Biosynthesized Selenium-hydroxytyrosol nanoparticles attenuate hepatocellular carcinoma in rats

Biosynthesized Selenium-hydroxytyrosol nanoparticles attenuate hepatocellular carcinoma in rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Biosynthesized Selenium-hydroxytyrosol nanoparticles attenuate hepatocellular carcinoma in rats Radwa T.M. Tawfik, Eman M. Abd El-Azeem, Sawsan M. Elsonbaty, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5726485/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Hepatocellular carcinoma (HCC) is a life-threatening disease with a global impact, underscoring the urgent need for the development of new therapeutic agents. This study evaluates the therapeutic effect of selenium-hydroxytyrosol nanoparticles (Se-HTNPs) in a rat model of HCC induced by diethylnitrosamine (DEN). In vitro, Se-HTNPs treatment reduced the viability of Hep G2 cells in a dose-dependent manner, with an IC 50 value of 61.29 ± 1.12 µg/mL. The results confirmed the antioxidant, anti-inflammatory, and anti-carcinogenic properties of Se-HTNPs, demonstrating their effectiveness against DEN-induced HCC. The therapeutic effects of Se-HTNPs were validated by inhibiting serum ALT, AST, and ALP enzyme activities and reducing serum total bilirubin levels. Simultaneously, Se-HTNPs enhanced serum albumin and total protein levels. Additionally, Se-HTNPs alleviated oxidative stress by significantly lowering hepatic lipid peroxidation (MDA) levels and markedly increasing antioxidant marker levels (GSH, SOD, and TAC) compared to DEN-administered rats. Se-HTNPs also significantly reduced hepatic inflammatory markers (TNFα, IL-6, and IL-1β), apoptotic markers (p53 and caspase 3), and VEGF levels. Furthermore, compared to the DEN group, Se-HTNPs distinctly suppressed c-JNK mRNA and NF-κB mRNA gene expression levels. Moreover, Se-HTNP treatment significantly improved the histological alterations induced by DEN. In conclusion, these findings suggest that Se-HTNPs mitigate DEN-induced HCC in rats through their potent antioxidant, anti-inflammatory, and anti-carcinogenic properties. hepatocellular carcinoma diethylnitrosamine Se-HTNPs antioxidant anti-inflammatory anti-carcinogenic Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction One of the most dangerous and fatal diseases in the world is cancer. According to estimates by the World Health Organization, cancer causes the death of 9.6 million people worldwide each year, and its incidence has sharply increased globally [ 1 ]. The prevalence of liver cancer is rising worldwide, and according to estimates from the International Agency for Research on Cancer, the total number of liver cancer cases will increase by more than one million each year by 2025 [ 2 ]. Approximately 90% of liver cancer cases are hepatocellular carcinoma (HCC), the most prevalent form of liver cancer [ 3 ]. Hepatocellular carcinoma is one of the most common malignancies in the world and the third largest cause of cancer-related mortality [ 4 ]. Hepatitis viral infections (HBV and HCV), dietary additives, alcohol, fungal toxins (aflatoxins), hazardous industrial chemicals, and environmental exposures (air and water pollution) are the most significant and well-known risk factors for hepatocellular carcinoma [ 5 ]. Additionally, hepatocellular carcinoma occurs due to reactive nitrogen species, reactive oxygen species, and pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) contributing to the tumor microenvironment [ 3 ]. Although removal by surgery is a successful treatment for HCC, it cannot be performed on individuals whose tumors have reached an advanced clinical stage. Chemoresistance in HCC therapy makes chemotherapy less successful despite its demonstrated efficacy in treating malignant tumors [ 6 ]. Thus, there is a pressing need for new and efficient therapeutic approaches for HCC. Nanoparticle-based cancer medications have been assessed or used in clinical trials for their usefulness due to the rapid development of nanocomplexes and nanotechnology synthesis processes. The advancement of nanotechnology has led to progress in drug manufacturing, including those related to nanoparticles used in cancer therapy [ 7 ]. Particles of one dimension ranging from 1 to 300 nm are nanoparticles (NPs) and have characteristics based on their size and surface functions. The common characteristics and capacities of nanoparticles include their prolonged circulation duration, therapeutic agent-carrying capability, and ability to penetrate deep tumor tissues due to their molecular structures and particle sizes [ 8 ]. These benefits have prompted researchers to focus heavily on creating chemotherapeutic drugs involving nanoparticles for cancer treatment [ 9 ]. Diethylnitrosamine (DEN) is a chemical carcinogen used to induce malignancies in the liver, gastrointestinal tract, skin, and respiratory system in different animals [ 10 ]. Diethylnitrosamine disrupts nuclear enzymes related to DNA replication and repair [ 11 ]. N-nitroso compounds are present in tobacco products, cosmetics, medicinal agents, agricultural chemicals, cheddar cheese, and cured and fried foods (meat, vegetables, and bread). These compounds are recognized as a significant health concern for humans [ 3 ]. Diethylnitrosamine has carcinogenic effects on the liver by producing pro-mutagenic adducts, such as O6-ethyl deoxyguanosine and O4- and O6-ethyl deoxythymidine, following its metabolic activation [ 12 ]. The enhanced expression of G1/S-phase regulatory proteins in hepatocytes, including cyclin-dependent kinases, contributes to DEN-induced tumor formation. In addition, the biotransformation of DEN causes hepatocyte DNA damage [ 11 ]. The production of ROS and RNS occurs after the cellular metabolism of diethylnitrosamine. Reactive oxygen species primarily cause DNA damage and tissue injury [ 13 ]. Therefore, one of the most reputable and commonly used experimental models for hepatocarcinogenesis research is the DEN-induced liver cancer model [ 14 ]. An important and distinctive trace element vital to both health and disease is selenium [ 15 ]. Selenium is incorporated into selenoproteins, primarily as selenocysteine, to perform several physiological tasks within the cells [ 16 ]. The primary focus of selenium and cancer research has been on the chemopreventive properties of selenium. This concept is based on selenium's direct and indirect antioxidant properties, which increase the cells' resistance to oxidative damage [ 17 ]. The most relevant example of an inorganic selenium compound studied as a potential therapeutic agent for cancer treatment is selenite. One common inorganic selenium source used in clinical cancer treatment is sodium selenite. Selenium-containing nanoparticles have recently attracted significant interest as potential cancer therapeutic agents because of their high biological activity and minimal toxicity [ 18 ]. Traditional medicine, which uses natural materials derived from plants, provides the foundation for pharmaceutical products and is essential to the provision of primary healthcare around the world [ 19 ][ 20 ]. One of the primary and traditional foods in Mediterranean countries is olive oil. The main naturally occurring phenolic component of olive oil is hydroxytyrosol [ 21 ]. The hydrolysis of oleuropein during the maturation of olive fruit produces hydroxytyrosol [ 22 ]. Even at very high dosages, hydroxytyrosol exhibited no adverse effects in a mouse model, demonstrating its good safety profile. Hydroxytyrosol is a non-mutagenic, non-genotoxic substance suitable for long-term consumption based on toxicological examination and in vitro genotoxicity experiments. Because of these biological features, hydroxytyrosol is now the most extensively researched natural phenol. Due to its safety record, hydroxytyrosol is a highly recommended dietary supplement in the food and nutraceutical industries [ 23 ]. In traditional medicine, hydroxytyrosol is used as an antidiabetic [ 24 ], antioxidant [ 23 ], anti-inflammatory [ 25 ], neuroprotective [ 26 ], cardioprotective [ 27 ], and antidepressant [ 28 ] natural product. Epidemiological studies have revealed that consuming virgin olive oil is strongly associated with lower incidence of numerous forms of cancer, most of which are due to its phenolic anticancer properties [ 29 ]. Additionally, previous studies have demonstrated the antitumor activities of hydroxytyrosol in several cancers, including breast [ 30 ], leukemia [ 29 ], and melanoma [ 31 ]. Based on this background, our study aimed to evaluate the therapeutic effect of selenium-hydroxytyrosol nanoparticles (Se-HTNPs) on hepatocellular carcinoma induced by diethylnitrosamine in male albino rats and to elucidate its underlying mechanism. 2. Materials and methods 2.1. Materials Diethylnitrosamine (DEN), sodium selenite, and 3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma-Aldrich Corporation (USA). Hydroxytyrosol was purchased from Prohealth Company (China). 2.2. Preparation of selenium-hydroxytyrosol nanoparticles (Se-HTNPs) Selenium-hydroxytyrosol nanocomposite was synthesized from a naturally occurring compound hydroxytyrosol according to the method of Li et al. [ 32 ] with slight modifications. First, 2.0 mL of 20 mM hydroxytyrosol was added to 46.0 mL of distilled water and mixed under magnetic stirring at room temperature. Then, 2.0 mL of 10 mM sodium selenite was added dropwise. The solution's pH was quickly raised to 10.0 using 1.0 M NaOH, and the reaction was maintained with magnetic stirring at room temperature for 30 minutes. Centrifugation at 10,000 g for 10 minutes was used to condense and purify the nanoparticles, and they were then washed three times with distilled water. 2.3. Characterizations of the synthesized Se-HTNPs Determining the size and morphology of nanoparticles is crucial for their use in biomedicine and biological applications. The following techniques were used to characterize the synthesized Se-HTNPs: 2.3.1. Dynamic light scattering (DLS) A sample of Se-HTNPs was analyzed for size dimensions, distribution, and zeta potential using the DLS Zetasizer Nano ZS (ZEN 3600, Malvern, UK), according to Montes-Burgos et al. [ 33 ]. 2.3.2. Transmission electron microscopy (TEM) The prepared Se-HTNPs were characterized by transmission electron microscopy (TEM, JEOL JEM-2100, Japan, with an accelerating voltage of 200 kV) to assess their size and morphology. A drop of the prepared suspension was placed on a carbon-coated copper TEM grid and evaporated at room temperature. Characterizations of Se-HTNPs were applied using advanced microscopy technique software and a digital TEM camera, which was adjusted for Se-HTNP size measurements. 2.3.3. Ultraviolet-visible absorption (UV/VIS) spectroscopy The ultraviolet-visible spectrum of Se-HTNPs was analyzed using a computerized double-beam ultraviolet-visible spectrophotometer (Cintra 3030, GBC, UK, S.N. v4439). 2.3.4. Fourier-transform infrared spectroscopy (FTIR) A sample of Se-HTNPs was analyzed for functional groups using the Vertex 70 FT-IR spectrometer (BRUKER), scanned at a wavenumber range of 4000 to 400 cm − 1 . 2.4. Se-HTNPs cytotoxicity on Hep G2 cell line The cytotoxicity and half maximal inhibitory concentration (IC 50 ) of Se-HTNPs were investigated on the viability of the hepatocellular cancer cell line (Hep G2) using the MTT assay (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) [ 34 ]. The assay relies on the ability of the active mitochondrial succinate dehydrogenase enzyme in living cells to cleave the tetrazolium rings of the yellow water-soluble MTT and form purple insoluble formazan crystals. These crystals are impermeable to the cell membrane, resulting in their accumulation within healthy cells. The number of viable cells is directly proportional to the level of soluble formazan. The extent of MTT reduction was determined by measuring the absorbance at 570 nm. The IC₅₀ value was calculated using the dose-response curve equation. 2.5. LD 50 (Lethal Dose) of Se-HTNPs Se-HTNPs were administered orally to 15 male Wistar albino rats (3 rats/group) via gastric gavage at cumulative doses of 10, 100, 500, 1000, and 2000 mg/kg. The rats were observed for 24 hours for signs of toxicity and potential death. We used the following formula to calculate the LD50 [ 35 ]: LD50 = (D h X D L ) 1/2 D h is the highest dose at which toxicity and death signs were absent, and D L is the lowest dose at which these symptoms were present. 2.6. Animals In the present study, male Wistar albino rats (120–140 g) were obtained from El Nile Pharmaceutical Company, Cairo, Egypt. Animals were housed in a controlled environment under standard conditions, including a temperature of 25 ± 2°C, humidity of 60 ± 5%, and a 12-hour light/dark cycle. Animals were provided with a standard diet and water ad libitum . The research protocol was approved by the Research Ethics Committee at the National Center for Radiation Research and Technology (REC-NCRRT, protocol serial number: 33A/23). 2.7. Experimental design The experimental animals were divided into eight groups (Fig. 1 ), with ten rats per group (n = 10). In group 1 (the control group), the rats were orally administered 1.0 mL of saline solution (0.9% NaCl) daily for eight weeks. In group 2 (the sodium selenite group), the rats were orally administered sodium selenite (6.0 mg/kg body weight/day in 1.0 mL saline solution) for eight weeks via gastric gavage [ 36 ]. Group 3 (the hydroxytyrosol group) rats were orally administered hydroxytyrosol (300 mg/kg body weight/day in 1.0 mL saline solution) for eight weeks via gastric gavage [ 37 ]. In group 4 (the Se-HTNPs group), the rats were orally administered Se-HTNPs (10 mg/kg body weight/day in 1.0 mL saline solution) for eight weeks via gastric gavage. In group 5 (the DEN group), the rats were orally administered diethylnitrosamine (20 mg/kg body weight/day in 1.0 mL saline solution) for eight weeks via gastric gavage [ 38 ]. In group 6 (the DEN + sodium selenite group), the rats were orally administered diethylnitrosamine as in group 5 and co-administered with sodium selenite as in group 2 for eight weeks. In group 7 (the DEN + hydroxytyrosol group), the rats were orally administered diethylnitrosamine as in group 5 and co-administered with hydroxytyrosol as in group 3 for eight weeks. In group 8 (the DEN + Se-HTNPs group), the rats were orally administered diethylnitrosamine as in group 5 and co-administered with Se-HTNPs as in group 4 for eight weeks. At the end of the experiment (Day 56), the animals were fasted overnight before being euthanized by rapid decapitation. Blood samples were collected in sterile, non-heparinized tubes to obtain serum for biochemical investigations. The liver of each animal was removed quickly, cleaned with ice-cold saline solution, and divided into two sections. The first section was immersed in a 10% formalin solution and embedded in paraffin for histological analysis. The second section was frozen in liquid nitrogen and kept at -80°C for biochemical analysis. 2.8. Liver tissue homogenate The liver tissue sample was homogenized in a Tris-HCl buffer solution (pH 7.4) for one minute using a high-intensity ultrasonic processor. The homogenate was centrifuged for 20 minutes at 10,000 g at 4°C. The resulting supernatant was stored at -80°C for future analysis. 2.9. Biochemical examinations Activities of alanine aminotransferase (ALT, Cat. No. 265001, Spectrum Diagnostic Kit, Egyptian Company for Biotechnology, Egypt), aspartate aminotransferase (AST, Cat. No. 260001, Spectrum Diagnostic Kit, Egyptian Company for Biotechnology, Egypt), and alkaline phosphatase (ALP, Cat. No. ALP101090, Biomed Diagnostics, Egypt) and total protein levels (Cat. No. 016206, Diamond Diagnostics, Egypt), total bilirubin (Cat. No. 202188, Diamond Diagnostics, Egypt), and albumin (Cat. No. ALB-MC-03100, Biotechnology, Egypt) were evaluated in serum samples using the manufacturer’s protocols. Malondialdehyde (MDA, Cat. No. MD2528, Biodiagnostic, Egypt), total antioxidant capacity (TAC, Cat. No. TA2512, Biodiagnostic, Egypt), reduced glutathione (GSH, Cat. No. GR2510, Biodiagnostic, Egypt), superoxide dismutase (SOD, Cat. No. SD2520, Biodiagnostic, Egypt), tumor necrosis factor-α (TNF-α, Cat. No. CSB-E11987r, Cusabio, China), interleukin-1 beta (IL-1β, ELISA Kit, Cat. No. MBS825017, MyBioSource, USA), interleukin-6 (IL-6, Quantikine ELISA Kit, Cat. No. R6000B, R&D Systems, Inc., USA), vascular endothelial growth factor (VEGF, ELISA Kit, Cat. No. CSB-E04757r, Cusabio, China), caspase-3 (ELISA Kit, Cat. No. MBS7244630, MyBioSource, USA ), and p53 (ELISA Kit, Cat. No. ELR-P53, Ray Biotech Company, USA) were determined in liver tissue homogenates. 2.10. Molecular analysis Total RNA was extracted from liver tissue using the SV Total RNA Isolation System (Thermo Scientific, USA). A total of 1 µg of RNA was used for cDNA conversion using a high-capacity cDNA Reverse Transcription Kit (Cat. No. K4374966, Thermo Fisher Scientific, USA). mRNA gene expression of inflammatory signaling pathways [NF-κB and c-JNK N-terminal kinase (c-JNK)] in liver tissue was measured by real-time qPCR amplification, and analysis was performed using an Applied Biosystem StepOne™ instrument with software version 3.1 (USA). Real-time qPCR was performed using SYBR Green/ROX qPCR Master Mix (Roche Diagnostics) and specific primer sequences for NF‐κB, c-JNK, and β-actin as the housekeeping (reference) gene (Table 1 ). Table 1 Primer sequence of studied genes Gene Accession number Primer sequence NF-KB NM_001276711.2 Forward :5′- AATTGCCCCGGCAT- 3′ Reverse: 5′- TCCCGTAACCGCGTA- 3′ c-JNK NM_021835.3 Forward: 5′- GATCCTAAAACAGAGCATGAC − 3′ Reverse :5′- GAAGTTGCTGAGGTTGGCG- 3′ β-Actin NM_031144.3 Forward: 5′- CAGCCTTCCTTCTTGGGTATG − 3′ Reverse: 5′- AGCTCAGTAACAGTCCGCCT- 3′ 2.11. Histopathological examination Liver tissue samples were treated with 10% neutral-buffered formalin. The specimens were sectioned, washed, dehydrated in ascending concentrations of alcohol, cleared in xylene, and embedded in paraffin. Sections were cut at 4–6 µm thickness and stained with hematoxylin and eosin [ 39 ]. 2.12. Statistical analysis Using the Statistical Package for the Social Science (SPSS) program version 25, the data were statistically analyzed using one-way analysis of variance (ANOVA), followed by Tukey's post-hoc test. The findings were expressed as mean ± SD and statistical significance was considered for values of P ≤ 0.05. 3. Results 3.1. Characterizations of the synthesized Se-HTNPs Due to its quick and easy procedure compared to other methods, Se-HTNPs were synthesized using sodium selenite and hydroxytyrosol. Synthesizing nanoparticles with a small and uniform particle size distribution is an efficient approach to enhancing the bioavailability and stability of Se-HTNPs. Dynamic light scattering analysis revealed that the size of Se-HTNPs ranged from 13.54 to 100.0 nm, with an average size of 56.77 nm (Fig. 2 a). UV/VIS spectroscopy of Se-HTNPs showed a narrow peak at a wavelength of 279.8 nm (Fig. 2 b). The physical morphology and size distribution of Se-HTNPs, visualized by transmission electron microscopy, revealed that the nanoparticles were spherical, with sizes ranging from 13.42 nm to 100.0 nm and an average size of 56.71 nm (Fig. 2 c). The FT-IR spectrum of Se-HTNPs (Fig. 2 d) showed a broad band at 3419.54 cm⁻¹, corresponding to the hydroxyl group [O-H stretching], and a weak band at 2593.92 cm⁻¹, corresponding to C = C stretching. A medium band at 1660.79 cm⁻¹ was associated with C = C stretching, and a peak at 1027.74 cm⁻¹ corresponded to a single C-O or C-N bond. Other weak bands were noted at 2311.58 cm⁻¹ (C-O stretching), 2089.90 cm⁻¹ (C = C stretching), and 1522.08 cm⁻¹ (N-O stretching). Additionally, a slight shift was observed in the band corresponding to C-N stretching at 1116.11 cm⁻¹, and a weak band at 954.29 cm⁻¹ was attributed to O-H stretching. The bands corresponding to the single C-H bond ranged from 900.52 cm⁻¹ to 671.34 cm⁻¹. These results confirmed the presence of functional groups in Se-HTNPs, indicating that no chemical interactions interfered with their synthesis. 3.2. Evaluation of the antitumor efficacy of the Se-HTNPs on Hep G2 cell line The results of the MTT assay demonstrated that Se-HTNPs induced a marked decrease in cell viability compared to the control (untreated Hep G2 cells) in a dose-dependent manner (Table 2 and Fig. 3 ). The IC 50 value (the concentration of Se-HTNPs that reduced the viable Hep G2 cell count by 50%) was determined to be 61.29 ± 1.12 µg/mL. Table 2 Effect of Se-HTNPs on Hep G2 cells at different concentrations Concentration Se-HTNPs (µg/mL) Toxicity % Control (0) 0 31.25 2.66 ± 0.2 62.5 52.11 ± 3.1 125 83.49 ± 5.3 250 94.55 ± 7.8 500 95.69 ± 6.4 1000 96.73 ± 8.1 Data was represented as mean ± SD of triplicate values 3.2. LD50 of Se-HTNPs The results of the LD50 determination showed that the oral administration of Se-HTNPs had an LD50 value of 707 mg/kg body weight (D h = 500 mg/kg and D L = 1000 mg/kg). The obtained LD50 value indicates that the prepared nanoparticles are safe and non-toxic. 3.3. Biochemical results 3.3.1. Levels of serum liver function indices Enzyme activities of serum aminotransferases (ALT and AST), alkaline phosphatase (ALP), and serum levels of albumin, total proteins, and total bilirubin in groups 2, 3, and 4 showed non-significant changes compared to the control group (Table 3 ). Oral administration of DEN (group 5) significantly increased ALT, AST, and ALP activities and total bilirubin levels. It significantly decreased serum albumin and total protein levels compared to group 1 (the control group). Treatment of DEN-administered rats with sodium selenite, hydroxytyrosol, and Se-HTNPs significantly improved (P ≤ 0.05) the levels of all liver function tests studied, with the highest enhancement observed in the Se-HTNPs-treated group compared to group 5 (DEN group). 3.3.2. Levels of oxidative stress and antioxidant status The results in Table 4 demonstrated non-significant changes in the levels of lipid peroxidation indicator (MDA) and antioxidant indicators (GSH, SOD, and TAC) in the liver tissues of groups 2, 3, and 4 compared to the control group (group 1). In group 5 (DEN group), a significant increase (P ≤ 0.05) in lipid peroxidation and a significant decrease (P ≤ 0.05) in GSH, SOD, and TAC levels were observed compared to control values in group 1. The liver tissue samples of rats administered sodium selenite, hydroxytyrosol, and Se-HTNPs exhibited a significant decline in MDA levels with a concurrent significant increase in antioxidant marker levels compared to DEN-administered rats (group 5). Interestingly, Se-HTNPs restored the activity of SOD and the TAC levels to values comparable to the control group. 3.3.3. Levels of hepatic inflammatory markers (TNF-α, IL-6, and IL-1β) The results in Table 5 demonstrated a non-significant change in pro-inflammatory cytokines (TNF-α, IL-6, and IL-1β) in groups 2, 3, and 4 and a significant increase (P ≤ 0.05) in the level of these inflammatory indicators in the liver tissues of rats administered DEN (group 5) compared to the control group. On the other hand, oral administration with sodium selenite, hydroxytyrosol, and Se-HTNPs significantly decreased (P ≤ 0.05) the levels of inflammatory markers. The Se-HTNPs-treated group (group 8) showed a significant improvement in the levels of IL-6 and IL-1β, restoring them to control values. 3.3.4. Levels of hepatic apoptotic markers (p53 and caspase-3) and angiogenesis indicator (VEGF) As shown in Table 6 , apoptotic markers (p53 and caspase-3) and angiogenesis indicator (VEGF) in liver tissues were non-significantly changed in groups 2, 3, and 4 while significantly elevated (P ≤ 0.05) in group 5 (DEN group) compared to the control group (group 1). In contrast, treatment with sodium selenite, hydroxytyrosol, and Se-HTNPs significantly decreased (P ≤ 0.05) p53, caspase 3, and VEGF levels in hepatic tissues compared to DEN-administered rats, with Se-HTNPs showing the most pronounced improvement. 3.3.5. Levels of c- JNK mRNA and NF-κB mRNA gene expression Levels of c-JNK mRNA and NF-κB mRNA gene expression in hepatic tissue were non-significantly changed in groups 2, 3, and 4 compared to the control group (Fig. 4 ). DEN-administered rats (group 5) showed a significant increase (P ≤ 0.05) in c-JNK mRNA and NF‐κB mRNA gene expression levels compared with the control group (group 1). In contrast, Se-HTNPs significantly suppressed c-JNK mRNA and NF‐κB mRNA gene expression levels compared to the DEN group. Interestingly, treatment of the DEN group with Se-HTNPs restored NF‐κB mRNA gene expression to normal levels. 3.4. Histopathological results Liver tissue sections of groups 1, 2, 3, and 4 showed normal hepatic lobules consisting of polygonal cells arranged in cords with prominent round nuclei and eosinophilic cytoplasm oriented perpendicular to the central vein. The sinusoids were lined by a discontinuous layer of fenestrated endothelial cells with a fine arrangement of Kupffer cells. The portal area revealed a normal (grade 0) histological structure (Fig. 5). The DEN-induced hepatocellular carcinoma (group 5) showed disorganization of hepatic cords with hyperplasia of Kupffer cells and widely distributed nodules of variable sizes and shapes embedded in the hepatic parenchyma. Focal neoplastic cells were polyhedral to round with dense, centrally located vesicular nuclei. Multinucleated tumor giant cells with prominent basophilic nuclei and basophilic spindle cells were observed. Leukocytic infiltration was visible in this group (Fig. 6-a). Hepatocellular carcinomas were graded as poorly differentiated anaplastic lesions (grade IV). Carcinoma cells were recognizable as tissues of origin and arranged in a trabecular pattern with numerous clear cells and foamy cytoplasm. Malignant cells showed anisokaryosis (variation in nuclear size) and anisocytosis (variation in cell size), scanty basophilic cytoplasm, and frequent mitotic figures (Fig. 6-b). Hyperplasia of the bile duct, the formation of bile ductules surrounded by dense fibrous connective tissue, and focal aggregation of mononuclear cells were also noticed (Fig. 6-c). Rats in group 6 treated with sodium selenite (DEN + sodium selenite) revealed swelling and vacuolation of hepatocytes (Fig. 7-a). Disorganization of hepatic plates invaded and infiltrated with a few lymphocytes and macrophages was observed. Few pleomorphic nuclei without mitotic activity were present. The hepatic lobule showed binucleation of hepatocytes with a frequent number of apoptotic bodies and Kupffer cells hyperplasia (Fig. 7-b). Partial tumor necrosis (51–99%) was evident, as numerous pyknotic nuclei were observed (Fig. 7-c). The rats in group 7, treated with hydroxytyrosol (DEN + Hydroxytyrosol), showed degenerative changes such as cellular swelling, anisokaryosis, and anisocytosis. Focal necrotic areas in the hepatic lobules were infiltrated with a few mononuclear cells, particularly lymphocytes and macrophages (Fig. 8-a). Hyperplasia of the bile duct, with intraluminal cellular casts, was observed (Fig. 8-b). Pleomorphism of nuclei, with peripheral condensation of chromatin and poor tumor necrosis (< 50%), was evident (Fig. 8-c). The rats in group 8, treated with Se-HTNPs (DEN + Se-HTNPs), revealed degenerative changes, appearing as vacuolation of hepatocytes, nuclear pyknosis, and clear cytoplasm without evidence of mitotic activity (Fig. 9-a). Partial tumor necrosis (51–99%), characterized by apoptosis of tumor cells displayed as eosinophilic bodies scattered among hepatocytic cells, was observed (Fig. 9-b). Binucleation of hepatocytes and hyperplasia of Kupffer cells and mononuclear cells, predominantly lymphocytes and macrophages, were evident (Fig. 9-c). 4. Discussion Although hepatocellular carcinoma is more common and has a poor prognosis, there are still not enough effective therapeutic options available [ 40 ]. Surgical intervention, including transplantation, ablation, and resection, remains the principal treatment option for hepatocellular carcinoma. However, the long-term survival rate is low, and the recurrence rate remains high [ 41 ]. Due to their high cost, severe toxicity at high dosages, and limited efficacy in treating cancer, the majority of hepatocellular carcinoma medications on the market are less effective at treating the disease and are not suitable for patients. Therefore, we evaluate a novel compound, Se-HTNPs, derived from natural sources in nanoparticle form, demonstrating multi-target potential, is more cost-effective, and offers a safer option for treating HCC induced by diethylnitrosamine administration in rats. In the current study, the results of the MTT assay demonstrated that Se-HTNPs induce a marked decrease in cell viability compared to the control (Hep G2 cells) in a dose-dependent manner. The IC50 value of Se-HTNPs was 61.29 ± 1.12 µg/mL. Diethylnitrosamine-induced hepatocellular carcinoma is considered the most appropriate experimental model because it mimics the characteristics of liver cancer [ 1 ]. The liver, the body's largest gland, and a vital organ, plays a crucial role in maintaining physiological functions. Hepatocyte injury leads to increased ALT, AST, and ALP activity, with these enzymes leaking into the bloodstream, which is common in liver diseases. Therefore, elevated serum levels of AST, ALT, and ALP activities indicate the severity of liver injury [ 1 ]. Furthermore, Kumar et al. reported that in cases of diethylnitrosamine-induced hepatocellular carcinoma, serum albumin levels decrease while bilirubin levels increase [ 42 ]. Consistent with previous studies [ 3 ] [ 43 ], our findings showed that the oral administration of DEN significantly elevated the enzyme activities of ALT, AST, ALP, and total bilirubin levels. In contrast, serum albumin and total protein levels were significantly decreased compared to the control group. These elevated enzyme levels and changes in the other liver function tests indicate necrotic and inflammatory conditions in hepatocytes. Conversely, oral administration of Se-HTNPs had a significant therapeutic effect in treating hepatocellular carcinoma induced by diethylnitrosamine. The therapeutic effect on the liver was verified by reducing the activities of the serum transaminases (ALT and AST), ALP, and bilirubin levels and increasing the levels of albumin and total proteins compared to the DEN group. This improvement in liver function tests may be due to Se-HTNPs administration promoting the regeneration of parenchymal hepatocytes, maintaining cell membranes, and decreasing the leakage of hepatic enzymes. The results of the current study are consistent with those of Fang et al., who reported that hydroxytyrosol significantly reduced ALT and AST activities in liver damage induced by ethanol [ 25 ]. Reactive oxygen species (ROS) are produced by highly reactive, toxic, and mutagenic exogenous or endogenous sources. Toxic substances generated by lipid peroxidation, such as malondialdehyde (MDA), cause mutagenicity and carcinogenesis by damaging DNA [ 11 ]. Additionally, MDA increases the permeability of cell membranes, disrupting ion exchange across the membrane. Consequently, the intracellular ion balance is disturbed, inhibiting enzyme activity [ 44 ]. Antioxidants exhibit various biological activities, including inducing drug-metabolizing enzymes, inhibiting prostaglandin synthesis, preventing carcinogenesis, and scavenging free radicals [ 45 ]. Antioxidants can protect membranes from ROS toxicity by inhibiting ROS production, promoting ROS-induced repair, and providing cofactors necessary for the efficient function of other antioxidants [ 46 ]. The antioxidant system's first line of defense against oxidative damage caused by superoxide radicals is superoxide dismutase (SOD) [ 47 ]. SOD enzymes catalyze the conversion of superoxide radicals into hydrogen peroxide and water. Liver tissues are rich in reduced glutathione (GSH), a non-protein cellular thiol that protects cells from the damaging effects of free radicals. GSH acts as a major antioxidant due to its ability to neutralize reactive oxygen species [ 48 ]. The results in this study showed that in the DEN group, the hepatic lipid peroxidation level (MDA) significantly increased, accompanied by a significant decrease in antioxidant status (GSH and SOD) compared to the control group. Furthermore, the study showed that ROS generated by DEN administration depletes the TAC by targeting antioxidant molecules during the ROS neutralization process. These findings confirm that DEN administration induces oxidative stress in liver tissues. Consistent with previous studies, DEN has been shown to elevate MDA levels and total oxidative stress while reducing antioxidant capacity in blood and hepatic tissues [ 3 ] [ 11 ]. In contrast, our results revealed that Se-HTNPs-administered rats exhibited a significant decrease in lipid peroxidation level (MDA) with a concurrent significant increase in antioxidant marker levels (GSH, SOD, and TAC) compared with DEN-administered rats. These results suggest that Se-HTNPs protect hepatocytes from injury caused by diethylnitrosamine through their antioxidant activity against lipid peroxidation. Notably, Se-HTNPs restored SOD activity and TAC levels to values comparable to the control group. Supporting our findings, Bertelli et al. reported that hydroxytyrosol possesses potent antioxidant activity among olive phenols due to its ability to form stable hydrogen bonds with phenoxyl radicals and donate electrons via hydroxyl groups. Moreover, the antioxidant effect of hydroxytyrosol is attributed not only to its capacity to scavenge oxidative chemical species but also to its ability to enhance the activity and production of antioxidant enzymes [ 23 ]. Liver carcinogenesis and its progression are closely associated with chronic inflammation. Most pro-inflammatory cytokines and their ligands also induce immunosuppression, contributing to the growth of HCC [ 1 ]. Liver cancer develops from a single normal cell through the accumulation of multiple genetic mutations and the induction of inflammatory mediators [ 49 ]. The activation of Kupffer cells, stellate cells, and sinusoidal endothelial cells leads to the production of pro-inflammatory cytokines, which stimulate and drive pathological processes in the liver [ 50 ]. Among these, the pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 are mediators of hepatic tissue inflammation. Consequently, reducing inflammation is considered one of the primary challenges in treating tumors. The current results revealed that DEN-administered rats exhibited a significant increase in the pro-inflammatory mediators (TNFα, IL-6, and IL-1β) levels compared to the control group. Consistent with earlier studies, DEN and its metabolites have been shown to stimulate liver cells to produce more pro-inflammatory cytokines, including TNF-α, IL-6, and IL-1β [ 51 ] [ 1 ]. These findings align with our results. Pro-inflammatory cytokines induce and amplify necrotic and apoptotic cascades in liver tissues. Moreover, DEN inhibits the production of anti-inflammatory cytokines such as IL-10, IL-4, IL-2, and IL-13 [ 52 ]. Furthermore, the current findings are in agreement with those of Mohamed et al., who found that DEN leads to ROS production, which activates the NF-κB transcription factor. NF-κB activation leads to increased gene expression of pro-inflammatory cytokines [ 53 ]. Interestingly, treatment with Se-HTNPs significantly reduced the levels of the investigated pro-inflammatory cytokines (TNFα, IL-6, and IL-1β) in the liver tissues compared to the DEN group, restoring IL-6 and IL-1β to those of the control group. This anti-inflammatory effect of Se-HTNPs can be attributed to their antioxidant activity, as oxidative stress is a primary driver of inflammatory responses. Consistent with our findings, a previous study demonstrated that hydroxytyrosol inhibits inflammatory mediators such as TNF-α and IL-1β in lipopolysaccharide-stimulated microglia. [ 54 ]. Additional research has shown that hydroxytyrosol exhibits anti-inflammatory effects at nutritionally appropriate levels by inhibiting the production and activity of the enzyme COX-2 in activated human monocytes [ 55 ]. Furthermore, as demonstrated in animal models, hydroxytyrosol increases anti-inflammatory effects by reducing pro-inflammatory cytokines, including TNF-α and IL-6 [ 56 ]. NF-κB is one of several factors that lead to human disorders, including malignancies. Cancer is strongly associated with inflammation, which relies on the reciprocal activation of NF‐κB and inflammatory cytokines. Therapeutic-induced NF‐κB activation can diminish the effectiveness of anticancer treatments [ 57 ]. NF‐κB proteins play a central role in regulating inflammation, emphasizing their involvement in the body's intricate defense mechanisms [ 58 ]. The expression of various genes linked to essential activities, such as pro-inflammatory cytokines and chemokines, can be positively or negatively regulated to control inflammation. For example, tumor necrosis factor-alpha and IL-1β are potent activators of NF‐κB [ 59 ]. NF-κB significantly influences multiple cancers, including HCC. Previous research has highlighted that targeting NF‐κB-mediated signaling pathways, either directly or indirectly, is a viable approach to improving treatment outcomes for HCC patients [ 60 ]. NF‐κB regulates the expression of genes encoding proteins involved in critical processes such as invasion, apoptosis, inflammation, metastasis, angiogenesis, chemoresistance, and radioresistance [ 57 ]. Consequently, we also examined how Se-HTNPs affected the NF‐κB-regulated gene products, such as VEGF, that contributed to tumor angiogenesis [ 61 ]. Our results revealed that DEN-administered rats significantly increased NF-κB mRNA gene expression and hepatic VEGF levels compared to the control group. Consistent with our findings, a recent study [ 62 ] also demonstrated that diethylnitrosamine significantly increases the expression of NF-κB in rat hepatocellular carcinoma models. Conversely, treatment with Se-HTNPs significantly suppressed NF‐κB mRNA gene expression and reduced hepatic VEGF levels compared to the DEN group. Remarkably, Se-HTNPs restored NF-κB mRNA expression to levels comparable to the control group. Qin et al. demonstrated that the production of ROS mediates the activation of transcription factor NF-κB [ 63 ]. This activation subsequently increases pro-inflammatory cytokine levels. Our result indicated that Se-HTNPs can suppress the pathway of NF-κB, which is a critical pathway for oxidative stress and inflammation. Hydroxytyrosol has previously been shown to exert additional effects, such as reducing the expression of the epidermal growth factor receptor (EGFR) in colon cancer cells [ 64 ]. In this study, the effect of Se-HTNPs on HCC may be due to its inhibitory effect on the ROS-mediated NF‐κB pathway. As reported by Z. Wang et al., hepatocyte survival and apoptosis are regulated through pathways such as IL-6/NF-κB, TNF-α/NF-κB, and IL-8/JAK1 [ 3 ]. Thus, we further investigated the influence of Se-HTNPs on the apoptosis of hepatic cells in the HCC rat model. Apoptosis is a process of programmed cell death essential to tissue homeostasis and cell development in multicellular organisms. In malignant transformations of cells, such as HCC, defective apoptosis is a critical phase during which apoptosis is reduced compared to normal hepatic tissues. It is crucial for cytotoxicity caused by chemotherapy drugs [ 65 ]. p53 is a potent growth-preventing, proapoptotic, and tumor-suppressing gene that plays a significant role in apoptosis by protecting tissues from the onset of cancer [ 66 ]. p53 interacts with Bcl-2 family members and contributes to the intrinsic apoptotic cascades. Furthermore, apoptotic cells exhibit a favorable response to Caspase-3, which is necessary for both external and internal apoptotic signaling pathways. Therefore, caspase-3 is essential for identifying morphologically apoptotic cells and detecting and assessing cells undergoing apoptosis [ 11 ]. Our results revealed that the liver tissue apoptotic markers (p53 and caspase 3) significantly increased in the DEN group compared to the control group. In agreement with our findings, previous studies have shown that rats with HCC induced by DEN exhibited elevated levels of apoptotic caspase-3 and p53 [ 3 ] [ 11 ]. Proapoptotic proteins like caspases and p53 are activated by oxidative stress conditions brought on by the increase in ROS and the resulting DNA damage. Treatment with Se-HTNPs significantly decreased p53 and caspase-3 levels in hepatic tissues compared to DEN-administered rats. These findings suggest that Se-HTNPs are a potent hepatic defense agent with anti-apoptotic properties. Similarly, Costantini et al. reported a dose-dependent increase in the intrinsic apoptotic pathway in hydroxytyrosol-treated melanoma cells, accompanied by the downregulation of survival proteins like PARP and AKT and the activation of proapoptotic proteins like p53, caspases-9, and caspases-3 [ 31 ]. Indeed, the production and stimulation of p53 significantly increase under stress conditions associated with chromosomal abnormalities or DNA damage, enhancing its capacity to regulate the expression of genes and cell survival. c-Jun N-terminal kinase (c-JNK) is a mitogen-activated protein kinase that controls biological processes, such as inflammation, autophagy, apoptosis, and cell division [ 67 ]. c-JNK is considered stress-activated protein kinases since their activity responds to pro-inflammatory cytokine-induced cellular stress. Therefore, we determined the c-JNK mRNA gene expression level as a biomarker of apoptosis and inflammatory conditions. Currently, c-JNK is regarded as a promising therapeutic target for various illnesses. JNK pathway inhibitors offer a promising future therapeutic option in the context of diseases, with several of them registered in preclinical and clinical trials as potential treatments for depression [ 68 ], diabetes [ 69 ], and cancer [ 70 ]. In the present study, DEN-administered rats showed a significant increase in c-JNK mRNA gene expression level compared to the control group. In line with our findings, Zeng et al. demonstrated that the c-JNK level was elevated in the serum of DEN-challenged animals compared to the control [ 1 ]. An essential aspect of the JNK cascade is its crucial role in cancer cell resistance to chemotherapy. Previous research demonstrated that JNK can worsen liver cancer by inhibiting apoptosis in cancer cells, which is affected by the inactivation of p53 [ 71 ]. Conversely, treatment with Se-HTNPs significantly suppressed the level of c-JNK mRNA gene expression compared to the DEN-administered group. A previous study [ 72 ] revealed that reactive oxygen species (ROS) formation activates the mitogen-activated protein kinase (MAPK) and the c-JNK N-terminal kinase (JNK). Therefore, we suggest that the suppression effect of Se-HTNPs on the c-JNK mRNA gene expression levels may be due to its potent ability to suppress ROS. Histopathological examination of liver tissue validated the biochemical results in this study. In agreement with previous studies [ 1 ] [ 11 ], our histological analysis of liver tissue from the DEN group revealed polyhedral to round neoplastic cells with dense, centrally located vesicular nuclei and multinucleated tumor giant cells. The carcinoma cells were arranged in a trabecular pattern with numerous numbers of clear cells with foamy cytoplasm, hyperplasia of the bile duct with the formation of bile ductules, and focal aggregation of mononuclear cells. Remarkably, treatment with Se-HTNPs ameliorated these histological alterations caused by DEN. In conclusion, to the best of our knowledge, this is the first study to report the therapeutic effects of Se-HTNPs against diethylnitrosamine (DEN)-induced hepatocellular carcinoma (HCC) in a rat model. The therapeutic effects of Se-HTNPs were confirmed by inhibiting liver enzymes and reducing oxidative stress and inflammatory markers in DEN-administered rats. Furthermore, Se-HTNPs suppressed hepatic apoptosis, c-JNK mRNA, and NF-κB mRNA gene expression. Additionally, Se-HTNP treatment significantly ameliorated the histological alterations induced by DEN. These findings suggest that Se-HTNPs mitigate DEN-induced HCC in rats through their potent antioxidant, anti-inflammatory, and anti-carcinogenic properties. Abbreviations ALP: alkaline phosphatase ALT: alanine aminotransferase AST: aspartate aminotransferase c-JNK: c-JNK N-terminal kinase DEN: diethylnitrosamine DLS: Dynamic light scattering FTIR: Fourier-transform infrared spectroscopy GSH: reduced glutathione HCC: hepatocellular carcinoma Hep G2: human liver cancer cell line. IL-1β: interleukin-1 beta IL-6: interleukin-6 LD50: median lethal dose MDA: malondialdehyde NF-κB: Nuclear factor kappa-light-chain-enhancer of activated B cells RNS: reactive nitrogen species ROS: reactive oxygen species Se-HTNPs: selenium-hydroxytyrosol nanoparticles SOD: superoxide dismutase TAC: total antioxidant capacity TEM: Transmission electron microscopy TNF-α: tumor necrosis factor-α VEGF: vascular endothelial growth factor Declarations Author contributions Radwa T.M. Tawfik : data curation, methodology, formal analysis. Eman M. Abdel-Azim : conceptualization, supervision, Sawsan M. Elsonbaty : conceptualization, supervision, methodology. Ehab A. Ibrahim: conceptualization, supervision, writing original draft, Writing-review & editing. All authors approved the final version of the manuscript. Funding The authors did not receive support from any organization for the submitted work. Availability of data The data used in this study are included in this published article and are available from the corresponding author upon reasonable request. Ethics Approval All animal procedures were carried out following the NIH (National Research Council) Guide for the Care and Use of Laboratory Animals. The research protocol was approved by the Research Ethics Committee in the National Center for Radiation Research and Technology (REC-NCRRT, serial number of the protocol: 33A/23). Competing interests The author(s) declared no potential conflicts of interest concerning the research, authorship, and/or publication of this article. Acknowledgments For our assistance in the development of histopathology, we thank Prof. Dr. Ahmed Osman, professor of Pathology, Faculty of Veterinary Medicine, Cairo University. References Zeng X, Liu H, Huang Z et al (2022) Anticancer effect of arbutin on diethylnitrosamine-induced liver carcinoma in rats via the GRP and GADD pathway. J Environ Pathol Toxicol Oncol 41 Lindemann J, Doyle MBM (2024) Expanding the Boundaries for Liver Transplantation for Hepatocellular Carcinoma. Surg Clin 104:129–143 Wang Z, Jiang X, Zhang L, Chen H (2023) Protective effects of Althaea officinalis L. extract against N-diethylnitrosamine‐induced hepatocellular carcinoma in male Wistar rats through antioxidative, anti‐inflammatory, mitochondrial apoptosis and PI3K/Akt/mTOR signaling pathways. Food Sci Nutr Wang M-D, Diao Y-K, Yao L-Q et al (2024) Emerging role of molecular diagnosis and personalized therapy for hepatocellular carcinoma. iLIVER 100083 Pessino G, Scotti C, Maggi M, Consortium I-H (2024) Hepatocellular Carcinoma: Old and Emerging Therapeutic Targets. Cancers (Basel) 16:901 Zhang S, Ma J, Yu T et al (2024) circ_HMGCS1 modulates hepatocellular carcinoma chemoresistance via miR-338‐5p/IL‐7 pathway. J Cell Mol Med 28:e18137 Gavas S, Quazi S, Karpiński TM (2021) Nanoparticles for cancer therapy: current progress and challenges. Nanoscale Res Lett 16:173 Kashyap BK, Singh VV, Solanki MK et al (2023) Smart nanomaterials in cancer theranostics: challenges and opportunities. ACS omega 8:14290–14320 Ma P, Wang G, Men K et al (2024) Advances in clinical application of nanoparticle-based therapy for cancer treatment: a systematic review. Nano TransMed 100036 Janmeda P, Jain D, Chaudhary P et al (2024) A systematic review on multipotent carcinogenic agent, N-nitrosodiethylamine (NDEA), its major risk assessment, and precautions. J Appl Toxicol Keleş ÖF, Huyut Z, Arslan M et al (2024) Antitumor activity of Urtica dioica seed extract on diethylnitrosamine-induced liver carcinogenesis in rats. Indian J Biochem Biophys 61:16–31 Schulien I, Hasselblatt P (2021) Diethylnitrosamine-induced liver tumorigenesis in mice. Methods Cell Biol 163:137–152 Renaudin X (2021) Reactive oxygen species and DNA damage response in cancer. Int Rev Cell Mol Biol 364:139–161 Wang Y, Wang M, Liu C et al (2023) Hepatoprotective effects of aspirin on diethylnitrosamine-induced hepatocellular carcinoma in rats by reducing inflammation levels and PD-L1 expression. Sci Rep 13:21362 del Castillo Busto ME, Ward-Deitrich C, Evans SO et al (2024) Selenium speciation studies in cancer patients to evaluate the responses of biomarkers of selenium status to different selenium compounds. Anal Bioanal Chem 1–14 Zhang F, Li X, Wei Y (2023) Selenium and selenoproteins in health. Biomolecules 13:799 Genchi G, Lauria G, Catalano A et al (2023) Biological activity of selenium and its impact on human health. Int J Mol Sci 24:2633 Au A, Mojadadi A, Shao J-Y et al (2023) Physiological benefits of novel selenium delivery via nanoparticles. Int J Mol Sci 24:6068 Abdel-Rasoul AA, Saleh NA, Hosny EN et al (2023) Cardamom oil ameliorates behavioral and neuropathological disorders in a rat model of depression induced by reserpine. J Ethnopharmacol 308:116254 Liu W, Wang Y, Xia L, Li J (2024) Research Progress of Plant-Derived Natural Products against Drug-Resistant Cancer. Nutrients 16:797 Gonçalves M, Aiello A, Rodríguez-Pérez M et al (2024) Olive Oil Components as Novel Antioxidants in Neuroblastoma Treatment: Exploring the Therapeutic Potential of Oleuropein and Hydroxytyrosol. Nutrients 16:818 Monteiro M, Silva AFR, Resende D et al (2021) Strategies to broaden the applications of olive biophenols oleuropein and hydroxytyrosol in food products. Antioxidants 10:444 Bertelli M, Kiani AK, Paolacci S et al (2020) Hydroxytyrosol: A natural compound with promising pharmacological activities. J Biotechnol 309:29–33 Vlavcheski F, Young M, Tsiani E (2019) Antidiabetic effects of hydroxytyrosol: In vitro and in vivo evidence. Antioxidants 8:188 Fang X, Cao J, Tao Z et al (2023) Hydroxytyrosol attenuates ethanol-induced liver injury by ameliorating steatosis, oxidative stress and hepatic inflammation by interfering STAT3/iNOS pathway. Redox Rep 28:2187564 Gallardo-Fernández M, Hornedo-Ortega R, Cerezo AB et al (2023) Hydroxytyrosol and dopamine metabolites: Anti-aggregative effect and neuroprotective activity against α-synuclein-induced toxicity. Food Chem Toxicol 171:113542 Noguera-Navarro C, Montoro-García S, Orenes-Piñero E (2023) Hydroxytyrosol: Its role in the prevention of cardiovascular diseases. Heliyon 9 Li S, Shao H, Sun T et al (2024) Anti-neuroinflammatory effect of hydroxytyrosol: a potential strategy for anti-depressant development. Front Pharmacol 15:1366683 Parra-Perez AM, Pérez-Jiménez A, Gris-Cárdenas I et al (2022) Involvement of the PI3K/AKT intracellular signaling pathway in the anticancer activity of hydroxytyrosol, a polyphenol from Olea europaea, in hematological cells and implication of HSP60 levels in its anti-inflammatory activity. Int J Mol Sci 23:7053 Garcia-Guasch M, Escrich E, Moral R, Duarte IF (2023) Metabolomics insights into the differential response of breast cancer cells to the phenolic compounds Hydroxytyrosol and Luteolin. Molecules 28:3886 Costantini F, Di Sano C, Barbieri G (2020) The hydroxytyrosol induces the death for apoptosis of human melanoma cells. Int J Mol Sci 21:8074 Li D, Liu Z, Yuan Y et al (2015) Green synthesis of gallic acid-coated silver nanoparticles with high antimicrobial activity and low cytotoxicity to normal cells. Process Biochem 50:357–366 Montes-Burgos I, Walczyk D, Hole P et al (2010) Characterisation of nanoparticle size and state prior to nanotoxicological studies. J Nanoparticle Res 12:47–53 Wang H, Cheng H, Wang F et al (2010) An improved 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) reduction assay for evaluating the viability of Escherichia coli cells. J Microbiol Methods 82:330–333 Feng J, Gao H, Yang L et al (2022) Renoprotective and hepatoprotective activity of Lepidium draba L. extracts on oxymetholone-induced oxidative stress in rat. J Food Biochem 46:e14250 Chattopadhyay S, Pal S, Ghosh D, Debnath J (2003) Effect of dietary co-administration of sodium selenite on sodium arsenite-induced ovarian and uterine disorders in mature albino rats. Toxicol Sci 75:412–422 Al Fazazi S, Casuso RA, Aragón-Vela J et al (2018) Effects of hydroxytyrosol dose on the redox status of exercised rats: The role of hydroxytyrosol in exercise performance. J Int Soc Sports Nutr 15:1–7 Darwish HA, EL-BOGHDADY NA (2013) Possible involvement of oxidative stress in diethylnitrosamine‐induced hepatocarcinogenesis: chemopreventive effect of curcumin. J Food Biochem 37:353–361 Cardiff RD, Miller CH, Munn RJ (2014) Manual hematoxylin and eosin staining of mouse tissue sections. Cold Spring Harb Protoc 2014:pdb-prot073411 Ganesan P, Kulik LM (2023) Hepatocellular carcinoma: new developments. Clin Liver Dis 27:85–102 Hsiao C-Y, Ho C-M, Ho M-C et al (2024) Risk factors, patterns, and outcome predictors of late recurrence in patients with hepatocellular carcinoma after curative resection: A large cohort study with long-term follow-up results. Surgery Kumar A, Naithani M, Kumar N et al (2022) Piperlongumine inhibits diethylnitrosamine induced hepatocellular carcinoma in rats. Hum Exp Toxicol 41:09603271211073593 Tamim YM, Nagy AA, Abdellah AM et al (2024) Anticancer effect of propranolol on diethylnitrosamine-induced hepatocellular carcinoma rat model. Fundam Clin Pharmacol Chen X, Shang S, Yan F et al (2023) Antioxidant Activities of Essential Oils and Their Major Components in Scavenging Free Radicals, Inhibiting Lipid Oxidation and Reducing Cellular Oxidative Stress. Molecules 28:4559 Muchtaridi M, Az-Zahra F, Wongso H et al (2024) Molecular Mechanism of Natural Food Antioxidants to Regulate ROS in Treating Cancer: A Review. Antioxidants 13:207 Sachdev S, Ansari SA, Ansari MI (2023) Antioxidant defensive mechanisms to regulate cellular redox homeostatic balance. Reactive Oxygen Species in Plants: The Right Balance. Springer, pp 143–172 Jomova K, Alomar SY, Alwasel SH et al (2024) Several lines of antioxidant defense against oxidative stress: antioxidant enzymes, nanomaterials with multiple enzyme-mimicking activities, and low-molecular-weight antioxidants. Arch Toxicol 1–45 Pradhan P, Majhi O, Biswas A et al (2020) Enhanced accumulation of reduced glutathione by Scopoletin improves survivability of dopaminergic neurons in Parkinson’s model. Cell Death Dis 11:739. https://doi.org/10.1038/s41419-020-02942-8 Nigam M, Mishra AP, Deb VK et al (2023) Evaluation of the association of chronic inflammation and cancer: Insights and implications. Biomed Pharmacother 164:115015 Li X, Li C, Zhang W et al (2023) Inflammation and aging: signaling pathways and intervention therapies. Signal Transduct Target Ther 8:239 Zhang Y, Li X, Li X (2021) Curcumae ameliorates diethylnitrosamine-induced hepatocellular carcinoma via alteration of oxidative stress, inflammation and gut microbiota. J Inflamm Res 5551–5566 Chen N, Nishio N, Ito S et al (2015) Growth arrest and DNA damage-inducible protein (GADD34) enhanced liver inflammation and tumorigenesis in a diethylnitrosamine (DEN)-treated murine model. Cancer Immunol Immunother 64:777–789 Mohamed EE, Ahmed OM, Zoheir KMA et al (2023) Naringin–Dextrin Nanocomposite Abates Diethylnitrosamine/Acetylaminofluorene-Induced Lung Carcinogenesis by Modulating Oxidative Stress, Inflammation, Apoptosis, and Cell Proliferation. Cancers (Basel) 15:5102 Zhang L, Zhang J, Jiang X et al (2020) Hydroxytyrosol inhibits LPS-induced neuroinflammatory responses via suppression of TLR-4-mediated NF-κB P65 activation and ERK signaling pathway. Neuroscience 426:189–200 Scoditti E, Nestola A, Massaro M et al (2014) Hydroxytyrosol suppresses MMP-9 and COX-2 activity and expression in activated human monocytes via PKCα and PKCβ1 inhibition. Atherosclerosis 232:17–24 Wang Q, Wang C, Abdullah et al (2022) Hydroxytyrosol alleviates dextran sulfate sodium-induced colitis by modulating inflammatory responses, intestinal barrier, and microbiome. J Agric Food Chem 70:2241–2252 Almowallad S, Alqahtani LS, Mobashir M (2022) NF-kB in signaling patterns and its temporal dynamics encode/decode human diseases. Life 12:2012 Mollaei M, Abbasi A, Hassan ZM, Pakravan N (2020) The intrinsic and extrinsic elements regulating inflammation. Life Sci 260:118258 Kaye AD, Perilloux DM, Hawkins AM et al (2024) Tumor Necrosis Factor and Interleukin Modulators for Pathologic Pain States: A Narrative Review. Pain Ther 1–13 Kurden-Pekmezci A, Cakiroglu E, Eris S et al (2023) MALT1 paracaspase is overexpressed in hepatocellular carcinoma and promotes cancer cell survival and growth. Life Sci 323:121690 Shaw P, Dwivedi SKD, Bhattacharya R et al (2024) VEGF signaling: Role in angiogenesis and beyond. Biochim Biophys Acta (BBA)-Reviews. Cancer 189079 Lin R, Xie S, Xu F et al (2024) Improvement of rat hepatocellular carcinoma model induced by diethylnitrosamine. Tissue Cell 86:102261 Qin Y, Song D, Liao S et al (2023) Isosinensetin alleviates estrogen deficiency-induced osteoporosis via suppressing ROS-mediated NF-κB/MAPK signaling pathways. Biomed Pharmacother 160:114347 Terzuoli E, Giachetti A, Ziche M, Donnini S (2016) Hydroxytyrosol, a product from olive oil, reduces colon cancer growth by enhancing epidermal growth factor receptor degradation. Mol Nutr Food Res 60:519–529 Li Y, Zhu J, Yu Z et al (2023) Regulation of apoptosis by ubiquitination in liver cancer. Am J Cancer Res 13:4832 Choudhary HB, Mandlik SK, Mandlik DS (2023) Role of p53 suppression in the pathogenesis of hepatocellular carcinoma. World J Gastrointest Pathophysiol 14:46 Chen J, Ye C, Wan C et al (2021) The roles of c-jun N-terminal kinase (JNK) in infectious diseases. Int J Mol Sci 22:9640 Hollos P, Marchisella F, Coffey ET (2018) JNK regulation of depression and anxiety. Brain Plast 3:145–155 Yung JHM, Giacca A (2020) Role of c-Jun N-terminal kinase (JNK) in obesity and type 2 diabetes. Cells 9:706 Wu Q, Wu W, Jacevic V et al (2020) Selective inhibitors for JNK signalling: a potential targeted therapy in cancer. J Enzyme Inhib Med Chem 35:574–583 Cao H, Chen X, Wang Z et al (2020) The role of MDM2–p53 axis dysfunction in the hepatocellular carcinoma transformation. Cell Death Discov 6:53 Averill-Bates D (2023) Reactive oxygen species and cell signaling. Rev Biochim Biophys Acta (BBA)-Molecular Cell Res 119573 Tables Tables 3 to 6 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Table3to6.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5726485","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":395843206,"identity":"925dfe17-7169-439e-b1ff-401b95da6696","order_by":0,"name":"Radwa T.M. Tawfik","email":"","orcid":"","institution":"Ain Shams University","correspondingAuthor":false,"prefix":"","firstName":"Radwa","middleName":"T.M.","lastName":"Tawfik","suffix":""},{"id":395843209,"identity":"c60693ee-ee37-49bd-9791-f04d179bdbb4","order_by":1,"name":"Eman M. Abd El-Azeem","email":"","orcid":"","institution":"Ain Shams University","correspondingAuthor":false,"prefix":"","firstName":"Eman","middleName":"M. Abd","lastName":"El-Azeem","suffix":""},{"id":395843212,"identity":"1696f119-dc5d-4029-afac-2550820b3e91","order_by":2,"name":"Sawsan M. Elsonbaty","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCUlEQVRIiWNgGAWjYBADGSBmAzHkQMSBB0Ro4YFoSWAwBmtJIEVLYgOIi0+LfPsZ4w8/d9jwyLf3Hnvw88fh9Plhhx8CbbGT023ArsXgTI6ZZO+ZNB6DM+fSDXsSDuduvJ1mANSSbGx2AIcWhtxtDLxth3kMJHLMJHhAWmYngLQcSNyGQ4t8/9vNH/+2/eeRnwG07k/C4XTD2ekf8GphuJG7QZq37QAPw40cM2mgLQny0jn4bTG48f6btGxbMtAvZ8yNZdLSDTdI5xQcSDDA7Rf5/rTkj2/b7OTk23vMHr6xsZaXn52++cOHCjs5XFrQQTODwQFIsBAN6hjkG4hXPQpGwSgYBSMDAADWQmM5Ibrp2gAAAABJRU5ErkJggg==","orcid":"","institution":"National Center for Radiation Research and Technology, Atomic Energy Authority","correspondingAuthor":true,"prefix":"","firstName":"Sawsan","middleName":"M.","lastName":"Elsonbaty","suffix":""},{"id":395843213,"identity":"47b4b312-cf46-458f-a35f-66551f740974","order_by":3,"name":"Ehab A. Ibrahim","email":"","orcid":"","institution":"Ain Shams University","correspondingAuthor":false,"prefix":"","firstName":"Ehab","middleName":"A.","lastName":"Ibrahim","suffix":""}],"badges":[],"createdAt":"2024-12-28 13:53:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5726485/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5726485/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":72737907,"identity":"5860c9f7-311a-43be-ab7d-0d0c30a33363","added_by":"auto","created_at":"2025-01-01 08:59:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":99562,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic diagram of experimental design\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/23665d6d6f7c96b11379b73e.png"},{"id":72737930,"identity":"ed6595b7-aeed-4eca-b5ae-13fa347071cb","added_by":"auto","created_at":"2025-01-01 08:59:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":279168,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterizations of the synthesized Se-HTNPs. (a) Dynamic light scattering analysis. (b) UV-absorption spectrum. (c) Transmission electron microscope image. (d) FT-IR spectrum\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/2eb2cd09ef244036740dbc76.png"},{"id":72737909,"identity":"6fa1c7f0-a925-41e8-ad9f-d5966896f9e5","added_by":"auto","created_at":"2025-01-01 08:59:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":77604,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCytotoxic effect of Se-HTNPs on Hep G2 cell line\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/09ce059afbc265d956cfc047.png"},{"id":72738150,"identity":"8c51901f-c06c-4ab4-9478-770435563891","added_by":"auto","created_at":"2025-01-01 09:07:28","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":44328,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLevels of C-JNK mRNA gene expression (a) and NF-KB mRNA gene expression (b) in all studied groups. \u003c/strong\u003eData are expressed as mean ± SD. Differences between groups were analyzed using a one-way analysis of variance (ANOVA), followed by Tukey's post hoc test. a: P ≤ 0.05 was considered statistically significant compared to the control group. b: P ≤ 0.05 was considered statistically significant compared to the DEN group. Se-HTNPs = selenium hydroxytyrosol nanoparticles; DEN = diethylnitrosamine.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/89c09dbae682a4839626a975.png"},{"id":72738746,"identity":"8ffd0316-8a78-423b-8822-122b32f60f9c","added_by":"auto","created_at":"2025-01-01 09:15:27","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":434492,"visible":true,"origin":"","legend":"\u003cp\u003ePhotomicrograph of hepatic tissue sections of groups 1, 2, 3, and 4 showing a normal histological structure of hepatic lobule arrows (H\u0026amp;E X200).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/5cebbc28f54fb92d908eebdb.png"},{"id":72737953,"identity":"2e982d42-4058-4ff2-b7cf-03db84a66095","added_by":"auto","created_at":"2025-01-01 08:59:28","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":688931,"visible":true,"origin":"","legend":"\u003cp\u003ePhotomicrograph of a hepatic tissue section of group 5 showing: (a) polyhedral to round neoplastic cells with dense, centrally located vesicular nuclei and multinucleated tumor giant cells arrow (b) Carcinoma cells arranged in a trabecular pattern with numerous numbers of clear cells with foamy cytoplasm arrow (c) Hyperplasia of bile duct with the formation of bile ductules and focal aggregation of mononuclear cells arrow (H\u0026amp;E X200).\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/745dcf70f5dec54ff41cc21d.png"},{"id":72737920,"identity":"db8b6445-b405-4751-ac71-3cd880e574fc","added_by":"auto","created_at":"2025-01-01 08:59:26","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":653144,"visible":true,"origin":"","legend":"\u003cp\u003ePhotomicrograph of a hepatic tissue section of group 6 showing: (a) Disorganization of hepatic plates and vacuolation of hepatocytes arrow (b) frequent number of apoptotic bodies and hyperplasia of Kupffer cells arrow (c) numerous numbers of pyknotic nuclei arrow (H\u0026amp;E X200).\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/2cfa79b6130c72f5f4f1b916.png"},{"id":72737928,"identity":"2c19ca0c-f99a-4aaf-8da6-301034c78fc1","added_by":"auto","created_at":"2025-01-01 08:59:27","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":638306,"visible":true,"origin":"","legend":"\u003cp\u003ePhotomicrograph of a hepatic tissue section of group 7 showing: (a) cellular swelling, anisokaryosis, and anisocytosis arrow (b) Hyperplasia of bile with intraluminal cellular casts arrow (c) Pleomorphism of nuclei with peripheral condensation of its chromatin arrow (H\u0026amp;E X200).\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/e12a822abf20891bc1c9857f.png"},{"id":72738743,"identity":"163d6329-5fd2-48ba-92d2-86638529ee77","added_by":"auto","created_at":"2025-01-01 09:15:27","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":599730,"visible":true,"origin":"","legend":"\u003cp\u003ePhotomicrograph of a hepatic tissue section of group 8 showing: (a) vacuolation of hepatocytes, nuclear pyknosis, and clear cytoplasm arrow (b) apoptosis of tumor cells scattered as eosinophilic bodies arrow (c) Binucleation of hepatocytes and hyperplasia of Kupffer cells arrow (H\u0026amp;E X200).\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/237bd7bfb7e27ac78cb8656f.png"},{"id":73223842,"identity":"1eec1cd3-fa48-4c99-80a7-347e58a130f7","added_by":"auto","created_at":"2025-01-08 02:01:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4074870,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/552c5200-02de-4c41-b5e8-e8ef9dcad98b.pdf"},{"id":72737904,"identity":"fb55e3fc-c4d7-4b4a-a00f-8efda59dfa12","added_by":"auto","created_at":"2025-01-01 08:59:25","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":21196,"visible":true,"origin":"","legend":"","description":"","filename":"Table3to6.docx","url":"https://assets-eu.researchsquare.com/files/rs-5726485/v1/03b1e712a5569c5843c5f91e.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Biosynthesized Selenium-hydroxytyrosol nanoparticles attenuate hepatocellular carcinoma in rats ","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eOne of the most dangerous and fatal diseases in the world is cancer. According to estimates by the World Health Organization, cancer causes the death of 9.6\u0026nbsp;million people worldwide each year, and its incidence has sharply increased globally [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The prevalence of liver cancer is rising worldwide, and according to estimates from the International Agency for Research on Cancer, the total number of liver cancer cases will increase by more than one million each year by 2025 [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Approximately 90% of liver cancer cases are hepatocellular carcinoma (HCC), the most prevalent form of liver cancer [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Hepatocellular carcinoma is one of the most common malignancies in the world and the third largest cause of cancer-related mortality [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Hepatitis viral infections (HBV and HCV), dietary additives, alcohol, fungal toxins (aflatoxins), hazardous industrial chemicals, and environmental exposures (air and water pollution) are the most significant and well-known risk factors for hepatocellular carcinoma [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Additionally, hepatocellular carcinoma occurs due to reactive nitrogen species, reactive oxygen species, and pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) contributing to the tumor microenvironment [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAlthough removal by surgery is a successful treatment for HCC, it cannot be performed on individuals whose tumors have reached an advanced clinical stage. Chemoresistance in HCC therapy makes chemotherapy less successful despite its demonstrated efficacy in treating malignant tumors [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Thus, there is a pressing need for new and efficient therapeutic approaches for HCC.\u003c/p\u003e \u003cp\u003eNanoparticle-based cancer medications have been assessed or used in clinical trials for their usefulness due to the rapid development of nanocomplexes and nanotechnology synthesis processes. The advancement of nanotechnology has led to progress in drug manufacturing, including those related to nanoparticles used in cancer therapy [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Particles of one dimension ranging from 1 to 300 nm are nanoparticles (NPs) and have characteristics based on their size and surface functions. The common characteristics and capacities of nanoparticles include their prolonged circulation duration, therapeutic agent-carrying capability, and ability to penetrate deep tumor tissues due to their molecular structures and particle sizes [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. These benefits have prompted researchers to focus heavily on creating chemotherapeutic drugs involving nanoparticles for cancer treatment [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDiethylnitrosamine (DEN) is a chemical carcinogen used to induce malignancies in the liver, gastrointestinal tract, skin, and respiratory system in different animals [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Diethylnitrosamine disrupts nuclear enzymes related to DNA replication and repair [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. N-nitroso compounds are present in tobacco products, cosmetics, medicinal agents, agricultural chemicals, cheddar cheese, and cured and fried foods (meat, vegetables, and bread). These compounds are recognized as a significant health concern for humans [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Diethylnitrosamine has carcinogenic effects on the liver by producing pro-mutagenic adducts, such as O6-ethyl deoxyguanosine and O4- and O6-ethyl deoxythymidine, following its metabolic activation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The enhanced expression of G1/S-phase regulatory proteins in hepatocytes, including cyclin-dependent kinases, contributes to DEN-induced tumor formation. In addition, the biotransformation of DEN causes hepatocyte DNA damage [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The production of ROS and RNS occurs after the cellular metabolism of diethylnitrosamine. Reactive oxygen species primarily cause DNA damage and tissue injury [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Therefore, one of the most reputable and commonly used experimental models for hepatocarcinogenesis research is the DEN-induced liver cancer model [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAn important and distinctive trace element vital to both health and disease is selenium [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Selenium is incorporated into selenoproteins, primarily as selenocysteine, to perform several physiological tasks within the cells [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The primary focus of selenium and cancer research has been on the chemopreventive properties of selenium. This concept is based on selenium's direct and indirect antioxidant properties, which increase the cells' resistance to oxidative damage [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The most relevant example of an inorganic selenium compound studied as a potential therapeutic agent for cancer treatment is selenite. One common inorganic selenium source used in clinical cancer treatment is sodium selenite. Selenium-containing nanoparticles have recently attracted significant interest as potential cancer therapeutic agents because of their high biological activity and minimal toxicity [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTraditional medicine, which uses natural materials derived from plants, provides the foundation for pharmaceutical products and is essential to the provision of primary healthcare around the world [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e][\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. One of the primary and traditional foods in Mediterranean countries is olive oil. The main naturally occurring phenolic component of olive oil is hydroxytyrosol [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The hydrolysis of oleuropein during the maturation of olive fruit produces hydroxytyrosol [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Even at very high dosages, hydroxytyrosol exhibited no adverse effects in a mouse model, demonstrating its good safety profile. Hydroxytyrosol is a non-mutagenic, non-genotoxic substance suitable for long-term consumption based on toxicological examination and in vitro genotoxicity experiments. Because of these biological features, hydroxytyrosol is now the most extensively researched natural phenol. Due to its safety record, hydroxytyrosol is a highly recommended dietary supplement in the food and nutraceutical industries [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn traditional medicine, hydroxytyrosol is used as an antidiabetic [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], antioxidant [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], anti-inflammatory [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], neuroprotective [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], cardioprotective [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], and antidepressant [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] natural product. Epidemiological studies have revealed that consuming virgin olive oil is strongly associated with lower incidence of numerous forms of cancer, most of which are due to its phenolic anticancer properties [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Additionally, previous studies have demonstrated the antitumor activities of hydroxytyrosol in several cancers, including breast [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], leukemia [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], and melanoma [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Based on this background, our study aimed to evaluate the therapeutic effect of selenium-hydroxytyrosol nanoparticles (Se-HTNPs) on hepatocellular carcinoma induced by diethylnitrosamine in male albino rats and to elucidate its underlying mechanism.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Materials\u003c/h2\u003e \u003cp\u003eDiethylnitrosamine (DEN), sodium selenite, and 3-(4,5-di-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma-Aldrich Corporation (USA). Hydroxytyrosol was purchased from Prohealth Company (China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Preparation of selenium-hydroxytyrosol nanoparticles (Se-HTNPs)\u003c/h2\u003e \u003cp\u003eSelenium-hydroxytyrosol nanocomposite was synthesized from a naturally occurring compound hydroxytyrosol according to the method of Li et al. [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] with slight modifications. First, 2.0 mL of 20 mM hydroxytyrosol was added to 46.0 mL of distilled water and mixed under magnetic stirring at room temperature. Then, 2.0 mL of 10 mM sodium selenite was added dropwise. The solution's pH was quickly raised to 10.0 using 1.0 M NaOH, and the reaction was maintained with magnetic stirring at room temperature for 30 minutes. Centrifugation at 10,000 g for 10 minutes was used to condense and purify the nanoparticles, and they were then washed three times with distilled water.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.3. Characterizations of the synthesized Se-HTNPs\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eDetermining the size and morphology of nanoparticles is crucial for their use in biomedicine and biological applications. The following techniques were used to characterize the synthesized Se-HTNPs:\u003c/p\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.3.1. Dynamic light scattering (DLS)\u003c/h2\u003e \u003cp\u003eA sample of Se-HTNPs was analyzed for size dimensions, distribution, and zeta potential using the DLS Zetasizer Nano ZS (ZEN 3600, Malvern, UK), according to Montes-Burgos et al. [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.3.2. Transmission electron microscopy (TEM)\u003c/h2\u003e \u003cp\u003eThe prepared Se-HTNPs were characterized by transmission electron microscopy (TEM, JEOL JEM-2100, Japan, with an accelerating voltage of 200 kV) to assess their size and morphology. A drop of the prepared suspension was placed on a carbon-coated copper TEM grid and evaporated at room temperature. Characterizations of Se-HTNPs were applied using advanced microscopy technique software and a digital TEM camera, which was adjusted for Se-HTNP size measurements.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.3.3. Ultraviolet-visible absorption (UV/VIS) spectroscopy\u003c/h2\u003e \u003cp\u003eThe ultraviolet-visible spectrum of Se-HTNPs was analyzed using a computerized double-beam ultraviolet-visible spectrophotometer (Cintra 3030, GBC, UK, S.N. v4439).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.3.4. Fourier-transform infrared spectroscopy (FTIR)\u003c/h2\u003e \u003cp\u003eA sample of Se-HTNPs was analyzed for functional groups using the Vertex 70 FT-IR spectrometer (BRUKER), scanned at a wavenumber range of 4000 to 400 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Se-HTNPs cytotoxicity on Hep G2 cell line\u003c/h2\u003e \u003cp\u003eThe cytotoxicity and half maximal inhibitory concentration (IC\u003csub\u003e50\u003c/sub\u003e) of Se-HTNPs were investigated on the viability of the hepatocellular cancer cell line (Hep G2) using the MTT assay (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The assay relies on the ability of the active mitochondrial succinate dehydrogenase enzyme in living cells to cleave the tetrazolium rings of the yellow water-soluble MTT and form purple insoluble formazan crystals. These crystals are impermeable to the cell membrane, resulting in their accumulation within healthy cells. The number of viable cells is directly proportional to the level of soluble formazan. The extent of MTT reduction was determined by measuring the absorbance at 570 nm. The IC₅₀ value was calculated using the dose-response curve equation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.5. LD\u003c/b\u003e\u003csub\u003e\u003cb\u003e50\u003c/b\u003e\u003c/sub\u003e \u003cb\u003e(Lethal Dose) of Se-HTNPs\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eSe-HTNPs were administered orally to 15 male Wistar albino rats (3 rats/group) via gastric gavage at cumulative doses of 10, 100, 500, 1000, and 2000 mg/kg. The rats were observed for 24 hours for signs of toxicity and potential death. We used the following formula to calculate the LD50 [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]:\u003c/p\u003e \u003cp\u003eLD50 = (D\u003csub\u003eh\u003c/sub\u003e X D\u003csub\u003eL\u003c/sub\u003e)\u003csup\u003e1/2\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eD\u003csub\u003eh\u003c/sub\u003e is the highest dose at which toxicity and death signs were absent, and D\u003csub\u003eL\u003c/sub\u003e is the lowest dose at which these symptoms were present.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Animals\u003c/h2\u003e \u003cp\u003eIn the present study, male Wistar albino rats (120\u0026ndash;140 g) were obtained from El Nile Pharmaceutical Company, Cairo, Egypt. Animals were housed in a controlled environment under standard conditions, including a temperature of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, humidity of 60\u0026thinsp;\u0026plusmn;\u0026thinsp;5%, and a 12-hour light/dark cycle. Animals were provided with a standard diet and water \u003cem\u003ead libitum\u003c/em\u003e. The research protocol was approved by the Research Ethics Committee at the National Center for Radiation Research and Technology (REC-NCRRT, protocol serial number: 33A/23).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Experimental design\u003c/h2\u003e \u003cp\u003eThe experimental animals were divided into eight groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), with ten rats per group (n\u0026thinsp;=\u0026thinsp;10). In group 1 (the control group), the rats were orally administered 1.0 mL of saline solution (0.9% NaCl) daily for eight weeks. In group 2 (the sodium selenite group), the rats were orally administered sodium selenite (6.0 mg/kg body weight/day in 1.0 mL saline solution) for eight weeks via gastric gavage [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Group 3 (the hydroxytyrosol group) rats were orally administered hydroxytyrosol (300 mg/kg body weight/day in 1.0 mL saline solution) for eight weeks via gastric gavage [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In group 4 (the Se-HTNPs group), the rats were orally administered Se-HTNPs (10 mg/kg body weight/day in 1.0 mL saline solution) for eight weeks via gastric gavage. In group 5 (the DEN group), the rats were orally administered diethylnitrosamine (20 mg/kg body weight/day in 1.0 mL saline solution) for eight weeks via gastric gavage [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. In group 6 (the DEN\u0026thinsp;+\u0026thinsp;sodium selenite group), the rats were orally administered diethylnitrosamine as in group 5 and co-administered with sodium selenite as in group 2 for eight weeks. In group 7 (the DEN\u0026thinsp;+\u0026thinsp;hydroxytyrosol group), the rats were orally administered diethylnitrosamine as in group 5 and co-administered with hydroxytyrosol as in group 3 for eight weeks. In group 8 (the DEN\u0026thinsp;+\u0026thinsp;Se-HTNPs group), the rats were orally administered diethylnitrosamine as in group 5 and co-administered with Se-HTNPs as in group 4 for eight weeks.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAt the end of the experiment (Day 56), the animals were fasted overnight before being euthanized by rapid decapitation. Blood samples were collected in sterile, non-heparinized tubes to obtain serum for biochemical investigations. The liver of each animal was removed quickly, cleaned with ice-cold saline solution, and divided into two sections. The first section was immersed in a 10% formalin solution and embedded in paraffin for histological analysis. The second section was frozen in liquid nitrogen and kept at -80\u0026deg;C for biochemical analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Liver tissue homogenate\u003c/h2\u003e \u003cp\u003eThe liver tissue sample was homogenized in a Tris-HCl buffer solution (pH 7.4) for one minute using a high-intensity ultrasonic processor. The homogenate was centrifuged for 20 minutes at 10,000 g at 4\u0026deg;C. The resulting supernatant was stored at -80\u0026deg;C for future analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Biochemical examinations\u003c/h2\u003e \u003cp\u003eActivities of alanine aminotransferase (ALT, Cat. No. 265001, Spectrum Diagnostic Kit, Egyptian Company for Biotechnology, Egypt), aspartate aminotransferase (AST, Cat. No. 260001, Spectrum Diagnostic Kit, Egyptian Company for Biotechnology, Egypt), and alkaline phosphatase (ALP, Cat. No. ALP101090, Biomed Diagnostics, Egypt) and total protein levels (Cat. No. 016206, Diamond Diagnostics, Egypt), total bilirubin (Cat. No. 202188, Diamond Diagnostics, Egypt), and albumin (Cat. No. ALB-MC-03100, Biotechnology, Egypt) were evaluated in serum samples using the manufacturer\u0026rsquo;s protocols.\u003c/p\u003e \u003cp\u003eMalondialdehyde (MDA, Cat. No. MD2528, Biodiagnostic, Egypt), total antioxidant capacity (TAC, Cat. No. TA2512, Biodiagnostic, Egypt), reduced glutathione (GSH, Cat. No. GR2510, Biodiagnostic, Egypt), superoxide dismutase (SOD, Cat. No. SD2520, Biodiagnostic, Egypt), tumor necrosis factor-α (TNF-α, Cat. No. CSB-E11987r, Cusabio, China), interleukin-1 beta (IL-1β, ELISA Kit, Cat. No. MBS825017, MyBioSource, USA), interleukin-6 (IL-6, Quantikine ELISA Kit, Cat. No. R6000B, R\u0026amp;D Systems, Inc., USA), vascular endothelial growth factor (VEGF, ELISA Kit, Cat. No. CSB-E04757r, Cusabio, China), caspase-3 (ELISA Kit, Cat. No. MBS7244630, MyBioSource, USA ), and p53 (ELISA Kit, Cat. No. ELR-P53, Ray Biotech Company, USA) were determined in liver tissue homogenates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Molecular analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from liver tissue using the SV Total RNA Isolation System (Thermo Scientific, USA). A total of 1 \u0026micro;g of RNA was used for cDNA conversion using a high-capacity cDNA Reverse Transcription Kit (Cat. No. K4374966, Thermo Fisher Scientific, USA). mRNA gene expression of inflammatory signaling pathways [NF-κB and c-JNK N-terminal kinase (c-JNK)] in liver tissue was measured by real-time qPCR amplification, and analysis was performed using an Applied Biosystem StepOne\u0026trade; instrument with software version 3.1 (USA). Real-time qPCR was performed using SYBR Green/ROX qPCR Master Mix (Roche Diagnostics) and specific primer sequences for NF‐κB, c-JNK, and β-actin as the housekeeping (reference) gene (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence of studied genes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNF-KB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001276711.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward :5\u0026prime;- AATTGCCCCGGCAT- 3\u0026prime;\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- TCCCGTAACCGCGTA- 3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec-JNK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_021835.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: 5\u0026prime;- GATCCTAAAACAGAGCATGAC \u0026minus;\u0026thinsp;3\u0026prime;\u003c/p\u003e \u003cp\u003eReverse :5\u0026prime;- GAAGTTGCTGAGGTTGGCG- 3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-Actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_031144.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: 5\u0026prime;- CAGCCTTCCTTCTTGGGTATG \u0026minus;\u0026thinsp;3\u0026prime;\u003c/p\u003e \u003cp\u003eReverse: 5\u0026prime;- AGCTCAGTAACAGTCCGCCT- 3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.11. Histopathological examination\u003c/h2\u003e \u003cp\u003eLiver tissue samples were treated with 10% neutral-buffered formalin. The specimens were sectioned, washed, dehydrated in ascending concentrations of alcohol, cleared in xylene, and embedded in paraffin. Sections were cut at 4\u0026ndash;6 \u0026micro;m thickness and stained with hematoxylin and eosin [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.12. Statistical analysis\u003c/h2\u003e \u003cp\u003e Using the Statistical Package for the Social Science (SPSS) program version 25, the data were statistically analyzed using one-way analysis of variance (ANOVA), followed by Tukey's post-hoc test. The findings were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD and statistical significance was considered for values of P\u0026thinsp;\u0026le;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1. Characterizations of the synthesized Se-HTNPs\u003c/h2\u003e\n \u003cp\u003eDue to its quick and easy procedure compared to other methods, Se-HTNPs were synthesized using sodium selenite and hydroxytyrosol. Synthesizing nanoparticles with a small and uniform particle size distribution is an efficient approach to enhancing the bioavailability and stability of Se-HTNPs.\u003c/p\u003e\n \u003cp\u003eDynamic light scattering analysis revealed that the size of Se-HTNPs ranged from 13.54 to 100.0 nm, with an average size of 56.77 nm (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea). UV/VIS spectroscopy of Se-HTNPs showed a narrow peak at a wavelength of 279.8 nm (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb). The physical morphology and size distribution of Se-HTNPs, visualized by transmission electron microscopy, revealed that the nanoparticles were spherical, with sizes ranging from 13.42 nm to 100.0 nm and an average size of 56.71 nm (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec).\u003c/p\u003e\n \u003cp\u003eThe FT-IR spectrum of Se-HTNPs (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ed) showed a broad band at 3419.54 cm⁻\u0026sup1;, corresponding to the hydroxyl group [O-H stretching], and a weak band at 2593.92 cm⁻\u0026sup1;, corresponding to C\u0026thinsp;=\u0026thinsp;C stretching. A medium band at 1660.79 cm⁻\u0026sup1; was associated with C\u0026thinsp;=\u0026thinsp;C stretching, and a peak at 1027.74 cm⁻\u0026sup1; corresponded to a single C-O or C-N bond. Other weak bands were noted at 2311.58 cm⁻\u0026sup1; (C-O stretching), 2089.90 cm⁻\u0026sup1; (C\u0026thinsp;=\u0026thinsp;C stretching), and 1522.08 cm⁻\u0026sup1; (N-O stretching). Additionally, a slight shift was observed in the band corresponding to C-N stretching at 1116.11 cm⁻\u0026sup1;, and a weak band at 954.29 cm⁻\u0026sup1; was attributed to O-H stretching. The bands corresponding to the single C-H bond ranged from 900.52 cm⁻\u0026sup1; to 671.34 cm⁻\u0026sup1;. These results confirmed the presence of functional groups in Se-HTNPs, indicating that no chemical interactions interfered with their synthesis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2. Evaluation of the antitumor efficacy of the Se-HTNPs on Hep G2 cell line\u003c/h2\u003e\n \u003cp\u003eThe results of the MTT assay demonstrated that Se-HTNPs induced a marked decrease in cell viability compared to the control (untreated Hep G2 cells) in a dose-dependent manner (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). The IC\u003csub\u003e50\u003c/sub\u003e value (the concentration of Se-HTNPs that reduced the viable Hep G2 cell count by 50%) was determined to be 61.29\u0026thinsp;\u0026plusmn;\u0026thinsp;1.12 \u0026micro;g/mL.\u003c/p\u003e\n \u003cp\u003e\u003c/p\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eEffect of Se-HTNPs on Hep G2 cells at different concentrations\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eConcentration\u003c/p\u003e\n \u003cp\u003eSe-HTNPs\u003c/p\u003e\n \u003cp\u003e(\u0026micro;g/mL)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eToxicity %\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eControl \u003cstrong\u003e(0)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e31.25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e62.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e52.11\u0026thinsp;\u0026plusmn;\u0026thinsp;3.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e83.49\u0026thinsp;\u0026plusmn;\u0026thinsp;5.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e250\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e94.55\u0026thinsp;\u0026plusmn;\u0026thinsp;7.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e500\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e95.69\u0026thinsp;\u0026plusmn;\u0026thinsp;6.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e96.73\u0026thinsp;\u0026plusmn;\u0026thinsp;8.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\"\u003eData was represented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD of triplicate values\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.2. LD50 of\u003c/strong\u003e Se-HTNPs\u003c/h2\u003e\n \u003cp\u003eThe results of the LD50 determination showed that the oral administration of Se-HTNPs had an LD50 value of 707 mg/kg body weight (D\u003csub\u003eh\u003c/sub\u003e = 500 mg/kg and D\u003csub\u003eL\u003c/sub\u003e = 1000 mg/kg). The obtained LD50 value indicates that the prepared nanoparticles are safe and non-toxic.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3. Biochemical results\u003c/h2\u003e\n \u003cdiv id=\"Sec24\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.1. Levels of serum liver function indices\u003c/h2\u003e\n \u003cp\u003eEnzyme activities of serum aminotransferases (ALT and AST), alkaline phosphatase (ALP), and serum levels of albumin, total proteins, and total bilirubin in groups 2, 3, and 4 showed non-significant changes compared to the control group (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Oral administration of DEN (group 5) significantly increased ALT, AST, and ALP activities and total bilirubin levels. It significantly decreased serum albumin and total protein levels compared to group 1 (the control group). Treatment of DEN-administered rats with sodium selenite, hydroxytyrosol, and Se-HTNPs significantly improved (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) the levels of all liver function tests studied, with the highest enhancement observed in the Se-HTNPs-treated group compared to group 5 (DEN group).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.3.2. Levels of oxidative stress and antioxidant status\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eThe results in Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e demonstrated non-significant changes in the levels of lipid peroxidation indicator (MDA) and antioxidant indicators (GSH, SOD, and TAC) in the liver tissues of groups 2, 3, and 4 compared to the control group (group 1). In group 5 (DEN group), a significant increase (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) in lipid peroxidation and a significant decrease (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) in GSH, SOD, and TAC levels were observed compared to control values in group 1. The liver tissue samples of rats administered sodium selenite, hydroxytyrosol, and Se-HTNPs exhibited a significant decline in MDA levels with a concurrent significant increase in antioxidant marker levels compared to DEN-administered rats (group 5). Interestingly, Se-HTNPs restored the activity of SOD and the TAC levels to values comparable to the control group.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.3. Levels of hepatic inflammatory markers (TNF-\u0026alpha;, IL-6, and IL-1\u0026beta;)\u003c/h2\u003e\n \u003cp\u003eThe results in Table \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e demonstrated a non-significant change in pro-inflammatory cytokines (TNF-\u0026alpha;, IL-6, and IL-1\u0026beta;) in groups 2, 3, and 4 and a significant increase (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) in the level of these inflammatory indicators in the liver tissues of rats administered DEN (group 5) compared to the control group. On the other hand, oral administration with sodium selenite, hydroxytyrosol, and Se-HTNPs significantly decreased (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) the levels of inflammatory markers. The Se-HTNPs-treated group (group 8) showed a significant improvement in the levels of IL-6 and IL-1\u0026beta;, restoring them to control values.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.4. Levels of hepatic apoptotic markers (p53 and caspase-3) and angiogenesis indicator (VEGF)\u003c/h2\u003e\n \u003cp\u003eAs shown in Table \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, apoptotic markers (p53 and caspase-3) and angiogenesis indicator (VEGF) in liver tissues were non-significantly changed in groups 2, 3, and 4 while significantly elevated (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) in group 5 (DEN group) compared to the control group (group 1). In contrast, treatment with sodium selenite, hydroxytyrosol, and Se-HTNPs significantly decreased (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) p53, caspase 3, and VEGF levels in hepatic tissues compared to DEN-administered rats, with Se-HTNPs showing the most pronounced improvement.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec28\" class=\"Section3\"\u003e\n \u003ch2\u003e3.3.5. Levels of c- JNK mRNA and NF-\u0026kappa;B mRNA gene expression\u003c/h2\u003e\n \u003cp\u003eLevels of c-JNK mRNA and NF-\u0026kappa;B mRNA gene expression in hepatic tissue were non-significantly changed in groups 2, 3, and 4 compared to the control group (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). DEN-administered rats (group 5) showed a significant increase (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) in c-JNK mRNA and NF‐\u0026kappa;B mRNA gene expression levels compared with the control group (group 1). In contrast, Se-HTNPs significantly suppressed c-JNK mRNA and NF‐\u0026kappa;B mRNA gene expression levels compared to the DEN group. Interestingly, treatment of the DEN group with Se-HTNPs restored NF‐\u0026kappa;B mRNA gene expression to normal levels.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec29\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4. Histopathological results\u003c/h2\u003e\n \u003cp\u003eLiver tissue sections of groups 1, 2, 3, and 4 showed normal hepatic lobules consisting of polygonal cells arranged in cords with prominent round nuclei and eosinophilic cytoplasm oriented perpendicular to the central vein. The sinusoids were lined by a discontinuous layer of fenestrated endothelial cells with a fine arrangement of Kupffer cells. The portal area revealed a normal (grade 0) histological structure (Fig.\u0026nbsp;5).\u003c/p\u003e\n \u003cp\u003eThe DEN-induced hepatocellular carcinoma (group 5) showed disorganization of hepatic cords with hyperplasia of Kupffer cells and widely distributed nodules of variable sizes and shapes embedded in the hepatic parenchyma. Focal neoplastic cells were polyhedral to round with dense, centrally located vesicular nuclei. Multinucleated tumor giant cells with prominent basophilic nuclei and basophilic spindle cells were observed. Leukocytic infiltration was visible in this group (Fig.\u0026nbsp;6-a). Hepatocellular carcinomas were graded as poorly differentiated anaplastic lesions (grade IV). Carcinoma cells were recognizable as tissues of origin and arranged in a trabecular pattern with numerous clear cells and foamy cytoplasm. Malignant cells showed anisokaryosis (variation in nuclear size) and anisocytosis (variation in cell size), scanty basophilic cytoplasm, and frequent mitotic figures (Fig.\u0026nbsp;6-b). Hyperplasia of the bile duct, the formation of bile ductules surrounded by dense fibrous connective tissue, and focal aggregation of mononuclear cells were also noticed (Fig.\u0026nbsp;6-c).\u003c/p\u003e\n \u003cp\u003eRats in group 6 treated with sodium selenite (DEN\u0026thinsp;+\u0026thinsp;sodium selenite) revealed swelling and vacuolation of hepatocytes (Fig.\u0026nbsp;7-a). Disorganization of hepatic plates invaded and infiltrated with a few lymphocytes and macrophages was observed. Few pleomorphic nuclei without mitotic activity were present. The hepatic lobule showed binucleation of hepatocytes with a frequent number of apoptotic bodies and Kupffer cells hyperplasia (Fig.\u0026nbsp;7-b). Partial tumor necrosis (51\u0026ndash;99%) was evident, as numerous pyknotic nuclei were observed (Fig.\u0026nbsp;7-c).\u003c/p\u003e\n \u003cp\u003eThe rats in group 7, treated with hydroxytyrosol (DEN\u0026thinsp;+\u0026thinsp;Hydroxytyrosol), showed degenerative changes such as cellular swelling, anisokaryosis, and anisocytosis. Focal necrotic areas in the hepatic lobules were infiltrated with a few mononuclear cells, particularly lymphocytes and macrophages (Fig.\u0026nbsp;8-a). Hyperplasia of the bile duct, with intraluminal cellular casts, was observed (Fig.\u0026nbsp;8-b). Pleomorphism of nuclei, with peripheral condensation of chromatin and poor tumor necrosis (\u0026lt;\u0026thinsp;50%), was evident (Fig.\u0026nbsp;8-c).\u003c/p\u003e\n \u003cp\u003eThe rats in group 8, treated with Se-HTNPs (DEN\u0026thinsp;+\u0026thinsp;Se-HTNPs), revealed degenerative changes, appearing as vacuolation of hepatocytes, nuclear pyknosis, and clear cytoplasm without evidence of mitotic activity (Fig.\u0026nbsp;9-a). Partial tumor necrosis (51\u0026ndash;99%), characterized by apoptosis of tumor cells displayed as eosinophilic bodies scattered among hepatocytic cells, was observed (Fig.\u0026nbsp;9-b). Binucleation of hepatocytes and hyperplasia of Kupffer cells and mononuclear cells, predominantly lymphocytes and macrophages, were evident (Fig.\u0026nbsp;9-c).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eAlthough hepatocellular carcinoma is more common and has a poor prognosis, there are still not enough effective therapeutic options available [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Surgical intervention, including transplantation, ablation, and resection, remains the principal treatment option for hepatocellular carcinoma. However, the long-term survival rate is low, and the recurrence rate remains high [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Due to their high cost, severe toxicity at high dosages, and limited efficacy in treating cancer, the majority of hepatocellular carcinoma medications on the market are less effective at treating the disease and are not suitable for patients. Therefore, we evaluate a novel compound, Se-HTNPs, derived from natural sources in nanoparticle form, demonstrating multi-target potential, is more cost-effective, and offers a safer option for treating HCC induced by diethylnitrosamine administration in rats.\u003c/p\u003e \u003cp\u003eIn the current study, the results of the MTT assay demonstrated that Se-HTNPs induce a marked decrease in cell viability compared to the control (Hep G2 cells) in a dose-dependent manner. The IC50 value of Se-HTNPs was 61.29\u0026thinsp;\u0026plusmn;\u0026thinsp;1.12 \u0026micro;g/mL. Diethylnitrosamine-induced hepatocellular carcinoma is considered the most appropriate experimental model because it mimics the characteristics of liver cancer [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The liver, the body's largest gland, and a vital organ, plays a crucial role in maintaining physiological functions. Hepatocyte injury leads to increased ALT, AST, and ALP activity, with these enzymes leaking into the bloodstream, which is common in liver diseases. Therefore, elevated serum levels of AST, ALT, and ALP activities indicate the severity of liver injury [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Furthermore, Kumar et al. reported that in cases of diethylnitrosamine-induced hepatocellular carcinoma, serum albumin levels decrease while bilirubin levels increase [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eConsistent with previous studies [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], our findings showed that the oral administration of DEN significantly elevated the enzyme activities of ALT, AST, ALP, and total bilirubin levels. In contrast, serum albumin and total protein levels were significantly decreased compared to the control group. These elevated enzyme levels and changes in the other liver function tests indicate necrotic and inflammatory conditions in hepatocytes. Conversely, oral administration of Se-HTNPs had a significant therapeutic effect in treating hepatocellular carcinoma induced by diethylnitrosamine. The therapeutic effect on the liver was verified by reducing the activities of the serum transaminases (ALT and AST), ALP, and bilirubin levels and increasing the levels of albumin and total proteins compared to the DEN group. This improvement in liver function tests may be due to Se-HTNPs administration promoting the regeneration of parenchymal hepatocytes, maintaining cell membranes, and decreasing the leakage of hepatic enzymes. The results of the current study are consistent with those of Fang et al., who reported that hydroxytyrosol significantly reduced ALT and AST activities in liver damage induced by ethanol [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eReactive oxygen species (ROS) are produced by highly reactive, toxic, and mutagenic exogenous or endogenous sources. Toxic substances generated by lipid peroxidation, such as malondialdehyde (MDA), cause mutagenicity and carcinogenesis by damaging DNA [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Additionally, MDA increases the permeability of cell membranes, disrupting ion exchange across the membrane. Consequently, the intracellular ion balance is disturbed, inhibiting enzyme activity [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Antioxidants exhibit various biological activities, including inducing drug-metabolizing enzymes, inhibiting prostaglandin synthesis, preventing carcinogenesis, and scavenging free radicals [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Antioxidants can protect membranes from ROS toxicity by inhibiting ROS production, promoting ROS-induced repair, and providing cofactors necessary for the efficient function of other antioxidants [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The antioxidant system's first line of defense against oxidative damage caused by superoxide radicals is superoxide dismutase (SOD) [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. SOD enzymes catalyze the conversion of superoxide radicals into hydrogen peroxide and water. Liver tissues are rich in reduced glutathione (GSH), a non-protein cellular thiol that protects cells from the damaging effects of free radicals. GSH acts as a major antioxidant due to its ability to neutralize reactive oxygen species [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe results in this study showed that in the DEN group, the hepatic lipid peroxidation level (MDA) significantly increased, accompanied by a significant decrease in antioxidant status (GSH and SOD) compared to the control group. Furthermore, the study showed that ROS generated by DEN administration depletes the TAC by targeting antioxidant molecules during the ROS neutralization process. These findings confirm that DEN administration induces oxidative stress in liver tissues. Consistent with previous studies, DEN has been shown to elevate MDA levels and total oxidative stress while reducing antioxidant capacity in blood and hepatic tissues [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In contrast, our results revealed that Se-HTNPs-administered rats exhibited a significant decrease in lipid peroxidation level (MDA) with a concurrent significant increase in antioxidant marker levels (GSH, SOD, and TAC) compared with DEN-administered rats. These results suggest that Se-HTNPs protect hepatocytes from injury caused by diethylnitrosamine through their antioxidant activity against lipid peroxidation. Notably, Se-HTNPs restored SOD activity and TAC levels to values comparable to the control group. Supporting our findings, Bertelli et al. reported that hydroxytyrosol possesses potent antioxidant activity among olive phenols due to its ability to form stable hydrogen bonds with phenoxyl radicals and donate electrons via hydroxyl groups. Moreover, the antioxidant effect of hydroxytyrosol is attributed not only to its capacity to scavenge oxidative chemical species but also to its ability to enhance the activity and production of antioxidant enzymes [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eLiver carcinogenesis and its progression are closely associated with chronic inflammation. Most pro-inflammatory cytokines and their ligands also induce immunosuppression, contributing to the growth of HCC [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Liver cancer develops from a single normal cell through the accumulation of multiple genetic mutations and the induction of inflammatory mediators [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. The activation of Kupffer cells, stellate cells, and sinusoidal endothelial cells leads to the production of pro-inflammatory cytokines, which stimulate and drive pathological processes in the liver [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Among these, the pro-inflammatory cytokines TNF-α, IL-1β, and IL-6 are mediators of hepatic tissue inflammation. Consequently, reducing inflammation is considered one of the primary challenges in treating tumors.\u003c/p\u003e \u003cp\u003eThe current results revealed that DEN-administered rats exhibited a significant increase in the pro-inflammatory mediators (TNFα, IL-6, and IL-1β) levels compared to the control group. Consistent with earlier studies, DEN and its metabolites have been shown to stimulate liver cells to produce more pro-inflammatory cytokines, including TNF-α, IL-6, and IL-1β [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. These findings align with our results. Pro-inflammatory cytokines induce and amplify necrotic and apoptotic cascades in liver tissues. Moreover, DEN inhibits the production of anti-inflammatory cytokines such as IL-10, IL-4, IL-2, and IL-13 [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFurthermore, the current findings are in agreement with those of Mohamed et al., who found that DEN leads to ROS production, which activates the NF-κB transcription factor. NF-κB activation leads to increased gene expression of pro-inflammatory cytokines [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Interestingly, treatment with Se-HTNPs significantly reduced the levels of the investigated pro-inflammatory cytokines (TNFα, IL-6, and IL-1β) in the liver tissues compared to the DEN group, restoring IL-6 and IL-1β to those of the control group. This anti-inflammatory effect of Se-HTNPs can be attributed to their antioxidant activity, as oxidative stress is a primary driver of inflammatory responses.\u003c/p\u003e \u003cp\u003eConsistent with our findings, a previous study demonstrated that hydroxytyrosol inhibits inflammatory mediators such as TNF-α and IL-1β in lipopolysaccharide-stimulated microglia. [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Additional research has shown that hydroxytyrosol exhibits anti-inflammatory effects at nutritionally appropriate levels by inhibiting the production and activity of the enzyme COX-2 in activated human monocytes [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Furthermore, as demonstrated in animal models, hydroxytyrosol increases anti-inflammatory effects by reducing pro-inflammatory cytokines, including TNF-α and IL-6 [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNF-κB is one of several factors that lead to human disorders, including malignancies. Cancer is strongly associated with inflammation, which relies on the reciprocal activation of NF‐κB and inflammatory cytokines. Therapeutic-induced NF‐κB activation can diminish the effectiveness of anticancer treatments [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. NF‐κB proteins play a central role in regulating inflammation, emphasizing their involvement in the body's intricate defense mechanisms [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. The expression of various genes linked to essential activities, such as pro-inflammatory cytokines and chemokines, can be positively or negatively regulated to control inflammation. For example, tumor necrosis factor-alpha and IL-1β are potent activators of NF‐κB [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNF-κB significantly influences multiple cancers, including HCC. Previous research has highlighted that targeting NF‐κB-mediated signaling pathways, either directly or indirectly, is a viable approach to improving treatment outcomes for HCC patients [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. NF‐κB regulates the expression of genes encoding proteins involved in critical processes such as invasion, apoptosis, inflammation, metastasis, angiogenesis, chemoresistance, and radioresistance [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Consequently, we also examined how Se-HTNPs affected the NF‐κB-regulated gene products, such as VEGF, that contributed to tumor angiogenesis [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. Our results revealed that DEN-administered rats significantly increased NF-κB mRNA gene expression and hepatic VEGF levels compared to the control group. Consistent with our findings, a recent study [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e] also demonstrated that diethylnitrosamine significantly increases the expression of NF-κB in rat hepatocellular carcinoma models. Conversely, treatment with Se-HTNPs significantly suppressed NF‐κB mRNA gene expression and reduced hepatic VEGF levels compared to the DEN group. Remarkably, Se-HTNPs restored NF-κB mRNA expression to levels comparable to the control group.\u003c/p\u003e \u003cp\u003eQin et al. demonstrated that the production of ROS mediates the activation of transcription factor NF-κB [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. This activation subsequently increases pro-inflammatory cytokine levels. Our result indicated that Se-HTNPs can suppress the pathway of NF-κB, which is a critical pathway for oxidative stress and inflammation. Hydroxytyrosol has previously been shown to exert additional effects, such as reducing the expression of the epidermal growth factor receptor (EGFR) in colon cancer cells [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, the effect of Se-HTNPs on HCC may be due to its inhibitory effect on the ROS-mediated NF‐κB pathway. As reported by Z. Wang et al., hepatocyte survival and apoptosis are regulated through pathways such as IL-6/NF-κB, TNF-α/NF-κB, and IL-8/JAK1 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Thus, we further investigated the influence of Se-HTNPs on the apoptosis of hepatic cells in the HCC rat model.\u003c/p\u003e \u003cp\u003eApoptosis is a process of programmed cell death essential to tissue homeostasis and cell development in multicellular organisms. In malignant transformations of cells, such as HCC, defective apoptosis is a critical phase during which apoptosis is reduced compared to normal hepatic tissues. It is crucial for cytotoxicity caused by chemotherapy drugs [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. p53 is a potent growth-preventing, proapoptotic, and tumor-suppressing gene that plays a significant role in apoptosis by protecting tissues from the onset of cancer [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. p53 interacts with Bcl-2 family members and contributes to the intrinsic apoptotic cascades. Furthermore, apoptotic cells exhibit a favorable response to Caspase-3, which is necessary for both external and internal apoptotic signaling pathways. Therefore, caspase-3 is essential for identifying morphologically apoptotic cells and detecting and assessing cells undergoing apoptosis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur results revealed that the liver tissue apoptotic markers (p53 and caspase 3) significantly increased in the DEN group compared to the control group. In agreement with our findings, previous studies have shown that rats with HCC induced by DEN exhibited elevated levels of apoptotic caspase-3 and p53 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Proapoptotic proteins like caspases and p53 are activated by oxidative stress conditions brought on by the increase in ROS and the resulting DNA damage. Treatment with Se-HTNPs significantly decreased p53 and caspase-3 levels in hepatic tissues compared to DEN-administered rats. These findings suggest that Se-HTNPs are a potent hepatic defense agent with anti-apoptotic properties. Similarly, Costantini et al. reported a dose-dependent increase in the intrinsic apoptotic pathway in hydroxytyrosol-treated melanoma cells, accompanied by the downregulation of survival proteins like PARP and AKT and the activation of proapoptotic proteins like p53, caspases-9, and caspases-3 [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Indeed, the production and stimulation of p53 significantly increase under stress conditions associated with chromosomal abnormalities or DNA damage, enhancing its capacity to regulate the expression of genes and cell survival.\u003c/p\u003e \u003cp\u003ec-Jun N-terminal kinase (c-JNK) is a mitogen-activated protein kinase that controls biological processes, such as inflammation, autophagy, apoptosis, and cell division [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. c-JNK is considered stress-activated protein kinases since their activity responds to pro-inflammatory cytokine-induced cellular stress. Therefore, we determined the c-JNK mRNA gene expression level as a biomarker of apoptosis and inflammatory conditions. Currently, c-JNK is regarded as a promising therapeutic target for various illnesses. JNK pathway inhibitors offer a promising future therapeutic option in the context of diseases, with several of them registered in preclinical and clinical trials as potential treatments for depression [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e], diabetes [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e], and cancer [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the present study, DEN-administered rats showed a significant increase in c-JNK mRNA gene expression level compared to the control group. In line with our findings, Zeng et al. demonstrated that the c-JNK level was elevated in the serum of DEN-challenged animals compared to the control [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. An essential aspect of the JNK cascade is its crucial role in cancer cell resistance to chemotherapy. Previous research demonstrated that JNK can worsen liver cancer by inhibiting apoptosis in cancer cells, which is affected by the inactivation of p53 [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]. Conversely, treatment with Se-HTNPs significantly suppressed the level of c-JNK mRNA gene expression compared to the DEN-administered group. A previous study [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e] revealed that reactive oxygen species (ROS) formation activates the mitogen-activated protein kinase (MAPK) and the c-JNK N-terminal kinase (JNK). Therefore, we suggest that the suppression effect of Se-HTNPs on the c-JNK mRNA gene expression levels may be due to its potent ability to suppress ROS.\u003c/p\u003e \u003cp\u003eHistopathological examination of liver tissue validated the biochemical results in this study. In agreement with previous studies [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], our histological analysis of liver tissue from the DEN group revealed polyhedral to round neoplastic cells with dense, centrally located vesicular nuclei and multinucleated tumor giant cells. The carcinoma cells were arranged in a trabecular pattern with numerous numbers of clear cells with foamy cytoplasm, hyperplasia of the bile duct with the formation of bile ductules, and focal aggregation of mononuclear cells. Remarkably, treatment with Se-HTNPs ameliorated these histological alterations caused by DEN.\u003c/p\u003e \u003cp\u003eIn conclusion, to the best of our knowledge, this is the first study to report the therapeutic effects of Se-HTNPs against diethylnitrosamine (DEN)-induced hepatocellular carcinoma (HCC) in a rat model. The therapeutic effects of Se-HTNPs were confirmed by inhibiting liver enzymes and reducing oxidative stress and inflammatory markers in DEN-administered rats. Furthermore, Se-HTNPs suppressed hepatic apoptosis, c-JNK mRNA, and NF-κB mRNA gene expression. Additionally, Se-HTNP treatment significantly ameliorated the histological alterations induced by DEN. These findings suggest that Se-HTNPs mitigate DEN-induced HCC in rats through their potent antioxidant, anti-inflammatory, and anti-carcinogenic properties.\u003c/p\u003e "},{"header":"Abbreviations","content":"\u003cp\u003eALP:\u0026nbsp;alkaline phosphatase\u003c/p\u003e\n\u003cp\u003eALT: alanine aminotransferase\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAST:\u0026nbsp;aspartate aminotransferase\u003c/p\u003e\n\u003cp\u003ec-JNK: c-JNK N-terminal kinase\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDEN: diethylnitrosamine\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDLS: Dynamic light scattering\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFTIR: Fourier-transform infrared spectroscopy\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGSH: reduced glutathione\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHCC:\u0026nbsp;hepatocellular carcinoma\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHep G2: human liver cancer cell line.\u003c/p\u003e\n\u003cp\u003eIL-1\u0026beta;: interleukin-1 beta\u003c/p\u003e\n\u003cp\u003eIL-6: interleukin-6\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLD50: median lethal dose\u003c/p\u003e\n\u003cp\u003eMDA: malondialdehyde\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNF-\u0026kappa;B: Nuclear factor kappa-light-chain-enhancer of activated B cells\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRNS: reactive nitrogen species\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eROS: reactive oxygen species\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSe-HTNPs: \u0026nbsp; selenium-hydroxytyrosol nanoparticles\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSOD: superoxide dismutase\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTAC: total antioxidant capacity\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTEM: Transmission electron microscopy\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTNF-\u0026alpha;: tumor necrosis factor-\u0026alpha;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eVEGF: vascular endothelial growth factor\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRadwa T.M. Tawfik\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003edata curation, methodology, formal analysis. Eman M. Abdel-Azim\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003econceptualization, supervision,\u0026nbsp;Sawsan M. Elsonbaty\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003econceptualization, supervision, methodology. Ehab A. Ibrahim: conceptualization, supervision, writing original draft, Writing-review \u0026amp; editing. All authors approved the final version of the manuscript. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors did not receive support from any organization for the submitted work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data used in this study are included in this published article and are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal procedures were carried out following the NIH (National Research Council) Guide for the Care and Use of Laboratory Animals. The research protocol was approved by the Research Ethics Committee in the National Center for Radiation Research and Technology (REC-NCRRT, serial number of the protocol: 33A/23).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The author(s) declared no potential conflicts of interest concerning the research, authorship, and/or publication of this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor our assistance in the development of histopathology, we thank Prof. Dr. Ahmed Osman, professor of Pathology, Faculty of Veterinary Medicine, Cairo University.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZeng X, Liu H, Huang Z et al (2022) Anticancer effect of arbutin on diethylnitrosamine-induced liver carcinoma in rats via the GRP and GADD pathway. J Environ Pathol Toxicol Oncol 41\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLindemann J, Doyle MBM (2024) Expanding the Boundaries for Liver Transplantation for Hepatocellular Carcinoma. Surg Clin 104:129\u0026ndash;143\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Jiang X, Zhang L, Chen H (2023) Protective effects of Althaea officinalis L. extract against N-diethylnitrosamine‐induced hepatocellular carcinoma in male Wistar rats through antioxidative, anti‐inflammatory, mitochondrial apoptosis and PI3K/Akt/mTOR signaling pathways. Food Sci Nutr\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang M-D, Diao Y-K, Yao L-Q et al (2024) Emerging role of molecular diagnosis and personalized therapy for hepatocellular carcinoma. iLIVER 100083\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePessino G, Scotti C, Maggi M, Consortium I-H (2024) Hepatocellular Carcinoma: Old and Emerging Therapeutic Targets. Cancers (Basel) 16:901\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Ma J, Yu T et al (2024) circ_HMGCS1 modulates hepatocellular carcinoma chemoresistance via miR-338‐5p/IL‐7 pathway. J Cell Mol Med 28:e18137\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGavas S, Quazi S, Karpiński TM (2021) Nanoparticles for cancer therapy: current progress and challenges. Nanoscale Res Lett 16:173\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKashyap BK, Singh VV, Solanki MK et al (2023) Smart nanomaterials in cancer theranostics: challenges and opportunities. ACS omega 8:14290\u0026ndash;14320\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa P, Wang G, Men K et al (2024) Advances in clinical application of nanoparticle-based therapy for cancer treatment: a systematic review. Nano TransMed 100036\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJanmeda P, Jain D, Chaudhary P et al (2024) A systematic review on multipotent carcinogenic agent, N-nitrosodiethylamine (NDEA), its major risk assessment, and precautions. J Appl Toxicol\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeleş \u0026Ouml;F, Huyut Z, Arslan M et al (2024) Antitumor activity of Urtica dioica seed extract on diethylnitrosamine-induced liver carcinogenesis in rats. Indian J Biochem Biophys 61:16\u0026ndash;31\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchulien I, Hasselblatt P (2021) Diethylnitrosamine-induced liver tumorigenesis in mice. Methods Cell Biol 163:137\u0026ndash;152\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRenaudin X (2021) Reactive oxygen species and DNA damage response in cancer. Int Rev Cell Mol Biol 364:139\u0026ndash;161\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Wang M, Liu C et al (2023) Hepatoprotective effects of aspirin on diethylnitrosamine-induced hepatocellular carcinoma in rats by reducing inflammation levels and PD-L1 expression. Sci Rep 13:21362\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003edel Castillo Busto ME, Ward-Deitrich C, Evans SO et al (2024) Selenium speciation studies in cancer patients to evaluate the responses of biomarkers of selenium status to different selenium compounds. Anal Bioanal Chem 1\u0026ndash;14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang F, Li X, Wei Y (2023) Selenium and selenoproteins in health. Biomolecules 13:799\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGenchi G, Lauria G, Catalano A et al (2023) Biological activity of selenium and its impact on human health. Int J Mol Sci 24:2633\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAu A, Mojadadi A, Shao J-Y et al (2023) Physiological benefits of novel selenium delivery via nanoparticles. Int J Mol Sci 24:6068\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdel-Rasoul AA, Saleh NA, Hosny EN et al (2023) Cardamom oil ameliorates behavioral and neuropathological disorders in a rat model of depression induced by reserpine. J Ethnopharmacol 308:116254\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu W, Wang Y, Xia L, Li J (2024) Research Progress of Plant-Derived Natural Products against Drug-Resistant Cancer. Nutrients 16:797\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGon\u0026ccedil;alves M, Aiello A, Rodr\u0026iacute;guez-P\u0026eacute;rez M et al (2024) Olive Oil Components as Novel Antioxidants in Neuroblastoma Treatment: Exploring the Therapeutic Potential of Oleuropein and Hydroxytyrosol. Nutrients 16:818\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonteiro M, Silva AFR, Resende D et al (2021) Strategies to broaden the applications of olive biophenols oleuropein and hydroxytyrosol in food products. Antioxidants 10:444\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBertelli M, Kiani AK, Paolacci S et al (2020) Hydroxytyrosol: A natural compound with promising pharmacological activities. J Biotechnol 309:29\u0026ndash;33\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVlavcheski F, Young M, Tsiani E (2019) Antidiabetic effects of hydroxytyrosol: In vitro and in vivo evidence. Antioxidants 8:188\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang X, Cao J, Tao Z et al (2023) Hydroxytyrosol attenuates ethanol-induced liver injury by ameliorating steatosis, oxidative stress and hepatic inflammation by interfering STAT3/iNOS pathway. Redox Rep 28:2187564\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGallardo-Fern\u0026aacute;ndez M, Hornedo-Ortega R, Cerezo AB et al (2023) Hydroxytyrosol and dopamine metabolites: Anti-aggregative effect and neuroprotective activity against α-synuclein-induced toxicity. Food Chem Toxicol 171:113542\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoguera-Navarro C, Montoro-Garc\u0026iacute;a S, Orenes-Pi\u0026ntilde;ero E (2023) Hydroxytyrosol: Its role in the prevention of cardiovascular diseases. Heliyon 9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi S, Shao H, Sun T et al (2024) Anti-neuroinflammatory effect of hydroxytyrosol: a potential strategy for anti-depressant development. Front Pharmacol 15:1366683\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParra-Perez AM, P\u0026eacute;rez-Jim\u0026eacute;nez A, Gris-C\u0026aacute;rdenas I et al (2022) Involvement of the PI3K/AKT intracellular signaling pathway in the anticancer activity of hydroxytyrosol, a polyphenol from Olea europaea, in hematological cells and implication of HSP60 levels in its anti-inflammatory activity. Int J Mol Sci 23:7053\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarcia-Guasch M, Escrich E, Moral R, Duarte IF (2023) Metabolomics insights into the differential response of breast cancer cells to the phenolic compounds Hydroxytyrosol and Luteolin. Molecules 28:3886\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCostantini F, Di Sano C, Barbieri G (2020) The hydroxytyrosol induces the death for apoptosis of human melanoma cells. Int J Mol Sci 21:8074\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi D, Liu Z, Yuan Y et al (2015) Green synthesis of gallic acid-coated silver nanoparticles with high antimicrobial activity and low cytotoxicity to normal cells. Process Biochem 50:357\u0026ndash;366\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMontes-Burgos I, Walczyk D, Hole P et al (2010) Characterisation of nanoparticle size and state prior to nanotoxicological studies. J Nanoparticle Res 12:47\u0026ndash;53\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Cheng H, Wang F et al (2010) An improved 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) reduction assay for evaluating the viability of Escherichia coli cells. J Microbiol Methods 82:330\u0026ndash;333\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng J, Gao H, Yang L et al (2022) Renoprotective and hepatoprotective activity of Lepidium draba L. extracts on oxymetholone-induced oxidative stress in rat. J Food Biochem 46:e14250\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChattopadhyay S, Pal S, Ghosh D, Debnath J (2003) Effect of dietary co-administration of sodium selenite on sodium arsenite-induced ovarian and uterine disorders in mature albino rats. Toxicol Sci 75:412\u0026ndash;422\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl Fazazi S, Casuso RA, Arag\u0026oacute;n-Vela J et al (2018) Effects of hydroxytyrosol dose on the redox status of exercised rats: The role of hydroxytyrosol in exercise performance. J Int Soc Sports Nutr 15:1\u0026ndash;7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDarwish HA, EL-BOGHDADY NA (2013) Possible involvement of oxidative stress in diethylnitrosamine‐induced hepatocarcinogenesis: chemopreventive effect of curcumin. J Food Biochem 37:353\u0026ndash;361\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCardiff RD, Miller CH, Munn RJ (2014) Manual hematoxylin and eosin staining of mouse tissue sections. Cold Spring Harb Protoc 2014:pdb-prot073411\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGanesan P, Kulik LM (2023) Hepatocellular carcinoma: new developments. Clin Liver Dis 27:85\u0026ndash;102\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHsiao C-Y, Ho C-M, Ho M-C et al (2024) Risk factors, patterns, and outcome predictors of late recurrence in patients with hepatocellular carcinoma after curative resection: A large cohort study with long-term follow-up results. Surgery\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar A, Naithani M, Kumar N et al (2022) Piperlongumine inhibits diethylnitrosamine induced hepatocellular carcinoma in rats. Hum Exp Toxicol 41:09603271211073593\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamim YM, Nagy AA, Abdellah AM et al (2024) Anticancer effect of propranolol on diethylnitrosamine-induced hepatocellular carcinoma rat model. Fundam Clin Pharmacol\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, Shang S, Yan F et al (2023) Antioxidant Activities of Essential Oils and Their Major Components in Scavenging Free Radicals, Inhibiting Lipid Oxidation and Reducing Cellular Oxidative Stress. Molecules 28:4559\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuchtaridi M, Az-Zahra F, Wongso H et al (2024) Molecular Mechanism of Natural Food Antioxidants to Regulate ROS in Treating Cancer: A Review. Antioxidants 13:207\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSachdev S, Ansari SA, Ansari MI (2023) Antioxidant defensive mechanisms to regulate cellular redox homeostatic balance. Reactive Oxygen Species in Plants: The Right Balance. Springer, pp 143\u0026ndash;172\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJomova K, Alomar SY, Alwasel SH et al (2024) Several lines of antioxidant defense against oxidative stress: antioxidant enzymes, nanomaterials with multiple enzyme-mimicking activities, and low-molecular-weight antioxidants. Arch Toxicol 1\u0026ndash;45\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePradhan P, Majhi O, Biswas A et al (2020) Enhanced accumulation of reduced glutathione by Scopoletin improves survivability of dopaminergic neurons in Parkinson\u0026rsquo;s model. Cell Death Dis 11:739. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41419-020-02942-8\u003c/span\u003e\u003cspan address=\"10.1038/s41419-020-02942-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNigam M, Mishra AP, Deb VK et al (2023) Evaluation of the association of chronic inflammation and cancer: Insights and implications. Biomed Pharmacother 164:115015\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Li C, Zhang W et al (2023) Inflammation and aging: signaling pathways and intervention therapies. Signal Transduct Target Ther 8:239\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Li X, Li X (2021) Curcumae ameliorates diethylnitrosamine-induced hepatocellular carcinoma via alteration of oxidative stress, inflammation and gut microbiota. J Inflamm Res 5551\u0026ndash;5566\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen N, Nishio N, Ito S et al (2015) Growth arrest and DNA damage-inducible protein (GADD34) enhanced liver inflammation and tumorigenesis in a diethylnitrosamine (DEN)-treated murine model. Cancer Immunol Immunother 64:777\u0026ndash;789\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohamed EE, Ahmed OM, Zoheir KMA et al (2023) Naringin\u0026ndash;Dextrin Nanocomposite Abates Diethylnitrosamine/Acetylaminofluorene-Induced Lung Carcinogenesis by Modulating Oxidative Stress, Inflammation, Apoptosis, and Cell Proliferation. Cancers (Basel) 15:5102\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Zhang J, Jiang X et al (2020) Hydroxytyrosol inhibits LPS-induced neuroinflammatory responses via suppression of TLR-4-mediated NF-κB P65 activation and ERK signaling pathway. Neuroscience 426:189\u0026ndash;200\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScoditti E, Nestola A, Massaro M et al (2014) Hydroxytyrosol suppresses MMP-9 and COX-2 activity and expression in activated human monocytes via PKCα and PKCβ1 inhibition. Atherosclerosis 232:17\u0026ndash;24\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Wang C, Abdullah et al (2022) Hydroxytyrosol alleviates dextran sulfate sodium-induced colitis by modulating inflammatory responses, intestinal barrier, and microbiome. J Agric Food Chem 70:2241\u0026ndash;2252\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlmowallad S, Alqahtani LS, Mobashir M (2022) NF-kB in signaling patterns and its temporal dynamics encode/decode human diseases. Life 12:2012\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMollaei M, Abbasi A, Hassan ZM, Pakravan N (2020) The intrinsic and extrinsic elements regulating inflammation. Life Sci 260:118258\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaye AD, Perilloux DM, Hawkins AM et al (2024) Tumor Necrosis Factor and Interleukin Modulators for Pathologic Pain States: A Narrative Review. Pain Ther 1\u0026ndash;13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurden-Pekmezci A, Cakiroglu E, Eris S et al (2023) MALT1 paracaspase is overexpressed in hepatocellular carcinoma and promotes cancer cell survival and growth. Life Sci 323:121690\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShaw P, Dwivedi SKD, Bhattacharya R et al (2024) VEGF signaling: Role in angiogenesis and beyond. Biochim Biophys Acta (BBA)-Reviews. Cancer 189079\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin R, Xie S, Xu F et al (2024) Improvement of rat hepatocellular carcinoma model induced by diethylnitrosamine. Tissue Cell 86:102261\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin Y, Song D, Liao S et al (2023) Isosinensetin alleviates estrogen deficiency-induced osteoporosis via suppressing ROS-mediated NF-κB/MAPK signaling pathways. Biomed Pharmacother 160:114347\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerzuoli E, Giachetti A, Ziche M, Donnini S (2016) Hydroxytyrosol, a product from olive oil, reduces colon cancer growth by enhancing epidermal growth factor receptor degradation. Mol Nutr Food Res 60:519\u0026ndash;529\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Zhu J, Yu Z et al (2023) Regulation of apoptosis by ubiquitination in liver cancer. Am J Cancer Res 13:4832\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoudhary HB, Mandlik SK, Mandlik DS (2023) Role of p53 suppression in the pathogenesis of hepatocellular carcinoma. World J Gastrointest Pathophysiol 14:46\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen J, Ye C, Wan C et al (2021) The roles of c-jun N-terminal kinase (JNK) in infectious diseases. Int J Mol Sci 22:9640\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHollos P, Marchisella F, Coffey ET (2018) JNK regulation of depression and anxiety. Brain Plast 3:145\u0026ndash;155\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYung JHM, Giacca A (2020) Role of c-Jun N-terminal kinase (JNK) in obesity and type 2 diabetes. Cells 9:706\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Q, Wu W, Jacevic V et al (2020) Selective inhibitors for JNK signalling: a potential targeted therapy in cancer. J Enzyme Inhib Med Chem 35:574\u0026ndash;583\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao H, Chen X, Wang Z et al (2020) The role of MDM2\u0026ndash;p53 axis dysfunction in the hepatocellular carcinoma transformation. Cell Death Discov 6:53\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAverill-Bates D (2023) Reactive oxygen species and cell signaling. Rev Biochim Biophys Acta (BBA)-Molecular Cell Res 119573\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 3 to 6 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"hepatocellular carcinoma, diethylnitrosamine, Se-HTNPs, antioxidant, anti-inflammatory, anti-carcinogenic","lastPublishedDoi":"10.21203/rs.3.rs-5726485/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5726485/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHepatocellular carcinoma (HCC) is a life-threatening disease with a global impact, underscoring the urgent need for the development of new therapeutic agents. This study evaluates the therapeutic effect of selenium-hydroxytyrosol nanoparticles (Se-HTNPs) in a rat model of HCC induced by diethylnitrosamine (DEN). In vitro, Se-HTNPs treatment reduced the viability of Hep G2 cells in a dose-dependent manner, with an IC\u003csub\u003e50\u003c/sub\u003e value of 61.29\u0026thinsp;\u0026plusmn;\u0026thinsp;1.12 \u0026micro;g/mL. The results confirmed the antioxidant, anti-inflammatory, and anti-carcinogenic properties of Se-HTNPs, demonstrating their effectiveness against DEN-induced HCC. The therapeutic effects of Se-HTNPs were validated by inhibiting serum ALT, AST, and ALP enzyme activities and reducing serum total bilirubin levels. Simultaneously, Se-HTNPs enhanced serum albumin and total protein levels. Additionally, Se-HTNPs alleviated oxidative stress by significantly lowering hepatic lipid peroxidation (MDA) levels and markedly increasing antioxidant marker levels (GSH, SOD, and TAC) compared to DEN-administered rats. Se-HTNPs also significantly reduced hepatic inflammatory markers (TNFα, IL-6, and IL-1β), apoptotic markers (p53 and caspase 3), and VEGF levels. Furthermore, compared to the DEN group, Se-HTNPs distinctly suppressed c-JNK mRNA and NF-κB mRNA gene expression levels. Moreover, Se-HTNP treatment significantly improved the histological alterations induced by DEN. In conclusion, these findings suggest that Se-HTNPs mitigate DEN-induced HCC in rats through their potent antioxidant, anti-inflammatory, and anti-carcinogenic properties.\u003c/p\u003e","manuscriptTitle":"Biosynthesized Selenium-hydroxytyrosol nanoparticles attenuate hepatocellular carcinoma in rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-01 08:59:20","doi":"10.21203/rs.3.rs-5726485/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e22b85b5-6d87-4188-ad9a-e254bffd20d8","owner":[],"postedDate":"January 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-08T01:53:37+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-01 08:59:20","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5726485","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5726485","identity":"rs-5726485","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}