gov/18723574/ Niederberger1, T.D., Sohm, J.A., Gunderson, T.E., Parker, A.E., Tirindelli, J., Capone, D.G., Carpenter, E.J., & Cary, S.C. (2015). Microbial community composition of transiently wet Antarctic Dry Valley soils. Front. Microbial. , 6, 1-12. https://doi.org/10.1186/s40793-024-00587-0 Osada, K., Hayashi, M., Hara, K., Yabuki, M., Wada, M., Shiobara, M., Yamanouchi, T., $ Fujita, K. (2010). Seasonal variation of coarse aerosol particle concentration at Sowa station, Antarctica. Antarct. Rec . 54, 487-497. https://www.researchgate.net/publication/289604947_Seasonal_ variation_of_coarse_aerosol_particle_concentration_at_Syowa_Station_Antarctica Pearce, D. A., Alekhina, I. A., Terauds, A., Wilmotte, A., Quesada, A., Edwards, A., Dommergue, A., Sattler, B., Adams, B. J., Magalhaes, C., Chu, W.-L., Lau, M. C. Y., Cary, C., Smith, D. J., Wall, D.H., Eguren, G., Matcher, G., Braadley, J. G., Gunde-Cimerman, N., Convey, P., Hong, S. G., Pointing, S. B., Pellizari, V. H., & Vinvent, W. F. (2016). Aerobiology over Antarctica – A new initiative for atmospheric ecology, Front. Microbiol. , 7, 16, 1-7. https://doi.org/10.3389/ FMICB. 2016.00016 Suzuki, K., Yamanouchi, T., & Motoyama, H. (2008) Moisture transport to Syowa and Dome Fuji stations in Antarctica, J. Geophys. Res. , 113, D24114. https://doi.org/10.1029/2008JD009794 Tomikawa, Y. & Sato, K. (2005). Design of the NIPR trajectory model, Pol. Meteol. Glaciol. , 19, 120-137. https://www.researchgate.net/publication/232701070_Design_of_the_NIPR_trajectory_ model Vandenberg, O., Dediste, A., Houg, K., Ibekwem, S., Souayah, H., Cadranel, S., Douat, N., Zissis, G., Butzler, J.-P., & Vandamme, P. (2004). Arcobacter species in humans, Emerging Infections Diseases, 10, 1863-1867. https://web.archive.org/web/20090927222905/http://www.cdc.gov/ ncidod/EID/vol10no10/pdfs/04-0241.pdf Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7725332","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":521972709,"identity":"033a4813-2d16-48c8-a7ab-d7592f25ce4d","order_by":0,"name":"F. Kobayashi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAUlEQVRIiWNgGAWjYBAC9gYGhsMMBgwM/BKMDSABAzaoDDMuLTwHoFokZ5CiBSxpcAMiYEDQYTwS2YmHCwrq5I1vN7d9+PDHzpiPgceA4UcNA7s5Ti25Gw7PMDhsuO3OweaZM9uSzdiAWhh7jjEwWzZg12IP0sJjcIBx243EZmbeBmYbNvk3Bgy8DQzMBgfw2MJjUGe/eQZQC8+fehuwLX8Ja2FO3CAB0sJ2GOwwZry28LwFaTmcPAPoMMaZbceN2RjYCg7LHJPA6Rce9tzNn3n+1Nn2z0h/zPDhT7Xh/AbmjQ/f1Ngk4wox7ADoJIlkwjGEDuxI1zIKRsEoGAXDFAAAKKJSTeXSn8MAAAAASUVORK5CYII=","orcid":"","institution":"Hirosaki University","correspondingAuthor":true,"prefix":"","firstName":"F.","middleName":"","lastName":"Kobayashi","suffix":""}],"badges":[],"createdAt":"2025-09-27 02:23:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7725332/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7725332/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92561039,"identity":"50594334-751a-4027-98bb-6ba7e050afbf","added_by":"auto","created_at":"2025-10-01 04:27:56","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":45306,"visible":true,"origin":"","legend":"","description":"","filename":"ManuscriptF.Kobayashi.docx","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/f826c46c5e4c46a034bc3648.docx"},{"id":92561726,"identity":"4c3afed5-8b00-4c3a-960a-9b8a894e0322","added_by":"auto","created_at":"2025-10-01 04:43:56","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3207,"visible":true,"origin":"","legend":"","description":"","filename":"13f1205ceeb94afab17b0b53b4dec36b.json","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/7f3e361016c2d672437d4ed3.json"},{"id":92561044,"identity":"3870ace5-dc34-45f0-bccf-18449161a501","added_by":"auto","created_at":"2025-10-01 04:27:56","extension":"pptx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":256089,"visible":true,"origin":"","legend":"","description":"","filename":"FIG01FKobayashi.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/08736545f55399cdd4e742e8.pptx"},{"id":92561047,"identity":"c95ee7cc-761f-423e-9aee-7d5b7ff41b26","added_by":"auto","created_at":"2025-10-01 04:27:56","extension":"pptx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":869494,"visible":true,"origin":"","legend":"","description":"","filename":"FIG02FKobayashi.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/c3fbb54dbe91b3e25f6023e6.pptx"},{"id":92561229,"identity":"a9f095af-3f13-4ce6-af33-d653e4af615f","added_by":"auto","created_at":"2025-10-01 04:35:56","extension":"pptx","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":324079,"visible":true,"origin":"","legend":"","description":"","filename":"FIG03FKobayashi.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/4c27e09d9faa64e801322dab.pptx"},{"id":92561231,"identity":"4b008834-92ce-4247-9014-a9f014276f60","added_by":"auto","created_at":"2025-10-01 04:35:56","extension":"pptx","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":139182,"visible":true,"origin":"","legend":"","description":"","filename":"FIG04FKobayashi.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/e1e2e79c3c8add0022681a37.pptx"},{"id":92561051,"identity":"a991ebe3-c813-4825-9717-a32611fa75b5","added_by":"auto","created_at":"2025-10-01 04:27:56","extension":"pptx","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":104804,"visible":true,"origin":"","legend":"","description":"","filename":"FIG05FKobayashi.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/72da393584758c8d15579663.pptx"},{"id":92561053,"identity":"3982bdfa-b6f4-43e0-81f3-f7e57bd7f21a","added_by":"auto","created_at":"2025-10-01 04:27:56","extension":"pptx","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":124151,"visible":true,"origin":"","legend":"","description":"","filename":"FIG06FKobayashi.pptx","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/fafaf4c83552265b2b719cf1.pptx"},{"id":92561230,"identity":"2d77df67-bb96-4197-bbe5-8c644ce370a9","added_by":"auto","created_at":"2025-10-01 04:35:56","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59892,"visible":true,"origin":"","legend":"","description":"","filename":"13f1205ceeb94afab17b0b53b4dec36b1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/f168a465a2113a7a534d1375.xml"},{"id":92561232,"identity":"e472f0fb-82ca-4d5b-89af-1e5ea3ce6ef9","added_by":"auto","created_at":"2025-10-01 04:35:56","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59556,"visible":true,"origin":"","legend":"","description":"","filename":"13f1205ceeb94afab17b0b53b4dec36b1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/63b3044c72ea9d30984098f7.xml"},{"id":92561049,"identity":"f9d212b0-5737-494e-b2a9-f90a015f0062","added_by":"auto","created_at":"2025-10-01 04:27:56","extension":"html","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65082,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/f26231508b96be7eaa5516b9.html"},{"id":92561038,"identity":"71227d84-a4ea-4d0d-a12c-13b9fd7d42ba","added_by":"auto","created_at":"2025-10-01 04:27:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":97622,"visible":true,"origin":"","legend":"\u003cp\u003eLocation of S17 Base as the sampling site\u003c/p\u003e","description":"","filename":"FIG01FKobayashi1.png","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/dea211d9ff7cfada9628c243.png"},{"id":92561227,"identity":"c0cf6ac3-8930-4ad2-8c98-a74b77506fda","added_by":"auto","created_at":"2025-10-01 04:35:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":918561,"visible":true,"origin":"","legend":"\u003cp\u003ePhotographs of the UAV, the snowmobile\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e), and the two inlets installed at front of the UAV (\u003cstrong\u003eb\u003c/strong\u003e). The optical particle counter (OPC) device and the filter unit for bioaerosols are visible\u003c/p\u003e","description":"","filename":"FIG02FKobayashi1.png","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/47f883141330c4eb168770bb.png"},{"id":92561041,"identity":"3f094d70-12d9-4ab3-8824-cfe7e9b5d6d6","added_by":"auto","created_at":"2025-10-01 04:27:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":30388,"visible":true,"origin":"","legend":"\u003cp\u003eVertical profiles of temperature\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e), relative humidity\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eb\u003c/strong\u003e), wind direction\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003ec\u003c/strong\u003e), and wind speed (\u003cstrong\u003ed\u003c/strong\u003e) obtained by meteorological sonde measurements at the altitude for UAV sampling\u003c/p\u003e","description":"","filename":"FIG03FKobayashi1.png","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/079511eb94e5f81512a04bea.png"},{"id":92561040,"identity":"9e288d18-fe9a-4920-bc69-6ca838f28dd0","added_by":"auto","created_at":"2025-10-01 04:27:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":19652,"visible":true,"origin":"","legend":"\u003cp\u003eVertical profile of the aerosol number concentration, obtained by OPC attached to UAV on particle diameter of \u0026gt; 0.3 µm (\u003cstrong\u003ea\u003c/strong\u003e), \u0026gt;1.0 µm\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eb\u003c/strong\u003e), and \u0026gt;5.0 µm (\u003cstrong\u003ec\u003c/strong\u003e)\u003c/p\u003e","description":"","filename":"FIG04FKobayashi1.png","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/17ca8696aa692fb1e5576903.png"},{"id":92561046,"identity":"f9f91881-ec94-41d3-9b3c-4bce6e2f222b","added_by":"auto","created_at":"2025-10-01 04:27:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":22076,"visible":true,"origin":"","legend":"\u003cp\u003eClass-level distributions of sequences observed at an altitude of approximately 900 m via a UAV and on the ice sheet at an altitude of approximately 600 m for the same time\u003c/p\u003e","description":"","filename":"FIG05FKobayashi1.png","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/3c8738259ac2e3de76e612ef.png"},{"id":92561045,"identity":"b194b0e3-dff5-4e87-8eb2-a1d994fad3d2","added_by":"auto","created_at":"2025-10-01 04:27:56","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":176180,"visible":true,"origin":"","legend":"\u003cp\u003eBackward trajectories from S17 Base, the sampling site to that of 7-days calculation on the location (\u003cstrong\u003ea\u003c/strong\u003e) and altitude (\u003cstrong\u003eb\u003c/strong\u003e)\u003c/p\u003e","description":"","filename":"FIG06FKobayashi1.png","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/0c9c5882dc6d124395e3a2f0.png"},{"id":93067000,"identity":"425e2145-273b-4b64-80f9-9d520f4e3d2f","added_by":"auto","created_at":"2025-10-08 16:54:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1924032,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7725332/v1/18d30a68-5848-4ad9-ac6e-ff34c06a1db7.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Direct sampling and bioanalyses of atmospheric bioaerosols via an unmanned aerial vehicle over S17 Base, East Antarctica","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAtmospheric bioaerosols include diverse biological entities suspended in the air, such as organisms, pollen, fungi, bacteria, spores, and viruses. In Antarctica, atmospheric bioaerosol research is garnering international attention (Pearce et.al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The focus of Antarctic atmospheric bioaerosol research is as follows: (1) assessing the effects of the atmospheric ecosystem on the region\u0026rsquo;s terrestrial and aquatic ecosystems within its challenging ecological environment; (2) substantiating the atmospheric origins of microbes found in Antarctic ice cores, which may be tens of thousands of years old; (3) elucidating the relationship between bioaerosols and Antarctic meteorological dynamics, such as polar circulation, the polar vortex, and katabatic winds; (4) investigating the long-distance transport of bioaerosols from South America, Australia, and Africa; and (5) conducting inaugural observations of atmospheric bioaerosols in Antarctica.\u003c/p\u003e\u003cp\u003eWe previously observed atmospheric bioaerosols at Hukuro Cove in association with Ad\u0026eacute;lie penguin research, at Syowa Station using a tethered balloon, and others on 2013 (Kobayashi et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Kobayashi, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003ea; \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003eb; Kobayashi \u0026amp; Hayashi, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Specifically, efforts to determine the direct origins of bioaerosols involved observations at the Ad\u0026eacute;lie penguin nesting site in the ecologically challenging Antarctic environment (Kobayashi et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Employing a custom-made bioaerosol sampler at Hukuro Cove, samples were collected both upwind and downwind of the penguin colony, followed by amplicon analysis via massively parallel sequencing. Downwind, Bacilli class bacteria levels were 19.4-fold higher than those detected upwind. Amplicon analysis of penguin feces revealed a predominance of Clostridia class bacteria (78.7%) with the remainder belonging to the Bacilli class (20.1%). These findings indicate the release of Bacilli class bacteria from penguin excrement, dispersing downwind as bioaerosols. Although the study was originally intended for ecological air observations, medical researchers\u0026rsquo; inquiries into wind velocity and similar factors arose owing to the implications for airborne transmission of viruses, such as COVID-19, from fecal matter, impacting fields such as public health. This type of analysis is challenging in tropical regions due to high background levels but represents a distinctive research opportunity in Antarctica\u0026rsquo;s impoverished ecosystem. Atmospheric bioaerosol research above Antarctica involves a tethered balloon sampling at Syowa Station collecting samples approximately 1,000 m above sea level (Kobayashi, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003ea). Notably, bacterial species associated with chloroplasts were found at markedly higher levels in airborne samples from Syowa Station compared with similar ground-based observations. Backward trajectory analysis indicated an air mass origin from West Antarctica, opposite Syowa Station, at an altitude exceeding 4,000 m, i.e., the free troposphere, likely introducing these bacteria from other continents and its surrounding oceanic regions, considering the polar vortex. Thus, it is evident that atmospheric bioaerosols traverse continents over vast distances in dynamic global air currents. However, owing to logistical constraints, only one-year of samples is available, with current data lacking scientific robustness. To refine data accuracy, multiyear studies are imperative. Furthermore, tethered balloons are difficult to operate in Antarctic observations where air currents change abruptly.\u003c/p\u003e\u003cp\u003eIn the present study, I have newly developed an unmanned aerial vehicle (UAV) for atmospheric bioaerosol sampling because UAVs can withstand sudden changes in airflow to a certain extent, direct sampling of atmospheric bioaerosols was conducted at high altitudes via improved UAV over S17 Base in inland eastern Antarctica. Sampled DNA was extracted directly from filter membrane samples and subjected to amplicon analysis. I attempted to identify bacteria specific to the upper atmosphere by comparing them with samples from the ice sheet. Furthermore, we investigated the origin of these bacteria using Backward trajectories analyses.\u003c/p\u003e"},{"header":"2. Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Sampling and observation site\u003c/h2\u003e\u003cp\u003eThe atmospheric bioaerosol sampling was conducted over the Syowa Station in 2013 (Kobayashi, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003ea). At Syowa Station, the population can reach nearly 100 people during the summer (local season). Even at high altitudes, the sheer number of atmospheric bioaerosols in Antarctica is low, making the potential for anthropogenic impact impossible to ignore. The Antarctic region experiences poleward flow in the free troposphere and is subject to katabatic winds (gliding winds), i.e., cool air caused by radiative cooling descending due to gravity over the continental ice sheet, flowing along the ice sheet surface toward the outer continent. To elucidate the mechanism of bioaerosol long-range transport to Antarctica, it is necessary to compare bioaerosols within the katabatic wind with those in the free troposphere above. This requires conducting sampling on the ice sheet within the Antarctic continent. Therefore, we decided to conduct it at the S17 Base, which only has personnel for one month and a mere six members. Furthermore, while Syowa Station is located on a coastal island, S17 Base is situated on the mainland, albeit in a peripheral area, making it well-suited for observing the Antarctic continent. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows a map of Antarctica, delineating the locations of S17 Base on the Antarctic coast (69\u0026deg; 01' S, 40\u0026deg; 05' E; elevation: 580 m) and Syowa Station on East Ongul Island (69\u0026deg; 00' S, 39\u0026deg; 35' E; elevation: 28.8 m). This island lies 4 km from the continent\u0026rsquo;s edge on the eastern shore of L\u0026uuml;tzow-Holm Bay, East Antarctica. The S17 Base is located on the continental ice sheet, approximately 20 km east of Syowa Station, comprising a generator shed and a mess hall on a jack-up trestle.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Sampling and observation via the UAV\u003c/h2\u003e\u003cp\u003eNew type of UAV for bioaerosol sampling was developed as follows. The kite plane UAV [Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e(\u003cb\u003ea\u003c/b\u003e)], equipped with a two-cylinder 80 cc gasoline engine, measured 2,305 mm in length, 2,780 mm in width, and 1,195 mm in height, and had a weight of 15 kg, a payload weight of 5 kg, and a maximum altitude of 3 km. It maintained a cruising speed of approximately 40 km/h, with a flight duration equivalent to 1.5 km travel. The photo in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e(\u003cb\u003eb\u003c/b\u003e) shows the two inlets installed at the front of the UAV: one coupled to a bioaerosol sampler unit specifically developed for the UAV and the other linked to an optical particle counter (OPC) for measuring aerosol number concentration (Particle Counter HHPC3+, MET ONE Co., Ltd.). The bioaerosol sampler for the UAV was modified to activate via a switch on the controller for radio control, allowing sampling initiation during both manual and automatic flight. Given the low temperatures above Antarctica, the battery was insulated with metal cold-resistant tape to maintain its electric capacity. A membrane filter for atmospheric bioaerosol sampling with a pore size of 0.45 \u0026micro;m and a diameter of 47 mm, made of sterilized hydrophilic polyvinylidene fluoride (Advantech, Durapore HVLP04700), was used. The sampling suction system connected the sterilized filter holder (Merck Millipore, XX4304700) containing the sterilized filter membrane as noted above to an electrically conductive tube, which was then attached to one of the two inlets on the UAV. The other port connected to two lightweight, high-performance diaphragm pumps and is installed on the UAV [Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e(\u003cb\u003eb\u003c/b\u003e)]. Sterilization of filter holders and electrically conductive tubes was performed using a portable autoclave brought into the S17 Base facility. Suction was performed for one hour at a rate of approximately 720 L/h. Air temperature, relative humidity, wind direction, and wind speed were measured using radiosondes (RS-11G, Meisei Electric Co., Ltd.) attached to the UAV. The UAV was manually controlled by a kite controller (radio controlled) until takeoff, and subsequently automatically navigated along a predetermined route via an onboard autopilot upon reaching the sampling altitude. Once at the target altitude, the autopilot autonomously guided the aircraft along a preset route using GPS, with the route programmed via a personal computer installed in the snow mobile[(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e(\u003cb\u003ea\u003c/b\u003e)]. Before takeoff, while preparing, the shutter was closed and the interior was completely sterile. Upon reaching the target altitude, the snowmobile transmits a radio signal via remote control to activate the pump and open the shutter for suction and sampling. This navigation prevented sample contamination by the kite plane\u0026rsquo;s engine exhaust. Post observation, the sample was landed manually,\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe atmospheric bioaerosol samplings in this study was carried out as follows. This aircraft took off at 14:47 (local time) on January 10, 2019, for 1h (from 15:08 to 16:08) at a 900 m altitude (approximately 300 m above the ice sheet), and landed at 16:20 (local time). After landing on the ice sheet, seal the filter holder while maintaining sterility, transport it to the S17 Base observation sled, remove the membrane filter sample inside the sled's sterile clean booth, place it in a gamma-irradiated plastic tube, and store it in the freezer. On the ice sheet, we used the same sampling device (spare) to sample during the same period, creating ice samples. It was processed and stored in the same methods as bioaerosol sample on the upper air. Sterilizations of filter membrane, filter holder, and electrically conductive tube were performed in a small autoclave within the habitation caboose. All operations requiring sterility were performed within the sterile clean booth installed inside the habitation caboose.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. DNA extraction and amplicon analyses\u003c/h2\u003e\u003cp\u003eMembrane filter samples were folded to remove excess water, washed with sterile water, and subjected to bacterial collection in microcentrifuge tubes via centrifugation at 5,000 \u003cem\u003eg\u003c/em\u003e (7,500 rpm) for 10 min. DNA was extracted directly using a DNeasy Blood and Tissue Kit (QIAGEN Co. Ltd.). The membrane filter solution was subjected to bacteriolysis incubation at 37\u0026deg;C overnight, performed by adding protease K and extraction buffer from a DNA extraction kit (ISOTISSUE, Nippon Gene Co., Ltd.). After the sample solution was treated with RNase, DNA was collected using phenol\u0026ndash;chloroform extraction and butanol precipitation.\u003c/p\u003e\u003cp\u003eThe first polymerase chain reaction (PCR) step was performed using the 515F and 806R primers. Tag sequences targeted in the second PCR amplification were incorporated into the 16S rDNA universal sequences, i.e., TGTGCCAGCMGCCGCGGTAA and GGACTACHVGGGTWTCTAAT (Caporaso et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). PCR conditions in the first step included initial denaturation at 95\u0026deg;C for 1 min, followed by 23 cycles of 95\u0026deg;C for 1 min, 52\u0026deg;C for 2 min, and 72\u0026deg;C for 2 min, with a final elongation step at 72\u0026deg;C for 1 min. PCR amplicons were purified using AMPure XP Beads (Beckman Coulter Co., Ltd.). For the second round of PCR, the following primers were used: F5 (5\u0026acute;-AATGATACGGCGACC ACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGACGC-3\u0026acute;), F6 (5\u0026acute;-AATGATACG GCGACCACCGAGATCTACACTAATCTTAACACTCTTTCCCTACACGACGC-3\u0026acute;), and R2 (5\u0026acute;-CAAGCAGAAGACGGCATACGAGATACGAATTCGTGACTGGAGTTCAGACGTGTG-3\u0026acute;). PCR conditions in the second round comprised initial denaturation at 98\u0026deg;C for 30 s, followed by 12 cycles of 98\u0026deg;C for 1 min, 60\u0026deg;C for 2 min, and 72\u0026deg;C for 2 min, with a final elongation step at 72\u0026deg;C for 1 min. Ex Taq HS (TaKaRa Co., Ltd) was employed as the PCR enzyme. Sequencing of all samples was performed on Illumina\u0026rsquo;s MiSeq sequencer using the 500-Cycle MiSeq Reagent Kit v2 (Illumina Inc.). This protocol yielded read lengths of approximately 400 bp, covering the variable region V4 of the 16S rRNA gene enabling accurate taxonomy assignment to at least the family level of microorganism composition (Liu et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e\u003cp\u003ePrior to bacterial community structure analysis, sequences shorter than 200 bp, those with a Phred-equivalent quality score below 25, those containing ambiguous characters, those with uncorrectable barcodes, and those with primer sequences were filtered out. Remaining sequences were clustered into phylotypes using QIIME 2 2021.11, with a minimum coverage of 99% and a minimum identity of 97%. Phylotype bacterial composition was analyzed via comparison against the DNA Data Bank of Japan (DDBJ) using BLAST. All sequencing data were deposited in the DDBJ under the accession number PRJDB17672.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. Air mass backward trajectories\u003c/h2\u003e\u003cp\u003eTo trace the origin of atmospheric bioaerosols, backward trajectories of air mass were computed at five altitudes: 0, 500, 1,000, 1,500, and 2,000 m. These were calculated using kinematic and isentropic trajectory models developed at the National Institute of Polar Research (NIPR) (Suzuki et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Tomikawa and Sato, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2005\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results and discussion","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e3.1. Weather condition and aerosol number concentration measured over S17 Base via the UAV\u003c/h2\u003e\u003cp\u003eIn 2013, we collected atmospheric bioaerosols using tethered balloons (Kobayashi, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003ea). Tethered balloons are well-suited for meteorological observations and direst atmospheric bioaerosol sampling because they can minimize relative wind speed. However, most of Antarctica's surface is covered in ice, resulting in an extremely low coefficient of friction with the atmosphere. Consequently, changes in airflow directly affect wind direction and speed [Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e (\u003cb\u003ec\u003c/b\u003e) and (\u003cb\u003ed\u003c/b\u003e)]. In areas where wind direction and speed change abruptly, tethered balloon operations become extremely difficult and require considerable skill, making them unsuitable for observations or bioaerosol sampling in Antarctica. Based on the above, this study attempted bioaerosol sampling via UAV that are easy to operate even with some changes in wind direction and speed. Additionally, UAV capable of autopilot operation from the snowmobile where the interior is not cold are well-suited for bioaerosol collection in the extreme cold of Antarctica.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e shows the relationships between the altitude range 600\u0026ndash;900 m and temperature (a), relative humidity (b), wind direction (c), and wind speed (d) over S17 Base, as measured by the UAV with observation equipment. Temperature declined gradually from approximately \u0026minus;\u0026thinsp;3\u0026deg;C to \u0026minus;\u0026thinsp;5\u0026deg;C with increasing altitude. Relative humidity remained stable at around 75% at 600\u0026ndash;800 m altitude, decreasing to 60% up to 900 m altitude. Wind direction exhibited substantial variation at 600\u0026ndash;900 m altitudes. Wind speed displayed notable fluctuations up to an altitude of 800 m, stabilizing at 5 m/s for altitudes of 800\u0026ndash;900 m. These findings suggest that the boundary layer extends beyond an altitude of 900 m, indicating that bioaerosol sampling at approximately 900 m corresponds to a high mixed layer and/or the low free troposphere.\u003c/p\u003e\u003cp\u003eParticle concentration measurements were obtained using an OPC apparatus mounted on the UAV. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e shows the vertical profiles of aerosol number concentration. The number of particles larger than 0.3 \u0026micro;m considered fine particles, decreased from around 5.0 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e at 600 m to approximately 3.0 \u0026times;10\u003csup\u003e6\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e at 900 m [Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e (\u003cb\u003ea\u003c/b\u003e)]. Similarly, the number of particles larger than 1.0 \u0026micro;m decreased from around 5.5 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e at 600 m to approximately 3.0 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e at 900 m [Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e (\u003cb\u003eb\u003c/b\u003e)]. The number of particles larger than 5.0 \u0026micro;m decreased from approximately 2.0 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e at 600 m to approximately 1.0 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e at 900 m [Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e (\u003cb\u003ec\u003c/b\u003e)]. Particle concentrations of all sizes decreased with increasing altitude, approximately halving in number. Additionally, aerobiological particles decreased with altitude. In the previous study, the concentration particle (D\u003csub\u003ep\u003c/sub\u003e \u0026gt;0.3 \u0026micro;m) was on the order of 10\u003csup\u003e5\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e at approximately 1,000 m altitude using a tethered balloon over Syowa Station in 2013 (Kobayashi, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003ea). The ground-based aerosol measurements (D\u003csub\u003ep\u003c/sub\u003e \u0026gt;0.3 \u0026micro;m) obtained by an OPC at Syowa Station in 2005 had range of 2.0 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e \u0026ndash; 2.0 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e (mean, 8.9 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e; median 3.5 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e m\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e) (Osada et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Hara et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The particles sample and measurement in the present study are reasonable values.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Class-level sequence distributions in air samples collected via the UAV over S17 Base\u003c/h2\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e shows the class-level distribution of bioaerosol sequences observed in the high mixed layer and/or low free troposphere at an altitude of approximately 900 m as well as on the ice sheet (approximately 600 m). In both samples, The ratio of bacteria belonging to the classes Flavobacteria (around 35%), β-proteobacteria (around 12%), and α-proteobacteria (around 8%) were the dominant bacterial classes. The ratio of bacteria belonging to classes Clostridia, δ-proteobacteria, and Chloroplast showed slightly increases with altitude from 0.6%, 9.2%, and 1.0% to 2.3%, 10.5%, and 1.3%, respectively. The bacteria belonging to class Clostridia are commonly found in various environmental settings, especially in soil, and some are human pathogens. The bacteria belonging to the class δ-proteobacteria are gram negative and include several pathogenic bacteria. Notably, Bacteria belonging to class Chloroplast was also observed using a tethered balloon in 2013 at an altitude of approximately 1,000 m over Syowa Station (Kobayashi, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003ea). Niederberger et al. (2015) examined the microbial community composition of transiently wetted Antarctic Dry Valley soils, where the bacterium belonging to the class Chloroplast signatures associated with \u003cem\u003eStreptophyta\u003c/em\u003e were prevalent in wet soils. Therefore, the Chloroplast observed at high altitudes in the present study likely originated from the Antarctic Dry Valley in West Antarctica. The bacterium of the class Chloroplast may be permanently present at approximately 1,000 m above the surface of East Antarctica.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo deepen the analysis beyond the class comparison shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, we examined recent comparisons at the genus level. The ratios in upper air of bacteria belonging to the genera \u003cem\u003eArcobacter\u003c/em\u003e, \u003cem\u003eFinegoldia\u003c/em\u003e, and \u003cem\u003eMethyloversatilis\u003c/em\u003e (0.20, 0.36, and 0.15%) were approximately 5.0, 3.0, and 2.1 times higher than those on the ice surface (0.04, 0.12, and 0.07%). These strains were considered to be specific bioaerosols in and are thought to be transported from elsewhere. The bacteria belonging to the genus \u003cem\u003eArcobacter\u003c/em\u003e is Gram-negative, spiral-shaped bacteria in the class ε-proteobacteria. Species of the genus Arcobacter are found in both animal and environmental sources, making them unique among the Campylobacterota. Unlike other Campylobacter species, it has the characteristic ability to grow at lower temperatures (15\u0026deg;C) and even in air (Vamdemberg, et al., 2004). The ability to grow at low temperature and in air may be the reason it was detected frequently in upper air. The bacteria belonging to the genus \u003cem\u003eFinegoldia\u003c/em\u003e is Gram-positive bacteria and anaerobic cocci of the class Clostridia. In Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, the higher ratio of class Clostridia in the upper atmosphere compared to near the ice sheet is thought to be due to the abundance of this genus \u003cem\u003eFinegoldia\u003c/em\u003e. It is an opportunistic human pathogen that normally colonizes skin and mucous membranes. It's interesting that bacteria found on the skin can be detected in the upper atmosphere. The bacteria belonging to the genus \u003cem\u003eMethyloversatilis\u003c/em\u003e is a Gram-negative, nonmotile rod-shaped bacterium in the class β-proteobacteria. These bacteria possess the ability to utilize single-carbon compounds (such as methanol) and play important roles in various environments.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Backward trajectory analyses\u003c/h2\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e presents air mass backward trajectories at altitudes of 900 m. These trajectories calculated using kinematic and isentropic trajectory models developed at the NIPR (Suzuki et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Tomikawa and Sato, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), cover the seven days from 15:00 on January 10, 2019, to 15:00 on January 3, 2019 (local time). Air mass history is investigated to understand the transport processes, sources, and sinks of bioaerosols. In the present study, air masses originating from the inland area located at 100\u0026deg;E longitude and 70\u0026deg;S latitude in West Antarctica traversed through the coastal region [Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e (\u003cb\u003ea\u003c/b\u003e)].\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAs seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e(\u003cb\u003ea\u003c/b\u003e), at the shoreline, the bacteria belonging to the class Chloroplast stirred up by Antarctic Ocean strong waves may have been transported long distances to the air mass above S17 Base. The air mass altitude reached approximately 4,500 m, well within the free troposphere [Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e (\u003cb\u003eb\u003c/b\u003e)]. From these data, bacteria belonging to the genera \u003cem\u003eArcobacter\u003c/em\u003e, \u003cem\u003eFinegoldia\u003c/em\u003e, and \u003cem\u003eMethyloversatilis\u003c/em\u003e detected in the high mixed layer and/or low free troposphere at an altitude of approximately 900 m over East Antarctica, as they do not thrive in this environment of Antarctic, transformed long-distance from some other continents by dynamic atmospheric phenomena such as polar circulation.\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Conclusions","content":"\u003cp\u003eAtmospheric bioaerosols were successfully sampled and analyzed using a UAV on January 10, 2019. Analysis, including massively parallel sequencing, yielded the following results: (1) successful sampling of atmospheric bioaerosols were achieved at an altitude of approximately 900 m using the UAV over S17 Base, East Antarctica; (2) metrological data for the sampling day indicated that the bioaerosol sample was obtained from a high mixed layer and/or the low free troposphere, with air mass backward trajectories suggesting inland transportation across Antarctica at an altitude of around 4,500 m; (3) the bacteria belonging to the class Chloroplast may be persistent in the upper atmosphere over East Antarctica from the data of bioaerosol sampling using tethered balloon over Syowa Station, 2013 (Kobayashi, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003ea); (4) the bacteria belonging to the genera \u003cem\u003eArcobacter\u003c/em\u003e, \u003cem\u003eFinegoldia\u003c/em\u003e, and \u003cem\u003eMethyloversatilis\u003c/em\u003e were specially detected from the upper atmosphere; (5) From backward trajectory analyses of the air mass, revealed that these bacteria may have been transported long distances from outside the Antarctic continent by dynamic atmospheric phenomena such as polar circulation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003cp\u003eThe author declares no competing interests.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eF.Kobayashi wrote the all manuscript text and all figures. F.Kobayashi reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eI thank the 60th Japanese Antarctic Research Expedition (JARE60) members (Prof. Masaki Tsutsumi, JARE60 leader, and Prof. Naomi Harada, JARE60 assistant reader), particularly Mr. Katsumi Saga, Mr. Ryohei Haraguchi, Mr. Kouki Saito, and Mr. Masataka Tsutsumi (Tsutsumi Bravo) as Meteorology and Glaciology Group members, for their support in operating the UAV.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCaporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens, S. M., Betley, J., Fraser, I., Bauer, M., Gormley, N., Gilbert, J. A., Smith, G., \u0026amp; Knight, R. (2012). Ultra-high-throughput microbial community analysis on the illumina Hiseq and Miseq platforms. \u003cem\u003eISME J\u003c/em\u003e. 6, 1624-1624. https://www.nature.com/articles/ismej20128\u003c/li\u003e\n\u003cli\u003eHara, K., Osada, K., Nishida-Hara, C., \u0026amp; Yamanouchi, T. (2011). Seasonal variations and vertical features of aerosol particles in the Antarctic troposphere. \u003cem\u003eAtmos. Chem. Phys.\u003c/em\u003e 11, 5471-5784. https://doi.org/10.5194/acp-11-5471-2011\u003c/li\u003e\n\u003cli\u003eKobayashi, F., Maki, T., Kakikawa, M., Noda, T., Mitamura, H., Takahashi, A., Imura, S., \u0026amp; Iwasaka, Y. (2016). Atmospheric bioaerosols originating from Adelie penguins (\u003cem\u003ePygoscelis adeliae\u003c/em\u003e): ecological obaservations of airborne bacteria at Hukuro Cove, Langhovde, Antarctica, \u003cem\u003ePol. Sci.\u003c/em\u003e 10, 71-78. https://doi.org/10.1016/j.polar.2015.12.002\u003c/li\u003e\n\u003cli\u003eKobayashi, F. (2022a). Direct sampling and bioanalyses of atmospheric bioaerosols using a tethered balloon over Syowa Station, Antarctica, \u003cem\u003ePol. Sci.\u003c/em\u003e 32, 100842-100848. https://doi.org/10.1016/ j.polar.2022.100842\u003c/li\u003e\n\u003cli\u003eKobayashi, F. (2022b). Novel environmental observation in Antarctica -variations in bacterial communities of bioaerosols at the Syowa Station and Langovde Yukidori Valley-, \u003cem\u003eKankyo Kagaku Kaishi\u003c/em\u003e, 35, 113-120. https://doi.org/10.11353/sesj.35.113\u003c/li\u003e\n\u003cli\u003eKobayashi, F. \u0026amp; Hayashi, M. (2022). Atmosphere bioaerosol observation using a tethered balloon and kite plane over the Antarctica, \u003cem\u003eEarozoru Kenkyu\u003c/em\u003e, 37, 109-116. https://www.jstage.jst.go.jp/article/ jar/37/2/37_370205/_pdf/-char/ja\u003c/li\u003e\n\u003cli\u003eLiu. Z., DcSantis, T. Z., Andersen, G. L., \u0026amp; Knight, R. (2008). Accurate taxonomy assignments from 16S rRNA sequences produced by highly parallel pyrosequencers. \u003cem\u003eNucleic Acids Res\u003c/em\u003e., 36, e120_1-e12011. https://pubmed.ncbi.nlm.nih.gov/18723574/\u003c/li\u003e\n\u003cli\u003eNiederberger1, T.D., Sohm, J.A., Gunderson, T.E., Parker, A.E., Tirindelli, J., Capone, D.G., Carpenter, E.J., \u0026amp; Cary, S.C. (2015). Microbial community composition of transiently wet Antarctic Dry Valley soils. \u003cem\u003eFront. Microbial.\u003c/em\u003e, 6, 1-12. https://doi.org/10.1186/s40793-024-00587-0 \u003c/li\u003e\n\u003cli\u003eOsada, K., Hayashi, M., Hara, K., Yabuki, M., Wada, M., Shiobara, M., Yamanouchi, T., $ Fujita, K. (2010). Seasonal variation of coarse aerosol particle concentration at Sowa station, Antarctica. \u003cem\u003eAntarct. Rec\u003c/em\u003e. 54, 487-497. https://www.researchgate.net/publication/289604947_Seasonal_ variation_of_coarse_aerosol_particle_concentration_at_Syowa_Station_Antarctica\u003c/li\u003e\n\u003cli\u003ePearce, D. A., Alekhina, I. A., Terauds, A., Wilmotte, A., Quesada, A., Edwards, A., Dommergue, A., Sattler, B., Adams, B. J., Magalhaes, C., Chu, W.-L., Lau, M. C. Y., Cary, C., Smith, D. J., Wall, D.H., Eguren, G., Matcher, G., Braadley, J. G., Gunde-Cimerman, N., Convey, P., Hong, S. G., Pointing, S. B., Pellizari, V. H., \u0026amp; Vinvent, W. F. (2016). Aerobiology over Antarctica \u0026ndash; A new initiative for atmospheric ecology, \u003cem\u003eFront. Microbiol.\u003c/em\u003e, 7, 16, 1-7. https://doi.org/10.3389/ FMICB. 2016.00016\u003c/li\u003e\n\u003cli\u003eSuzuki, K., Yamanouchi, T., \u0026amp; Motoyama, H. (2008) Moisture transport to Syowa and Dome Fuji stations in Antarctica, \u003cem\u003eJ. Geophys. Res.\u003c/em\u003e, 113, D24114. https://doi.org/10.1029/2008JD009794\u003c/li\u003e\n\u003cli\u003eTomikawa, Y. \u0026amp; Sato, K. (2005). Design of the NIPR trajectory model, \u003cem\u003ePol. Meteol. Glaciol.\u003c/em\u003e, 19, 120-137. https://www.researchgate.net/publication/232701070_Design_of_the_NIPR_trajectory_ model\u003c/li\u003e\n\u003cli\u003eVandenberg, O., Dediste, A., Houg, K., Ibekwem, S., Souayah, H., Cadranel, S., Douat, N., Zissis, G., Butzler, J.-P., \u0026amp; Vandamme, P. (2004). \u003cem\u003eArcobacter\u003c/em\u003e species in humans, Emerging Infections Diseases, 10, 1863-1867. https://web.archive.org/web/20090927222905/http://www.cdc.gov/ ncidod/EID/vol10no10/pdfs/04-0241.pdf\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Atmospheric bioaerosol, Antarctica, Unmanned aerial vehicle, Amplicon analysis","lastPublishedDoi":"10.21203/rs.3.rs-7725332/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7725332/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAtmospheric bioaerosol aerosol sampling is being extensively conducted in Antarctica. In this study, bioaerosol sampling was conducted at a 900-m altitude over S17 Base in the coastal region of Antarctica using an unmanned aerial vehicle (UAV) on January 10, 2019. Based on the metrological data collected using the UAV, bioaerosol samples were obtained from a high mixed layer and/or the low free troposphere. Bacteria belonging to the class Chloroplast were detected in the upper air. Those were also observed at an altitude of about 1,000 m over Syowa Station in 2013 (Kobayashi, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003ea), suggesting that they may be persistent in the upper atmosphere over East Antarctica. In the upper air, bacteria belonging to the genera \u003cem\u003eArcobacter\u003c/em\u003e, \u003cem\u003eFinegoldia\u003c/em\u003e, and \u003cem\u003eMethyloversatilis\u003c/em\u003e were particularly detected. Backward trajectory analyses of the air mass, revealed that these bacteria may have been transported long distances from outside the Antarctic continent by dynamic atmospheric phenomena such as polar circulation.\u003c/p\u003e","manuscriptTitle":"Direct sampling and bioanalyses of atmospheric bioaerosols via an unmanned aerial vehicle over S17 Base, East Antarctica","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-01 04:27:51","doi":"10.21203/rs.3.rs-7725332/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"51510941-b977-4fec-a815-3861e40ce4ba","owner":[],"postedDate":"October 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-08T16:53:40+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-01 04:27:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7725332","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7725332","identity":"rs-7725332","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}