Blautia coccoides CML164 improved lipid and energy metabolism in broiler chickens via gut microbiota pathways

Blautia coccoides CML164 improved lipid and energy metabolism in broiler chickens via gut microbiota pathways | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Blautia coccoides CML164 improved lipid and energy metabolism in broiler chickens via gut microbiota pathways Zhouyang Gao, Xiaohang Yang, Muying Nie, Suxin Shi, Gaoxiang Yuan, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8511274/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract The probiotic potential of Blautia coccoides CML164, a novel acetate-producing strain isolated from the poultry gut, was systematically evaluated for its ability to modulate lipid and energy metabolism in broilers via gut microbiota-mediated pathways. Supplementation with Blautia coccoides CML164 significantly reshaped the cecal microbiome, enriching beneficial short-chain fatty acid (SCFA)-producing bacteria such as Phocaeicola vulgatus , Parabacteroides distasonis , and members of Prevotellaceae , while concurrently increasing cecal acetate concentration in broiler chickens. These microbial changes were accompanied by improved mitochondrial function, enhanced hepatic fatty acid oxidation (upregulation of PPARα , ACOX1 ), and suppression of lipogenic genes ( SREBP1 , PPARγ ), leading to reduced abdominal fat deposition and improved serum lipid profiles without compromising growth performance in broilers. The study demonstrates that Blautia coccoides CML164 functions as an effective probiotic by orchestrating gut microbiota composition and promoting SCFA production, thereby activating host metabolic pathways that mitigate lipid accumulation. Our findings highlight the critical role of microbial intervention in regulating energy homeostasis and offer a promising strategy for leveraging probiotics to enhance metabolic health in poultry production. Probiotic Blautia coccoides CML164 Lipid metabolism Energy metabolism Gut microbiota Broiler chickens Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction In recent years, a burgeoning body of research has established a robust association between gut microbiota and obesity, alongside related metabolic disorders. Many scientists postulate that perturbations in gut microbial composition represent one of the etiological factors contributing to obesity, with marked differences in gut microbial profiles observed between obese individuals and those with normal body weight[ 1 , 2 ]. To date, the majority of studies have reported reduced colonic microbial diversity, decreased abundance of Bacteroidetes, and elevated levels of Firmicutes in patients with obesity and diabetes[ 3 ]. An increased Firmicutes/Bacteroidetes ratio is implicated in enhanced energy extraction by the host, which is subsequently stored as white adipose tissue[ 4 ]. Emerging evidence highlights a intimate link between gut microbiota and adipose tissue thermogenesis[ 5 ]. This connection is primarily mediated by the microbial fermentation of dietary fiber in the colon, leading to the production of short-chain fatty acids (SCFAs). As intermediate metabolites of the tricarboxylic acid (TCA) cycle, SCFAs facilitate the conversion of energy into a proton gradient, thereby driving energy expenditure and mitigating fat accumulation[ 6 ]. Furthermore, accumulating studies indicate that modulating gut microbial composition constitutes a viable strategy for weight management, predominantly through dietary interventions, prebiotic supplementation, and probiotic administration. Probiotics exert their beneficial effects by inhibiting the proliferation of enteropathogens while augmenting the abundance of commensal beneficial bacteria, thereby preserving gut microbial homeostasis, reducing levels of the endotoxin lipopolysaccharide (LPS), enhancing insulin sensitivity, and alleviating insulin resistance[ 7 , 8 ]. Numerous preclinical studies have demonstrated that intraperitoneal gavage of probiotics in male C57BL/6J mice maintained on a high-fat diet (HFD) results in a significant reduction in fat mass without altering food intake. These phenotypic changes are accompanied by concomitant shifts in gut microbiota, characterized by increased abundance of beneficial taxa such as Bifidobacteriaceae , Lactobacillus , Prevotella, Roseburia , and Akkermansia [ 9 , 10 ]. Collectively, these findings underscore the potential of gut microbiota as a therapeutic target for obesity. Blautia is an anaerobic microorganism widely distributed in the intestines and feces of mammals, primarily classified into Blautia coccoides , Blautia producta , Blautia schinkii , etc[ 11 ]. Recent research has highlighted its significance in mitigating metabolic diseases. Study involving monoclonal gavage experiments in high-fat diet mice demonstrated that Blautia coccoides significantly reduced high-fat diet-induced insulin resistance and fat accumulation[ 12 ]. As a glycolytic organism, Blautia primarily synthesizes acetic acid as its end product. Additionally, Blautia is strictly anaerobic and utilizes hydrogen and carbon dioxide to generate acetic acid[ 13 ]. As a typical SCFAs, acetic acid decreases fat deposition by modulating energy intake, enhancing mitochondrial metabolism, and regulating fatty acid oxidation and synthesis[ 14 , 15 ]. Research indicated that subcutaneous injection of sodium acetate in rabbits significantly inhibited fat deposition in the liver and adipose tissue[ 16 ]. Sahuri-Arisoylu et al. found that intraperitoneal acetate administration in mice reduced fat deposition by decreasing circulating free fatty acids, suppressing hepatic de novo lipogenesis, and enhancing mitochondrial efficiency[ 17 ]. Chicken is highly regarded by consumers for its nutritional value and palatability, characterized by high protein content and low fat content, contributing to human health benefits[ 18 ]. Through years of genetic selection and nutritional advancements, modern broilers in our country have achieved significant improvements in weight, growth rate, and feed efficiency. However, the rapid growth rate of broilers is often accompanied by an imbalance in lipid metabolism. This leads to increased abdominal fat deposition, predisposes the birds to fat metabolism-related disorders, causes a decline in meat quality and reduced feed efficiency, ultimately compromising their economic value[ 19 , 20 ]. Among the body fats in broilers, abdominal fat constitutes the largest proportion[ 21 ]. Therefore, developing strategies to regulate abdominal fat deposition is crucial. Currently, animal nutrition approaches, such as optimizing dietary composition and improving the gut microbiota structure to specifically modulate metabolic functions, have become important methods for enhancing lipid metabolism in poultry. Currently, in the context of antibiotic-free feeding, probiotics, as one of the most common feed additives, are widely used in poultry production[ 22 ]. A number of studies have shown that probiotics can inhibit lipogenesis and regulate host lipid metabolism, and dietary probiotic supplementation can effectively reduce abdominal fat deposition in poultry. Research has demonstrated that adding Bacillus subtilis-based microbial preparations to the diet significantly reduces triglyceride levels in the serum and liver of hens[ 23 ]. Furthermore, compound microbial preparations have been shown to improve the growth performance of breeder hens while simultaneously lowering serum triglyceride levels and enhancing antioxidant capacity[ 24 ]. Similarly, studies by Yang et al. indicated that treatment with M. funiformis CML154 activated the APN-AMPK-PPARα signaling pathway in both high-fat diet-fed laying hens and mice, alleviated hepatic steatosis, and increased the concentration of propionate in the gut[ 25 ]. These findings collectively highlight the strong application potential of probiotics in ameliorating lipid deposition in poultry. Our laboratory successfully isolated and cultivated a pure strain of Blautia coccoides CML164 through in vitro methods. Blautia coccoides CML164 belongs to the phylum Firmicutes and demonstrated high acetic acid production capacity. However, the effects and mechanisms of action of this microorganism on broiler chicken growth performance and lipid metabolism require systematic investigation. Therefore, this study aimed to administer a specific concentration of CML164 (10 8 CFU/mL) to broiler chickens through their drinking water. The study analyzed its impact on the growth performance and lipid deposition of broiler chickens, and elucidated the underlying mechanisms. The research seeks to provide new insights into the application of Blautia strains as functional feed additives in sustainable broiler production. 2. Materials and Methods 2.1 Bacteria Strains, Culture, and Preparation The methods used for bacterial cultivation and isolation were adapted from our earlier research[ 26 ]. The identity of each strain was verified by amplifying the 16S rRNA gene with the primers 27F (5′-AGA GTT TGA TCA TGG CTC A-3′) and 1492R (5′-TAC GGT TAC CTT GTT ACG ACT T-3′). Then, the sequence was compared with the NCBI database or EzBioCloud ( http://www.ezbiocloud.net ) for taxonomic affiliation. The genome of Blautia coccoides CML164 (CML) was sequenced, and its genome map was performed using Proksee ( https://proksee.ca/ ). Functional annotation of the Blautia coccoides CML164 core genes was performed using the KEGG database ( https://www.genome.jp/kegg/ ). After culturing Blautia coccoides CML164 in Gifu Anaerobic Medium (GAM, catalog no. HB8518, Hope Bio, China) at 37°C under anaerobic conditions for 24 hours, bacterial pellets were harvested by centrifugation at 4,000 rpm and 4°C for 5 minutes. The pellets were then resuspended in sterile anaerobic PBS containing 20% glycerol, and the resulting bacterial suspension was aliquoted and stored at -80°C for subsequent use. In parallel, sterile anaerobic PBS supplemented with 20% glycerol (without bacteria) was aliquoted and cryopreserved under the same conditions. Prior to use, both the frozen bacterial suspension and the 20% glycerol-containing sterile anaerobic PBS were thawed in a 37°C water bath. Before gavage administration, the bacterial suspension was diluted to 1×10⁸ CFU/mL with sterile PBS (resulting in a final glycerol concentration of 0.8%). Concurrently, the 20% glycerol-containing sterile anaerobic PBS was subjected to equal-volume dilution with sterile PBS to prepare sterile PBS with a final glycerol concentration of 0.8% (serving as a control). 2.2 Birds, experimental design and diets A total of 140 male Arbor Acres day-old chicks with a similar initial average weight (43.97 ± 0.35 g) were selected and randomly divided into two groups: (1) control group with a basal diet (CON), and (2) basal diet supplemented with 1 × 10 8 CFU/mL of CML 164 (CML). Each experimental group comprised 7 replicates, with 10 chicks per replicate, and the feeding period extended for 42 days. Throughout the experimental period, the chicks received unrestricted access to feed and water, and were housed in a two-tier cage system. Daily monitoring recorded the feed intake and health status of the broiler chickens. The temperature, humidity, and lighting duration within the chicken house were maintained according to broiler production standards. All diets were formulated to meet the NRC (1994) and Chinese chicken feeding standards (NY/T-33–2004)[ 27 ], with the dietary composition and nutritional levels outlined in Table 1 . Table 1 Composition and nutrient level of the basal diet (as-fed basis). Ingredient, % D1–20 D21–41 Corn 61.07 55.66 Soybean meal 24.74 32.50 Corn gluten meal 6.50 4.70 Soy oil 3.78 2.97 Dicalcium phosphate 1.94 2.20 Limestone 0.63 0.63 Salt 0.35 0.45 Lysine-HCl 0.29 0.19 Methionine 0.21 0.21 Choline 0.20 0.20 Mineral premix 1 0.20 0.20 Vitamin premix 2 0.03 0.03 Antioxidant 0.03 0.03 Phytase 0.02 0.02 Total 100.00 100.00 Nutrient composition Metabolizable energy, mc/kg 3.10 3.10 Crude protein 20.00 22.00 Lysine 1.10 1.20 Calcium 0.90 1.00 Phosphorus 0.45 0.50 1 Per kilogram of diet contained: copper, 8 mg; zinc, 75 mg; iron, 80 mg; manganese, 100 mg; selenium, 0.15 mg; iodine, 0.35 mg; cobalt, 0.5 mg. 2 Per kilogram of diet contained: vitamin A, 12500 IU; vitamin D 3 ; 2500 IU; vitamin K 3 , 2.65 mg; vitamin B 1 , 2 mg; vitamin B 2 , 6 mg; vitamin B 12 , 0.025 mg; vitamin E, 30 IU; biotin, 0.0325 mg; folic acid, 1.25 mg; pantothenic acid, 12 mg; niacin, 50 mg. 2.3 Growth performance The chickens in each experimental group were weighed at 20 and 41 days of age, using replicates as the unit of measurement. Their body weight (BW) was recorded, and the feed consumption was monitored. From this data, the average daily weight gain (ADWG) and average daily feed intake (ADFI) for each replicate were calculated. Additionally, the FCR for each replicate was determined based on the ADWG and ADFI values. At 41 days of age, one chicken was randomly selected from each replicate for weighing and subsequently euthanized by jugular vein bleeding. Following the standards outlined in NY/T 823–2020[ 28 ], measurements were taken to calculate various parameters including slaughter rate, semi-eviscerated yield, eviscerated yield, pectoral muscle rate, leg muscle rate, and abdominal fat rate. 2.4 Sample Collection and Processing At 42 days of age, two chickens with weighed approximating the mean were selected and marked from each replicate. The marked chickens were euthanized by jugular vein bleeding. Blood was collected via the wing vein from one chicken. Serum was separated through centrifugation at 3,000 × g for 15 minutes. The supernatant was extracted and stored at -20°C for subsequent physicochemical analysis. The abdominal cavity was promptly opened, and uniformly sized liver and abdominal fat tissues were collected and fixed in 4% paraformaldehyde for morphological analysis. A liver sample measured 1 cm × 1 cm × 1 cm was preserved in 2.5% glutaraldehyde for transmission electron microscopy analysis. Cecal contents, liver, and abdominal fat tissues were snap-frozen in liquid nitrogen and stored at -80°C for analysis of SCFAs, microbial communities, and gene mRNA levels. From the second chicken, liver tissue of consistent size was excised for immediate mitochondrial extraction to monitor oxygen consumption rates in subsequent analysis. 2.5 Morphological Analysis of Liver and Abdominal Adipose Tissue Fresh liver and abdominal fat tissue samples were fixed in 4% paraformaldehyde at room temperature. The samples underwent dehydration, paraffin embedding, sectioning, and hematoxylin-eosin (HE) staining. Images were captured using LIOO 3.7 digital camera software (Leica DM750, Wetzlar, Hesse, Germany). Adipocyte size and distribution in the abdominal fat were measured and calculated from 5 to 6 fields of view per sample using a 100 µm scale bar. 2.6 Lipid Content in Liver, Serum, and Abdominal Fat Determination Levels of serum Triglyceride (TG) and Total Cholesterol (TC) were measured using an automatic biochemical analyzer (Kehua ZY KHB-1280, Beijing, China) following manufacturer instructions. TG and TC levels in the liver and abdominal fat were measured using ELISA kits (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China). 2.7 Liver Mitochondria Transmission Electron Microscopy (TEM) Fresh liver tissues were quickly excised, rinsed with ice-cold hosphate buffer saline (PBS), and cut into 1 mm³ pieces. The pieces were fixed in 2.5% glutaraldehyde at 4°C for 24 h, followed by post-fixation with 1% osmium tetroxide and dehydration through a graded ethanol series. Tissues were embedded in Epon 812 resin, sectioned into 50–70 nm slices using an ultramicrotome, mounted on copper grids, and stained with 2% uranyl acetate and 0.1% lead citrate. Images of liver mitochondria were captured by a transmission electron microscope at 80 kV (HITACHI HT7700, Japan). Quantitative analysis of mitochondrial morphological indicators in different treatment groups was performed using Image J software. 2.8 Liver Mitochondrial Energy Metabolism Assay Liver mitochondria isolation was performed using Beyotime kit according to manufacturer specifications. Fresh tissues were cleaned with ice-cold PBS, minced, and homogenized in ice-cold buffer containing protease inhibitors. The homogenate underwent centrifugation at 600 × g for 10 min to eliminate debris, followed by recentrifugation of the supernatant at 10,000 × g for 15 min to obtain mitochondrial pellets. The pellet was subjected to one wash with kit-provided buffer at 10,000 × g for 10 min, resuspended in storage buffer, and maintained on ice. Following isolation, liver mitochondrial oxygen consumption was assessed using a Seahorse XF Analyzer. Mitochondria (100 µg protein) were suspended in XF Base Medium containing 10 mM glucose, 2 mM glutamine, and 2 mM pyruvate, placed in a Seahorse XF 24-well microplate, and incubated at 37°C without CO₂. Oxygen consumption rate (OCR) measurement involved sequential administration of 2 µM oligomycin, 1 µM FCCP, and 0.5 µM antimycin A + rotenone to evaluate basal respiration, ATP-linked respiration, maximal respiratory capacity, and non-mitochondrial respiration, respectively. Data analysis was conducted using Seahorse Wave software, with OCR normalized to mitochondrial protein content for quantification[ 29 ]. 2.9 Cecal Contents 16S rRNA Sequencing The procedure for extracting DNA from chicken cecum adhered to previously described methods. To amplify the hypervariable regions V3 to V4 of the bacterial 16 S rRNA gene, the primer pair 338 F/806 R (338 F: 5′-ACTCCTACGGAGGCAGCAG-3′; 806 R: 5′-GGACTACHVGGGTWTCTAAT-3′) was utilized. The raw sequencing data were processed by filtering reads and joining paired-end reads with tags employing the Illumina platform. Operational taxonomic units (OTUs) were identified by clustering tags with UPARSE software. The representative sequences for each OTU were taxonomically classified using the Ribosomal Database Project classifier v.2.2 with training from the Greengenes database v201305, utilizing Quantitative Insights into Microbial Ecology (QIIME) software v1.8.0. USEARCH Global compared all taxonomic labels to the identified OTUs to generate a table summarizing OTU abundance across each sample. The MOTHUR software (v1.31.2) and QIIME (v1.8.0) were used to assess "OTU abundance" and "diversity" at the OTU level. Unweighted pair-group average linkage clustering for sample categorization was achieved using QIIME. Visualization of data across different classification levels was accomplished using R package v3.4.1 and R package "gplots," which were utilized to create bar charts and heat maps, respectively. Cluster analysis, including Linear discriminant analysis (LDA) effect size (LEfSe) and LDA, was performed using the LEfSe software. 2.10 Cecal Contents SCFAs Determination Prepare a homogenate by combining cecal contents with distilled water at a ratio of 5:1 (distilled water: cecal contents). Centrifuge the mixture at 12,000 × g for 15 minutes at 4°C. Extract 1 mL of the supernatant and combine with 0.2 mL of 25% (w/v) metaphosphate solution, mixing thoroughly. Store at 4°C for 30 minutes. Perform a second centrifugation at 12,000 × g for 10 minutes to obtain the supernatant for analysis. Determine the SCFAs concentration using a gas chromatography system (Agilent 5975C GC system, Wilmington, NC, USA). 2.11 RNA Extraction and Quantitative Real-time PCR Detection Total RNA was extracted from liver and abdominal fat samples using TRIzol reagent (Takara, Japan). Subsequently, the RNA was reverse transcribed into cDNA using a cDNA Reverse Transcription Kit (Takara, Japan). Using cDNA as the template, qPCR detection was performed with the TB Green Premix Ex Taq II Kit (Takara, Japan) on the QuantStudio 7 Flex real-time PCR system (Applied Biosystems, USA). The mRNA levels of all genes were statistically analyzed using the 2 −ΔΔCt method, with β-actin as the internal reference. The primer sequences for the target genes are shown in Table 2 . Table 2 List of primer sequences for RT-qPCR analysis. Gene Primer sequences (5′-3′) β-actin F: GGTGAAAGTCGGAGTCAACGG R: CGATGAAGGGATCATTGATGGC SCD1 F: CCAGCGGAGATACTACAAGCC R: CCGATTGCCAAACATGTGAGC ACOX1 F: ATGTCACGTTCACCCCATCC R: AGGTAGGAGACCATGCCAGT CPT1 F: TCGTCTTGCCATGACTGGTG R: GCTGTGGTGTCTGACTCGTT ACC F: GGCCAGTGCTATGCTGAGAT R: AGGGTCAAGTGCTGCTCCA CHREBP F: GATGAGCACCGCAAACCAGAGG R: TCGGAGCCGCTTCTTGTAGTAGG PIN2 F: TGCTTCATAGACGGCTGCAT R: AAGAACAAGGCGCAGAAGGA SIRT3 F: GTGAGCTTCTGCTTCCCACT R: GCAGGGTACAAGGGACCAG OPA1 F: CACAATGCTCCCCCAAAAGG R: AGATTGTCAAGCAGCAGCAAC Mfn1 F: TCGGTCGCGTAGTTCACAAA R: ATCGTTGTTGGCGGAGTGAT Mfn2 F: CATTGATGTACGCAGCCAGC R: TGAAGCGCAATGTCCCTGTT NRF1 F: GCAACAGACCACAACCACAC R: TGACTTGTGCGACGGTAACT ATP5B F: GATCACCACCACACGCAAAG R: GGTCCATGATTCGGGAGGTG ATP5C F: TCTGAAAGACATTACCAGGCGT R: CAGCTCCCTCTCAGCTCTTG Cytc F: GGAGTCTGCACTCATCTTGGT R: TCCAGGTTATAGGGGGCAGG TFAM F: AACCTGAGTTATGCTGCTGT R: ACCAAGCCAGAAGTTAGCGT AMPK F: ACTGTGTGGCCTGTCTTGTT R: TCTGAGAATCCTCCCGCTCT SREBP1 F: CCCGAGGGAGACCATCTACA R: GGTACTCCAACGCATCCGAA PPARα F: TGTGGAGATCGTCCTGGTCT R: CGTCAGGATGGTTGGTTTGC PPARγ F: GCAGGAACAGAACAAAGAAG R: TGCCAGGTCACTGTCATCTA 2.12 Data Statistics Analysis Data analysis was conducted using SPSS Statistics 25.0 software. Comparisons between two groups utilized Student's t-test. Results are expressed as "mean ± standard error (SEM)." Statistical significance levels are denoted by * P < 0.05, ** P < 0.01, and *** P < 0.001, with 0.05 ≤ P < 0.10 indicating trending significance. Graphical representations were created using GraphPad Prism 9 software. 3. Results 3.1 Biological Characteristics of Blautia coccoides CML164 In previous studies, our laboratory isolated and cultured a pure strain of Blautia coccoides from the poultry gut, designated as CML164, which was obtained through 16S rRNA sequencing. Whole-genome sequencing revealed that CML164 has a genome size of 5,918,542 bp, containing 5,299 coding sequences (Fig. 1A). KEGG annotation of CML164 displayed a total of 2,149 coding genes distributed across four primary categories in the KEGG database: cellular processes, metabolism, genetic information processing, and environmental information processing, with the metabolism category being the most prevalent. Within the secondary functional categories, Metabolic pathways were the most numerous, with 665 genes annotated, suggesting a strong association between CML164's functions and metabolism (Fig. 1B). 3.2 Growth performance and carcass traits The effects of Blautia coccoides CML164 on broiler growth performance and carcass traits are presented in Fig. 2. Throughout the entire feeding period, CML164 significantly enhanced ADFI ( P 0.05). Regarding slaughter performance, CML164 significantly reduced abdominal fat percentage ( P < 0.05) and indicated a trend toward increased eviscerated rate ( P = 0.079). 3.3 Effects of Blautia coccoides CML164 on lipid metabolism To evaluate CML164 treatment's impact on lipid metabolism in broilers, lipid content measurements were conducted in serum, liver, and abdominal fat across experimental groups (Fig. 3A, B, C). The findings indicated that CML164 supplementation significantly reduced TC levels in abdominal fat at 21 days of age and TG at 42 days of age ( P < 0.05). It also significantly decreased TG levels in the liver at both 21 and 42 days of age ( P < 0.05), as well as TG and TC levels in abdominal fat at 21 days and TG levels at 42 days ( P < 0.05). Histological examination using HE staining of liver and abdominal fat tissue from 42-day-old broilers revealed that the CML164 group exhibited reduced macrosteatosis and hepatocyte ballooning compared to the control group (Fig. 3D, E). Furthermore, CML164 treatment significantly decreased large adipocyte proportions (diameter ≥ 90 µm) while increasing small adipocyte proportions (diameter ≤ 80 µm) in abdominal fat tissue (Fig. 3F). Analysis of fatty acid synthesis and oxidation genes in the liver and abdominal fat revealed that CML164 significantly enhanced liver lipid oxidation-related gene expression, including PPARα and ACOX1 , while suppressing lipid synthesis-related genes, such as SREBP1 and PPARγ ( P < 0.05) (Fig. 3G, H). Similarly, CML164 significantly increased lipid oxidation-related gene expression ( PPARα and CPT1 ) in abdominal fat while inhibiting lipid synthesis-related genes ( SREBP1 and CHREBP ) (Fig. 3I, J) ( P < 0.05). These results demonstrated that dietary CML164 supplementation effectively enhanced lipid metabolism and reduced lipid accumulation in broilers. 3.4 Effects of Blautia coccoides CML164 on energy metabolism We evaluated the morphological alterations of mitochondria in liver tissues from broilers in the CON and CML164 groups using TEM. The electron micrograph images demonstrated that mitochondria in the CON group exhibited irregular shapes, vacuolar tendencies, and cristae rupture. Conversely, mitochondria in the CML164 group displayed intact structures and regular morphology, with abundant mitochondrial content (Fig. 4A, B). To precisely quantify the mitochondrial differences between groups, we performed a quantitative analysis of liver mitochondria from both groups (Fig. 4C, D). Statistical analysis revealed that CML164 supplementation did not significantly affect the quantity, area, long diameter, short diameter, or circumference of mitochondria compared to the control group ( P > 0.05). However, it significantly enhanced mitochondrial density in the control group ( P < 0.05), indicating that CML164 may influence mitochondrial function and metabolism in broilers. Given that mitochondrial metabolism is intrinsically linked to energy changes, and to further investigate whether CML164 intake affects energy metabolism (mitochondrial respiration and glycolysis), we assessed the respiratory activity of liver mitochondria using a cellular respiration energy metabolism monitoring system (Fig. 4E, F, G, H). The statistical analysis revealed that CML164 significantly increased ATP production ( P < 0.05) and showed a tendency to enhance basal respiration ( P = 0.052), converting more potential energy into heat. To elucidate the underlying mechanisms of liver mitochondrial metabolic differences between groups, we analyzed the expression levels of mitochondrial dynamics-related genes in liver and abdominal fat (Fig. 5A, B, C, D). We generated correlation clustering heatmaps for differentially expressed genes associated with lipid and energy metabolism (Fig. 5E, F). The findings showed that CML164 significantly enhanced the expression of liver mitochondrial metabolism-related genes ( P < 0.05), including Cytc , ATP5c , OPA1 , PIN2 , and Mfn2 . Moreover, it significantly increased mitochondrial metabolism-related gene expression in abdominal fat ( P < 0.05), including PIN2 and ATP5b . Based on these mitochondrial and lipid metabolism indicators, CML164 supplementation appeared to enhance energy metabolism and regulate lipid metabolism in broilers. 3.5 Diversity and composition of gut microbiota As shown in Fig. 6A, B, α-diversity indices (Simpson and Chao1) and observed species counts showed no significant differences between two groups ( P > 0.05). Sample coverage rates exceeded 99.99%, confirming their validity for subsequent analyses. β-diversity was evaluated through principal coordinate analysis to assess microbial compositional similarity between two groups (Fig. 6C, D). The PCoA and PLS-DA ordination plot revealed distinct clustering of CML164 and CON group communities, suggesting that CML164 intervention altered the colonic microbial structure of growing broilers. Additional analyses of gut microbiota relative abundance at phylum and species levels were presented in Fig. 6E-G. At the phylum level, Firmicutes and Bacteroidetes dominated both groups. CML164 supplementation increased Firmicutes while decreasing Bacteroidota relative abundance compared to control group. At genus and species levels, Barnesiella , Bacteroides , and Lachnospiraceae were the predominant genera, while Barnesiella_viscericola , Phocaeicola_dorei , and Faecalibacterium_bacterium_ic1379 were the most abundant species. Additionally, CML164 supplementation induced various changes in gut microbiota from phylum to species level. The linear discriminant analysis effect size (LEfSe) method identified significantly different microbial populations across the microbiome ( P 2.0). As illustrated in Fig. 6H, the CML164 group showed significantly increased relative abundances of Phocaeicola_vulgatus , Parabacteroides_distasonis , Ruminococcus , Burkholderiales , and Prevotellaceae compared to the CON group. The cecal chyme microbiota analysis indicated that CML164 supplementation enhanced beneficial bacteria while reducing pathogenic bacteria in the broiler gut. 3.6 Cecal SCFAs profile of broilers The contents of acetate, propionate, butyrate, valerate, isobutyrate, isovalerate, and total SCFAs were detected by gas chromatography. Regarding major SCFAs (Fig. 6I), propionate and butyrate levels in broiler ceca showed no significant changes with CML164 supplementation ( P > 0.05), while acetate concentration increased significantly ( P 0.05), while isobutyrate and isovalerate levels showed an increasing trend ( P = 0.090, P = 0.087). 4. Discussion Broiler chickens have emerged as one of the most rapidly expanding and efficient sources of animal protein, with significant increases in production to maximize meat yields[ 30 ]. However, intensive, high-density farming conditions substantially enhance fatty acid synthesis in broiler chicken livers while limiting lipid breakdown metabolism[ 31 , 32 ]. Consequently, achieving equilibrium between meat yield and quality has become a critical challenge in the broiler chicken industry. Recent studies have demonstrated the significance of the gut microbiota Blautia in various obesity-related metabolic syndromes. Blautia facilitated SCFAs production, modulated amino acid and fatty acid metabolism, and maintained intestinal homeostasis, demonstrating potential probiotic properties[ 25 ]. Research has shown that Blautia wexlerae supplementation mitigated obesity-related weight gain and inflammation in mice on high-fat diets through acetic acid production and gut microbiota modification[ 34 ]. Studies indicated that administering Blautia producta to high-fat diet mice significantly decreased lipid accumulation[ 35 ]. Furthermore, research has identified Blautia coccoides as a novel bacterium that proliferates during leucine deficiency and ameliorates metabolic disorders in high-fat mice through tryptophan metabolism[ 12 ]. However, research examining specific Blautia strains and their impact on animal lipid metabolism remains limited, particularly regarding broilers. Consequently, our laboratory isolated a pure strain of Blautia coccoides CML164 and conducted broiler feeding trials to examine its regulatory effects. In broiler production, growth performance and carcass traits are served as fundamental indicators determining industry economic benefits and product quality[ 36 , 37 ]. Growth performance encompasses weight, feed intake, and FCR, directly influencing farming efficiency and costs. Carcass traits comprise meat yield (including breast and leg meat percentages) and abdominal fat rate, which directly affect meat quality and economic value. This study demonstrated that dietary CML164 supplementation enhanced both feed intake and body weight throughout the rearing period. Notably, FCR remained consistent between groups during early, late, and entire feeding periods. FCR provides a direct measure of input-output efficiency in broiler production and has become crucial for evaluating farming efficiency[ 38 ]. These findings indicated that CML164 dietary maintained production performance, farming efficiency, and cost effectiveness. Regarding carcass characteristics, CML164 supplementation markedly reduced abdominal fat rates in broilers, consistent with previous research showed Blautia species effectively decreased animal fat accumulation[ 39 ]. Typically, excessive abdominal fat accumulation correlates with liver fat degeneration and irregular intramuscular fat distribution, reducing meat tenderness[ 40 ]. Lower-fat broilers typically exhibit improved feed efficiency, reducing economic losses during farming and processing[ 41 ]. The results demonstrate that Blautia coccoides CML164 supplementation enhanced carcass traits, reduced abdominal fat deposition, and increased lean meat ratio while maintaining growth performance. The liver, serving as the central organ for lipid metabolism, plays a pivotal role in maintaining lipid metabolic homeostasis[ 42 ]. Its key functions encompass the de novo synthesis of endogenous triglycerides and the biosynthesis of phospholipids and cholesterol[ 43 ]. In poultry, approximately 90% of body fat synthesis occurs in the liver, where fatty acids combine with glycerol to form TG. These TG can be stored in the liver or transported through the bloodstream to other tissues, such as adipose and muscle tissues, completing the fat storage process[ 44 ]. The breakdown and synthesis of TG within animal organisms maintain a dynamic equilibrium[ 45 ]. When TG breakdown exceeds synthesis, this process inhibits further adipocyte differentiation, resulting in reduced body fat content. Conversely, when TG breakdown falls below synthesis, it promotes adipocyte differentiation, leading to lipid droplet accumulation within cells and increased fat content. Previous studies have demonstrated that enhancing serum lipid profiles, while reducing hepatic lipid accumulation and absorption, constitute effective strategies for decreasing fat deposition[ 46 ]. In this study, dietary supplementation with CML164 significantly reduced the abdominal fat percentage in 42-day-old broilers. To elucidate the underlying mechanism, we investigated key processes including hepatic lipid synthesis, lipoprotein secretion and transport, and abdominal adipose tissue deposition. Histological examination via liver HE staining revealed normal hepatocyte morphology and the absence of pathological changes such as fatty vacuoles in both groups, indicating that the reduction in lipid deposition induced by CML164 was not attributable to liver damage. Further analysis showed that CML164 treatment significantly decreased hepatic TG levels at both 21 and 42 days of age. As the central medium for lipid transport and systemic metabolic regulation, blood lipid metabolic parameters reflect overall lipid homeostasis[ 47 ]. Serum biochemical analysis demonstrated that TG levels were significantly lower in the CML164 group at both 21 and 42 days of age. The reduction in serum TG may be associated with inhibited hepatic de novo fatty acid synthesis or enhanced triglyceride breakdown catalyzed by hormone-sensitive lipase (HSL)[ 48 , 49 ]. Analysis of abdominal adipose tissue showed that the average adipocyte diameter and tissue TG content were significantly reduced in the CML164 group at 42 days of age, suggesting decreased lipid storage in adipocytes. This effect is generally regulated by a dynamic balance among fatty acid uptake, lipid synthesis, lipolysis, and fatty acid oxidation. To further explore the molecular mechanism by which CML164 reduces abdominal fat deposition, we examined the mRNA expression levels of key genes involved in lipid metabolism in the liver and abdominal adipose tissue based on the phenotypic findings described above. The results revealed that CML164 enhanced the expression of fatty acid oxidation genes while suppressing fatty acid synthesis genes. PPARα , a nuclear receptor transcription factor, functions as a primary regulator of fatty acid oxidation, activating downstream genes such as ACOX1 and CPT1 , thereby reducing TG accumulation. SREBP1 , a core regulator of fatty acid synthesis genes (including PPAR-γ and CHREBP ), when downregulated, directly inhibits fatty acid-related enzyme synthesis in liver and adipose tissue, decreasing endogenous fatty acid production[ 50 , 51 ]. In conclusion, dietary supplementation with Blautia coccoides CML164 in broilers regulates lipid metabolism by inhibiting adipocyte differentiation, suppressing lipogenesis, and promoting lipolysis and fatty acid oxidation, thereby ultimately reducing abdominal fat deposition. Our finding corresponded with previous results showing that Blautia bacteria administration reduced hepatic lipid levels in high-fat animal model. Mitochondria, the cellular energy factories, are essential for lipid catabolism, with their metabolic functions closely linked to lipid metabolism, particularly lipid oxidation[ 44 ]. Additionally, energy production, transport, and lipid transport metabolism represented 6.58% and 4.03%, respectively, of the functional pathways associated with the Blautia genus[ 11 ]. Carbohydrates in the chicken's diet, after being digested and absorbed, generate acetyl-CoA via the glycolytic pathway. This acetyl-CoA then serves as a substrate for de novo fatty acid synthesis. The process of de novo fatty acid synthesis in hepatocytes begins with the cytosolic translocation of acetyl-CoA[ 53 , 54 ]. Specifically, within the mitochondrial matrix of hepatocytes, synthesized acetyl-CoA combines with oxaloacetate under the action of citrate synthase to form citrate. The citrate is subsequently transported into the cytosol via the tricarboxylate transporter[ 55 ]. Subsequently, the effects of CML164 on energy changes in broilers were analyzed. The study revealed that CML164 supplementation enhanced liver mitochondrial metabolic activity and increased nuclear transcription factor expression in liver and abdominal fat mitochondrial tissues, accelerating energy cycling. Research has shown that accelerated mitochondrial metabolism directs more acetyl-CoA toward oxidative breakdown, thereby affecting the supply of reducing equivalents required for cytoplasmic fatty acid synthesis and subsequently reducing both substrate availability and the activation of key enzymes for lipogenesis[ 56 ]. In conclusion, dietary Blautia coccoides CML164 supplementation significantly enhanced liver mitochondrial respiratory function, increased ATP production, converted more potential energy into heat, and promoted fatty acid oxidation. Consequently, broiler fat reserved are more efficiently converted into energy, resulting in reduced abdominal fat. The gut microbiome serves a vital function in host health, encompassing nutrient absorption, metabolism, and immune function[ 57 ]. Research demonstrated that dietary factors significantly influenced gut microbiota composition[ 58 ]. This investigation revealed that supplementing broiler chicken diets with CML164 modified the bacterial community in their cecum. LEfSe analysis demonstrated elevated abundances of Phocaeicola vulgatus , Parabacteroides distasonis , and Prevotellaceae in the CML164 group. These bacterial taxa produced SCFAs, which function as energy sources and signaling molecules that regulated energy homeostasis and physiological processes. Phocaeicola vulgatus , belonging to the Bacteroidetes phylum, generates acetic acid and propionic acid. The propionic acid metabolite decreases hepatic triglyceride synthesis while promoting fatty acid β-oxidation[ 59 ]. Parabacteroides distasonis produces acetic acid and butyric acid, affecting lipid absorption through bile acid metabolism regulation. Studies indicated that this bacterium enhanced liver PPARα expression in high-fat diet models, thereby improving mitochondrial fatty acid oxidation capacity[ 60 ]. Prevotellaceae metabolize indigestible polysaccharides (such as arabinoxylan) to generate acetic acid, propionic acid, and butyric acid, enhancing insulin sensitivity and reducing fat synthesis[ 61 ]. These results indicated that Blautia coccoides CML164 enhanced SCFAs-producing bacterial populations in broiler chicken gut. SCFAs constitute the primary metabolic products of gut microbes, and alterations in microbial communities inherently affect SCFAs production[ 62 ]. The present study revealed significantly elevated acetic acid concentrations in the cecum of CML164-fed chickens. Acetic acid maintains energy balance and metabolic homeostasis, influences immune function, and regulates lipid metabolism[ 63 , 64 ]. Acetic acid promotes white adipose tissue browning by increasing mitochondrial quantity and energy expenditure, enhancing mitochondrial metabolism; it stimulates fatty acid oxidation while suppressing de novo lipogenesis in the liver, thus reducing fat accumulation through catabolic and anabolic pathways. These findings suggested that Blautia coccoides CML164 optimized fat deposition in broiler chickens by enriching beneficial microbes, particularly those producing SCFAs. 5. Conclusion In summary, Blautia coccoides CML164 serves as a beneficial and effective dietary supplement that reduces abdominal fat deposition in broilers without compromising their production performance. The underlying mechanism is possibly attributed to CML164 increasing acetic acid levels and the abundance of SCFAs-producing beneficial gut bacteria. This accelerated energy and fatty acid metabolism in broiler chickens, modulated fat deposition rates. This research established a theoretical foundation for producing high-quality chicken meat and provided novel insights into gut microbiota's role in mediating poultry fat deposition. Declarations Ethics approval and consent to participate All procedures followed the Guidelines for the Care and Use of Laboratory Animals in China and were approved by the Ethics Committee of China Agricultural University (Approval NO. statement no. AW30112202-1-1). CRediT authorship contribution statement Zhouyang Gao: Writing – review & editing, Writing – original draft, Software, Investigation, Formal analysis, Data curation, Conceptualization. Xiaohang Yang, Muying Nie, Suxin Shi: Writing – review & editing, Methodology. Gaoxiang Yuan, Xiaoyi Li, Yuying Zhang: Writing – review & editing, Supervision. Dan Liu: Writing – review & editing, Project administration, Methodology, Funding acquisition, Conceptualization. All authors read and approved the finally manuscript. Declaration of competing interest The authors declare that they have no known competing financial interests. Acknowledgments This work was supported by the National Key Research and Development Program of China (2022YFD1300400) and the 2115 Talent Development Program of China Agricultural University. Data availability No data was used for the research described in the article. References Chanda D, De D (2024) Meta-analysis reveals obesity associated gut microbial alteration patterns and reproducible contributors of functional shift. Gut Microbes 16:2304900. https://doi.org/10.1080/19490976.2024.2304900 Sanders ME, Merenstein DJ, Reid G, et al (2019) Probiotics and prebiotics in intestinal health and disease: from biology to the clinic. Nat Rev Gastroenterol Hepatol 16:605–616. https://doi.org/10.1038/s41575-019-0173-3 Ahmed K, Choi H-N, Cho S-R, Yim J-E (2024) Association of Firmicutes/Bacteroidetes Ratio with Body Mass Index in Korean Type 2 Diabetes Mellitus Patients. Metabolites 14:518. https://doi.org/10.3390/metabo14100518 Wang Z, Zeng M, Wang Z, et al (2023) Food phenolics stimulate adipocyte browning via regulating gut microecology. Crit Rev Food Sci Nutr 63:4026–4052. https://doi.org/10.1080/10408398.2021.1997905 Cani PD, Van Hul M (2024) Gut microbiota in overweight and obesity: crosstalk with adipose tissue. Nat Rev Gastroenterol Hepatol 21:164–183. https://doi.org/10.1038/s41575-023-00867-z Wei Y-H, Ma X, Zhao J-C, et al (2023) Succinate metabolism and its regulation of host-microbe interactions. Gut Microbes 15:2190300. https://doi.org/10.1080/19490976.2023.2190300 Krawczyk B, Wityk P, Gałęcka M, Michalik M (2021) The Many Faces of Enterococcus spp.-Commensal, Probiotic and Opportunistic Pathogen. Microorganisms 9:1900. https://doi.org/10.3390/microorganisms9091900 Raheem A, Liang L, Zhang G, Cui S (2021) Modulatory Effects of Probiotics During Pathogenic Infections With Emphasis on Immune Regulation. Front Immunol 12:616713. https://doi.org/10.3389/fimmu.2021.616713 Chai Z, Yan Y, Zan S, et al (2022) Probiotic-fermented blueberry pomace alleviates obesity and hyperlipidemia in high-fat diet C57BL/6J mice. Food Res Int Ott Ont 157:111396. https://doi.org/10.1016/j.foodres.2022.111396 Huang J, Jiang R, Wang Y (2023) Effects of the probiotic Bacillus coagulans BC69 on the metabolic and histological alterations induced by a high-sugar and high-fat diet in C57BL/6J mice. Food Funct 14:6596–6609. https://doi.org/10.1039/d3fo01104f Liu X, Mao B, Gu J, et al (2021) Blautia-a new functional genus with potential probiotic properties? Gut Microbes 13:1–21. https://doi.org/10.1080/19490976.2021.1875796 Niu Y, Hu X, Song Y, et al (2024) Blautia Coccoides is a Newly Identified Bacterium Increased by Leucine Deprivation and has a Novel Function in Improving Metabolic Disorders. Adv Sci Weinh Baden-Wurtt Ger 11:e2309255. https://doi.org/10.1002/advs.202309255 Trischler R, Roth J, Sorbara MT, et al (2022) A functional Wood-Ljungdahl pathway devoid of a formate dehydrogenase in the gut acetogens Blautia wexlerae, Blautia luti and beyond. Environ Microbiol 24:3111–3123. https://doi.org/10.1111/1462-2920.16029 Liu S, Zhao L, Xiao X, et al (2022) Acetate promotes lipogenesis in adipocytes but not in hepatocytes of chickens. Br Poult Sci 63:54–61. https://doi.org/10.1080/00071668.2021.1960950 Moffett JR, Puthillathu N, Vengilote R, et al (2020) Acetate Revisited: A Key Biomolecule at the Nexus of Metabolism, Epigenetics and Oncogenesis-Part 1: Acetyl-CoA, Acetogenesis and Acyl-CoA Short-Chain Synthetases. Front Physiol 11:580167. https://doi.org/10.3389/fphys.2020.580167 Ni M, He H, Chen M, et al (2024) Supplementation of sodium acetate improves the growth performance and intestinal health of rabbits through Wnt/β-catenin signaling pathway. J Anim Sci 102:skae197. https://doi.org/10.1093/jas/skae197 Sahuri-Arisoylu M, Brody LP, Parkinson JR, et al (2016) Reprogramming of hepatic fat accumulation and “browning” of adipose tissue by the short-chain fatty acid acetate. Int J Obes 2005 40:955–963. https://doi.org/10.1038/ijo.2016.23 Xu C, Yin Z (2024) Unraveling the flavor profiles of chicken meat: Classes, biosynthesis, influencing factors in flavor development, and sensory evaluation. Compr Rev Food Sci Food Saf 23:e13391. https://doi.org/10.1111/1541-4337.13391 Li L, Cui Z, Wang H, et al (2023) Dietary supplementation of dimethyl itaconate protects against chronic heat stress-induced growth performance impairment and lipid metabolism disorder in broiler chickens. J Anim Sci 101:skad120. https://doi.org/10.1093/jas/skad120 Choi J, Kong B, Bowker BC, et al (2023) Nutritional Strategies to Improve Meat Quality and Composition in the Challenging Conditions of Broiler Production: A Review. Anim Open Access J MDPI 13:1386. https://doi.org/10.3390/ani13081386 Kim M, Voy BH (2021) Fighting Fat With Fat: n-3 Polyunsaturated Fatty Acids and Adipose Deposition in Broiler Chickens. Front Physiol 12:755317. https://doi.org/10.3389/fphys.2021.755317 Lone A, Mottawea W, Mehdi Y, Hammami R (2022) Bacteriocinogenic probiotics as an integrated alternative to antibiotics in chicken production - why and how? Crit Rev Food Sci Nutr 62:8744–8760. https://doi.org/10.1080/10408398.2021.1932722 Cai Y, Xiao C, Tian B, et al (2024) Dietary probiotic based on a dual-strain Bacillus subtilis improves immunity, intestinal health, and growth performance of broiler chickens. J Anim Sci 102:skae183. https://doi.org/10.1093/jas/skae183 Wang Y, Zhang C, Chen X, et al (2024) Dietary supplementation of compound probiotics to improve performance, egg quality, biochemical parameters and intestinal morphology of laying hens. Front Vet Sci 11:1505151. https://doi.org/10.3389/fvets.2024.1505151 Yang X, Zhang M, Liu Y, et al (2023) Inulin-enriched Megamonas funiformis ameliorates metabolic dysfunction-associated fatty liver disease by producing propionic acid. NPJ Biofilms Microbiomes 9:84. https://doi.org/10.1038/s41522-023-00451-y Liu Y, Feng Y, Yang X, et al (2023) Mining chicken ileal microbiota for immunomodulatory microorganisms. ISME J 17:758–774. https://doi.org/10.1038/s41396-023-01387-z Lin XJ, Li L, Gou ZY, et al (2021) Reproductive performance, metabolism and oxidative stress profile in Chinese yellow-feathered broiler breeder hens fed multiple levels of isoleucine. Br Poult Sci 62:509–516. https://doi.org/10.1080/00071668.2021.1894322 Liu Z, Chen Q, Zhong Y, et al (2023) Effects of earthworm hydrolysate in production performance, serum biochemical parameters, antioxidant capacity and intestinal function of Muscovy ducks. Poult Sci 102:102409. https://doi.org/10.1016/j.psj.2022.102409 Ludikhuize MC, Meerlo M, Burgering BMT, Rodríguez Colman MJ (2021) Protocol to profile the bioenergetics of organoids using Seahorse. STAR Protoc 2:100386. https://doi.org/10.1016/j.xpro.2021.100386 Shah AA, Totakul P, Matra M, et al (2022) Nutritional composition of various insects and potential uses as alternative protein sources in animal diets. Anim Biosci 35:317–331. https://doi.org/10.5713/ab.21.0447 Li A, Hu H, Huang Y, et al (2024) Effects of dietary metabolizable energy level on hepatic lipid metabolism and cecal microbiota in aged laying hens. Poult Sci 103:103855. https://doi.org/10.1016/j.psj.2024.103855 Yin C, Tang S, Liu L, et al (2021) Effects of Bile Acids on Growth Performance and Lipid Metabolism during Chronic Heat Stress in Broiler Chickens. Anim Open Access J MDPI 11:630. https://doi.org/10.3390/ani11030630 Markowiak-Kopeć P, Śliżewska K (2020) The Effect of Probiotics on the Production of Short-Chain Fatty Acids by Human Intestinal Microbiome. Nutrients 12:1107. https://doi.org/10.3390/nu12041107 Hosomi K, Saito M, Park J, et al (2022) Oral administration of Blautia wexlerae ameliorates obesity and type 2 diabetes via metabolic remodeling of the gut microbiota. Nat Commun 13:4477. https://doi.org/10.1038/s41467-022-32015-7 Xu W, Yu J, Yang Y, et al (2023) Strain-level screening of human gut microbes identifies Blautia producta as a new anti-hyperlipidemic probiotic. Gut Microbes 15:2228045. https://doi.org/10.1080/19490976.2023.2228045 Sakr SA, Abouelnaga AF, Ateya AI, et al (2025) Growth performance, behavior, gene expression, carcass characteristics, stress indicators, and economical parameters of avian 48 broiler chickens raised under three different stocking density. Front Vet Sci 12:1517142. https://doi.org/10.3389/fvets.2025.1517142 Wang Q, Wang L, Li L, et al (2024) Effects of dietary supplementation of fermented Artemisia argyi on growth performance, slaughter performance, and meat quality in broilers. Poult Sci 103:103545. https://doi.org/10.1016/j.psj.2024.103545 Liu H, Wang L, Guo Z, et al (2021) Genome-wide association and selective sweep analyses reveal genetic loci for FCR of egg production traits in ducks. Genet Sel Evol GSE 53:98. https://doi.org/10.1186/s12711-021-00684-5 Holmberg SM, Feeney RH, Prasoodanan P K V, et al (2024) The gut commensal Blautia maintains colonic mucus function under low-fiber consumption through secretion of short-chain fatty acids. Nat Commun 15:3502. https://doi.org/10.1038/s41467-024-47594-w Jing Y, Yuan Y, Monson M, et al (2021) Multi-Omics Association Reveals the Effects of Intestinal Microbiome-Host Interactions on Fat Deposition in Broilers. Front Microbiol 12:815538. https://doi.org/10.3389/fmicb.2021.815538 Park S-Y, Byeon D-S, Kim G-W, Kim H-Y (2021) Carcass and retail meat cuts quality properties of broiler chicken meat based on the slaughter age. J Anim Sci Technol 63:180–190. https://doi.org/10.5187/jast.2021.e2 Benedé-Ubieto R, Cubero FJ, Nevzorova YA (2024) Breaking the barriers: the role of gut homeostasis in Metabolic-Associated Steatotic Liver Disease (MASLD). Gut Microbes 16:2331460. https://doi.org/10.1080/19490976.2024.2331460 Ouyang S, Zhuo S, Yang M, et al (2024) Glycerol Kinase Drives Hepatic de novo Lipogenesis and Triglyceride Synthesis in Nonalcoholic Fatty Liver by Activating SREBP-1c Transcription, Upregulating DGAT1/2 Expression, and Promoting Glycerol Metabolism. Adv Sci Weinh Baden-Wurtt Ger 11:e2401311. https://doi.org/10.1002/advs.202401311 Appleton SR, Ballou A, Watkins KL (2024) Use of Monoglycerides and Diglycerides to Mitigate Poultry Production Losses: A Review. Vet Sci 11:101. https://doi.org/10.3390/vetsci11030101 Santoro A, McGraw TE, Kahn BB (2021) Insulin action in adipocytes, adipose remodeling, and systemic effects. Cell Metab 33:748–757. https://doi.org/10.1016/j.cmet.2021.03.019 Heeren J, Scheja L (2021) Metabolic-associated fatty liver disease and lipoprotein metabolism. Mol Metab 50:101238. https://doi.org/10.1016/j.molmet.2021.101238 Ford H, Strieder-Barboza C (2025) Depot-dependent effects of subclinical ketosis on visceral and subcutaneous adipose tissue transcriptional cellular diversity in dairy cows. J Anim Sci Biotechnol 16:128. https://doi.org/10.1186/s40104-025-01265-y Mz D, B V, R C-N (2025) Lipid Hormones at the Intersection of Metabolic Imbalances and Endocrine Disorders. Curr Issues Mol Biol 47:. https://doi.org/10.3390/cimb47070565 Engin A (2024) Nonalcoholic Fatty Liver Disease and Staging of Hepatic Fibrosis. Adv Exp Med Biol 1460:539–574. https://doi.org/10.1007/978-3-031-63657-8_18 Tahri-Joutey M, Andreoletti P, Surapureddi S, et al (2021) Mechanisms Mediating the Regulation of Peroxisomal Fatty Acid Beta-Oxidation by PPARα. Int J Mol Sci 22:8969. https://doi.org/10.3390/ijms22168969 Montaigne D, Butruille L, Staels B (2021) PPAR control of metabolism and cardiovascular functions. Nat Rev Cardiol 18:809–823. https://doi.org/10.1038/s41569-021-00569-6 Chen Y-Y, Chen X-G, Zhang S (2022) Druggability of lipid metabolism modulation against renal fibrosis. Acta Pharmacol Sin 43:505–519. https://doi.org/10.1038/s41401-021-00660-1 Luo C, Yu Y, Meng G, Yuan J (2025) Slowly digestible starch impairs growth performance of broiler chickens offered low-protein diet supplemental higher amino acid densities by inhibiting the utilization of intestinal amino acid. J Anim Sci Biotechnol 16:12. https://doi.org/10.1186/s40104-024-01142-0 Van Every HA, Schmidt CJ (2021) Transcriptomic and metabolomic characterization of post-hatch metabolic reprogramming during hepatic development in the chicken. BMC Genomics 22:380. https://doi.org/10.1186/s12864-021-07724-w Fernandez-Fuente G, Rigby MJ, Puglielli L (2023) Intracellular Citrate/acetyl-CoA flux and endoplasmic reticulum acetylation: Connectivity is the answer. Mol Metab 67:101653. https://doi.org/10.1016/j.molmet.2022.101653 Felix JB, Cox AR, Hartig SM (2021) Acetyl-CoA and Metabolite Fluxes Regulate White Adipose Tissue Expansion. Trends Endocrinol Metab TEM 32:320–332. https://doi.org/10.1016/j.tem.2021.02.008 de Vos WM, Tilg H, Van Hul M, Cani PD (2022) Gut microbiome and health: mechanistic insights. Gut 71:1020–1032. https://doi.org/10.1136/gutjnl-2021-326789 Zhang P (2022) Influence of Foods and Nutrition on the Gut Microbiome and Implications for Intestinal Health. Int J Mol Sci 23:9588. https://doi.org/10.3390/ijms23179588 Vital S-T, Clausen U, Füssel J, et al (2024) Global Growth Phase Response of the Gut Bacterium Phocaeicola vulgatus (Phylum Bacteroidota). Microb Physiol 34:153–169. https://doi.org/10.1159/000538914 Guo M, Jiang X, Ouyang H, et al (2025) Parabacteroides distasonis promotes liver regeneration by increasing β-hydroxybutyric acid (BHB) production and BHB-driven STAT3 signals. Acta Pharm Sin B 15:1430–1446. https://doi.org/10.1016/j.apsb.2025.01.024 Betancur-Murillo CL, Aguilar-Marín SB, Jovel J (2022) Prevotella: A Key Player in Ruminal Metabolism. Microorganisms 11:1. https://doi.org/10.3390/microorganisms11010001 Martin-Gallausiaux C, Marinelli L, Blottière HM, et al (2021) SCFA: mechanisms and functional importance in the gut. Proc Nutr Soc 80:37–49. https://doi.org/10.1017/S0029665120006916 He J, Zhang P, Shen L, et al (2020) Short-Chain Fatty Acids and Their Association with Signalling Pathways in Inflammation, Glucose and Lipid Metabolism. Int J Mol Sci 21:6356. https://doi.org/10.3390/ijms21176356 Yao Y, Cai X, Fei W, et al (2022) The role of short-chain fatty acids in immunity, inflammation and metabolism. Crit Rev Food Sci Nutr 62:1–12. https://doi.org/10.1080/10408398.2020.1854675 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 17 Feb, 2026 Reviews received at journal 15 Feb, 2026 Reviewers agreed at journal 08 Feb, 2026 Reviews received at journal 23 Jan, 2026 Reviewers agreed at journal 15 Jan, 2026 Reviewers invited by journal 13 Jan, 2026 Editor assigned by journal 06 Jan, 2026 Submission checks completed at journal 06 Jan, 2026 First submitted to journal 04 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8511274","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":575115407,"identity":"a7abb751-be27-4910-bbd7-1608da1a006b","order_by":0,"name":"Zhouyang Gao","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhouyang","middleName":"","lastName":"Gao","suffix":""},{"id":575115408,"identity":"df55d7ff-3a48-45c1-b265-6979b764741b","order_by":1,"name":"Xiaohang Yang","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiaohang","middleName":"","lastName":"Yang","suffix":""},{"id":575115409,"identity":"01efe95a-ee33-47ca-bcc2-a6cf2d30b756","order_by":2,"name":"Muying Nie","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Muying","middleName":"","lastName":"Nie","suffix":""},{"id":575115410,"identity":"bfb4ed23-89d7-4c56-860c-1f2cad09e933","order_by":3,"name":"Suxin Shi","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Suxin","middleName":"","lastName":"Shi","suffix":""},{"id":575115411,"identity":"4b28fa81-e956-4125-9186-6e76f89170c9","order_by":4,"name":"Gaoxiang Yuan","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Gaoxiang","middleName":"","lastName":"Yuan","suffix":""},{"id":575115412,"identity":"c3bbc737-fc3e-4f3d-886d-2c21b9d4d665","order_by":5,"name":"Xiaoyi Li","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyi","middleName":"","lastName":"Li","suffix":""},{"id":575115413,"identity":"a1c4cacf-8b59-45b4-a8e3-f9e8888da7d4","order_by":6,"name":"Yuying Zhang","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuying","middleName":"","lastName":"Zhang","suffix":""},{"id":575115414,"identity":"c55a48c1-28ec-430e-a986-33c1578cb90f","order_by":7,"name":"Dan Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAoklEQVRIiWNgGAWjYBACPmYGBokPELYBcVrYgFokZ5CmBYileUjTws5jeNumxi6xgb15mwRDzR1iHMZjbJ1zLDmxgedYmQTDsWdEaTGTzm1gTmyQyDGTYGw4TKQWy4b6xAb5N6RoAaoE2sJDtBa2YsueY8eN23jSii0SjhGhhZ//8MYbP2qqZfvZgYwPNURoQVgHIhJI0DAKRsEoGAWjAA8AAFUNLGz/rIYzAAAAAElFTkSuQmCC","orcid":"","institution":"China Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Dan","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2026-01-04 07:53:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8511274/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8511274/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100546867,"identity":"9489600e-b00a-447e-98c7-faa2107cc62e","added_by":"auto","created_at":"2026-01-19 08:13:00","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":127335,"visible":true,"origin":"","legend":"","description":"","filename":"PAPmanuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/fbf377d2aced9be4deadef38.docx"},{"id":100448254,"identity":"573b8c82-ca9f-46c4-87ec-c8d8d7cf963b","added_by":"auto","created_at":"2026-01-16 19:16:54","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8754,"visible":true,"origin":"","legend":"","description":"","filename":"3d37e3377318423ca4ad965a1cc3e786.json","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/fdbdb9d48cd16524a1e5bdd9.json"},{"id":100547630,"identity":"dd5f1404-f610-43c5-9744-2572b30a2c14","added_by":"auto","created_at":"2026-01-19 08:16:09","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1505648,"visible":true,"origin":"","legend":"","description":"","filename":"PAPFIGURE.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/6216e02d9099bfc977e27bc9.pdf"},{"id":100448261,"identity":"78c51499-5b02-4404-802a-0198f11ce247","added_by":"auto","created_at":"2026-01-16 19:16:54","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":158597,"visible":true,"origin":"","legend":"","description":"","filename":"3d37e3377318423ca4ad965a1cc3e7861enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/820ee809844893f401217ccb.xml"},{"id":100448263,"identity":"b08a26e4-707c-4b2b-ac0d-5a968c170065","added_by":"auto","created_at":"2026-01-16 19:16:54","extension":"xml","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":155919,"visible":true,"origin":"","legend":"","description":"","filename":"3d37e3377318423ca4ad965a1cc3e7861structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/fcfd306210457213721da60a.xml"},{"id":100448262,"identity":"2bde07c1-c02f-4fc2-b535-3ef7a1527dfd","added_by":"auto","created_at":"2026-01-16 19:16:54","extension":"html","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":172785,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/813819626c87f0a5539fa24a.html"},{"id":100547295,"identity":"6ae39122-f54c-479a-83bb-fc1fd47928cd","added_by":"auto","created_at":"2026-01-19 08:15:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":895632,"visible":true,"origin":"","legend":"\u003cp\u003e\u0026nbsp;See image above for figure legend.\u003c/p\u003e","description":"","filename":"PAPFIGURE1.png","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/8997f4821d0b15615a7a4d67.png"},{"id":100448252,"identity":"87499d3c-1e37-407f-a2aa-065a4d8989d3","added_by":"auto","created_at":"2026-01-16 19:16:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":264498,"visible":true,"origin":"","legend":"\u003cp\u003e\u0026nbsp;See image above for figure legend.\u003c/p\u003e","description":"","filename":"PAPFIGURE2.png","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/ea8b6a1b4c887913c355f577.png"},{"id":100448255,"identity":"335d9d18-48af-498e-b78c-375e7c5e5b02","added_by":"auto","created_at":"2026-01-16 19:16:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2023390,"visible":true,"origin":"","legend":"\u003cp\u003e\u0026nbsp;See image above for figure legend.\u003c/p\u003e","description":"","filename":"PAPFIGURE4.png","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/1b557790032c368858133fba.png"},{"id":100547892,"identity":"5dd1ca7c-880a-44f4-a9b1-14f9a25c2b16","added_by":"auto","created_at":"2026-01-19 08:16:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1235027,"visible":true,"origin":"","legend":"\u003cp\u003e\u0026nbsp;See image above for figure legend.\u003c/p\u003e","description":"","filename":"PAPFIGURE7.png","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/e1aaf18c0077e287184e9af8.png"},{"id":100448257,"identity":"fb13f8ec-857e-4a02-967a-4bb69a74ab5b","added_by":"auto","created_at":"2026-01-16 19:16:54","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":251252,"visible":true,"origin":"","legend":"\u003cp\u003e\u0026nbsp;See image above for figure legend.\u003c/p\u003e","description":"","filename":"PAPFIGURE9.png","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/3083b2b0ac61b2827740b4a3.png"},{"id":100547801,"identity":"100f61ef-b578-4694-ab43-82784d36d5a5","added_by":"auto","created_at":"2026-01-19 08:16:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":872785,"visible":true,"origin":"","legend":"\u003cp\u003e\u0026nbsp;See image above for figure legend.\u003c/p\u003e","description":"","filename":"PAPFIGURE11.png","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/780f58fe06ecb0b683a2e6be.png"},{"id":100554322,"identity":"c4cc45db-dffc-4d0e-aa1b-7f5c5af1c109","added_by":"auto","created_at":"2026-01-19 08:38:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6599178,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8511274/v1/c80b1c78-1106-493e-ade7-13b53cbbcc1c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Blautia coccoides CML164 improved lipid and energy metabolism in broiler chickens via gut microbiota pathways","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eIn recent years, a burgeoning body of research has established a robust association between gut microbiota and obesity, alongside related metabolic disorders. Many scientists postulate that perturbations in gut microbial composition represent one of the etiological factors contributing to obesity, with marked differences in gut microbial profiles observed between obese individuals and those with normal body weight[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. To date, the majority of studies have reported reduced colonic microbial diversity, decreased abundance of Bacteroidetes, and elevated levels of Firmicutes in patients with obesity and diabetes[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. An increased Firmicutes/Bacteroidetes ratio is implicated in enhanced energy extraction by the host, which is subsequently stored as white adipose tissue[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEmerging evidence highlights a intimate link between gut microbiota and adipose tissue thermogenesis[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. This connection is primarily mediated by the microbial fermentation of dietary fiber in the colon, leading to the production of short-chain fatty acids (SCFAs). As intermediate metabolites of the tricarboxylic acid (TCA) cycle, SCFAs facilitate the conversion of energy into a proton gradient, thereby driving energy expenditure and mitigating fat accumulation[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Furthermore, accumulating studies indicate that modulating gut microbial composition constitutes a viable strategy for weight management, predominantly through dietary interventions, prebiotic supplementation, and probiotic administration. Probiotics exert their beneficial effects by inhibiting the proliferation of enteropathogens while augmenting the abundance of commensal beneficial bacteria, thereby preserving gut microbial homeostasis, reducing levels of the endotoxin lipopolysaccharide (LPS), enhancing insulin sensitivity, and alleviating insulin resistance[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Numerous preclinical studies have demonstrated that intraperitoneal gavage of probiotics in male C57BL/6J mice maintained on a high-fat diet (HFD) results in a significant reduction in fat mass without altering food intake. These phenotypic changes are accompanied by concomitant shifts in gut microbiota, characterized by increased abundance of beneficial taxa such as \u003cem\u003eBifidobacteriaceae\u003c/em\u003e, \u003cem\u003eLactobacillus\u003c/em\u003e, \u003cem\u003ePrevotella, Roseburia\u003c/em\u003e, and \u003cem\u003eAkkermansia\u003c/em\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Collectively, these findings underscore the potential of gut microbiota as a therapeutic target for obesity.\u003c/p\u003e \u003cp\u003e \u003cem\u003eBlautia\u003c/em\u003e is an anaerobic microorganism widely distributed in the intestines and feces of mammals, primarily classified into \u003cem\u003eBlautia coccoides\u003c/em\u003e, \u003cem\u003eBlautia producta\u003c/em\u003e, \u003cem\u003eBlautia schinkii\u003c/em\u003e, etc[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Recent research has highlighted its significance in mitigating metabolic diseases. Study involving monoclonal gavage experiments in high-fat diet mice demonstrated that \u003cem\u003eBlautia coccoides\u003c/em\u003e significantly reduced high-fat diet-induced insulin resistance and fat accumulation[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. As a glycolytic organism, \u003cem\u003eBlautia\u003c/em\u003e primarily synthesizes acetic acid as its end product. Additionally, \u003cem\u003eBlautia\u003c/em\u003e is strictly anaerobic and utilizes hydrogen and carbon dioxide to generate acetic acid[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. As a typical SCFAs, acetic acid decreases fat deposition by modulating energy intake, enhancing mitochondrial metabolism, and regulating fatty acid oxidation and synthesis[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Research indicated that subcutaneous injection of sodium acetate in rabbits significantly inhibited fat deposition in the liver and adipose tissue[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Sahuri-Arisoylu et al. found that intraperitoneal acetate administration in mice reduced fat deposition by decreasing circulating free fatty acids, suppressing hepatic de novo lipogenesis, and enhancing mitochondrial efficiency[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eChicken is highly regarded by consumers for its nutritional value and palatability, characterized by high protein content and low fat content, contributing to human health benefits[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Through years of genetic selection and nutritional advancements, modern broilers in our country have achieved significant improvements in weight, growth rate, and feed efficiency. However, the rapid growth rate of broilers is often accompanied by an imbalance in lipid metabolism. This leads to increased abdominal fat deposition, predisposes the birds to fat metabolism-related disorders, causes a decline in meat quality and reduced feed efficiency, ultimately compromising their economic value[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Among the body fats in broilers, abdominal fat constitutes the largest proportion[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Therefore, developing strategies to regulate abdominal fat deposition is crucial. Currently, animal nutrition approaches, such as optimizing dietary composition and improving the gut microbiota structure to specifically modulate metabolic functions, have become important methods for enhancing lipid metabolism in poultry.\u003c/p\u003e \u003cp\u003eCurrently, in the context of antibiotic-free feeding, probiotics, as one of the most common feed additives, are widely used in poultry production[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. A number of studies have shown that probiotics can inhibit lipogenesis and regulate host lipid metabolism, and dietary probiotic supplementation can effectively reduce abdominal fat deposition in poultry. Research has demonstrated that adding Bacillus subtilis-based microbial preparations to the diet significantly reduces triglyceride levels in the serum and liver of hens[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Furthermore, compound microbial preparations have been shown to improve the growth performance of breeder hens while simultaneously lowering serum triglyceride levels and enhancing antioxidant capacity[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Similarly, studies by Yang et al. indicated that treatment with \u003cem\u003eM. funiformis\u003c/em\u003e CML154 activated the APN-AMPK-PPARα signaling pathway in both high-fat diet-fed laying hens and mice, alleviated hepatic steatosis, and increased the concentration of propionate in the gut[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. These findings collectively highlight the strong application potential of probiotics in ameliorating lipid deposition in poultry.\u003c/p\u003e \u003cp\u003eOur laboratory successfully isolated and cultivated a pure strain of \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 through \u003cem\u003ein vitro\u003c/em\u003e methods. \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 belongs to the phylum Firmicutes and demonstrated high acetic acid production capacity. However, the effects and mechanisms of action of this microorganism on broiler chicken growth performance and lipid metabolism require systematic investigation. Therefore, this study aimed to administer a specific concentration of CML164 (10\u003csup\u003e8\u003c/sup\u003e CFU/mL) to broiler chickens through their drinking water. The study analyzed its impact on the growth performance and lipid deposition of broiler chickens, and elucidated the underlying mechanisms. The research seeks to provide new insights into the application of \u003cem\u003eBlautia\u003c/em\u003e strains as functional feed additives in sustainable broiler production.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Bacteria Strains, Culture, and Preparation\u003c/h2\u003e \u003cp\u003eThe methods used for bacterial cultivation and isolation were adapted from our earlier research[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The identity of each strain was verified by amplifying the 16S rRNA gene with the primers 27F (5\u0026prime;-AGA GTT TGA TCA TGG CTC A-3\u0026prime;) and 1492R (5\u0026prime;-TAC GGT TAC CTT GTT ACG ACT T-3\u0026prime;). Then, the sequence was compared with the NCBI database or EzBioCloud (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ezbiocloud.net\u003c/span\u003e\u003cspan address=\"http://www.ezbiocloud.net\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for taxonomic affiliation. The genome of \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 (CML) was sequenced, and its genome map was performed using Proksee (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://proksee.ca/\u003c/span\u003e\u003cspan address=\"https://proksee.ca/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Functional annotation of the \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 core genes was performed using the KEGG database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genome.jp/kegg/\u003c/span\u003e\u003cspan address=\"https://www.genome.jp/kegg/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAfter culturing \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 in Gifu Anaerobic Medium (GAM, catalog no. HB8518, Hope Bio, China) at 37\u0026deg;C under anaerobic conditions for 24 hours, bacterial pellets were harvested by centrifugation at 4,000 rpm and 4\u0026deg;C for 5 minutes. The pellets were then resuspended in sterile anaerobic PBS containing 20% glycerol, and the resulting bacterial suspension was aliquoted and stored at -80\u0026deg;C for subsequent use. In parallel, sterile anaerobic PBS supplemented with 20% glycerol (without bacteria) was aliquoted and cryopreserved under the same conditions. Prior to use, both the frozen bacterial suspension and the 20% glycerol-containing sterile anaerobic PBS were thawed in a 37\u0026deg;C water bath. Before gavage administration, the bacterial suspension was diluted to 1\u0026times;10⁸ CFU/mL with sterile PBS (resulting in a final glycerol concentration of 0.8%). Concurrently, the 20% glycerol-containing sterile anaerobic PBS was subjected to equal-volume dilution with sterile PBS to prepare sterile PBS with a final glycerol concentration of 0.8% (serving as a control).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Birds, experimental design and diets\u003c/h2\u003e \u003cp\u003eA total of 140 male Arbor Acres day-old chicks with a similar initial average weight (43.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35 g) were selected and randomly divided into two groups: (1) control group with a basal diet (CON), and (2) basal diet supplemented with 1 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e CFU/mL of CML 164 (CML). Each experimental group comprised 7 replicates, with 10 chicks per replicate, and the feeding period extended for 42 days. Throughout the experimental period, the chicks received unrestricted access to feed and water, and were housed in a two-tier cage system. Daily monitoring recorded the feed intake and health status of the broiler chickens. The temperature, humidity, and lighting duration within the chicken house were maintained according to broiler production standards. All diets were formulated to meet the NRC (1994) and Chinese chicken feeding standards (NY/T-33\u0026ndash;2004)[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], with the dietary composition and nutritional levels outlined in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComposition and nutrient level of the basal diet (as-fed basis).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIngredient, %\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eD1\u0026ndash;20\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eD21\u0026ndash;41\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e61.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e55.66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e24.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e32.50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn gluten meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4.70\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoy oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.97\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDicalcium phosphate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLimestone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.63\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSalt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysine-HCl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethionine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCholine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMineral premix\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin premix\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntioxidant\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhytase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e100.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e100.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNutrient composition\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMetabolizable energy, mc/kg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3.10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCalcium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePhosphorus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003csup\u003e1\u003c/sup\u003ePer kilogram of diet contained: copper, 8 mg; zinc, 75 mg; iron, 80 mg; manganese, 100 mg; selenium, 0.15 mg; iodine, 0.35 mg; cobalt, 0.5 mg.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003csup\u003e2\u003c/sup\u003ePer kilogram of diet contained: vitamin A, 12500 IU; vitamin D\u003csub\u003e3\u003c/sub\u003e; 2500 IU; vitamin K\u003csub\u003e3\u003c/sub\u003e, 2.65 mg; vitamin B\u003csub\u003e1\u003c/sub\u003e, 2 mg; vitamin B\u003csub\u003e2\u003c/sub\u003e, 6 mg; vitamin B\u003csub\u003e12\u003c/sub\u003e, 0.025 mg; vitamin E, 30 IU; biotin, 0.0325 mg; folic acid, 1.25 mg; pantothenic acid, 12 mg; niacin, 50 mg.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Growth performance\u003c/h2\u003e \u003cp\u003eThe chickens in each experimental group were weighed at 20 and 41 days of age, using replicates as the unit of measurement. Their body weight (BW) was recorded, and the feed consumption was monitored. From this data, the average daily weight gain (ADWG) and average daily feed intake (ADFI) for each replicate were calculated. Additionally, the FCR for each replicate was determined based on the ADWG and ADFI values.\u003c/p\u003e \u003cp\u003eAt 41 days of age, one chicken was randomly selected from each replicate for weighing and subsequently euthanized by jugular vein bleeding. Following the standards outlined in NY/T 823\u0026ndash;2020[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], measurements were taken to calculate various parameters including slaughter rate, semi-eviscerated yield, eviscerated yield, pectoral muscle rate, leg muscle rate, and abdominal fat rate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Sample Collection and Processing\u003c/h2\u003e \u003cp\u003eAt 42 days of age, two chickens with weighed approximating the mean were selected and marked from each replicate. The marked chickens were euthanized by jugular vein bleeding. Blood was collected via the wing vein from one chicken. Serum was separated through centrifugation at 3,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 15 minutes. The supernatant was extracted and stored at -20\u0026deg;C for subsequent physicochemical analysis. The abdominal cavity was promptly opened, and uniformly sized liver and abdominal fat tissues were collected and fixed in 4% paraformaldehyde for morphological analysis. A liver sample measured 1 cm \u0026times; 1 cm \u0026times; 1 cm was preserved in 2.5% glutaraldehyde for transmission electron microscopy analysis. Cecal contents, liver, and abdominal fat tissues were snap-frozen in liquid nitrogen and stored at -80\u0026deg;C for analysis of SCFAs, microbial communities, and gene \u003cem\u003emRNA\u003c/em\u003e levels. From the second chicken, liver tissue of consistent size was excised for immediate mitochondrial extraction to monitor oxygen consumption rates in subsequent analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Morphological Analysis of Liver and Abdominal Adipose Tissue\u003c/h2\u003e \u003cp\u003eFresh liver and abdominal fat tissue samples were fixed in 4% paraformaldehyde at room temperature. The samples underwent dehydration, paraffin embedding, sectioning, and hematoxylin-eosin (HE) staining. Images were captured using LIOO 3.7 digital camera software (Leica DM750, Wetzlar, Hesse, Germany). Adipocyte size and distribution in the abdominal fat were measured and calculated from 5 to 6 fields of view per sample using a 100 \u0026micro;m scale bar.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Lipid Content in Liver, Serum, and Abdominal Fat Determination\u003c/h2\u003e \u003cp\u003eLevels of serum Triglyceride (TG) and Total Cholesterol (TC) were measured using an automatic biochemical analyzer (Kehua ZY KHB-1280, Beijing, China) following manufacturer instructions. TG and TC levels in the liver and abdominal fat were measured using ELISA kits (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e\u003cem\u003e2.7 Liver Mitochondria Transmission Electron Microscopy (TEM)\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eFresh liver tissues were quickly excised, rinsed with ice-cold hosphate buffer saline (PBS), and cut into 1 mm\u0026sup3; pieces. The pieces were fixed in 2.5% glutaraldehyde at 4\u0026deg;C for 24 h, followed by post-fixation with 1% osmium tetroxide and dehydration through a graded ethanol series. Tissues were embedded in Epon 812 resin, sectioned into 50\u0026ndash;70 nm slices using an ultramicrotome, mounted on copper grids, and stained with 2% uranyl acetate and 0.1% lead citrate. Images of liver mitochondria were captured by a transmission electron microscope at 80 kV (HITACHI HT7700, Japan). Quantitative analysis of mitochondrial morphological indicators in different treatment groups was performed using Image J software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Liver Mitochondrial Energy Metabolism Assay\u003c/h2\u003e \u003cp\u003eLiver mitochondria isolation was performed using Beyotime kit according to manufacturer specifications. Fresh tissues were cleaned with ice-cold PBS, minced, and homogenized in ice-cold buffer containing protease inhibitors. The homogenate underwent centrifugation at 600 \u0026times; \u003cem\u003eg\u003c/em\u003e for 10 min to eliminate debris, followed by recentrifugation of the supernatant at 10,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 15 min to obtain mitochondrial pellets. The pellet was subjected to one wash with kit-provided buffer at 10,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 10 min, resuspended in storage buffer, and maintained on ice. Following isolation, liver mitochondrial oxygen consumption was assessed using a Seahorse XF Analyzer. Mitochondria (100 \u0026micro;g protein) were suspended in XF Base Medium containing 10 mM glucose, 2 mM glutamine, and 2 mM pyruvate, placed in a Seahorse XF 24-well microplate, and incubated at 37\u0026deg;C without CO₂. Oxygen consumption rate (OCR) measurement involved sequential administration of 2 \u0026micro;M oligomycin, 1 \u0026micro;M FCCP, and 0.5 \u0026micro;M antimycin A\u0026thinsp;+\u0026thinsp;rotenone to evaluate basal respiration, ATP-linked respiration, maximal respiratory capacity, and non-mitochondrial respiration, respectively. Data analysis was conducted using Seahorse Wave software, with OCR normalized to mitochondrial protein content for quantification[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Cecal Contents 16S rRNA Sequencing\u003c/h2\u003e \u003cp\u003eThe procedure for extracting DNA from chicken cecum adhered to previously described methods. To amplify the hypervariable regions V3 to V4 of the bacterial 16 S rRNA gene, the primer pair 338 F/806 R (338 F: 5\u0026prime;-ACTCCTACGGAGGCAGCAG-3\u0026prime;; 806 R: 5\u0026prime;-GGACTACHVGGGTWTCTAAT-3\u0026prime;) was utilized. The raw sequencing data were processed by filtering reads and joining paired-end reads with tags employing the Illumina platform. Operational taxonomic units (OTUs) were identified by clustering tags with UPARSE software. The representative sequences for each OTU were taxonomically classified using the Ribosomal Database Project classifier v.2.2 with training from the Greengenes database v201305, utilizing Quantitative Insights into Microbial Ecology (QIIME) software v1.8.0. USEARCH Global compared all taxonomic labels to the identified OTUs to generate a table summarizing OTU abundance across each sample. The MOTHUR software (v1.31.2) and QIIME (v1.8.0) were used to assess \"OTU abundance\" and \"diversity\" at the OTU level. Unweighted pair-group average linkage clustering for sample categorization was achieved using QIIME. Visualization of data across different classification levels was accomplished using R package v3.4.1 and R package \"gplots,\" which were utilized to create bar charts and heat maps, respectively. Cluster analysis, including Linear discriminant analysis (LDA) effect size (LEfSe) and LDA, was performed using the LEfSe software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e\u003cem\u003e2.10 Cecal Contents SCFAs Determination\u003c/em\u003e\u003c/h2\u003e \u003cp\u003ePrepare a homogenate by combining cecal contents with distilled water at a ratio of 5:1 (distilled water: cecal contents). Centrifuge the mixture at 12,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 15 minutes at 4\u0026deg;C. Extract 1 mL of the supernatant and combine with 0.2 mL of 25% (w/v) metaphosphate solution, mixing thoroughly. Store at 4\u0026deg;C for 30 minutes. Perform a second centrifugation at 12,000 \u0026times; \u003cem\u003eg\u003c/em\u003e for 10 minutes to obtain the supernatant for analysis. Determine the SCFAs concentration using a gas chromatography system (Agilent 5975C GC system, Wilmington, NC, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 RNA Extraction and Quantitative Real-time PCR Detection\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from liver and abdominal fat samples using TRIzol reagent (Takara, Japan). Subsequently, the RNA was reverse transcribed into cDNA using a cDNA Reverse Transcription Kit (Takara, Japan). Using cDNA as the template, qPCR detection was performed with the TB Green Premix Ex Taq II Kit (Takara, Japan) on the QuantStudio 7 Flex real-time PCR system (Applied Biosystems, USA). The mRNA levels of all genes were statistically analyzed using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method, with β-actin as the internal reference. The primer sequences for the target genes are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primer sequences for RT-qPCR analysis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequences (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGTGAAAGTCGGAGTCAACGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CGATGAAGGGATCATTGATGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSCD1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCAGCGGAGATACTACAAGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CCGATTGCCAAACATGTGAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eACOX1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGTCACGTTCACCCCATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AGGTAGGAGACCATGCCAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCPT1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCGTCTTGCCATGACTGGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GCTGTGGTGTCTGACTCGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eACC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGCCAGTGCTATGCTGAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AGGGTCAAGTGCTGCTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCHREBP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GATGAGCACCGCAAACCAGAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TCGGAGCCGCTTCTTGTAGTAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePIN2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGCTTCATAGACGGCTGCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AAGAACAAGGCGCAGAAGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSIRT3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GTGAGCTTCTGCTTCCCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GCAGGGTACAAGGGACCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eOPA1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CACAATGCTCCCCCAAAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AGATTGTCAAGCAGCAGCAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eMfn1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCGGTCGCGTAGTTCACAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: ATCGTTGTTGGCGGAGTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eMfn2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CATTGATGTACGCAGCCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TGAAGCGCAATGTCCCTGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eNRF1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCAACAGACCACAACCACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TGACTTGTGCGACGGTAACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eATP5B\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GATCACCACCACACGCAAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GGTCCATGATTCGGGAGGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eATP5C\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCTGAAAGACATTACCAGGCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CAGCTCCCTCTCAGCTCTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCytc\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGAGTCTGCACTCATCTTGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TCCAGGTTATAGGGGGCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eTFAM\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AACCTGAGTTATGCTGCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: ACCAAGCCAGAAGTTAGCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eAMPK\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ACTGTGTGGCCTGTCTTGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TCTGAGAATCCTCCCGCTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSREBP1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCCGAGGGAGACCATCTACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GGTACTCCAACGCATCCGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePPARα\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TGTGGAGATCGTCCTGGTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CGTCAGGATGGTTGGTTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ePPARγ\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCAGGAACAGAACAAAGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TGCCAGGTCACTGTCATCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e\u003cem\u003e2.12 Data Statistics Analysis\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eData analysis was conducted using SPSS Statistics 25.0 software. Comparisons between two groups utilized Student's t-test. Results are expressed as \"mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SEM).\" Statistical significance levels are denoted by *\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, with 0.05\u0026thinsp;\u0026le;\u0026thinsp;\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.10 indicating trending significance. Graphical representations were created using GraphPad Prism 9 software.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Biological Characteristics of Blautia coccoides CML164\u003c/h2\u003e \u003cp\u003eIn previous studies, our laboratory isolated and cultured a pure strain of Blautia coccoides from the poultry gut, designated as CML164, which was obtained through 16S rRNA sequencing. Whole-genome sequencing revealed that CML164 has a genome size of 5,918,542 bp, containing 5,299 coding sequences (Fig.\u0026nbsp;1A). KEGG annotation of CML164 displayed a total of 2,149 coding genes distributed across four primary categories in the KEGG database: cellular processes, metabolism, genetic information processing, and environmental information processing, with the metabolism category being the most prevalent. Within the secondary functional categories, Metabolic pathways were the most numerous, with 665 genes annotated, suggesting a strong association between CML164's functions and metabolism (Fig.\u0026nbsp;1B).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Growth performance and carcass traits\u003c/h2\u003e \u003cp\u003eThe effects of \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 on broiler growth performance and carcass traits are presented in Fig.\u0026nbsp;2. Throughout the entire feeding period, CML164 significantly enhanced ADFI (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and showed a trend toward increased ADWG (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.087), while maintaining consistent FCR (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Regarding slaughter performance, CML164 significantly reduced abdominal fat percentage (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and indicated a trend toward increased eviscerated rate (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.079).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e3.3 Effects of Blautia coccoides CML164 on lipid metabolism\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eTo evaluate CML164 treatment's impact on lipid metabolism in broilers, lipid content measurements were conducted in serum, liver, and abdominal fat across experimental groups (Fig.\u0026nbsp;3A, B, C). The findings indicated that CML164 supplementation significantly reduced TC levels in abdominal fat at 21 days of age and TG at 42 days of age (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). It also significantly decreased TG levels in the liver at both 21 and 42 days of age (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), as well as TG and TC levels in abdominal fat at 21 days and TG levels at 42 days (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Histological examination using HE staining of liver and abdominal fat tissue from 42-day-old broilers revealed that the CML164 group exhibited reduced macrosteatosis and hepatocyte ballooning compared to the control group (Fig.\u0026nbsp;3D, E). Furthermore, CML164 treatment significantly decreased large adipocyte proportions (diameter\u0026thinsp;\u0026ge;\u0026thinsp;90 \u0026micro;m) while increasing small adipocyte proportions (diameter\u0026thinsp;\u0026le;\u0026thinsp;80 \u0026micro;m) in abdominal fat tissue (Fig.\u0026nbsp;3F). Analysis of fatty acid synthesis and oxidation genes in the liver and abdominal fat revealed that CML164 significantly enhanced liver lipid oxidation-related gene expression, including \u003cem\u003ePPARα\u003c/em\u003e and \u003cem\u003eACOX1\u003c/em\u003e, while suppressing lipid synthesis-related genes, such as \u003cem\u003eSREBP1\u003c/em\u003e and \u003cem\u003ePPARγ\u003c/em\u003e (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;3G, H). Similarly, CML164 significantly increased lipid oxidation-related gene expression (\u003cem\u003ePPARα\u003c/em\u003e and \u003cem\u003eCPT1\u003c/em\u003e) in abdominal fat while inhibiting lipid synthesis-related genes (\u003cem\u003eSREBP1\u003c/em\u003e and \u003cem\u003eCHREBP\u003c/em\u003e) (Fig.\u0026nbsp;3I, J) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results demonstrated that dietary CML164 supplementation effectively enhanced lipid metabolism and reduced lipid accumulation in broilers.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e3.4 Effects of Blautia coccoides CML164 on energy metabolism\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eWe evaluated the morphological alterations of mitochondria in liver tissues from broilers in the CON and CML164 groups using TEM. The electron micrograph images demonstrated that mitochondria in the CON group exhibited irregular shapes, vacuolar tendencies, and cristae rupture. Conversely, mitochondria in the CML164 group displayed intact structures and regular morphology, with abundant mitochondrial content (Fig.\u0026nbsp;4A, B). To precisely quantify the mitochondrial differences between groups, we performed a quantitative analysis of liver mitochondria from both groups (Fig.\u0026nbsp;4C, D). Statistical analysis revealed that CML164 supplementation did not significantly affect the quantity, area, long diameter, short diameter, or circumference of mitochondria compared to the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, it significantly enhanced mitochondrial density in the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), indicating that CML164 may influence mitochondrial function and metabolism in broilers.\u003c/p\u003e \u003cp\u003eGiven that mitochondrial metabolism is intrinsically linked to energy changes, and to further investigate whether CML164 intake affects energy metabolism (mitochondrial respiration and glycolysis), we assessed the respiratory activity of liver mitochondria using a cellular respiration energy metabolism monitoring system (Fig.\u0026nbsp;4E, F, G, H). The statistical analysis revealed that CML164 significantly increased ATP production (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and showed a tendency to enhance basal respiration (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.052), converting more potential energy into heat. To elucidate the underlying mechanisms of liver mitochondrial metabolic differences between groups, we analyzed the expression levels of mitochondrial dynamics-related genes in liver and abdominal fat (Fig.\u0026nbsp;5A, B, C, D). We generated correlation clustering heatmaps for differentially expressed genes associated with lipid and energy metabolism (Fig.\u0026nbsp;5E, F). The findings showed that CML164 significantly enhanced the expression of liver mitochondrial metabolism-related genes (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), including \u003cem\u003eCytc\u003c/em\u003e, \u003cem\u003eATP5c\u003c/em\u003e, \u003cem\u003eOPA1\u003c/em\u003e, \u003cem\u003ePIN2\u003c/em\u003e, and \u003cem\u003eMfn2\u003c/em\u003e. Moreover, it significantly increased mitochondrial metabolism-related gene expression in abdominal fat (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), including \u003cem\u003ePIN2\u003c/em\u003e and \u003cem\u003eATP5b\u003c/em\u003e. Based on these mitochondrial and lipid metabolism indicators, CML164 supplementation appeared to enhance energy metabolism and regulate lipid metabolism in broilers.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Diversity and composition of gut microbiota\u003c/h2\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;6A, B, α-diversity indices (Simpson and Chao1) and observed species counts showed no significant differences between two groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Sample coverage rates exceeded 99.99%, confirming their validity for subsequent analyses. β-diversity was evaluated through principal coordinate analysis to assess microbial compositional similarity between two groups (Fig.\u0026nbsp;6C, D). The PCoA and PLS-DA ordination plot revealed distinct clustering of CML164 and CON group communities, suggesting that CML164 intervention altered the colonic microbial structure of growing broilers. Additional analyses of gut microbiota relative abundance at phylum and species levels were presented in Fig.\u0026nbsp;6E-G. At the phylum level, Firmicutes and Bacteroidetes dominated both groups. CML164 supplementation increased Firmicutes while decreasing Bacteroidota relative abundance compared to control group. At genus and species levels, \u003cem\u003eBarnesiella\u003c/em\u003e, \u003cem\u003eBacteroides\u003c/em\u003e, and \u003cem\u003eLachnospiraceae\u003c/em\u003e were the predominant genera, while \u003cem\u003eBarnesiella_viscericola\u003c/em\u003e, \u003cem\u003ePhocaeicola_dorei\u003c/em\u003e, and \u003cem\u003eFaecalibacterium_bacterium_ic1379\u003c/em\u003e were the most abundant species. Additionally, CML164 supplementation induced various changes in gut microbiota from phylum to species level. The linear discriminant analysis effect size (LEfSe) method identified significantly different microbial populations across the microbiome (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; LDA\u0026thinsp;\u0026gt;\u0026thinsp;2.0). As illustrated in Fig.\u0026nbsp;6H, the CML164 group showed significantly increased relative abundances of \u003cem\u003ePhocaeicola_vulgatus\u003c/em\u003e, \u003cem\u003eParabacteroides_distasonis\u003c/em\u003e, \u003cem\u003eRuminococcus\u003c/em\u003e, \u003cem\u003eBurkholderiales\u003c/em\u003e, and \u003cem\u003ePrevotellaceae\u003c/em\u003e compared to the CON group. The cecal chyme microbiota analysis indicated that CML164 supplementation enhanced beneficial bacteria while reducing pathogenic bacteria in the broiler gut.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Cecal SCFAs profile of broilers\u003c/h2\u003e \u003cp\u003eThe contents of acetate, propionate, butyrate, valerate, isobutyrate, isovalerate, and total SCFAs were detected by gas chromatography. Regarding major SCFAs (Fig.\u0026nbsp;6I), propionate and butyrate levels in broiler ceca showed no significant changes with CML164 supplementation (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), while acetate concentration increased significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). For minor SCFAs (Fig.\u0026nbsp;6J), valerate levels remained unchanged (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), while isobutyrate and isovalerate levels showed an increasing trend (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.090, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.087).\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eBroiler chickens have emerged as one of the most rapidly expanding and efficient sources of animal protein, with significant increases in production to maximize meat yields[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. However, intensive, high-density farming conditions substantially enhance fatty acid synthesis in broiler chicken livers while limiting lipid breakdown metabolism[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Consequently, achieving equilibrium between meat yield and quality has become a critical challenge in the broiler chicken industry. Recent studies have demonstrated the significance of the gut microbiota \u003cem\u003eBlautia\u003c/em\u003e in various obesity-related metabolic syndromes. \u003cem\u003eBlautia\u003c/em\u003e facilitated SCFAs production, modulated amino acid and fatty acid metabolism, and maintained intestinal homeostasis, demonstrating potential probiotic properties[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Research has shown that \u003cem\u003eBlautia wexlerae\u003c/em\u003e supplementation mitigated obesity-related weight gain and inflammation in mice on high-fat diets through acetic acid production and gut microbiota modification[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Studies indicated that administering \u003cem\u003eBlautia producta\u003c/em\u003e to high-fat diet mice significantly decreased lipid accumulation[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Furthermore, research has identified \u003cem\u003eBlautia coccoides\u003c/em\u003e as a novel bacterium that proliferates during leucine deficiency and ameliorates metabolic disorders in high-fat mice through tryptophan metabolism[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, research examining specific \u003cem\u003eBlautia\u003c/em\u003e strains and their impact on animal lipid metabolism remains limited, particularly regarding broilers. Consequently, our laboratory isolated a pure strain of \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 and conducted broiler feeding trials to examine its regulatory effects.\u003c/p\u003e \u003cp\u003eIn broiler production, growth performance and carcass traits are served as fundamental indicators determining industry economic benefits and product quality[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Growth performance encompasses weight, feed intake, and FCR, directly influencing farming efficiency and costs. Carcass traits comprise meat yield (including breast and leg meat percentages) and abdominal fat rate, which directly affect meat quality and economic value. This study demonstrated that dietary CML164 supplementation enhanced both feed intake and body weight throughout the rearing period. Notably, FCR remained consistent between groups during early, late, and entire feeding periods. FCR provides a direct measure of input-output efficiency in broiler production and has become crucial for evaluating farming efficiency[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. These findings indicated that CML164 dietary maintained production performance, farming efficiency, and cost effectiveness. Regarding carcass characteristics, CML164 supplementation markedly reduced abdominal fat rates in broilers, consistent with previous research showed \u003cem\u003eBlautia\u003c/em\u003e species effectively decreased animal fat accumulation[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Typically, excessive abdominal fat accumulation correlates with liver fat degeneration and irregular intramuscular fat distribution, reducing meat tenderness[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Lower-fat broilers typically exhibit improved feed efficiency, reducing economic losses during farming and processing[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The results demonstrate that \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 supplementation enhanced carcass traits, reduced abdominal fat deposition, and increased lean meat ratio while maintaining growth performance.\u003c/p\u003e \u003cp\u003eThe liver, serving as the central organ for lipid metabolism, plays a pivotal role in maintaining lipid metabolic homeostasis[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Its key functions encompass the de novo synthesis of endogenous triglycerides and the biosynthesis of phospholipids and cholesterol[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In poultry, approximately 90% of body fat synthesis occurs in the liver, where fatty acids combine with glycerol to form TG. These TG can be stored in the liver or transported through the bloodstream to other tissues, such as adipose and muscle tissues, completing the fat storage process[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The breakdown and synthesis of TG within animal organisms maintain a dynamic equilibrium[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. When TG breakdown exceeds synthesis, this process inhibits further adipocyte differentiation, resulting in reduced body fat content. Conversely, when TG breakdown falls below synthesis, it promotes adipocyte differentiation, leading to lipid droplet accumulation within cells and increased fat content. Previous studies have demonstrated that enhancing serum lipid profiles, while reducing hepatic lipid accumulation and absorption, constitute effective strategies for decreasing fat deposition[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In this study, dietary supplementation with CML164 significantly reduced the abdominal fat percentage in 42-day-old broilers. To elucidate the underlying mechanism, we investigated key processes including hepatic lipid synthesis, lipoprotein secretion and transport, and abdominal adipose tissue deposition. Histological examination via liver HE staining revealed normal hepatocyte morphology and the absence of pathological changes such as fatty vacuoles in both groups, indicating that the reduction in lipid deposition induced by CML164 was not attributable to liver damage. Further analysis showed that CML164 treatment significantly decreased hepatic TG levels at both 21 and 42 days of age. As the central medium for lipid transport and systemic metabolic regulation, blood lipid metabolic parameters reflect overall lipid homeostasis[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Serum biochemical analysis demonstrated that TG levels were significantly lower in the CML164 group at both 21 and 42 days of age. The reduction in serum TG may be associated with inhibited hepatic de novo fatty acid synthesis or enhanced triglyceride breakdown catalyzed by hormone-sensitive lipase (HSL)[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Analysis of abdominal adipose tissue showed that the average adipocyte diameter and tissue TG content were significantly reduced in the CML164 group at 42 days of age, suggesting decreased lipid storage in adipocytes. This effect is generally regulated by a dynamic balance among fatty acid uptake, lipid synthesis, lipolysis, and fatty acid oxidation. To further explore the molecular mechanism by which CML164 reduces abdominal fat deposition, we examined the mRNA expression levels of key genes involved in lipid metabolism in the liver and abdominal adipose tissue based on the phenotypic findings described above. The results revealed that CML164 enhanced the expression of fatty acid oxidation genes while suppressing fatty acid synthesis genes. \u003cem\u003ePPARα\u003c/em\u003e, a nuclear receptor transcription factor, functions as a primary regulator of fatty acid oxidation, activating downstream genes such as \u003cem\u003eACOX1\u003c/em\u003e and \u003cem\u003eCPT1\u003c/em\u003e, thereby reducing TG accumulation. \u003cem\u003eSREBP1\u003c/em\u003e, a core regulator of fatty acid synthesis genes (including \u003cem\u003ePPAR-γ\u003c/em\u003e and \u003cem\u003eCHREBP\u003c/em\u003e), when downregulated, directly inhibits fatty acid-related enzyme synthesis in liver and adipose tissue, decreasing endogenous fatty acid production[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. In conclusion, dietary supplementation with \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 in broilers regulates lipid metabolism by inhibiting adipocyte differentiation, suppressing lipogenesis, and promoting lipolysis and fatty acid oxidation, thereby ultimately reducing abdominal fat deposition. Our finding corresponded with previous results showing that \u003cem\u003eBlautia\u003c/em\u003e bacteria administration reduced hepatic lipid levels in high-fat animal model.\u003c/p\u003e \u003cp\u003eMitochondria, the cellular energy factories, are essential for lipid catabolism, with their metabolic functions closely linked to lipid metabolism, particularly lipid oxidation[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Additionally, energy production, transport, and lipid transport metabolism represented 6.58% and 4.03%, respectively, of the functional pathways associated with the \u003cem\u003eBlautia\u003c/em\u003e genus[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Carbohydrates in the chicken's diet, after being digested and absorbed, generate acetyl-CoA via the glycolytic pathway. This acetyl-CoA then serves as a substrate for de novo fatty acid synthesis. The process of de novo fatty acid synthesis in hepatocytes begins with the cytosolic translocation of acetyl-CoA[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Specifically, within the mitochondrial matrix of hepatocytes, synthesized acetyl-CoA combines with oxaloacetate under the action of citrate synthase to form citrate. The citrate is subsequently transported into the cytosol via the tricarboxylate transporter[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Subsequently, the effects of CML164 on energy changes in broilers were analyzed. The study revealed that CML164 supplementation enhanced liver mitochondrial metabolic activity and increased nuclear transcription factor expression in liver and abdominal fat mitochondrial tissues, accelerating energy cycling. Research has shown that accelerated mitochondrial metabolism directs more acetyl-CoA toward oxidative breakdown, thereby affecting the supply of reducing equivalents required for cytoplasmic fatty acid synthesis and subsequently reducing both substrate availability and the activation of key enzymes for lipogenesis[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. In conclusion, dietary \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 supplementation significantly enhanced liver mitochondrial respiratory function, increased ATP production, converted more potential energy into heat, and promoted fatty acid oxidation. Consequently, broiler fat reserved are more efficiently converted into energy, resulting in reduced abdominal fat.\u003c/p\u003e \u003cp\u003eThe gut microbiome serves a vital function in host health, encompassing nutrient absorption, metabolism, and immune function[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Research demonstrated that dietary factors significantly influenced gut microbiota composition[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. This investigation revealed that supplementing broiler chicken diets with CML164 modified the bacterial community in their cecum. LEfSe analysis demonstrated elevated abundances of \u003cem\u003ePhocaeicola vulgatus\u003c/em\u003e, \u003cem\u003eParabacteroides distasonis\u003c/em\u003e, and \u003cem\u003ePrevotellaceae\u003c/em\u003e in the CML164 group. These bacterial taxa produced SCFAs, which function as energy sources and signaling molecules that regulated energy homeostasis and physiological processes. \u003cem\u003ePhocaeicola vulgatus\u003c/em\u003e, belonging to the Bacteroidetes phylum, generates acetic acid and propionic acid. The propionic acid metabolite decreases hepatic triglyceride synthesis while promoting fatty acid β-oxidation[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. \u003cem\u003eParabacteroides distasonis\u003c/em\u003e produces acetic acid and butyric acid, affecting lipid absorption through bile acid metabolism regulation. Studies indicated that this bacterium enhanced liver \u003cem\u003ePPARα\u003c/em\u003e expression in high-fat diet models, thereby improving mitochondrial fatty acid oxidation capacity[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. \u003cem\u003ePrevotellaceae\u003c/em\u003e metabolize indigestible polysaccharides (such as arabinoxylan) to generate acetic acid, propionic acid, and butyric acid, enhancing insulin sensitivity and reducing fat synthesis[\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. These results indicated that \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 enhanced SCFAs-producing bacterial populations in broiler chicken gut. SCFAs constitute the primary metabolic products of gut microbes, and alterations in microbial communities inherently affect SCFAs production[\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. The present study revealed significantly elevated acetic acid concentrations in the cecum of CML164-fed chickens. Acetic acid maintains energy balance and metabolic homeostasis, influences immune function, and regulates lipid metabolism[\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. Acetic acid promotes white adipose tissue browning by increasing mitochondrial quantity and energy expenditure, enhancing mitochondrial metabolism; it stimulates fatty acid oxidation while suppressing de novo lipogenesis in the liver, thus reducing fat accumulation through catabolic and anabolic pathways. These findings suggested that \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 optimized fat deposition in broiler chickens by enriching beneficial microbes, particularly those producing SCFAs.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 serves as a beneficial and effective dietary supplement that reduces abdominal fat deposition in broilers without compromising their production performance. The underlying mechanism is possibly attributed to CML164 increasing acetic acid levels and the abundance of SCFAs-producing beneficial gut bacteria. This accelerated energy and fatty acid metabolism in broiler chickens, modulated fat deposition rates. This research established a theoretical foundation for producing high-quality chicken meat and provided novel insights into gut microbiota's role in mediating poultry fat deposition.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures followed the Guidelines for the Care and Use of Laboratory Animals in China and were approved by the Ethics Committee of China Agricultural University (Approval NO. statement no. AW30112202-1-1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZhouyang Gao: Writing \u0026ndash; review \u0026amp; editing, Writing \u0026ndash; original draft, Software, Investigation, Formal analysis, Data curation, Conceptualization. Xiaohang Yang, Muying Nie, Suxin Shi: Writing \u0026ndash; review \u0026amp; editing, Methodology. Gaoxiang Yuan, Xiaoyi Li, Yuying Zhang: Writing \u0026ndash; review \u0026amp; editing, Supervision. Dan Liu: Writing \u0026ndash; review \u0026amp; editing, Project administration, Methodology, Funding acquisition, Conceptualization. All authors read and approved the finally manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Key Research and Development Program of China (2022YFD1300400) and the 2115 Talent Development Program of China Agricultural University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo data was used for the research described in the article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChanda D, De D (2024) Meta-analysis reveals obesity associated gut microbial alteration patterns and reproducible contributors of functional shift. Gut Microbes 16:2304900. https://doi.org/10.1080/19490976.2024.2304900\u003c/li\u003e\n\u003cli\u003eSanders ME, Merenstein DJ, Reid G, et al (2019) Probiotics and prebiotics in intestinal health and disease: from biology to the clinic. Nat Rev Gastroenterol Hepatol 16:605\u0026ndash;616. https://doi.org/10.1038/s41575-019-0173-3\u003c/li\u003e\n\u003cli\u003eAhmed K, Choi H-N, Cho S-R, Yim J-E (2024) Association of Firmicutes/Bacteroidetes Ratio with Body Mass Index in Korean Type 2 Diabetes Mellitus Patients. Metabolites 14:518. https://doi.org/10.3390/metabo14100518\u003c/li\u003e\n\u003cli\u003eWang Z, Zeng M, Wang Z, et al (2023) Food phenolics stimulate adipocyte browning via regulating gut microecology. Crit Rev Food Sci Nutr 63:4026\u0026ndash;4052. https://doi.org/10.1080/10408398.2021.1997905\u003c/li\u003e\n\u003cli\u003eCani PD, Van Hul M (2024) Gut microbiota in overweight and obesity: crosstalk with adipose tissue. Nat Rev Gastroenterol Hepatol 21:164\u0026ndash;183. https://doi.org/10.1038/s41575-023-00867-z\u003c/li\u003e\n\u003cli\u003eWei Y-H, Ma X, Zhao J-C, et al (2023) Succinate metabolism and its regulation of host-microbe interactions. Gut Microbes 15:2190300. https://doi.org/10.1080/19490976.2023.2190300\u003c/li\u003e\n\u003cli\u003eKrawczyk B, Wityk P, Gałęcka M, Michalik M (2021) The Many Faces of Enterococcus spp.-Commensal, Probiotic and Opportunistic Pathogen. Microorganisms 9:1900. https://doi.org/10.3390/microorganisms9091900\u003c/li\u003e\n\u003cli\u003eRaheem A, Liang L, Zhang G, Cui S (2021) Modulatory Effects of Probiotics During Pathogenic Infections With Emphasis on Immune Regulation. Front Immunol 12:616713. https://doi.org/10.3389/fimmu.2021.616713\u003c/li\u003e\n\u003cli\u003eChai Z, Yan Y, Zan S, et al (2022) Probiotic-fermented blueberry pomace alleviates obesity and hyperlipidemia in high-fat diet C57BL/6J mice. Food Res Int Ott Ont 157:111396. https://doi.org/10.1016/j.foodres.2022.111396\u003c/li\u003e\n\u003cli\u003eHuang J, Jiang R, Wang Y (2023) Effects of the probiotic Bacillus coagulans BC69 on the metabolic and histological alterations induced by a high-sugar and high-fat diet in C57BL/6J mice. Food Funct 14:6596\u0026ndash;6609. https://doi.org/10.1039/d3fo01104f\u003c/li\u003e\n\u003cli\u003eLiu X, Mao B, Gu J, et al (2021) Blautia-a new functional genus with potential probiotic properties? Gut Microbes 13:1\u0026ndash;21. https://doi.org/10.1080/19490976.2021.1875796\u003c/li\u003e\n\u003cli\u003eNiu Y, Hu X, Song Y, et al (2024) Blautia Coccoides is a Newly Identified Bacterium Increased by Leucine Deprivation and has a Novel Function in Improving Metabolic Disorders. Adv Sci Weinh Baden-Wurtt Ger 11:e2309255. https://doi.org/10.1002/advs.202309255\u003c/li\u003e\n\u003cli\u003eTrischler R, Roth J, Sorbara MT, et al (2022) A functional Wood-Ljungdahl pathway devoid of a formate dehydrogenase in the gut acetogens Blautia wexlerae, Blautia luti and beyond. Environ Microbiol 24:3111\u0026ndash;3123. https://doi.org/10.1111/1462-2920.16029\u003c/li\u003e\n\u003cli\u003eLiu S, Zhao L, Xiao X, et al (2022) Acetate promotes lipogenesis in adipocytes but not in hepatocytes of chickens. Br Poult Sci 63:54\u0026ndash;61. https://doi.org/10.1080/00071668.2021.1960950\u003c/li\u003e\n\u003cli\u003eMoffett JR, Puthillathu N, Vengilote R, et al (2020) Acetate Revisited: A Key Biomolecule at the Nexus of Metabolism, Epigenetics and Oncogenesis-Part 1: Acetyl-CoA, Acetogenesis and Acyl-CoA Short-Chain Synthetases. Front Physiol 11:580167. https://doi.org/10.3389/fphys.2020.580167\u003c/li\u003e\n\u003cli\u003eNi M, He H, Chen M, et al (2024) Supplementation of sodium acetate improves the growth performance and intestinal health of rabbits through Wnt/\u0026beta;-catenin signaling pathway. J Anim Sci 102:skae197. https://doi.org/10.1093/jas/skae197\u003c/li\u003e\n\u003cli\u003eSahuri-Arisoylu M, Brody LP, Parkinson JR, et al (2016) Reprogramming of hepatic fat accumulation and \u0026ldquo;browning\u0026rdquo; of adipose tissue by the short-chain fatty acid acetate. Int J Obes 2005 40:955\u0026ndash;963. https://doi.org/10.1038/ijo.2016.23\u003c/li\u003e\n\u003cli\u003eXu C, Yin Z (2024) Unraveling the flavor profiles of chicken meat: Classes, biosynthesis, influencing factors in flavor development, and sensory evaluation. Compr Rev Food Sci Food Saf 23:e13391. https://doi.org/10.1111/1541-4337.13391\u003c/li\u003e\n\u003cli\u003eLi L, Cui Z, Wang H, et al (2023) Dietary supplementation of dimethyl itaconate protects against chronic heat stress-induced growth performance impairment and lipid metabolism disorder in broiler chickens. J Anim Sci 101:skad120. https://doi.org/10.1093/jas/skad120\u003c/li\u003e\n\u003cli\u003eChoi J, Kong B, Bowker BC, et al (2023) Nutritional Strategies to Improve Meat Quality and Composition in the Challenging Conditions of Broiler Production: A Review. Anim Open Access J MDPI 13:1386. https://doi.org/10.3390/ani13081386\u003c/li\u003e\n\u003cli\u003eKim M, Voy BH (2021) Fighting Fat With Fat: n-3 Polyunsaturated Fatty Acids and Adipose Deposition in Broiler Chickens. Front Physiol 12:755317. https://doi.org/10.3389/fphys.2021.755317\u003c/li\u003e\n\u003cli\u003eLone A, Mottawea W, Mehdi Y, Hammami R (2022) Bacteriocinogenic probiotics as an integrated alternative to antibiotics in chicken production - why and how? Crit Rev Food Sci Nutr 62:8744\u0026ndash;8760. https://doi.org/10.1080/10408398.2021.1932722\u003c/li\u003e\n\u003cli\u003eCai Y, Xiao C, Tian B, et al (2024) Dietary probiotic based on a dual-strain Bacillus subtilis improves immunity, intestinal health, and growth performance of broiler chickens. J Anim Sci 102:skae183. https://doi.org/10.1093/jas/skae183\u003c/li\u003e\n\u003cli\u003eWang Y, Zhang C, Chen X, et al (2024) Dietary supplementation of compound probiotics to improve performance, egg quality, biochemical parameters and intestinal morphology of laying hens. Front Vet Sci 11:1505151. https://doi.org/10.3389/fvets.2024.1505151\u003c/li\u003e\n\u003cli\u003eYang X, Zhang M, Liu Y, et al (2023) Inulin-enriched Megamonas funiformis ameliorates metabolic dysfunction-associated fatty liver disease by producing propionic acid. NPJ Biofilms Microbiomes 9:84. https://doi.org/10.1038/s41522-023-00451-y\u003c/li\u003e\n\u003cli\u003eLiu Y, Feng Y, Yang X, et al (2023) Mining chicken ileal microbiota for immunomodulatory microorganisms. ISME J 17:758\u0026ndash;774. https://doi.org/10.1038/s41396-023-01387-z\u003c/li\u003e\n\u003cli\u003eLin XJ, Li L, Gou ZY, et al (2021) Reproductive performance, metabolism and oxidative stress profile in Chinese yellow-feathered broiler breeder hens fed multiple levels of isoleucine. Br Poult Sci 62:509\u0026ndash;516. https://doi.org/10.1080/00071668.2021.1894322\u003c/li\u003e\n\u003cli\u003eLiu Z, Chen Q, Zhong Y, et al (2023) Effects of earthworm hydrolysate in production performance, serum biochemical parameters, antioxidant capacity and intestinal function of Muscovy ducks. Poult Sci 102:102409. https://doi.org/10.1016/j.psj.2022.102409\u003c/li\u003e\n\u003cli\u003eLudikhuize MC, Meerlo M, Burgering BMT, Rodr\u0026iacute;guez Colman MJ (2021) Protocol to profile the bioenergetics of organoids using Seahorse. STAR Protoc 2:100386. https://doi.org/10.1016/j.xpro.2021.100386\u003c/li\u003e\n\u003cli\u003eShah AA, Totakul P, Matra M, et al (2022) Nutritional composition of various insects and potential uses as alternative protein sources in animal diets. Anim Biosci 35:317\u0026ndash;331. https://doi.org/10.5713/ab.21.0447\u003c/li\u003e\n\u003cli\u003eLi A, Hu H, Huang Y, et al (2024) Effects of dietary metabolizable energy level on hepatic lipid metabolism and cecal microbiota in aged laying hens. Poult Sci 103:103855. https://doi.org/10.1016/j.psj.2024.103855\u003c/li\u003e\n\u003cli\u003eYin C, Tang S, Liu L, et al (2021) Effects of Bile Acids on Growth Performance and Lipid Metabolism during Chronic Heat Stress in Broiler Chickens. Anim Open Access J MDPI 11:630. https://doi.org/10.3390/ani11030630\u003c/li\u003e\n\u003cli\u003eMarkowiak-Kopeć P, Śliżewska K (2020) The Effect of Probiotics on the Production of Short-Chain Fatty Acids by Human Intestinal Microbiome. Nutrients 12:1107. https://doi.org/10.3390/nu12041107\u003c/li\u003e\n\u003cli\u003eHosomi K, Saito M, Park J, et al (2022) Oral administration of Blautia wexlerae ameliorates obesity and type 2 diabetes via metabolic remodeling of the gut microbiota. Nat Commun 13:4477. https://doi.org/10.1038/s41467-022-32015-7\u003c/li\u003e\n\u003cli\u003eXu W, Yu J, Yang Y, et al (2023) Strain-level screening of human gut microbes identifies Blautia producta as a new anti-hyperlipidemic probiotic. Gut Microbes 15:2228045. https://doi.org/10.1080/19490976.2023.2228045\u003c/li\u003e\n\u003cli\u003eSakr SA, Abouelnaga AF, Ateya AI, et al (2025) Growth performance, behavior, gene expression, carcass characteristics, stress indicators, and economical parameters of avian 48 broiler chickens raised under three different stocking density. Front Vet Sci 12:1517142. https://doi.org/10.3389/fvets.2025.1517142\u003c/li\u003e\n\u003cli\u003eWang Q, Wang L, Li L, et al (2024) Effects of dietary supplementation of fermented Artemisia argyi on growth performance, slaughter performance, and meat quality in broilers. Poult Sci 103:103545. https://doi.org/10.1016/j.psj.2024.103545\u003c/li\u003e\n\u003cli\u003eLiu H, Wang L, Guo Z, et al (2021) Genome-wide association and selective sweep analyses reveal genetic loci for FCR of egg production traits in ducks. Genet Sel Evol GSE 53:98. https://doi.org/10.1186/s12711-021-00684-5\u003c/li\u003e\n\u003cli\u003eHolmberg SM, Feeney RH, Prasoodanan P K V, et al (2024) The gut commensal Blautia maintains colonic mucus function under low-fiber consumption through secretion of short-chain fatty acids. Nat Commun 15:3502. https://doi.org/10.1038/s41467-024-47594-w\u003c/li\u003e\n\u003cli\u003eJing Y, Yuan Y, Monson M, et al (2021) Multi-Omics Association Reveals the Effects of Intestinal Microbiome-Host Interactions on Fat Deposition in Broilers. Front Microbiol 12:815538. https://doi.org/10.3389/fmicb.2021.815538\u003c/li\u003e\n\u003cli\u003ePark S-Y, Byeon D-S, Kim G-W, Kim H-Y (2021) Carcass and retail meat cuts quality properties of broiler chicken meat based on the slaughter age. J Anim Sci Technol 63:180\u0026ndash;190. https://doi.org/10.5187/jast.2021.e2\u003c/li\u003e\n\u003cli\u003eBened\u0026eacute;-Ubieto R, Cubero FJ, Nevzorova YA (2024) Breaking the barriers: the role of gut homeostasis in Metabolic-Associated Steatotic Liver Disease (MASLD). Gut Microbes 16:2331460. https://doi.org/10.1080/19490976.2024.2331460\u003c/li\u003e\n\u003cli\u003eOuyang S, Zhuo S, Yang M, et al (2024) Glycerol Kinase Drives Hepatic de novo Lipogenesis and Triglyceride Synthesis in Nonalcoholic Fatty Liver by Activating SREBP-1c Transcription, Upregulating DGAT1/2 Expression, and Promoting Glycerol Metabolism. Adv Sci Weinh Baden-Wurtt Ger 11:e2401311. https://doi.org/10.1002/advs.202401311\u003c/li\u003e\n\u003cli\u003eAppleton SR, Ballou A, Watkins KL (2024) Use of Monoglycerides and Diglycerides to Mitigate Poultry Production Losses: A Review. Vet Sci 11:101. https://doi.org/10.3390/vetsci11030101\u003c/li\u003e\n\u003cli\u003eSantoro A, McGraw TE, Kahn BB (2021) Insulin action in adipocytes, adipose remodeling, and systemic effects. Cell Metab 33:748\u0026ndash;757. https://doi.org/10.1016/j.cmet.2021.03.019\u003c/li\u003e\n\u003cli\u003eHeeren J, Scheja L (2021) Metabolic-associated fatty liver disease and lipoprotein metabolism. Mol Metab 50:101238. https://doi.org/10.1016/j.molmet.2021.101238\u003c/li\u003e\n\u003cli\u003eFord H, Strieder-Barboza C (2025) Depot-dependent effects of subclinical ketosis on visceral and subcutaneous adipose tissue transcriptional cellular diversity in dairy cows. J Anim Sci Biotechnol 16:128. https://doi.org/10.1186/s40104-025-01265-y\u003c/li\u003e\n\u003cli\u003eMz D, B V, R C-N (2025) Lipid Hormones at the Intersection of Metabolic Imbalances and Endocrine Disorders. Curr Issues Mol Biol 47:. https://doi.org/10.3390/cimb47070565\u003c/li\u003e\n\u003cli\u003eEngin A (2024) Nonalcoholic Fatty Liver Disease and Staging of Hepatic Fibrosis. Adv Exp Med Biol 1460:539\u0026ndash;574. https://doi.org/10.1007/978-3-031-63657-8_18\u003c/li\u003e\n\u003cli\u003eTahri-Joutey M, Andreoletti P, Surapureddi S, et al (2021) Mechanisms Mediating the Regulation of Peroxisomal Fatty Acid Beta-Oxidation by PPAR\u0026alpha;. Int J Mol Sci 22:8969. https://doi.org/10.3390/ijms22168969\u003c/li\u003e\n\u003cli\u003eMontaigne D, Butruille L, Staels B (2021) PPAR control of metabolism and cardiovascular functions. Nat Rev Cardiol 18:809\u0026ndash;823. https://doi.org/10.1038/s41569-021-00569-6\u003c/li\u003e\n\u003cli\u003eChen Y-Y, Chen X-G, Zhang S (2022) Druggability of lipid metabolism modulation against renal fibrosis. Acta Pharmacol Sin 43:505\u0026ndash;519. https://doi.org/10.1038/s41401-021-00660-1\u003c/li\u003e\n\u003cli\u003eLuo C, Yu Y, Meng G, Yuan J (2025) Slowly digestible starch impairs growth performance of broiler chickens offered low-protein diet supplemental higher amino acid densities by inhibiting the utilization of intestinal amino acid. J Anim Sci Biotechnol 16:12. https://doi.org/10.1186/s40104-024-01142-0\u003c/li\u003e\n\u003cli\u003eVan Every HA, Schmidt CJ (2021) Transcriptomic and metabolomic characterization of post-hatch metabolic reprogramming during hepatic development in the chicken. BMC Genomics 22:380. https://doi.org/10.1186/s12864-021-07724-w\u003c/li\u003e\n\u003cli\u003eFernandez-Fuente G, Rigby MJ, Puglielli L (2023) Intracellular Citrate/acetyl-CoA flux and endoplasmic reticulum acetylation: Connectivity is the answer. Mol Metab 67:101653. https://doi.org/10.1016/j.molmet.2022.101653\u003c/li\u003e\n\u003cli\u003eFelix JB, Cox AR, Hartig SM (2021) Acetyl-CoA and Metabolite Fluxes Regulate White Adipose Tissue Expansion. Trends Endocrinol Metab TEM 32:320\u0026ndash;332. https://doi.org/10.1016/j.tem.2021.02.008\u003c/li\u003e\n\u003cli\u003ede Vos WM, Tilg H, Van Hul M, Cani PD (2022) Gut microbiome and health: mechanistic insights. Gut 71:1020\u0026ndash;1032. https://doi.org/10.1136/gutjnl-2021-326789\u003c/li\u003e\n\u003cli\u003eZhang P (2022) Influence of Foods and Nutrition on the Gut Microbiome and Implications for Intestinal Health. Int J Mol Sci 23:9588. https://doi.org/10.3390/ijms23179588\u003c/li\u003e\n\u003cli\u003eVital S-T, Clausen U, F\u0026uuml;ssel J, et al (2024) Global Growth Phase Response of the Gut Bacterium Phocaeicola vulgatus (Phylum Bacteroidota). Microb Physiol 34:153\u0026ndash;169. https://doi.org/10.1159/000538914\u003c/li\u003e\n\u003cli\u003eGuo M, Jiang X, Ouyang H, et al (2025) Parabacteroides distasonis promotes liver regeneration by increasing \u0026beta;-hydroxybutyric acid (BHB) production and BHB-driven STAT3 signals. Acta Pharm Sin B 15:1430\u0026ndash;1446. https://doi.org/10.1016/j.apsb.2025.01.024\u003c/li\u003e\n\u003cli\u003eBetancur-Murillo CL, Aguilar-Mar\u0026iacute;n SB, Jovel J (2022) Prevotella: A Key Player in Ruminal Metabolism. Microorganisms 11:1. https://doi.org/10.3390/microorganisms11010001\u003c/li\u003e\n\u003cli\u003eMartin-Gallausiaux C, Marinelli L, Blotti\u0026egrave;re HM, et al (2021) SCFA: mechanisms and functional importance in the gut. Proc Nutr Soc 80:37\u0026ndash;49. https://doi.org/10.1017/S0029665120006916\u003c/li\u003e\n\u003cli\u003eHe J, Zhang P, Shen L, et al (2020) Short-Chain Fatty Acids and Their Association with Signalling Pathways in Inflammation, Glucose and Lipid Metabolism. Int J Mol Sci 21:6356. https://doi.org/10.3390/ijms21176356\u003c/li\u003e\n\u003cli\u003eYao Y, Cai X, Fei W, et al (2022) The role of short-chain fatty acids in immunity, inflammation and metabolism. Crit Rev Food Sci Nutr 62:1\u0026ndash;12. https://doi.org/10.1080/10408398.2020.1854675\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Probiotic, Blautia coccoides CML164, Lipid metabolism, Energy metabolism, Gut microbiota, Broiler chickens","lastPublishedDoi":"10.21203/rs.3.rs-8511274/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8511274/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe probiotic potential of \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164, a novel acetate-producing strain isolated from the poultry gut, was systematically evaluated for its ability to modulate lipid and energy metabolism in broilers via gut microbiota-mediated pathways. Supplementation with \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 significantly reshaped the cecal microbiome, enriching beneficial short-chain fatty acid (SCFA)-producing bacteria such as \u003cem\u003ePhocaeicola vulgatus\u003c/em\u003e, \u003cem\u003eParabacteroides distasonis\u003c/em\u003e, and members of \u003cem\u003ePrevotellaceae\u003c/em\u003e, while concurrently increasing cecal acetate concentration in broiler chickens. These microbial changes were accompanied by improved mitochondrial function, enhanced hepatic fatty acid oxidation (upregulation of \u003cem\u003ePPARα\u003c/em\u003e, \u003cem\u003eACOX1\u003c/em\u003e), and suppression of lipogenic genes (\u003cem\u003eSREBP1\u003c/em\u003e, \u003cem\u003ePPARγ\u003c/em\u003e), leading to reduced abdominal fat deposition and improved serum lipid profiles without compromising growth performance in broilers. The study demonstrates that \u003cem\u003eBlautia coccoides\u003c/em\u003e CML164 functions as an effective probiotic by orchestrating gut microbiota composition and promoting SCFA production, thereby activating host metabolic pathways that mitigate lipid accumulation. Our findings highlight the critical role of microbial intervention in regulating energy homeostasis and offer a promising strategy for leveraging probiotics to enhance metabolic health in poultry production.\u003c/p\u003e","manuscriptTitle":"Blautia coccoides CML164 improved lipid and energy metabolism in broiler chickens via gut microbiota pathways","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-16 19:16:49","doi":"10.21203/rs.3.rs-8511274/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-17T10:35:39+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-15T19:57:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"197948479395247414348422272181356764619","date":"2026-02-08T19:23:50+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-23T18:31:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"213625840375428803193880287928729096123","date":"2026-01-15T13:59:19+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-13T13:44:48+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-06T10:28:40+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-06T10:24:41+00:00","index":"","fulltext":""},{"type":"submitted","content":"Probiotics and Antimicrobial Proteins","date":"2026-01-04T07:46:08+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"probiotics-and-antimicrobial-proteins","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paap","sideBox":"Learn more about [Probiotics and Antimicrobial Proteins](http://link.springer.com/journal/12601)","snPcode":"12602","submissionUrl":"https://submission.nature.com/new-submission/12602/3","title":"Probiotics and Antimicrobial Proteins","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"5c284e39-c78c-4e60-a62d-7c1d350c43ad","owner":[],"postedDate":"January 16th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-14T19:09:09+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-16 19:16:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8511274","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8511274","identity":"rs-8511274","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}