SDC-1 deficiency enhances the pancreatic cancer response to PD-1 antibody by reprogramming tumor microenvironment

preprint OA: closed
Full text JSON View at publisher
Full text 120,254 characters · extracted from preprint-html · click to expand
SDC-1 deficiency enhances the pancreatic cancer response to PD-1 antibody by reprogramming tumor microenvironment | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article SDC-1 deficiency enhances the pancreatic cancer response to PD-1 antibody by reprogramming tumor microenvironment Hanteng Yang, Ting Wang, Yun Wang, Yongyue Du, Chen Mi, Siyang Wang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6802997/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Immunotherapy with PD-1 antibody for pancreatic cancer faces significant challenges due to the intricate tumor microenvironment. Syndecan-1 ( SDC-1 ), a type I transmembrane heparan sulfate proteoglycan, plays a crucial role in paracrine and epithelial-stromal interactions. However, its functional and clinical significance in the development and immunotherapy of pancreatic cancer remains unclear. Here, we report that targeting SDC-1 is a potential strategy to enhance therapeutic efficacy of PD-1 on pancreatic cancer by regulating tumor microenvironment. Our analysis reveals that SDC-1 is upregulated in pancreatic cancer tissues compared to normal pancreatic tissues. High SDC-1 expression correlates negatively with patient prognosis, as demonstrated through publicly available databases and tissue microarrays from pancreatic cancer patients. Overexpression of SDC-1 in PANC-1 cells promoted proliferation, migration, and invasion of pancreatic cancer cells, while SDC-1 knockdown significantly reduced these activities. In vivo, SDC-1 knockdown inhibited tumor growth and prolonged survival in mice with subcutaneous pancreatic cancer tumors. Crucially, SDC-1 ablation significantly enhanced the response of pancreatic cancer to PD-1 antibody treatment by reducing collagen deposition and cancer-associated fibroblast (CAF) levels in the stroma, while promoting increased infiltration of CD4 + and CD8 + T cells. Taken together, our findings suggest that SDC-1 is a critical oncogene in pancreatic cancer. Its deficiency leads to significant sensitization to immunotherapy by reprogramming the tumor microenvironment, offering a promising strategy to improve PD-1 antibody efficacy in pancreatic cancer treatment. Biological sciences/Cancer Biological sciences/Immunology Health sciences/Biomarkers Pancreatic cancer SDC-1 gene Biological function Tumor microenvironment Immune therapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1 Introduction Pancreatic cancer is an aggressive malignancy characterized by rapid progression. In 2022, the International Agency for Research on Cancer (IARC) reported over 510,000 new cases and 460,000 deaths worldwide 1 . Despite various therapeutic strategies, pancreatic cancer remains a formidable challenge due to its high recurrence rate and limited treatment success 2 , 3 . While immunotherapy has demonstrated efficacy in several solid tumors, such as melanoma and lung cancer, the application of PD-1 inhibitors in pancreatic cancer has yielded largely disappointing results 4 – 6 . This is primarily attributed to the immunosuppressive tumor microenvironment (TME) of pancreatic cancer, which promotes T cell exhaustion via upregulation of PD-1 ligands, thereby fostering tumor growth 7 , 8 . Tumor-associated factors, including cancer-associated fibroblasts (CAFs), further contribute to the immunosuppressive nature of the TME, thereby limiting the effectiveness of PD-1 inhibition. Consequently, targeting these immunosuppressive mechanisms is of paramount importance to enhance immunotherapy outcomes in pancreatic cancer. The tumor microenvironment, comprising immune cells, cancer-associated fibroblasts (CAFs), and extracellular matrix (ECM), critically regulates tumor progression and therapeutic resistance 9 . As principal stromal constituents, CAFs actively remodel ECM architecture, modulate its biomechanical characteristics, orchestrate bidirectional communication with both neoplastic and immune cells, and exert potent immunosuppressive functions through cytokine networks 10 . The ECM - a dynamic scaffold composed of collagen fibers, glycoproteins, and proteoglycans - serves as a biochemical signaling platform while undergoing continuous remodeling by matrix metalloproteinases (MMPs) and other proteolytic enzymes within the TME 11 . This reciprocal CAF-ECM interaction establishes a fibrotic barrier that physically restricts cytotoxic T lymphocyte infiltration, sustains immunosuppressive niches through TGF-β signaling, and drives resistance to immune checkpoint inhibitors in pancreatic ductal adenocarcinoma 12 , 13 . Consequently, deciphering spatiotemporal TME evolution, particularly the plasticity of CAF subpopulations, could unlock novel strategies to potentiate adoptive T cell therapies against pancreatic malignancies. Syndecan-1 ( SDC-1 , CD138) is a heparan sulfate proteoglycan (HSPG) predominantly expressed in epithelial and plasma cells, serving as a pivotal member of the HSPG family 14 . Functioning as an extracellular matrix receptor, SDC-1 participates in diverse biological processes including cell-cell communication, proliferation, angiogenesis, and metastatic dissemination. It critically regulates extracellular matrix (ECM) assembly and collagen fiber reorganization during breast cancer progression 15 , 16 . SDC-1 activates signaling cascades such as mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) and MAPK/c-Jun N-terminal kinase (JNK) upon ligand engagement, thereby driving neoplastic cell proliferation 17 . In epithelial malignancies, elevated SDC-1 expression correlates with E-cadherin downregulation, reflecting diminished intercellular adhesion and enhanced metastatic competence. SDC1 also modulates oncogenic signaling networks and interacts with tumor microenvironment (TME) components to influence disease progression 18 . Elucidating SDC-1 's TME interactions remains essential for advancing malignant tumors such as pancreatic cancer therapeutic strategies. This study aimed to investigate the expression dynamics and functional roles of SDC-1 in pancreatic cancer development, as well as its regulatory effects on CAFs within the pancreatic cancer tumor microenvironment. Additionally, we evaluated the therapeutic potential of anti-PD-1 in pancreatic cancer-bearing mouse models. To identify potential biomarkers for the diagnosis and prognosis of pancreatic cancer and to provide a solid experimental foundation for developing immunotherapy strategies targeting SDC-1 and anti-PD-1. These insights carry substantial public health significance, offering pathways to enhance early detection rates and reducing pancreatic cancer related mortality. 2 Materials and Methods 2.1. Collection of public database results and pancreatic cancer specimens collected SDC-1 gene expression in pancreatic cancer was analyzed using GEPIA ( http://gepia.cancer-pku.cn/ ), UALCAN ( https://ualcan.path.uab.edu/ ), and TIMER 2.0 database ( http://timer.comp-genomics.org/ ). Correlations between SDC-1 expression and patient survival were assessed via Kaplan-Meier Plotter, GEPIA, and TISIDB ( http://cis.hku.hk/TISIDB ). The relationship between SDC-1 and immunity was examined using the IMMPORT database ( https://www.immport.org/ ). In addition, a total of 114 pancreatic cancer and paracancerous samples, with clinical data, were analyzed for SDC-1 expression. None of the patients received preoperative chemotherapy or radiotherapy. All specimens were collected with informed consent under protocols approved by the Ethics Committee of the School of Public Health, Lanzhou University (No. IRB22100501). This study conforms to the principles of the Declaration of Helsinki, and informed consent was obtained from all patients. 2.2. Cell culture, lentiviral transfections, and the detection of gene and protein expression levels Human pancreatic ductal cells (HPNE) and cancer cell lines (PANC-1, CFPAC-1, SW1990, BXPC-3) were sourced from Chinese Academy of Sciences and Wuhan Technology Co., Ltd., while mouse pancreatic cancer cells (PANC02) were obtained from Hefei Everything Life Biotechnology Co., Ltd. HPNE, PANC-1, CFPAC-1, and PANC02 were cultured in DMEM with 10% fetal bovine serum, and BXPC-3 and SW1990 in RPMI medium. All cell lines were authenticated by short tandem repeat (STR) profiling. All cell lines were cultured at 37°C with 5% CO 2 . The SDC-1 overexpression plasmid (Shanghai Genechem Co., Ltd), SDC-1 siRNA (Guangzhou Ribobio Co., Ltd), and Lipofectamine 2000 (Invitrogen) were prepared in serum-free medium. The plasmid or siRNA was combined with Lipofectamine 2000 to form a transfection mixture, which was applied to PANC-1 and BXPC-3 cells at 50–60% confluency, mRNA expression was analyzed after 36 hours, and protein expression after 48 hours, successfully establishing cell lines for subsequent functional experiments. A mouse pancreatic cancer cell suspension (10⁵ cells/mL) was seeded in a 6-well plate and cultured for 24 hours. Based on the MOI value of PAN02 cells and the titer of the SDC-1 knockout lentivirus, the appropriate volume of virus and infection enhancer was added. Cells were incubated at 37°C for 12–16 hours, followed by a medium change and continued cultivation. After 72 hours, cells were screened with 2–5 µg/mL puromycin for 48 hours to establish stable cell lines. Western blot verified knockout efficiency, and the CRISPR/Cas9 knockout cell line with the highest efficiency was selected for functional experiments. The sgRNA sequence used was TCTGACAACTTTCCGGCTC. Total RNA from cells or tissues was extracted using RNAiso Plus (Takara, Japan). Reverse transcription was performed using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Japan). Real-time quantitative PCR (RT-qPCR) was conducted using TB Green (Takara, Japan), with GAPDH as the internal control. Data were analyzed using the 2 -ΔΔCT and 40-ΔCT methods for relative quantification. Primer sequences are provided in Table 1 . Total protein was extracted from cells and quantified using the bicinchoninic acid (BCA) assay. Cells were lysed with RIPA buffer, and the lysates were centrifuged at 12,000 g for 10 minutes. Proteins were separated by SDS-PAGE, transferred onto a PVDF membrane, and incubated overnight at 4°C with primary antibodies: rabbit anti- SDC-1 (1:1000; ab128936, Abcam) and mouse anti-GAPDH (1:1000, Wuhan Servicebio). After stripping, membranes were probed with secondary antibodies: goat anti-mouse or anti-rabbit IgG (1:10,000, Bioworld) and visualized using enhanced chemiluminescence. . Table 1 Primer sequences Primer name Primer sequences SDC-1 -Forward GTGCTGGGAGGGGTCATTGC SDC-1 -Reverse AGCTGCCTTCGTCCTTCTTCTTC GAPDH-Forward CAGGAGGCATTGCTGATGAT GAPDH-Reverse GAAGGCTGGGGCTCATTT 2.3. CCK8, cell migration, colony formation, and wound healing assay For the cell proliferation assay, cells were seeded in 96-well plates at 1,000 cells per well. After attachment, fresh medium with CCK8 (Biosharp, China) was added, and OD values were measured at 24, 48, 72h. For colony formation, 1,000 cells were plated in six-well plates. After one week, cells were fixed with methanol for 15 min, stained with crystal violet for 10 min, and counted using Image J. For invasion and migration assays, 5,000 cells were seeded in the upper chamber (Millipore, MA, USA), with complete medium containing 10% FBS in the lower chamber. For invasion, 200 µL of 1:8 diluted Matrigel (Corning, NYC, USA) was added to the upper chamber. After 24 h, cells were fixed with 4% paraformaldehyde for 20 min, stained with crystal violet, and observed under a microscope. For the scratch assay, cells were seeded in 6-well plates at 90% density. After attachment, a scratch was made using a 200 µL pipette tip. PBS was washed twice, and RPMI-1640 serum-free medium (Gibco, CA, USA) was added. Scratch widths were measured at 0, 12, 24, and 36 h, and migration was analyzed using Image J. 2.4. SDC-1 knockout C57 mouse model construction SDC-1 knockout lentivirus (Shanghai Genechem Co., Ltd) was used to knock out SDC-1 in mouse pancreatic cancer PAN02 cells. Mouse Tumorigenesis Model: SDC-1 knockout and untreated PAN02 cells were inoculated into SDC-1 knockout mice (Shanghai Model Organisms Center) and wild-type C57 mice (Lanzhou University Experimental Animal Center) for subcutaneous tumor growth. Tumor volume and mass were measured, and paraffin and frozen sections were prepared for further analysis. PD-1 Antagonistic Tumor Model: SDC-1 knockout and regular PAN02 cells were injected into SDC-1 knockout and wild-type C57 mice for subcutaneous tumor development. Half of the mice received intraperitoneal PD-1 injections (200 µg each, P372, Leinco Technologies) for 10 doses. All mice were anesthetized with 5% isoflurane, and euthanized by intraperitoneal injection of sodium pentobarbital (100 mg/kg). Tumor volume and mass were measured, and paraffin and frozen sections were prepared. Fresh tumor tissue was used for flow cytometry analysis. All animal handling procedures were approved by the School of Public Health, Lanzhou University (No. IRB22100501). All animal experimental operations followed the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health. The ARRIVE guidelines ( https://arriveguidelines.org ) have been followed for conducting and reporting animal experiments. A statement to confirm that all methods were carried out in accordance with relevant guidelines and regulations. 2.5. IHC, Immunofluorescence, Sirius Red, Masson Staining Analyses, and T-Cell Flow Cytometry Immunohistochemistry (IHC) staining, tissue microarrays (TMAs) of human pancreatic cancer specimens were deparaffinized, rehydrated, and treated to block endogenous peroxidase and nonspecific staining. Following antigen retrieval, samples were incubated with SDC-1 antibody (ab128936, Abcam, 1:200), and processed using biotin-labeled IgG polymer, streptavidin, and peroxidase. DAB chromogenic solution was applied for visualization, followed by hematoxylin counterstaining. Images were captured using a Tissue FAXS Plus system (Austria), and staining intensity (0, 1, 2, 3) along with the percentage of positive cancer duct cells (0%-100%) were assessed by pathologists at Lanzhou University Second Hospital. The final tissue score (H-score) was calculated by multiplying the staining intensity with the percentage of positive cells. Immunofluorescence, tissue slices fixed with 4% paraformaldehyde were permeabilized with 0.5% Triton X-100 for 10 minutes, then blocked with Blocking Buffer (P0620, Beyotime) for 1 hour to prevent nonspecific binding. The samples were incubated overnight at 4°C with primary antibodies: CY3-conjugated α-SMA (C6198, Sigma-Aldrich), Alexa Fluor-647 anti-mouse CD4 (100530, Clone: RM4-5, BioLegend), and Alexa Fluor-647 anti-mouse CD8 (100724, Clone: 53 − 6.7, BioLegend). Nuclei were counterstained with DAPI (C1005, Beyotime). Confocal fluorescence images were captured using a Zeiss LSM 880 laser microscope with a 20× objective lens. For Sirius red staining, paraffin sections of pancreatic cancer were deparaffinized and rehydrated, then stained with iron hematoxylin and Sirius red staining solutions (G1472, Solarbio). The Sirius red dye bound to collagen fibers, rendering them visible as red under a microscope. After staining, the tissue slices were washed to remove excess dye, dehydrated, and mounted on glass slides for analysis. Images were captured using an optical microscope. . T-cell flow cytometry of tumor tissues, fresh tumor tissues were harvested, minced, and digested into single-cell suspensions using Collagenase-I (Sigma-Aldrich) in DMEM for 60 minutes at 37°C with continuous shaking. After digestion, collagenase activity was stopped by adding DMEM + 10% FBS, followed by filtration and centrifugation to obtain a single-cell suspension. Cells were stained with 7-AAD Viability Staining Solution (Beyotime) and analyzed for T cell populations using fluorophore-conjugated antibodies: PE anti-mouse CD3 (BioLegend), Alexa Fluor-647 anti-mouse CD4 (BioLegend), and APC anti-mouse CD8a (BioLegend). Samples were analyzed on a BD FACS Canto Flow Cytometer (BD Biosciences) and processed using FlowJo software (BD Life Sciences). 2.6. Statistical analysis Data expressed as mean ± SD, statistical analyses included two-tailed t-tests for two-group comparisons, one-way ANOVA for multi-group comparisons, chi-squared tests for categorical variables, and Spearman’s rank correlation coefficient for ranked variables. Data were analyzed using SPSS version 27.0 (SPSS, CT, USA) and visualized with GraphPad Prism 9.5 (GraphPad Software, CA, USA). Significance levels were denoted as ns (not significant), *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001. All experiments were repeated at least three times. 3 Results 3.1. SDC-1 is highly expressed in pancreatic cancer tissues and cell lines, and its expression correlates with clinicopathologic features Analysis of transcriptomic datasets (TIMER, GEPIA, UALCAN) demonstrated significant overexpression of SDC-1 in pancreatic cancer tissues compared to normal pancreatic tissues ( P <0.05; Fig. 1A-C). Prognostic evaluation revealed a inverse correlation between SDC-1 expression levels and overall survival (HR = 1.6, log-rank P = 0.019), with high SDC-1 expression cohorts exhibiting reduced median survival duration (Fig. 1D-G). Tissue microarray validation through immunohistochemical staining confirmed elevated SDC-1 protein expression in malignant epithelia versus adjacent normal ductal cells (Fig. 1H-J). Further analysis of 114 pancreatic cancer and paracancerous tissue samples showed a significant correlation between SDC-1 levels and tumor diameter ( P = 0.023) (Table 2). SDC-1 expression was low in normal pancreatic ductal cells (HPNE) but elevated in pancreatic cancer cells such as PANC-1 and CFPAC-1 (Fig. 1K, L). These results suggest that SDC-1 is overexpressed in pancreatic cancer and may contribute to its development. 3.2. Overexpression of SDC-1 promotes proliferation, migration, and invasion of of pancreatic cancer cells Comparative assessment revealed significantly lower SDC-1 expression in PANC-1 cells compared to BXPC-3 cells, while normal HPNE cells showed baseline expression levels. Based on this differential expression profile, we established SDC-1 -overexpressing PANC-1 cells through plasmid transfection and generated SDC-1 -knockdown BXPC-3 cells using targeted siRNA. Western blot validation confirmed successful transfection overexpression in PANC-1 and knockdown efficiency in BXPC-3 ( P < 0.05) (Fig. 2A-D). Functional characterization demonstrated that SDC-1 overexpression significantly enhanced PANC-1 cell proliferation, as evidenced by CCK-8 assays showing 80% increased viability at 72h ( P < 0.001) and colony formation assays revealing more colonies compared to controls ( P < 0.01) (Fig. 2E-F). Conversely, SDC-1 knockdown in BXPC-3 cells reduced proliferation ( P < 0.01) and decreased colony formation ( P < 0.01) (Fig. 2I-J). Scratch wound healing assays showed SDC-1 -overexpressing PANC-1 cells increase wound closure at 48h versus controls ( P < 0.05), while knockdown cells exhibited decrease closure compared to controls ( P < 0.01) (Fig. 2J, K ). Transwell invasion assays further revealed a increase in invasive capacity with SDC-1 overexpression versus reduction in knockdown cells ( P < 0.05) (Fig. 2H, L). These findings collectively demonstrate that SDC-1 functionally regulates pancreatic cancer cell proliferation, migration and invasion capacities 3.3. SDC-1 knockdown impaires the tumor growth and extends the survival of mice with pancreatic cancer To investigate the impact of SDC-1 on pancreatic cancer progression, we established a subcutaneous tumor model by inoculating PAN02 cells (with or without SDC-1 knockout) into syngeneic SDC-1 knockout (KO) and wild-type (WT) C57BL/6 mice. Four experimental groups were designed: 1) SDC-1 KO mice receiving SDC-1 KO PAN02 cells, 2) SDC-1 KO mice with WT PAN02 cells, 3) WT mice with SDC-1 KO PAN02 cells, and 4) WT mice with WT PAN02 cells. Tumor growth metrics revealed striking differences between groups (Fig. 3A-C). The SDC-1 KO mice implanted with SDC-1 KO PAN02 cells demonstrated the most significant tumor suppression, exhibiting reduction in final tumor volume compared to WT mice receiving WT cells ( P < 0.001). Notably, the host genetic background exerted greater influence than tumor cell SDC-1 status – SDC-1 KO mice bearing WT tumors still showed smaller volumes than WT mice with KO tumors ( P < 0.01). Survival analysis paralleled these findings (Fig. 3D). The SDC-1 KO/KO group achieved longest median survival (83 days), significantly exceeding both SDC-1 KO/WT (43 days, P < 0.01) and WT/KO groups (58 days, P < 0.01). 3.4. SDC-1 knockdown reduces collagen deposition, decreases CAFs levels and facilitates T cells infiltration of pancreatic cancer Comparative analysis revealed significantly elevated SDC-1 expression levels in wild-type (WT) C57BL/6 mice compared to SDC-1 knockout (KO) counterparts ( P < 0.05). Histopathological evaluation demonstrated exacerbated pancreatic epithelial cell deformation and necrotic areasin WT tumors. HE staining, Sirius red staining, and immunofluorescence, we observed SDC-1 expression, pancreatic epithelial cell deformation, necrosis, collagen fibers, tumor-associated fibroblasts, and CD4 + and CD8 + T cells. The results showed that in wild-type mice, SDC-1 expression was higher, pancreatic epithelial cell deformation and necrosis were more severe, collagen fibers and tumor-associated fibroblasts were more abundant, and CD4 + and CD8 + T cell content was lower. In contrast, SDC-1 knockout reduced tumor-associated fibroblasts, impacting collagen fiber and immune cell distribution in the extracellular matrix (Fig. 4A-C). These findings suggest that SDC-1 knockout may alter the pancreatic tumor microenvironment by reducing fibroblasts and influencing immune cell distribution. 3.5. SDC-1 knockout enhances the response of pancreatic cancer to PD-1 antibody by improving the TME We established a subcutaneous tumor model by inoculating SDC-1 knockout and wild-type C57 mice with PAN02 cells (normal SDC-1 expression or knockout). Once tumors reached 100 mm³, mice were randomly selected and treated with PD-1 intraperitoneal injections (200 µg per mouse, every three days for one month). After treatment, tumor volume and weight were measured, and tumor tissues were collected for paraffin and frozen sectioning (Fig. 5A-D). Immune cell infiltration, including CD4 + T and CD8 + T cells, was analyzed by flow cytometry. The results showed that PD-1 treatment in SDC-1 knockout mice increased CAFs, collagen fiber distribution, and immune cell infiltration (Fig. 6A-D), improving the tumor suppressive microenvironment and enhancing the inhibition of tumor growth. 4 Discussion Pancreatic cancer is characterized by low early detection rates, rapid progression, poor prognosis, and high invasiveness and metastatic potential, underscoring the urgent need for more effective prevention and treatment strategies. Immunotherapy, which enhances T-cell cytotoxicity and promotes tumor infiltration, has emerged as a promising therapeutic approach for various cancers 19 – 21 . However, the highly immunosuppressive TME in pancreatic cancer significantly restricts its efficacy. Consequently, targeting and modulating the immunosuppressive TME represents a novel and potentially transformative strategy for pancreatic cancer treatment 22 , 23 . SDC-1 exhibits diverse expression patterns and functional roles across various tumor types, highlighting its potential as a cancer biomarker 24 . In epithelial ovarian cancer, increased SDC-1 expression enhances angiogenesis and invasiveness 25 . Furthermore, SDC-1 is upregulated in epithelial cells of gallbladder and pancreatic ductal carcinomas, where it is predominantly expressed in the tumor mesenchyme 26 , 27 . Given the limited studies investigating SDC-1 's role in pancreatic cancer pathogenesis and progression, along with small sample sizes in prior research, this study explored the relationship between SDC-1 expression and pancreatic cancer development. Tumor and adjacent normal tissues from pancreatic cancer patients were analyzed by immunohistochemical and assess SDC1's correlation with pathological stages. Cellular experiments confirmed SDC-1 expression across pancreatic cancer cell lines. Results demonstrated significant SDC-1 overexpression in pancreatic cancer tissues and cells, with levels positively associated with tumor size. Study results of the bioinformatics analysis adopted also showed that the median survival period of pancreatic cancer patients with high expression of SDC-1 was shorter, indicating a poorer survival period. It is suggested that SDC-1 is overexpressed in pancreatic cancer, which may promote the occurrence and development of pancreatic cancer and indicate prognosis. SDC-1 , consisting of extracellular, transmembrane, and intracellular domains, demonstrates domain-specific functions: the extracellular domain primarily contributes to tumor immune evasion, metastasis, angiogenesis, and drug resistance 28 , whereas the intracellular domain modulates cell proliferation, survival, adhesion, and migration 29 . However, the biological role of the transmembrane domain remains poorly characterized 30 . In this investigation, we found that SDC-1 overexpression in pancreatic cancer cell lines substantially increased proliferation, migration, and invasiveness, whereas its knockout significantly attenuated these malignant phenotypes. In vivo experiments further demonstrated that SDC-1 -/- +AKR-KO mice showed the growth of pancreatic cancer cells slows down after tumor formation, highlighting SDC-1 's critical role in promoting pancreatic cancer proliferation. These findings indicate that SDC-1 actively drives malignant progression in pancreatic cancer and may function as an oncogene. The differential expression of SDC-1 across pancreatic cancer cell lines (low in PANC-1 vs. high in BXPC-3) and its functional correlation with malignant phenotypes establish SDC-1 as a critical regulator of pancreatic cancer progression. Our in vitro models demonstrated that SDC-1 overexpression in PANC-1 cells increased proliferation, migration, and invasion, whereas SDC-1 knockdown in BXPC-3 cells reversed these effects. These bidirectional manipulations confirm SDC-1 's oncogenic role through tumor-autonomous mechanisms, potentially via syndecan-mediated matrix interactions or growth factor receptor co-signaling. The in vivo tumor model revealed an unexpected dual regulatory axis: SDC-1 depletion in both tumor cells (PAN02-KO) and host microenvironment (KO mice) synergistically suppressed tumor growth, suggesting stromal-tumor crosstalk beyond cell-intrinsic effects. Notably, WT mice implanted with SDC-1 -KO tumors showed intermediate growth reduction compared to KO mice with WT tumors, implying host-derived SDC-1 contributes of the total pro-tumorigenic effect through paracrine mechanisms. This microenvironmental dependency aligns with recent findings on syndecan-1's role in extracellular matrix remodeling and immune cell recruitment 31 – 33 . TME serves as a critical regulator of pancreatic carcinogenesis, progression, and therapeutic resistance 34 . A hallmark event in stromal remodeling involves the pathological transformation of resident fibroblasts into activated CAFs through paracrine signaling from malignant cells 35 . Pancreatic tumor cells orchestrate this phenotypic conversion via sustained secretion of TGF-β1, FGF family members, IL-1, and CXCL chemokines, establishing a self-perpetuating CAF activation loop within the TME. Notably, TGF-β1 operates through both autocrine and paracrine mechanisms to maintain the myofibroblastic CAF (myCAF) phenotype characterized by α-smooth muscle actin (α-SMA) expression 36 . These α-SMA + myCAFs mediate immunosuppression through secretory factors that promote regulatory T cell expansion and myeloid-derived suppressor cell recruitment, thereby sculpting an immune-evasive niche 37 , 38 . Our experimental evidence demonstrates significant downregulation of both α-SMA and vimentin in SDC-1 deficient models compared to wild-type controls, indicative of impaired stromal activation. This molecular attenuation correlates with reduced myCAF infiltration and diminished immunosuppressive capacity, proposing SDC-1 ablation as a potential therapeutic strategy targeting desmoplasia and immune evasion in pancreatic adenocarcinoma. Our study provides compelling evidence that SDC-1 serves as a critical modulator of pancreatic cancer TME architecture and immunotherapy responsiveness. The comparative analysis between SDC-1 KO and WT models revealed profound differences in TME composition and function. Histopathological assessment demonstrated that SDC-1 ablation significantly reduced malignant features, including epithelial cell deformation, necrotic areas, and collagen deposition—hallmarks of pancreatic cancer desmoplasia. Most notably, we observed a marked decrease in CAF infiltration, consistent with prior reports implicating SDC-1 in fibroblast activation and extracellular matrix remodeling 39 . The increase of CD8 + T cell infiltration in SDC-1 KO tumors further supports SDC-1's role in maintaining an immunosuppressive stromal barrier, aligning with findings in other solid tumors 40 , 41 . The dense structural barrier formed through CAF-mediated ECM remodeling significantly compromises therapeutic agent penetration into tumor tissues, thereby exacerbating chemoresistance in malignant cells 42 . Our study demonstrated superior anti-tumor responses in SDC1-deficient models, with the SDC-1 -/- +AKR-KO + anti-PD-1 cohort exhibiting marked tumor volume reduction compared to WT controls. This enhanced efficacy aligns with established mechanisms wherein CAFs orchestrate immune evasion through three synergistic pathways: (1) cytokine-driven PD-L1 upregulation in neoplastic cells 43 , 44 , (2) ECM modification-induced physical exclusion of immune effectors, and (3) TGF-β-mediated differentiation of Foxp3 + regulatory T cells that subvert CD8 + T cell cytotoxicity 45 . Notably, SDC1 knockout amplified the effector T cell compartment, increasing CD8 + T cell infiltration of total CD3 + lymphocytes post-PD-L1 blockade. This immunomodulatory effect correlated with elevated expression of cytotoxic mediators including IFN-γ, Granzyme B, and T-box transcription factors 46 , 47 . Flow cytometric analysis revealed concurrent expansion of both CD8 + and CD4 + T cell subsets in SDC-1 -/- models, suggesting multifaceted immune activation beyond direct PD-1/PD-L1 axis modulation.While our data confirm SDC-1 's pivotal role in TME reprogramming, the complete mechanistic network remains to be elucidated. Particularly, the observed metabolic shift in CAFs from glycolytic to oxidative phosphorylation phenotypes in knockout models implies potential crosstalk between proteoglycan signaling and stromal bioenergetics that warrants further investigation. Our study demonstrates significant SDC-1 overexpression in pancreatic cancer tissues and cell lines, showing correlations with tumor aggressiveness, establishing SDC-1 as a promising diagnostic and prognostic biomarker for pancreatic cancer. Functionally, SDC-1 promotes pancreatic cancer cell proliferation, migration and invasive capacity, whereas its genetic ablation suppresses these oncogenic phenotypes, confirming its tumor-promoting role. At the molecular level, SDC-1 knockout can inhibits the conversion of normal fibroblasts into CAFs, consequently alleviating immunosuppressive TME characteristics and potentiating anti-PD-1 immunotherapy response. Future investigations should prioritize: (1) delineating SDC-1 's regulatory mechanisms, (2) characterizing the biological functions of its transmembrane domain, and (3) mapping its crosstalk with other signaling networks. Furthermore, comprehensive studies are needed to elucidate SDC-1 's involvement in immune cell recruitment dynamics and extracellular matrix (ECM) reorganization to refine immunotherapeutic approaches for pancreatic cancer. Declarations Data availability The dataset and material are available from the corresponding authors on reasonable request. Acknowledgements : We thank the patients and their families who provided the tissues for this study. This research was funded by The Cuiying Scientific and Technological Innovation Program of Lanzhou University Second Hospital, No. CY2024-MS-B04; Gansu Provincial Natural Science Foundation Project, No. 24JRRA331; Traditional Chinese Medicine Research Project of Gansu Province, No. GZKZ-2024-26;Lanzhou Science and Technology Plan Project (Grant No. 2023-4-26). Author Contributions: Conceptualization, H.Y. and C.L.; methodology, T.W.; software, Y.W., Y.D.; validation, H.Y., T.W. and Y.W.; formal analysis, C.M.; data curation, W.S. and C.L.; writing—original draft preparation, H.Y. and C.L.; writing—review and editing, T.W., W.S. and C.L.; visualization, S.W., G.Z. and C.L.; supervision, C.L.; project administration, H.Y.; funding acquisition, H.Y. All authors have read and agreed to the published version of the manuscript. Institutional Review Board Statement: The study was conducted in accordance with the Declaration of Helsinki. Experiment protocols were approved by the Ethics Committee of the School of Public Health, Lanzhou University (No. IRB22100501). Informed Consent Statement: Not applicable. Conflicts of Interest: The authors declare no conflict of interest. References Siegel, R. L., Giaquinto, A. N. & Jemal, A. Cancer Statistics, 2024. CA Cancer J Clin . 74 , 12-49 (2024). Salazar, J. et al. Treatment with Anticancer Drugs for Advanced Pancreatic Cancer: A Systematic Review. BMC Cancer . 23 , 748 (2023). Anderson, T., Mitchell, G., Prue, G., McLaughlin, S. & Graham-Wisener, L. The Psychosocial Impact of Pancreatic Cancer On Caregivers: A Scoping Review. BMC Cancer . 25 , 511 (2025). Ralli, M. et al. Immunotherapy in the Treatment of Metastatic Melanoma: Current Knowledge and Future Directions. J Immunol Res . 2020 , 9235638 (2020). Reck, M., Remon, J. & Hellmann, M. D. First-Line Immunotherapy for Non-Small-Cell Lung Cancer. J. Clin. Oncol. 40 , 586-597 (2022). Chen, K. et al. Single Cell RNA-seq Reveals the CCL5/SDC1 Receptor-Ligand Interaction Between T Cells and Tumor Cells in Pancreatic Cancer. Cancer Lett. 545 , 215834 (2022). Wang, Q., Qin, Y. & Li, B. CD8(+) T Cell Exhaustion and Cancer Immunotherapy. Cancer Lett. 559 , 216043 (2023). Oh, S. A. et al. PD-L1 Expression by Dendritic Cells is a Key Regulator of T-cell Immunity in Cancer. Nat Cancer . 1 , 681-691 (2020). Hanahan, D., Michielin, O. & Pittet, M. J. Convergent Inducers and Effectors of T Cell Paralysis in the Tumour Microenvironment. Nat. Rev. Cancer . 25 , 41-58 (2025). Mao, X. et al. Crosstalk Between Cancer-Associated Fibroblasts and Immune Cells in the Tumor Microenvironment: New Findings and Future Perspectives. Mol. Cancer . 20 , 131 (2021). Flies, D. B., Langermann, S., Jensen, C., Karsdal, M. A. & Willumsen, N. Regulation of Tumor Immunity and Immunotherapy by the Tumor Collagen Extracellular Matrix. Front Immunol . 14 , 1199513 (2023). Stouten, I., van Montfoort, N. & Hawinkels, L. The Tango between Cancer-Associated Fibroblasts (CAFs) and Immune Cells in Affecting Immunotherapy Efficacy in Pancreatic Cancer. Int. J. Mol. Sci. 24 , (2023). Balar, P. C., Apostolopoulos, V. & Chavda, V. P. A New Era of Immune Therapeutics for Pancreatic Cancer: Monoclonal Antibodies Paving the Way. Eur. J. Pharmacol. 969 , 176451 (2024). Kumar-Singh, A. et al. Mapping the Interactome of the Nuclear Heparan Sulfate Proteoglycan Syndecan-1 in Mesothelioma Cells. Biomolecules . 10 , (2020). Pham, S. H. et al. Syndecan-1 and -4 Influence Wnt Signaling and Cell Migration in Human Breast Cancers. Biochimie . 198 , 60-75 (2022). Wang, H. et al. Clinical/Prognostic Significance of Syndecan-1 Expression in Invasive Breast Carcinoma with Distant Metastasis and its Correlation with Tumor Immunity. Pathol. Res. Pract. 250 , 154787 (2023). Okolicsanyi, R. K. et al. Association of Heparan Sulfate Proteoglycans SDC1 and SDC4 Polymorphisms with Breast Cancer in an Australian Caucasian Population. Tumour Biol . 36 , 1731-1738 (2015). Chen, S., Navickas, A. & Goodarzi, H. Translational Adaptation in Breast Cancer Metastasis and Emerging Therapeutic Opportunities. Trends Pharmacol. Sci. 45 , 304-318 (2024). Qu, J. et al. In Vivo Gene Editing of T-cells in Lymph Nodes for Enhanced Cancer Immunotherapy. Nat. Commun. 15 , 10218 (2024). Chen, Y. et al. A Transformable Supramolecular Bispecific Cell Engager for Augmenting Natural Killer and T Cell-Based Cancer Immunotherapy. Adv. Mater. 36 , e2306736 (2024). Zhou, Z. et al. A T Cell-Engaging Tumor Organoid Platform for Pancreatic Cancer Immunotherapy. Adv Sci (Weinh) . 10 , e2300548 (2023). Zhang, R. et al. Pancreatic Cancer Cell-Derived Migrasomes Promote Cancer Progression by Fostering an Immunosuppressive Tumor Microenvironment. Cancer Lett. 605 , 217289 (2024). Dong, G. et al. DDX18 Drives Tumor Immune Escape through Transcription-Activated STAT1 Expression in Pancreatic Cancer. Oncogene . 42 , 3000-3014 (2023). Santos, N. J. et al. Syndecan Family Gene and Protein Expression and their Prognostic Values for Prostate Cancer. Int. J. Mol. Sci. 22 , (2021). Orecchia, P. et al. L19-IL2 Immunocytokine in Combination with the Anti-Syndecan-1 46F2SIP Antibody Format: A New Targeted Treatment Approach in an Ovarian Carcinoma Model. Cancers (Basel) . 11 , (2019). Zhang, C. L. et al. SDC1 and ITGA2 as Novel Prognostic Biomarkers for PDAC Related to IPMN. Sci Rep . 13 , 18727 (2023). Czarnowski, D. Syndecans in Cancer: A Review of Function, Expression, Prognostic Value, and Therapeutic Significance. Cancer Treat Res Commun . 27 , 100312 (2021). Theocharis, A. D. & Karamanos, N. K. Proteoglycans Remodeling in Cancer: Underlying Molecular Mechanisms. Matrix Biol. 75-76 , 220-259 (2019). Guo, S. et al. The Role and Therapeutic Value of Syndecan-1 in Cancer Metastasis and Drug Resistance. Front Cell Dev Biol . 9 , 784983 (2021). Yang, Z., Chen, S., Ying, H. & Yao, W. Targeting Syndecan-1: New Opportunities in Cancer Therapy. Am J Physiol Cell Physiol . 323 , C29-C45 (2022). Saleh, M. E. et al. The Immunomodulatory Role of Tumor Syndecan-1 (CD138) On Ex Vivo Tumor Microenvironmental CD4+ T Cell Polarization in Inflammatory and Non-Inflammatory Breast Cancer Patients. PLoS One . 14 , e217550 (2019). Liu, Y. et al. Syndecan-1 Inhibition Promotes Antitumor Immune Response and Facilitates the Efficacy of anti-PD1 Checkpoint Immunotherapy. Sci Adv . 10 , i7764 (2024). Zhong, Y. et al. Syndecan-1 as an Immunogene in Triple-negative Breast Cancer: Regulation Tumor-Infiltrating Lymphocyte in the Tumor Microenviroment and EMT by TGFb1/Smad Pathway. Cancer Cell Int. 23 , 76 (2023). Piwocka, O., Piotrowski, I., Suchorska, W. M. & Kulcenty, K. Dynamic Interactions in the Tumor Niche: How the Cross-Talk Between CAFs and the Tumor Microenvironment Impacts Resistance to Therapy. Front Mol Biosci . 11 , 1343523 (2024). Morgan, A. et al. Medical Biology of Cancer-Associated Fibroblasts in Pancreatic Cancer. Biology (Basel) . 12 , (2023). Yang, D. et al. Analysis of M2 Macrophage-Associated Risk Score Signature in Pancreatic Cancer TME Landscape and Immunotherapy. Front Mol Biosci . 10 , 1184708 (2023). Ozmen, E., Demir, T. D. & Ozcan, G. Cancer-Associated Fibroblasts: Protagonists of the Tumor Microenvironment in Gastric Cancer. Front Mol Biosci . 11 , 1340124 (2024). Sodergren, M. H. et al. Immunological Combination Treatment Holds the Key to Improving Survival in Pancreatic Cancer. J Cancer Res Clin Oncol . 146 , 2897-2911 (2020). Hartupee, C. et al. Pancreatic Cancer Tumor Microenvironment is a Major Therapeutic Barrier and Target. Front Immunol . 15 , 1287459 (2024). Wei, L. et al. Cancer-Associated Fibroblasts Promote Progression and Gemcitabine Resistance Via the SDF-1/SATB-1 Pathway in Pancreatic Cancer. Cell Death Dis. 9 , 1065 (2018). Ren, B. et al. Tumor Microenvironment Participates in Metastasis of Pancreatic Cancer. Mol. Cancer . 17 , 108 (2018). Natu, J. & Nagaraju, G. P. Gemcitabine Effects On Tumor Microenvironment of Pancreatic Ductal Adenocarcinoma: Special Focus On Resistance Mechanisms and Metronomic Therapies. Cancer Lett. 573 , 216382 (2023). Pei, L. et al. Roles of Cancer-Associated Fibroblasts (CAFs) in Anti- PD-1/PD-L1 Immunotherapy for Solid Cancers. Mol. Cancer . 22 , 29 (2023). Shi, T. et al. DKK1 Promotes Tumor Immune Evasion and Impedes Anti-PD-1 Treatment by Inducing Immunosuppressive Macrophages in Gastric Cancer. Cancer Immunol Res . 10 , 1506-1524 (2022). Lu, J. et al. Myeloid-Derived Suppressor Cells in Cancer: Therapeutic Targets to Overcome Tumor Immune Evasion. Exp Hematol Oncol . 13 , 39 (2024). Van den Eynde, A. et al. IL-15-secreting CAR Natural Killer Cells Directed Toward the Pan-Cancer Target CD70 Eliminate Both Cancer Cells and Cancer-Associated Fibroblasts. J. Hematol. Oncol. 17 , 8 (2024). Safaei, S. et al. Exploring the Dynamic Interplay Between Exosomes and the Immune Tumor Microenvironment: Implications for Breast Cancer Progression and Therapeutic Strategies. Breast Cancer Res. 26 , 57 (2024). Table 2 Table 2 is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files SupplementarymaterialOriginalproteinbandsscansofmembranesusedforWesternblotanalysisandidentificationofthetailsofgeneticallyknockoutmice.docx Table2.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6802997","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":485915413,"identity":"b4900c72-42ff-4f13-9d88-1826beb055fa","order_by":0,"name":"Hanteng Yang","email":"","orcid":"","institution":"Lanzhou University Second Hospital","correspondingAuthor":false,"prefix":"","firstName":"Hanteng","middleName":"","lastName":"Yang","suffix":""},{"id":485915414,"identity":"c4114c69-23cf-43d9-881b-7b5c31f457da","order_by":1,"name":"Ting Wang","email":"","orcid":"","institution":"Chengdu Center for Disease Control and Prevention","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Wang","suffix":""},{"id":485915415,"identity":"c4181ff0-4d69-4aa5-b628-b140319daafa","order_by":2,"name":"Yun Wang","email":"","orcid":"","institution":"the Second People's Hospital of Gansu Province","correspondingAuthor":false,"prefix":"","firstName":"Yun","middleName":"","lastName":"Wang","suffix":""},{"id":485915416,"identity":"0d607c1f-61c0-408f-b212-6776cb4f9c9c","order_by":3,"name":"Yongyue Du","email":"","orcid":"","institution":"Lanzhou University Second Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yongyue","middleName":"","lastName":"Du","suffix":""},{"id":485915417,"identity":"4b23e6b9-0df8-488e-878f-86bffdf650ba","order_by":4,"name":"Chen Mi","email":"","orcid":"","institution":"Lanzhou University Second Hospital","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Mi","suffix":""},{"id":485915418,"identity":"1e2e77c5-9674-4eca-af93-1b22ad22f705","order_by":5,"name":"Siyang Wang","email":"","orcid":"","institution":"Lanzhou University Second Hospital","correspondingAuthor":false,"prefix":"","firstName":"Siyang","middleName":"","lastName":"Wang","suffix":""},{"id":485915419,"identity":"78599133-082a-422a-8ccf-ccba355e6a5e","order_by":6,"name":"Wengui Shi","email":"","orcid":"","institution":"Lanzhou University Second Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wengui","middleName":"","lastName":"Shi","suffix":""},{"id":485915420,"identity":"57da3da4-5d30-4ceb-8130-e305b55d9194","order_by":7,"name":"Gengyuan Zhang","email":"","orcid":"","institution":"Lanzhou University Second Hospital","correspondingAuthor":false,"prefix":"","firstName":"Gengyuan","middleName":"","lastName":"Zhang","suffix":""},{"id":485915421,"identity":"390b7761-7efd-4f12-95b9-62d30a0b1e50","order_by":8,"name":"Chengyun Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4ElEQVRIiWNgGAWjYBACPmYGNiiT+eABMH2AgBY2hBa2BCK1MMC18BgQqYWd+dmDjztqEzfc7vlw8GcbgxzfjQTGzwV4HcZmbjjzzPHEDXfObjgg2cZgLHkjgVl6Bl4tPGzSvG3HEjfcyN1wwLCNAchIAAoS0vIXrCXnwYHENoZ64rQwttWAtDAcONjGkGBAWAubmWRv2wHjmTfSDA42nJMAeuxhszQ+Lfz8h59J/Gyrk+27kfzw4Y8yG3m+48kHP+PTAgWHHRsgDAkgZmwgrIGBoc6eGFWjYBSMglEwQgEAwgVOsC+GCpEAAAAASUVORK5CYII=","orcid":"","institution":"Lanzhou University","correspondingAuthor":true,"prefix":"","firstName":"Chengyun","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2025-06-02 14:08:37","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6802997/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6802997/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":87320832,"identity":"fd9017d8-3b9c-4f60-a21a-bf7e3d9fc0c0","added_by":"auto","created_at":"2025-07-22 16:33:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":494091,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eSDC-1 \u003c/em\u003ewas overexpressed in PC and correlated with the poor prognosis of patients with PC. (A) \u003cem\u003eSDC-1\u003c/em\u003e was overexpressed in the PC tissue data from TIMER database. (B) SDC-1 was overexpressed in the PC tissue data from GEPIA database. (C) \u003cem\u003eSDC-1\u003c/em\u003e was overexpressed in the PC tissue data from UALCAN database. (D) SDC-1 expression levels and survival curves in cancer patients in GEPIA database. (E) \u003cem\u003eSDC-1\u003c/em\u003e expression levels and survival curves in cancer patients in TISIDB database. (F)Kaplan–Meier survival analysis of overall survival (OS). (G) Kaplan–Meier survival analysis of progression-free survival (PFS). (H) Immunohistochemical staining results of normal pancreatic tissue and cancer tissue. (I) Immunohistochemical staining scores of pancreatic tissues in 114 cases. (J) Correlation of\u003cem\u003e SDC-1\u003c/em\u003ewith patient survival in pancreatic cancer tissues. (K) Basic mRNA expression of SDC-1 in pancreatic cancer cells. (L) Basic expression of \u003cem\u003eSDC-1\u003c/em\u003e protein in pancreatic cancer cells.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6802997/v1/c4bb77ae981f650427d25b54.png"},{"id":87320836,"identity":"3c4c9730-7800-41c7-b0af-a3b97518dd1a","added_by":"auto","created_at":"2025-07-22 16:33:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":522039,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eSDC-1\u003c/em\u003e on pancreatic cancer cell function. (A) Overexpression of \u003cem\u003eSDC-1\u003c/em\u003e in PANC-1 was confirmed by RT-qPCR. (B) Overexpression of \u003cem\u003eSDC-1\u003c/em\u003e in PANC-1 was confirmed by Western blotting. (C) \u003cem\u003eSDC-1\u003c/em\u003e knock down in BXPC-3 was confirmed by RT-qPCR. (D) \u003cem\u003eSDC-1\u003c/em\u003e knock down in BXPC-3 was confirmed by western blotting. (E, F) CCK8, colony formation and statistical analysis detected the impact of\u003cem\u003e SDC-1\u003c/em\u003e overexpression on the proliferation ability of PANC-1 cell line. (G) Cell scratch migration assay and statistical analysis detected the impact of \u003cem\u003eSDC-1\u003c/em\u003e overexpression on the migration ability of PANC-1 cell line. (H) Transwell invasion assay and statistical analysis detected the impact of \u003cem\u003eSDC-1\u003c/em\u003e overexpression on the invasion ability of PANC-1 cell line. (I, J) CCK8, colony formation and statistical analysis detected the impact of \u003cem\u003eSDC-1 \u003c/em\u003eknock down on the proliferation ability of BXPC-3 cell line. (K) Cell scratch migration assay and statistical analysis detected the impact of \u003cem\u003eSDC-1\u003c/em\u003e knock down on the migration ability of BXPC-3 cell line. (L) Transwell invasion assay and statistical analysis detected the impact of \u003cem\u003eSDC-1\u003c/em\u003e knock down on the invasion ability of BXPC-3 cell line.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6802997/v1/cae24b8a1d73c860f84d6457.png"},{"id":87321888,"identity":"a8966cc9-0fb9-47f9-8397-df12f78fc777","added_by":"auto","created_at":"2025-07-22 16:41:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":112119,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown of \u003cem\u003eSDC-1\u003c/em\u003einhibited pancreatic cancer growth and promoted survival time. (A) Image of subcutaneous tumorigenesis in \u003cem\u003eSDC-1\u003c/em\u003eknockout mice and wild-type C57 mice. (B, C) Volume and mass of subcutaneous tumorigenesis in \u003cem\u003eSDC-1\u003c/em\u003e knockout mice and wild-type C57 mice. (D) Changes in subcutaneous survival time after tumorigenesis in \u003cem\u003eSDC-1\u003c/em\u003e knockout mice and wild-type C57 mice.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6802997/v1/078778c417976146265633ff.png"},{"id":87321891,"identity":"bd25d5c0-563c-44dc-9cdc-7b2429487317","added_by":"auto","created_at":"2025-07-22 16:41:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":938893,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of knockdown of \u003cem\u003eSDC-1\u003c/em\u003e on components of the tumor microenvironment in pancreatic cancer. (A) Immunohistochemical staining, HE staining, and Sirius red staining of tumor tissues from \u003cem\u003eSDC-1\u003c/em\u003eknockout mice and wild-type C57 mice after subcutaneous tumorigenesis. (B) Immunofluorescence staining and statistical analysis of α-SMA tumor tissues after subcutaneous tumorigenesis in \u003cem\u003eSDC-1\u003c/em\u003e knockout mice and wild-type C57 mice. (C) Immunofluorescence staining and statistical analysis of CD4+ T cells and CD8+ T cells in tumor tissue from \u003cem\u003eSDC-1\u003c/em\u003e knockout mice and wild-type C57 mice.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6802997/v1/d4f9ff80da30ca203faec94b.png"},{"id":87321889,"identity":"d7ac3fdc-7663-4333-b020-b8831de11718","added_by":"auto","created_at":"2025-07-22 16:41:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":126714,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of knockout of \u003cem\u003eSDC-1\u003c/em\u003e combined with PD-1 treatment on mice and tumors. (A) Tumor images of \u003cem\u003eSDC-1\u003c/em\u003e knockout mice and wild-type C57 mice after subcutaneous tumorigenesis combined with PD-1 treatment. (B, C) Volume and mass of subcutaneous tumors in \u003cem\u003eSDC-1\u003c/em\u003eknockout mice and wild-type C57 mice after PD-1 treatment. (D) Quality of \u003cem\u003eSDC-1\u003c/em\u003eknockout mice and wild-type C57 mice before and after PD-1 treatment.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6802997/v1/dc8efd396ebf63fefcac4eaa.png"},{"id":87320839,"identity":"4978f137-05a0-47f7-99dc-c3b587214fdf","added_by":"auto","created_at":"2025-07-22 16:33:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":931733,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of knockout \u003cem\u003eSDC-1\u003c/em\u003e in combination with PD-1 antibody in the treatment of pancreatic cancer. (A) Immunohistochemical staining, HE staining, and Sirius red staining of tumor tissues from \u003cem\u003eSDC-1\u003c/em\u003e knockout mice and wild-type C57 mice after PD-1 treatment. (B) Immunofluorescence staining and statistical analysis of α-SMA of subcutaneous tumors in \u003cem\u003eSDC-1\u003c/em\u003e knockout mice and wild-type C57 mice after PD-1 treatment. (C) Immunofluorescence staining and statistical analysis of CD4+ T cells and CD8+ T cells of subcutaneous tumors in \u003cem\u003eSDC-1\u003c/em\u003e knockout mice and wild-type C57 mice after PD-1 treatment. (D) Flow cytometry analysis and statistical analysis of CD3+ T cells, CD4+ T cells, and CD8+ T cells from subcutaneous tumors in \u003cem\u003eSDC-1\u003c/em\u003e knockout mice and wild-type C57 mice after PD-1 treatment.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6802997/v1/d24149e53dda2d1d3b66972f.png"},{"id":90168704,"identity":"e3a50636-b2f3-45b1-9cfc-5bd1062d66a1","added_by":"auto","created_at":"2025-08-29 10:47:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4133580,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6802997/v1/025a946e-ee04-426d-bfd3-49101fdde34a.pdf"},{"id":87320858,"identity":"0ca8cf78-712a-4578-8586-a15d9ebd6004","added_by":"auto","created_at":"2025-07-22 16:33:50","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":6399873,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementarymaterialOriginalproteinbandsscansofmembranesusedforWesternblotanalysisandidentificationofthetailsofgeneticallyknockoutmice.docx","url":"https://assets-eu.researchsquare.com/files/rs-6802997/v1/44b1857b81b8bc74d349c39f.docx"},{"id":87320834,"identity":"2232da39-38e8-4645-9efd-6ffd9d2f95d6","added_by":"auto","created_at":"2025-07-22 16:33:49","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":16645,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-6802997/v1/963b19155955e4004f7f8b49.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"SDC-1 deficiency enhances the pancreatic cancer response to PD-1 antibody by reprogramming tumor microenvironment","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003ePancreatic cancer is an aggressive malignancy characterized by rapid progression. In 2022, the International Agency for Research on Cancer (IARC) reported over 510,000 new cases and 460,000 deaths worldwide \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Despite various therapeutic strategies, pancreatic cancer remains a formidable challenge due to its high recurrence rate and limited treatment success \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. While immunotherapy has demonstrated efficacy in several solid tumors, such as melanoma and lung cancer, the application of PD-1 inhibitors in pancreatic cancer has yielded largely disappointing results \u003csup\u003e\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. This is primarily attributed to the immunosuppressive tumor microenvironment (TME) of pancreatic cancer, which promotes T cell exhaustion via upregulation of PD-1 ligands, thereby fostering tumor growth \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Tumor-associated factors, including cancer-associated fibroblasts (CAFs), further contribute to the immunosuppressive nature of the TME, thereby limiting the effectiveness of PD-1 inhibition. Consequently, targeting these immunosuppressive mechanisms is of paramount importance to enhance immunotherapy outcomes in pancreatic cancer.\u003c/p\u003e\u003cp\u003eThe tumor microenvironment, comprising immune cells, cancer-associated fibroblasts (CAFs), and extracellular matrix (ECM), critically regulates tumor progression and therapeutic resistance \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. As principal stromal constituents, CAFs actively remodel ECM architecture, modulate its biomechanical characteristics, orchestrate bidirectional communication with both neoplastic and immune cells, and exert potent immunosuppressive functions through cytokine networks \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. The ECM - a dynamic scaffold composed of collagen fibers, glycoproteins, and proteoglycans - serves as a biochemical signaling platform while undergoing continuous remodeling by matrix metalloproteinases (MMPs) and other proteolytic enzymes within the TME \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. This reciprocal CAF-ECM interaction establishes a fibrotic barrier that physically restricts cytotoxic T lymphocyte infiltration, sustains immunosuppressive niches through TGF-β signaling, and drives resistance to immune checkpoint inhibitors in pancreatic ductal adenocarcinoma \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Consequently, deciphering spatiotemporal TME evolution, particularly the plasticity of CAF subpopulations, could unlock novel strategies to potentiate adoptive T cell therapies against pancreatic malignancies.\u003c/p\u003e\u003cp\u003eSyndecan-1 (\u003cem\u003eSDC-1\u003c/em\u003e, CD138) is a heparan sulfate proteoglycan (HSPG) predominantly expressed in epithelial and plasma cells, serving as a pivotal member of the HSPG family \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Functioning as an extracellular matrix receptor, \u003cem\u003eSDC-1\u003c/em\u003e participates in diverse biological processes including cell-cell communication, proliferation, angiogenesis, and metastatic dissemination. It critically regulates extracellular matrix (ECM) assembly and collagen fiber reorganization during breast cancer progression \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eSDC-1\u003c/em\u003e activates signaling cascades such as mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) and MAPK/c-Jun N-terminal kinase (JNK) upon ligand engagement, thereby driving neoplastic cell proliferation \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. In epithelial malignancies, elevated \u003cem\u003eSDC-1\u003c/em\u003e expression correlates with E-cadherin downregulation, reflecting diminished intercellular adhesion and enhanced metastatic competence. SDC1 also modulates oncogenic signaling networks and interacts with tumor microenvironment (TME) components to influence disease progression \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Elucidating \u003cem\u003eSDC-1\u003c/em\u003e's TME interactions remains essential for advancing malignant tumors such as pancreatic cancer therapeutic strategies.\u003c/p\u003e\u003cp\u003eThis study aimed to investigate the expression dynamics and functional roles of \u003cem\u003eSDC-1\u003c/em\u003e in pancreatic cancer development, as well as its regulatory effects on CAFs within the pancreatic cancer tumor microenvironment. Additionally, we evaluated the therapeutic potential of anti-PD-1 in pancreatic cancer-bearing mouse models. To identify potential biomarkers for the diagnosis and prognosis of pancreatic cancer and to provide a solid experimental foundation for developing immunotherapy strategies targeting \u003cem\u003eSDC-1\u003c/em\u003e and anti-PD-1. These insights carry substantial public health significance, offering pathways to enhance early detection rates and reducing pancreatic cancer related mortality.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"2 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Collection of public database results and pancreatic cancer specimens collected\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e\u003cem\u003eSDC-1\u003c/em\u003e gene expression in pancreatic cancer was analyzed using GEPIA (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia.cancer-pku.cn/\u003c/span\u003e\u003cspan address=\"http://gepia.cancer-pku.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), UALCAN (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ualcan.path.uab.edu/\u003c/span\u003e\u003cspan address=\"https://ualcan.path.uab.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and TIMER 2.0 database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://timer.comp-genomics.org/\u003c/span\u003e\u003cspan address=\"http://timer.comp-genomics.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Correlations between \u003cem\u003eSDC-1\u003c/em\u003e expression and patient survival were assessed via Kaplan-Meier Plotter, GEPIA, and TISIDB (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://cis.hku.hk/TISIDB\u003c/span\u003e\u003cspan address=\"http://cis.hku.hk/TISIDB\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The relationship between \u003cem\u003eSDC-1\u003c/em\u003e and immunity was examined using the IMMPORT database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.immport.org/\u003c/span\u003e\u003cspan address=\"https://www.immport.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). In addition, a total of 114 pancreatic cancer and paracancerous samples, with clinical data, were analyzed for \u003cem\u003eSDC-1\u003c/em\u003e expression. None of the patients received preoperative chemotherapy or radiotherapy. All specimens were collected with informed consent under protocols approved by the Ethics Committee of the School of Public Health, Lanzhou University (No. IRB22100501). This study conforms to the principles of the Declaration of Helsinki, and informed consent was obtained from all patients.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Cell culture, lentiviral transfections, and the detection of gene and protein expression levels\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eHuman pancreatic ductal cells (HPNE) and cancer cell lines (PANC-1, CFPAC-1, SW1990, BXPC-3) were sourced from Chinese Academy of Sciences and Wuhan Technology Co., Ltd., while mouse pancreatic cancer cells (PANC02) were obtained from Hefei Everything Life Biotechnology Co., Ltd. HPNE, PANC-1, CFPAC-1, and PANC02 were cultured in DMEM with 10% fetal bovine serum, and BXPC-3 and SW1990 in RPMI medium. All cell lines were authenticated by short tandem repeat (STR) profiling. All cell lines were cultured at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. The \u003cem\u003eSDC-1\u003c/em\u003e overexpression plasmid (Shanghai Genechem Co., Ltd), \u003cem\u003eSDC-1\u003c/em\u003e siRNA (Guangzhou Ribobio Co., Ltd), and Lipofectamine 2000 (Invitrogen) were prepared in serum-free medium. The plasmid or siRNA was combined with Lipofectamine 2000 to form a transfection mixture, which was applied to PANC-1 and BXPC-3 cells at 50\u0026ndash;60% confluency, mRNA expression was analyzed after 36 hours, and protein expression after 48 hours, successfully establishing cell lines for subsequent functional experiments.\u003c/p\u003e\u003cp\u003eA mouse pancreatic cancer cell suspension (10⁵ cells/mL) was seeded in a 6-well plate and cultured for 24 hours. Based on the MOI value of PAN02 cells and the titer of the \u003cem\u003eSDC-1\u003c/em\u003e knockout lentivirus, the appropriate volume of virus and infection enhancer was added. Cells were incubated at 37\u0026deg;C for 12\u0026ndash;16 hours, followed by a medium change and continued cultivation. After 72 hours, cells were screened with 2\u0026ndash;5 \u0026micro;g/mL puromycin for 48 hours to establish stable cell lines. Western blot verified knockout efficiency, and the CRISPR/Cas9 knockout cell line with the highest efficiency was selected for functional experiments. The sgRNA sequence used was TCTGACAACTTTCCGGCTC.\u003c/p\u003e\u003cp\u003eTotal RNA from cells or tissues was extracted using RNAiso Plus (Takara, Japan). Reverse transcription was performed using the PrimeScript\u0026trade; RT reagent Kit with gDNA Eraser (Takara, Japan). Real-time quantitative PCR (RT-qPCR) was conducted using TB Green (Takara, Japan), with GAPDH as the internal control. Data were analyzed using the 2\u003csup\u003e-ΔΔCT\u003c/sup\u003e and 40-ΔCT methods for relative quantification. Primer sequences are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Total protein was extracted from cells and quantified using the bicinchoninic acid (BCA) assay. Cells were lysed with RIPA buffer, and the lysates were centrifuged at 12,000 g for 10 minutes. Proteins were separated by SDS-PAGE, transferred onto a PVDF membrane, and incubated overnight at 4\u0026deg;C with primary antibodies: rabbit anti-\u003cem\u003eSDC-1\u003c/em\u003e (1:1000; ab128936, Abcam) and mouse anti-GAPDH (1:1000, Wuhan Servicebio). After stripping, membranes were probed with secondary antibodies: goat anti-mouse or anti-rabbit IgG (1:10,000, Bioworld) and visualized using enhanced chemiluminescence. .\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequences\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSDC-1\u003c/em\u003e-Forward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTGCTGGGAGGGGTCATTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSDC-1\u003c/em\u003e-Reverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGCTGCCTTCGTCCTTCTTCTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH-Forward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGGAGGCATTGCTGATGAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH-Reverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAAGGCTGGGGCTCATTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. CCK8, cell migration, colony formation, and wound healing assay\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eFor the cell proliferation assay, cells were seeded in 96-well plates at 1,000 cells per well. After attachment, fresh medium with CCK8 (Biosharp, China) was added, and OD values were measured at 24, 48, 72h. For colony formation, 1,000 cells were plated in six-well plates. After one week, cells were fixed with methanol for 15 min, stained with crystal violet for 10 min, and counted using Image J. For invasion and migration assays, 5,000 cells were seeded in the upper chamber (Millipore, MA, USA), with complete medium containing 10% FBS in the lower chamber. For invasion, 200 \u0026micro;L of 1:8 diluted Matrigel (Corning, NYC, USA) was added to the upper chamber. After 24 h, cells were fixed with 4% paraformaldehyde for 20 min, stained with crystal violet, and observed under a microscope. For the scratch assay, cells were seeded in 6-well plates at 90% density. After attachment, a scratch was made using a 200 \u0026micro;L pipette tip. PBS was washed twice, and RPMI-1640 serum-free medium (Gibco, CA, USA) was added. Scratch widths were measured at 0, 12, 24, and 36 h, and migration was analyzed using Image J.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. \u003cem\u003eSDC-1\u003c/em\u003e knockout C57 mouse model construction\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e\u003cem\u003eSDC-1\u003c/em\u003e knockout lentivirus (Shanghai Genechem Co., Ltd) was used to knock out \u003cem\u003eSDC-1\u003c/em\u003e in mouse pancreatic cancer PAN02 cells. Mouse Tumorigenesis Model: \u003cem\u003eSDC-1\u003c/em\u003e knockout and untreated PAN02 cells were inoculated into \u003cem\u003eSDC-1\u003c/em\u003e knockout mice (Shanghai Model Organisms Center) and wild-type C57 mice (Lanzhou University Experimental Animal Center) for subcutaneous tumor growth. Tumor volume and mass were measured, and paraffin and frozen sections were prepared for further analysis. PD-1 Antagonistic Tumor Model: \u003cem\u003eSDC-1\u003c/em\u003e knockout and regular PAN02 cells were injected into \u003cem\u003eSDC-1\u003c/em\u003e knockout and wild-type C57 mice for subcutaneous tumor development. Half of the mice received intraperitoneal PD-1 injections (200 \u0026micro;g each, P372, Leinco Technologies) for 10 doses. All mice were anesthetized with 5% isoflurane, and euthanized by intraperitoneal injection of sodium pentobarbital (100 mg/kg). Tumor volume and mass were measured, and paraffin and frozen sections were prepared. Fresh tumor tissue was used for flow cytometry analysis. All animal handling procedures were approved by the School of Public Health, Lanzhou University (No. IRB22100501). All animal experimental operations followed the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health. The ARRIVE guidelines (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) have been followed for conducting and reporting animal experiments. A statement to confirm that all methods were carried out in accordance with relevant guidelines and regulations.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. IHC, Immunofluorescence, Sirius Red, Masson Staining Analyses, and T-Cell Flow Cytometry\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eImmunohistochemistry (IHC) staining, tissue microarrays (TMAs) of human pancreatic cancer specimens were deparaffinized, rehydrated, and treated to block endogenous peroxidase and nonspecific staining. Following antigen retrieval, samples were incubated with \u003cem\u003eSDC-1\u003c/em\u003e antibody (ab128936, Abcam, 1:200), and processed using biotin-labeled IgG polymer, streptavidin, and peroxidase. DAB chromogenic solution was applied for visualization, followed by hematoxylin counterstaining. Images were captured using a Tissue FAXS Plus system (Austria), and staining intensity (0, 1, 2, 3) along with the percentage of positive cancer duct cells (0%-100%) were assessed by pathologists at Lanzhou University Second Hospital. The final tissue score (H-score) was calculated by multiplying the staining intensity with the percentage of positive cells.\u003c/p\u003e\u003cp\u003eImmunofluorescence, tissue slices fixed with 4% paraformaldehyde were permeabilized with 0.5% Triton X-100 for 10 minutes, then blocked with Blocking Buffer (P0620, Beyotime) for 1 hour to prevent nonspecific binding. The samples were incubated overnight at 4\u0026deg;C with primary antibodies: CY3-conjugated α-SMA (C6198, Sigma-Aldrich), Alexa Fluor-647 anti-mouse CD4 (100530, Clone: RM4-5, BioLegend), and Alexa Fluor-647 anti-mouse CD8 (100724, Clone: 53\u0026thinsp;\u0026minus;\u0026thinsp;6.7, BioLegend). Nuclei were counterstained with DAPI (C1005, Beyotime). Confocal fluorescence images were captured using a Zeiss LSM 880 laser microscope with a 20\u0026times; objective lens.\u003c/p\u003e\u003cp\u003eFor Sirius red staining, paraffin sections of pancreatic cancer were deparaffinized and rehydrated, then stained with iron hematoxylin and Sirius red staining solutions (G1472, Solarbio). The Sirius red dye bound to collagen fibers, rendering them visible as red under a microscope. After staining, the tissue slices were washed to remove excess dye, dehydrated, and mounted on glass slides for analysis. Images were captured using an optical microscope. .\u003c/p\u003e\u003cp\u003eT-cell flow cytometry of tumor tissues, fresh tumor tissues were harvested, minced, and digested into single-cell suspensions using Collagenase-I (Sigma-Aldrich) in DMEM for 60 minutes at 37\u0026deg;C with continuous shaking. After digestion, collagenase activity was stopped by adding DMEM\u0026thinsp;+\u0026thinsp;10% FBS, followed by filtration and centrifugation to obtain a single-cell suspension. Cells were stained with 7-AAD Viability Staining Solution (Beyotime) and analyzed for T cell populations using fluorophore-conjugated antibodies: PE anti-mouse CD3 (BioLegend), Alexa Fluor-647 anti-mouse CD4 (BioLegend), and APC anti-mouse CD8a (BioLegend). Samples were analyzed on a BD FACS Canto Flow Cytometer (BD Biosciences) and processed using FlowJo software (BD Life Sciences).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Statistical analysis\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eData expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD, statistical analyses included two-tailed t-tests for two-group comparisons, one-way ANOVA for multi-group comparisons, chi-squared tests for categorical variables, and Spearman\u0026rsquo;s rank correlation coefficient for ranked variables. Data were analyzed using SPSS version 27.0 (SPSS, CT, USA) and visualized with GraphPad Prism 9.5 (GraphPad Software, CA, USA). Significance levels were denoted as ns (not significant), *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, and ****P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001. All experiments were repeated at least three times.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv\u003e\n \u003cp\u003e3.1. \u003cem\u003eSDC-1\u003c/em\u003e is highly expressed in pancreatic cancer tissues and cell lines, and its expression correlates with clinicopathologic features\u003c/p\u003e\n \u003cp\u003eAnalysis of transcriptomic datasets (TIMER, GEPIA, UALCAN) demonstrated significant overexpression of \u003cem\u003eSDC-1\u003c/em\u003e in pancreatic cancer tissues compared to normal pancreatic tissues (\u003cem\u003eP\u003c/em\u003e \u0026lt;0.05; Fig. 1A-C). Prognostic evaluation revealed a inverse correlation between \u003cem\u003eSDC-1\u003c/em\u003e expression levels and overall survival (HR = 1.6, log-rank \u003cem\u003eP\u003c/em\u003e = 0.019), with high \u003cem\u003eSDC-1\u003c/em\u003e expression cohorts exhibiting reduced median survival duration (Fig. 1D-G). Tissue microarray validation through immunohistochemical staining confirmed elevated \u003cem\u003eSDC-1\u003c/em\u003e protein expression in malignant epithelia versus adjacent normal ductal cells (Fig. 1H-J). Further analysis of 114 pancreatic cancer and paracancerous tissue samples showed a significant correlation between \u003cem\u003eSDC-1\u003c/em\u003e levels and tumor diameter (\u003cem\u003eP\u003c/em\u003e = 0.023) (Table 2). \u003cem\u003eSDC-1\u003c/em\u003e expression was low in normal pancreatic ductal cells (HPNE) but elevated in pancreatic cancer cells such as PANC-1 and CFPAC-1 (Fig. 1K, L). These results suggest that \u003cem\u003eSDC-1\u003c/em\u003e is overexpressed in pancreatic cancer and may contribute to its development.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\"\u003e\n \u003ch2\u003e3.2. Overexpression of \u003cem\u003eSDC-1\u003c/em\u003e promotes proliferation, migration, and invasion of of pancreatic cancer cells\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eComparative assessment revealed significantly lower \u003cem\u003eSDC-1\u003c/em\u003e expression in PANC-1 cells compared to BXPC-3 cells, while normal HPNE cells showed baseline expression levels. Based on this differential expression profile, we established \u003cem\u003eSDC-1\u003c/em\u003e-overexpressing PANC-1 cells through plasmid transfection and generated \u003cem\u003eSDC-1\u003c/em\u003e-knockdown BXPC-3 cells using targeted siRNA. Western blot validation confirmed successful transfection overexpression in PANC-1 and knockdown efficiency in BXPC-3 (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05) (Fig. 2A-D). Functional characterization demonstrated that \u003cem\u003eSDC-1\u003c/em\u003e overexpression significantly enhanced PANC-1 cell proliferation, as evidenced by CCK-8 assays showing 80% increased viability at 72h (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001) and colony formation assays revealing more colonies compared to controls (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01) (Fig. 2E-F). Conversely, \u003cem\u003eSDC-1\u003c/em\u003e knockdown in BXPC-3 cells reduced proliferation (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01) and decreased colony formation (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01) (Fig. 2I-J). Scratch wound healing assays showed \u003cem\u003eSDC-1\u003c/em\u003e-overexpressing PANC-1 cells increase wound closure at 48h versus controls (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), while knockdown cells exhibited decrease closure compared to controls (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01) (Fig. 2J, K ). Transwell invasion assays further revealed a increase in invasive capacity with \u003cem\u003eSDC-1\u003c/em\u003e overexpression versus reduction in knockdown cells (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05) (Fig. 2H, L). These findings collectively demonstrate that \u003cem\u003eSDC-1\u003c/em\u003e functionally regulates pancreatic cancer cell proliferation, migration and invasion capacities\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\"\u003e\n \u003ch2\u003e3.3. \u003cem\u003eSDC-1\u003c/em\u003e knockdown impaires the tumor growth and extends the survival of mice with pancreatic cancer\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eTo investigate the impact of \u003cem\u003eSDC-1\u003c/em\u003e on pancreatic cancer progression, we established a subcutaneous tumor model by inoculating PAN02 cells (with or without \u003cem\u003eSDC-1\u003c/em\u003e knockout) into syngeneic \u003cem\u003eSDC-1\u003c/em\u003e knockout (KO) and wild-type (WT) C57BL/6 mice. Four experimental groups were designed: 1) \u003cem\u003eSDC-1\u003c/em\u003e KO mice receiving SDC-1 KO PAN02 cells, 2) \u003cem\u003eSDC-1\u003c/em\u003e KO mice with WT PAN02 cells, 3) WT mice with \u003cem\u003eSDC-1\u003c/em\u003e KO PAN02 cells, and 4) WT mice with WT PAN02 cells. Tumor growth metrics revealed striking differences between groups (Fig. 3A-C). The \u003cem\u003eSDC-1\u003c/em\u003e KO mice implanted with \u003cem\u003eSDC-1\u003c/em\u003e KO PAN02 cells demonstrated the most significant tumor suppression, exhibiting reduction in final tumor volume compared to WT mice receiving WT cells (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001). Notably, the host genetic background exerted greater influence than tumor cell \u003cem\u003eSDC-1\u003c/em\u003e status – \u003cem\u003eSDC-1\u003c/em\u003e KO mice bearing WT tumors still showed smaller volumes than WT mice with KO tumors (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). Survival analysis paralleled these findings (Fig. 3D). The \u003cem\u003eSDC-1\u003c/em\u003e KO/KO group achieved longest median survival (83 days), significantly exceeding both \u003cem\u003eSDC-1\u003c/em\u003e KO/WT (43 days, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01) and WT/KO groups (58 days, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003e3.4. \u003cem\u003eSDC-1\u003c/em\u003e knockdown reduces collagen deposition, decreases CAFs levels and facilitates T cells infiltration of pancreatic cancer\u003c/p\u003e\n \u003cp\u003eComparative analysis revealed significantly elevated \u003cem\u003eSDC-1\u003c/em\u003e expression levels in wild-type (WT) C57BL/6 mice compared to \u003cem\u003eSDC-1\u003c/em\u003e knockout (KO) counterparts (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). Histopathological evaluation demonstrated exacerbated pancreatic epithelial cell deformation and necrotic areasin WT tumors. HE staining, Sirius red staining, and immunofluorescence, we observed \u003cem\u003eSDC-1\u003c/em\u003e expression, pancreatic epithelial cell deformation, necrosis, collagen fibers, tumor-associated fibroblasts, and CD4 + and CD8 + T cells. The results showed that in wild-type mice, \u003cem\u003eSDC-1\u003c/em\u003e expression was higher, pancreatic epithelial cell deformation and necrosis were more severe, collagen fibers and tumor-associated fibroblasts were more abundant, and CD4 + and CD8 + T cell content was lower. In contrast, \u003cem\u003eSDC-1\u003c/em\u003e knockout reduced tumor-associated fibroblasts, impacting collagen fiber and immune cell distribution in the extracellular matrix (Fig. 4A-C). These findings suggest that \u003cem\u003eSDC-1\u003c/em\u003e knockout may alter the pancreatic tumor microenvironment by reducing fibroblasts and influencing immune cell distribution.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\"\u003e\n \u003ch2\u003e3.5. \u003cem\u003eSDC-1\u003c/em\u003e knockout enhances the response of pancreatic cancer to PD-1 antibody by improving the TME\u003c/h2\u003e\n \u003cdiv\u003e\n \u003cp\u003eWe established a subcutaneous tumor model by inoculating \u003cem\u003eSDC-1\u003c/em\u003e knockout and wild-type C57 mice with PAN02 cells (normal \u003cem\u003eSDC-1\u003c/em\u003e expression or knockout). Once tumors reached 100 mm³, mice were randomly selected and treated with PD-1 intraperitoneal injections (200 µg per mouse, every three days for one month). After treatment, tumor volume and weight were measured, and tumor tissues were collected for paraffin and frozen sectioning (Fig. 5A-D). Immune cell infiltration, including CD4 + T and CD8 + T cells, was analyzed by flow cytometry. The results showed that PD-1 treatment in \u003cem\u003eSDC-1\u003c/em\u003e knockout mice increased CAFs, collagen fiber distribution, and immune cell infiltration (Fig. 6A-D), improving the tumor suppressive microenvironment and enhancing the inhibition of tumor growth.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003ePancreatic cancer is characterized by low early detection rates, rapid progression, poor prognosis, and high invasiveness and metastatic potential, underscoring the urgent need for more effective prevention and treatment strategies. Immunotherapy, which enhances T-cell cytotoxicity and promotes tumor infiltration, has emerged as a promising therapeutic approach for various cancers \u003csup\u003e\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. However, the highly immunosuppressive TME in pancreatic cancer significantly restricts its efficacy. Consequently, targeting and modulating the immunosuppressive TME represents a novel and potentially transformative strategy for pancreatic cancer treatment \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e\u003cem\u003eSDC-1\u003c/em\u003e exhibits diverse expression patterns and functional roles across various tumor types, highlighting its potential as a cancer biomarker \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. In epithelial ovarian cancer, increased \u003cem\u003eSDC-1\u003c/em\u003e expression enhances angiogenesis and invasiveness \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Furthermore, \u003cem\u003eSDC-1\u003c/em\u003e is upregulated in epithelial cells of gallbladder and pancreatic ductal carcinomas, where it is predominantly expressed in the tumor mesenchyme \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Given the limited studies investigating \u003cem\u003eSDC-1\u003c/em\u003e's role in pancreatic cancer pathogenesis and progression, along with small sample sizes in prior research, this study explored the relationship between \u003cem\u003eSDC-1\u003c/em\u003e expression and pancreatic cancer development. Tumor and adjacent normal tissues from pancreatic cancer patients were analyzed by immunohistochemical and assess SDC1's correlation with pathological stages. Cellular experiments confirmed \u003cem\u003eSDC-1\u003c/em\u003e expression across pancreatic cancer cell lines. Results demonstrated significant \u003cem\u003eSDC-1\u003c/em\u003e overexpression in pancreatic cancer tissues and cells, with levels positively associated with tumor size. Study results of the bioinformatics analysis adopted also showed that the median survival period of pancreatic cancer patients with high expression of \u003cem\u003eSDC-1\u003c/em\u003e was shorter, indicating a poorer survival period. It is suggested that \u003cem\u003eSDC-1\u003c/em\u003e is overexpressed in pancreatic cancer, which may promote the occurrence and development of pancreatic cancer and indicate prognosis.\u003c/p\u003e\u003cp\u003e\u003cem\u003eSDC-1\u003c/em\u003e, consisting of extracellular, transmembrane, and intracellular domains, demonstrates domain-specific functions: the extracellular domain primarily contributes to tumor immune evasion, metastasis, angiogenesis, and drug resistance \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e, whereas the intracellular domain modulates cell proliferation, survival, adhesion, and migration \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. However, the biological role of the transmembrane domain remains poorly characterized \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. In this investigation, we found that \u003cem\u003eSDC-1\u003c/em\u003e overexpression in pancreatic cancer cell lines substantially increased proliferation, migration, and invasiveness, whereas its knockout significantly attenuated these malignant phenotypes. In vivo experiments further demonstrated that \u003cem\u003eSDC-1\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e+AKR-KO mice showed the growth of pancreatic cancer cells slows down after tumor formation, highlighting \u003cem\u003eSDC-1\u003c/em\u003e's critical role in promoting pancreatic cancer proliferation. These findings indicate that \u003cem\u003eSDC-1\u003c/em\u003e actively drives malignant progression in pancreatic cancer and may function as an oncogene.\u003c/p\u003e\u003cp\u003eThe differential expression of \u003cem\u003eSDC-1\u003c/em\u003e across pancreatic cancer cell lines (low in PANC-1 vs. high in BXPC-3) and its functional correlation with malignant phenotypes establish \u003cem\u003eSDC-1\u003c/em\u003e as a critical regulator of pancreatic cancer progression. Our in vitro models demonstrated that \u003cem\u003eSDC-1\u003c/em\u003e overexpression in PANC-1 cells increased proliferation, migration, and invasion, whereas \u003cem\u003eSDC-1\u003c/em\u003e knockdown in BXPC-3 cells reversed these effects. These bidirectional manipulations confirm \u003cem\u003eSDC-1\u003c/em\u003e's oncogenic role through tumor-autonomous mechanisms, potentially via syndecan-mediated matrix interactions or growth factor receptor co-signaling. The in vivo tumor model revealed an unexpected dual regulatory axis: \u003cem\u003eSDC-1\u003c/em\u003e depletion in both tumor cells (PAN02-KO) and host microenvironment (KO mice) synergistically suppressed tumor growth, suggesting stromal-tumor crosstalk beyond cell-intrinsic effects. Notably, WT mice implanted with \u003cem\u003eSDC-1\u003c/em\u003e-KO tumors showed intermediate growth reduction compared to KO mice with WT tumors, implying host-derived \u003cem\u003eSDC-1\u003c/em\u003e contributes of the total pro-tumorigenic effect through paracrine mechanisms. This microenvironmental dependency aligns with recent findings on syndecan-1's role in extracellular matrix remodeling and immune cell recruitment \u003csup\u003e\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eTME serves as a critical regulator of pancreatic carcinogenesis, progression, and therapeutic resistance \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. A hallmark event in stromal remodeling involves the pathological transformation of resident fibroblasts into activated CAFs through paracrine signaling from malignant cells \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Pancreatic tumor cells orchestrate this phenotypic conversion via sustained secretion of TGF-β1, FGF family members, IL-1, and CXCL chemokines, establishing a self-perpetuating CAF activation loop within the TME. Notably, TGF-β1 operates through both autocrine and paracrine mechanisms to maintain the myofibroblastic CAF (myCAF) phenotype characterized by α-smooth muscle actin (α-SMA) expression \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. These α-SMA\u0026thinsp;+\u0026thinsp;myCAFs mediate immunosuppression through secretory factors that promote regulatory T cell expansion and myeloid-derived suppressor cell recruitment, thereby sculpting an immune-evasive niche \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Our experimental evidence demonstrates significant downregulation of both α-SMA and vimentin in \u003cem\u003eSDC-1\u003c/em\u003e deficient models compared to wild-type controls, indicative of impaired stromal activation. This molecular attenuation correlates with reduced myCAF infiltration and diminished immunosuppressive capacity, proposing \u003cem\u003eSDC-1\u003c/em\u003e ablation as a potential therapeutic strategy targeting desmoplasia and immune evasion in pancreatic adenocarcinoma.\u003c/p\u003e\u003cp\u003eOur study provides compelling evidence that \u003cem\u003eSDC-1\u003c/em\u003e serves as a critical modulator of pancreatic cancer TME architecture and immunotherapy responsiveness. The comparative analysis between \u003cem\u003eSDC-1\u003c/em\u003e KO and WT models revealed profound differences in TME composition and function. Histopathological assessment demonstrated that \u003cem\u003eSDC-1\u003c/em\u003e ablation significantly reduced malignant features, including epithelial cell deformation, necrotic areas, and collagen deposition\u0026mdash;hallmarks of pancreatic cancer desmoplasia. Most notably, we observed a marked decrease in CAF infiltration, consistent with prior reports implicating \u003cem\u003eSDC-1\u003c/em\u003e in fibroblast activation and extracellular matrix remodeling \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. The increase of CD8\u0026thinsp;+\u0026thinsp;T cell infiltration in \u003cem\u003eSDC-1\u003c/em\u003e KO tumors further supports SDC-1's role in maintaining an immunosuppressive stromal barrier, aligning with findings in other solid tumors \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThe dense structural barrier formed through CAF-mediated ECM remodeling significantly compromises therapeutic agent penetration into tumor tissues, thereby exacerbating chemoresistance in malignant cells \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Our study demonstrated superior anti-tumor responses in SDC1-deficient models, with the \u003cem\u003eSDC-1\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e+AKR-KO\u0026thinsp;+\u0026thinsp;anti-PD-1 cohort exhibiting marked tumor volume reduction compared to WT controls. This enhanced efficacy aligns with established mechanisms wherein CAFs orchestrate immune evasion through three synergistic pathways: (1) cytokine-driven PD-L1 upregulation in neoplastic cells \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e, (2) ECM modification-induced physical exclusion of immune effectors, and (3) TGF-β-mediated differentiation of Foxp3\u0026thinsp;+\u0026thinsp;regulatory T cells that subvert CD8\u0026thinsp;+\u0026thinsp;T cell cytotoxicity \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eNotably, SDC1 knockout amplified the effector T cell compartment, increasing CD8\u0026thinsp;+\u0026thinsp;T cell infiltration of total CD3\u0026thinsp;+\u0026thinsp;lymphocytes post-PD-L1 blockade. This immunomodulatory effect correlated with elevated expression of cytotoxic mediators including IFN-γ, Granzyme B, and T-box transcription factors \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e,\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. Flow cytometric analysis revealed concurrent expansion of both CD8\u0026thinsp;+\u0026thinsp;and CD4\u0026thinsp;+\u0026thinsp;T cell subsets in \u003cem\u003eSDC-1\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e models, suggesting multifaceted immune activation beyond direct PD-1/PD-L1 axis modulation.While our data confirm \u003cem\u003eSDC-1\u003c/em\u003e's pivotal role in TME reprogramming, the complete mechanistic network remains to be elucidated. Particularly, the observed metabolic shift in CAFs from glycolytic to oxidative phosphorylation phenotypes in knockout models implies potential crosstalk between proteoglycan signaling and stromal bioenergetics that warrants further investigation.\u003c/p\u003e\u003cp\u003eOur study demonstrates significant \u003cem\u003eSDC-1\u003c/em\u003e overexpression in pancreatic cancer tissues and cell lines, showing correlations with tumor aggressiveness, establishing \u003cem\u003eSDC-1\u003c/em\u003e as a promising diagnostic and prognostic biomarker for pancreatic cancer. Functionally, \u003cem\u003eSDC-1\u003c/em\u003e promotes pancreatic cancer cell proliferation, migration and invasive capacity, whereas its genetic ablation suppresses these oncogenic phenotypes, confirming its tumor-promoting role. At the molecular level, \u003cem\u003eSDC-1\u003c/em\u003e knockout can inhibits the conversion of normal fibroblasts into CAFs, consequently alleviating immunosuppressive TME characteristics and potentiating anti-PD-1 immunotherapy response. Future investigations should prioritize: (1) delineating \u003cem\u003eSDC-1\u003c/em\u003e's regulatory mechanisms, (2) characterizing the biological functions of its transmembrane domain, and (3) mapping its crosstalk with other signaling networks. Furthermore, comprehensive studies are needed to elucidate \u003cem\u003eSDC-1\u003c/em\u003e's involvement in immune cell recruitment dynamics and extracellular matrix (ECM) reorganization to refine immunotherapeutic approaches for pancreatic cancer.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe dataset and material are available from the corresponding authors on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003eWe thank the patients and their families who provided the tissues for this study. \u0026nbsp;This research was funded by The Cuiying Scientific and Technological Innovation Program of Lanzhou University Second Hospital, No. CY2024-MS-B04; Gansu Provincial Natural Science Foundation Project, No. 24JRRA331; Traditional Chinese Medicine Research Project of Gansu Province, No. GZKZ-2024-26;Lanzhou Science and Technology Plan Project (Grant No. 2023-4-26).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConceptualization, H.Y. and C.L.; methodology, T.W.; software, Y.W., Y.D.; validation, H.Y., T.W. and Y.W.; formal analysis, C.M.; data curation, W.S. and C.L.; writing\u0026mdash;original draft preparation, H.Y. and C.L.; writing\u0026mdash;review and editing, T.W., W.S. and C.L.; visualization, S.W., G.Z. and C.L.; supervision, C.L.; project administration, H.Y.; funding acquisition, H.Y. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInstitutional Review Board Statement:\u0026nbsp;\u003c/strong\u003eThe study was conducted in accordance with the Declaration of Helsinki. Experiment protocols were approved by the Ethics Committee of the School of Public Health, Lanzhou University (No. IRB22100501).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed Consent Statement:\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest:\u0026nbsp;\u003c/strong\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSiegel, R. L., Giaquinto, A. N. \u0026amp; Jemal, A. Cancer Statistics, 2024. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e. \u003cstrong\u003e74\u003c/strong\u003e, 12-49 (2024).\u003c/li\u003e\n\u003cli\u003eSalazar, J. et al. Treatment with Anticancer Drugs for Advanced Pancreatic Cancer: A Systematic Review. \u003cem\u003eBMC Cancer\u003c/em\u003e. \u003cstrong\u003e23\u003c/strong\u003e, 748 (2023).\u003c/li\u003e\n\u003cli\u003eAnderson, T., Mitchell, G., Prue, G., McLaughlin, S. \u0026amp; Graham-Wisener, L. The Psychosocial Impact of Pancreatic Cancer On Caregivers: A Scoping Review. \u003cem\u003eBMC Cancer\u003c/em\u003e. \u003cstrong\u003e25\u003c/strong\u003e, 511 (2025).\u003c/li\u003e\n\u003cli\u003eRalli, M. et al. Immunotherapy in the Treatment of Metastatic Melanoma: Current Knowledge and Future Directions. \u003cem\u003eJ Immunol Res\u003c/em\u003e. \u003cstrong\u003e2020\u003c/strong\u003e, 9235638 (2020).\u003c/li\u003e\n\u003cli\u003eReck, M., Remon, J. \u0026amp; Hellmann, M. D. First-Line Immunotherapy for Non-Small-Cell Lung Cancer. \u003cem\u003eJ. Clin. Oncol.\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 586-597 (2022).\u003c/li\u003e\n\u003cli\u003eChen, K. et al. Single Cell RNA-seq Reveals the CCL5/SDC1 Receptor-Ligand Interaction Between T Cells and Tumor Cells in Pancreatic Cancer. \u003cem\u003eCancer Lett.\u003c/em\u003e \u003cstrong\u003e545\u003c/strong\u003e, 215834 (2022).\u003c/li\u003e\n\u003cli\u003eWang, Q., Qin, Y. \u0026amp; Li, B. CD8(+) T Cell Exhaustion and Cancer Immunotherapy. \u003cem\u003eCancer Lett.\u003c/em\u003e \u003cstrong\u003e559\u003c/strong\u003e, 216043 (2023).\u003c/li\u003e\n\u003cli\u003eOh, S. A. et al. PD-L1 Expression by Dendritic Cells is a Key Regulator of T-cell Immunity in Cancer. \u003cem\u003eNat Cancer\u003c/em\u003e. \u003cstrong\u003e1\u003c/strong\u003e, 681-691 (2020).\u003c/li\u003e\n\u003cli\u003eHanahan, D., Michielin, O. \u0026amp; Pittet, M. J. Convergent Inducers and Effectors of T Cell Paralysis in the Tumour Microenvironment. \u003cem\u003eNat. Rev. Cancer\u003c/em\u003e. \u003cstrong\u003e25\u003c/strong\u003e, 41-58 (2025).\u003c/li\u003e\n\u003cli\u003eMao, X. et al. Crosstalk Between Cancer-Associated Fibroblasts and Immune Cells in the Tumor Microenvironment: New Findings and Future Perspectives. \u003cem\u003eMol. Cancer\u003c/em\u003e. \u003cstrong\u003e20\u003c/strong\u003e, 131 (2021).\u003c/li\u003e\n\u003cli\u003eFlies, D. B., Langermann, S., Jensen, C., Karsdal, M. A. \u0026amp; Willumsen, N. Regulation of Tumor Immunity and Immunotherapy by the Tumor Collagen Extracellular Matrix. \u003cem\u003eFront Immunol\u003c/em\u003e. \u003cstrong\u003e14\u003c/strong\u003e, 1199513 (2023).\u003c/li\u003e\n\u003cli\u003eStouten, I., van Montfoort, N. \u0026amp; Hawinkels, L. The Tango between Cancer-Associated Fibroblasts (CAFs) and Immune Cells in Affecting Immunotherapy Efficacy in Pancreatic Cancer. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, (2023).\u003c/li\u003e\n\u003cli\u003eBalar, P. C., Apostolopoulos, V. \u0026amp; Chavda, V. P. A New Era of Immune Therapeutics for Pancreatic Cancer: Monoclonal Antibodies Paving the Way. \u003cem\u003eEur. J. Pharmacol.\u003c/em\u003e \u003cstrong\u003e969\u003c/strong\u003e, 176451 (2024).\u003c/li\u003e\n\u003cli\u003eKumar-Singh, A. et al. Mapping the Interactome of the Nuclear Heparan Sulfate Proteoglycan Syndecan-1 in Mesothelioma Cells. \u003cem\u003eBiomolecules\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003ePham, S. H. et al. Syndecan-1 and -4 Influence Wnt Signaling and Cell Migration in Human Breast Cancers. \u003cem\u003eBiochimie\u003c/em\u003e. \u003cstrong\u003e198\u003c/strong\u003e, 60-75 (2022).\u003c/li\u003e\n\u003cli\u003eWang, H. et al. Clinical/Prognostic Significance of Syndecan-1 Expression in Invasive Breast Carcinoma with Distant Metastasis and its Correlation with Tumor Immunity. \u003cem\u003ePathol. Res. Pract.\u003c/em\u003e \u003cstrong\u003e250\u003c/strong\u003e, 154787 (2023).\u003c/li\u003e\n\u003cli\u003eOkolicsanyi, R. K. et al. Association of Heparan Sulfate Proteoglycans SDC1 and SDC4 Polymorphisms with Breast Cancer in an Australian Caucasian Population. \u003cem\u003eTumour Biol\u003c/em\u003e. \u003cstrong\u003e36\u003c/strong\u003e, 1731-1738 (2015).\u003c/li\u003e\n\u003cli\u003eChen, S., Navickas, A. \u0026amp; Goodarzi, H. Translational Adaptation in Breast Cancer Metastasis and Emerging Therapeutic Opportunities. \u003cem\u003eTrends Pharmacol. Sci.\u003c/em\u003e \u003cstrong\u003e45\u003c/strong\u003e, 304-318 (2024).\u003c/li\u003e\n\u003cli\u003eQu, J. et al. In Vivo Gene Editing of T-cells in Lymph Nodes for Enhanced Cancer Immunotherapy. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 10218 (2024).\u003c/li\u003e\n\u003cli\u003eChen, Y. et al. A Transformable Supramolecular Bispecific Cell Engager for Augmenting Natural Killer and T Cell-Based Cancer Immunotherapy. \u003cem\u003eAdv. Mater.\u003c/em\u003e \u003cstrong\u003e36\u003c/strong\u003e, e2306736 (2024).\u003c/li\u003e\n\u003cli\u003eZhou, Z. et al. A T Cell-Engaging Tumor Organoid Platform for Pancreatic Cancer Immunotherapy. \u003cem\u003eAdv Sci (Weinh)\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, e2300548 (2023).\u003c/li\u003e\n\u003cli\u003eZhang, R. et al. Pancreatic Cancer Cell-Derived Migrasomes Promote Cancer Progression by Fostering an Immunosuppressive Tumor Microenvironment. \u003cem\u003eCancer Lett.\u003c/em\u003e \u003cstrong\u003e605\u003c/strong\u003e, 217289 (2024).\u003c/li\u003e\n\u003cli\u003eDong, G. et al. DDX18 Drives Tumor Immune Escape through Transcription-Activated STAT1 Expression in Pancreatic Cancer. \u003cem\u003eOncogene\u003c/em\u003e. \u003cstrong\u003e42\u003c/strong\u003e, 3000-3014 (2023).\u003c/li\u003e\n\u003cli\u003eSantos, N. J. et al. Syndecan Family Gene and Protein Expression and their Prognostic Values for Prostate Cancer. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eOrecchia, P. et al. L19-IL2 Immunocytokine in Combination with the Anti-Syndecan-1 46F2SIP Antibody Format: A New Targeted Treatment Approach in an Ovarian Carcinoma Model. \u003cem\u003eCancers (Basel)\u003c/em\u003e. \u003cstrong\u003e11\u003c/strong\u003e, (2019).\u003c/li\u003e\n\u003cli\u003eZhang, C. L. et al. SDC1 and ITGA2 as Novel Prognostic Biomarkers for PDAC Related to IPMN. \u003cem\u003eSci Rep\u003c/em\u003e. \u003cstrong\u003e13\u003c/strong\u003e, 18727 (2023).\u003c/li\u003e\n\u003cli\u003eCzarnowski, D. Syndecans in Cancer: A Review of Function, Expression, Prognostic Value, and Therapeutic Significance. \u003cem\u003eCancer Treat Res Commun\u003c/em\u003e. \u003cstrong\u003e27\u003c/strong\u003e, 100312 (2021).\u003c/li\u003e\n\u003cli\u003eTheocharis, A. D. \u0026amp; Karamanos, N. K. Proteoglycans Remodeling in Cancer: Underlying Molecular Mechanisms. \u003cem\u003eMatrix Biol.\u003c/em\u003e \u003cstrong\u003e75-76\u003c/strong\u003e, 220-259 (2019).\u003c/li\u003e\n\u003cli\u003eGuo, S. et al. The Role and Therapeutic Value of Syndecan-1 in Cancer Metastasis and Drug Resistance. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e. \u003cstrong\u003e9\u003c/strong\u003e, 784983 (2021).\u003c/li\u003e\n\u003cli\u003eYang, Z., Chen, S., Ying, H. \u0026amp; Yao, W. Targeting Syndecan-1: New Opportunities in Cancer Therapy. \u003cem\u003eAm J Physiol Cell Physiol\u003c/em\u003e. \u003cstrong\u003e323\u003c/strong\u003e, C29-C45 (2022).\u003c/li\u003e\n\u003cli\u003eSaleh, M. E. et al. The Immunomodulatory Role of Tumor Syndecan-1 (CD138) On Ex Vivo Tumor Microenvironmental CD4+ T Cell Polarization in Inflammatory and Non-Inflammatory Breast Cancer Patients. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cstrong\u003e14\u003c/strong\u003e, e217550 (2019).\u003c/li\u003e\n\u003cli\u003eLiu, Y. et al. Syndecan-1 Inhibition Promotes Antitumor Immune Response and Facilitates the Efficacy of anti-PD1 Checkpoint Immunotherapy. \u003cem\u003eSci Adv\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, i7764 (2024).\u003c/li\u003e\n\u003cli\u003eZhong, Y. et al. Syndecan-1 as an Immunogene in Triple-negative Breast Cancer: Regulation Tumor-Infiltrating Lymphocyte in the Tumor Microenviroment and EMT by TGFb1/Smad Pathway. \u003cem\u003eCancer Cell Int.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 76 (2023).\u003c/li\u003e\n\u003cli\u003ePiwocka, O., Piotrowski, I., Suchorska, W. M. \u0026amp; Kulcenty, K. Dynamic Interactions in the Tumor Niche: How the Cross-Talk Between CAFs and the Tumor Microenvironment Impacts Resistance to Therapy. \u003cem\u003eFront Mol Biosci\u003c/em\u003e. \u003cstrong\u003e11\u003c/strong\u003e, 1343523 (2024).\u003c/li\u003e\n\u003cli\u003eMorgan, A. et al. Medical Biology of Cancer-Associated Fibroblasts in Pancreatic Cancer. \u003cem\u003eBiology (Basel)\u003c/em\u003e. \u003cstrong\u003e12\u003c/strong\u003e, (2023).\u003c/li\u003e\n\u003cli\u003eYang, D. et al. Analysis of M2 Macrophage-Associated Risk Score Signature in Pancreatic Cancer TME Landscape and Immunotherapy. \u003cem\u003eFront Mol Biosci\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, 1184708 (2023).\u003c/li\u003e\n\u003cli\u003eOzmen, E., Demir, T. D. \u0026amp; Ozcan, G. Cancer-Associated Fibroblasts: Protagonists of the Tumor Microenvironment in Gastric Cancer. \u003cem\u003eFront Mol Biosci\u003c/em\u003e. \u003cstrong\u003e11\u003c/strong\u003e, 1340124 (2024).\u003c/li\u003e\n\u003cli\u003eSodergren, M. H. et al. Immunological Combination Treatment Holds the Key to Improving Survival in Pancreatic Cancer. \u003cem\u003eJ Cancer Res Clin Oncol\u003c/em\u003e. \u003cstrong\u003e146\u003c/strong\u003e, 2897-2911 (2020).\u003c/li\u003e\n\u003cli\u003eHartupee, C. et al. Pancreatic Cancer Tumor Microenvironment is a Major Therapeutic Barrier and Target. \u003cem\u003eFront Immunol\u003c/em\u003e. \u003cstrong\u003e15\u003c/strong\u003e, 1287459 (2024).\u003c/li\u003e\n\u003cli\u003eWei, L. et al. Cancer-Associated Fibroblasts Promote Progression and Gemcitabine Resistance Via the SDF-1/SATB-1 Pathway in Pancreatic Cancer. \u003cem\u003eCell Death Dis.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 1065 (2018).\u003c/li\u003e\n\u003cli\u003eRen, B. et al. Tumor Microenvironment Participates in Metastasis of Pancreatic Cancer. \u003cem\u003eMol. Cancer\u003c/em\u003e. \u003cstrong\u003e17\u003c/strong\u003e, 108 (2018).\u003c/li\u003e\n\u003cli\u003eNatu, J. \u0026amp; Nagaraju, G. P. Gemcitabine Effects On Tumor Microenvironment of Pancreatic Ductal Adenocarcinoma: Special Focus On Resistance Mechanisms and Metronomic Therapies. \u003cem\u003eCancer Lett.\u003c/em\u003e \u003cstrong\u003e573\u003c/strong\u003e, 216382 (2023).\u003c/li\u003e\n\u003cli\u003ePei, L. et al. Roles of Cancer-Associated Fibroblasts (CAFs) in Anti- PD-1/PD-L1 Immunotherapy for Solid Cancers. \u003cem\u003eMol. Cancer\u003c/em\u003e. \u003cstrong\u003e22\u003c/strong\u003e, 29 (2023).\u003c/li\u003e\n\u003cli\u003eShi, T. et al. DKK1 Promotes Tumor Immune Evasion and Impedes Anti-PD-1 Treatment by Inducing Immunosuppressive Macrophages in Gastric Cancer. \u003cem\u003eCancer Immunol Res\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, 1506-1524 (2022).\u003c/li\u003e\n\u003cli\u003eLu, J. et al. Myeloid-Derived Suppressor Cells in Cancer: Therapeutic Targets to Overcome Tumor Immune Evasion. \u003cem\u003eExp Hematol Oncol\u003c/em\u003e. \u003cstrong\u003e13\u003c/strong\u003e, 39 (2024).\u003c/li\u003e\n\u003cli\u003eVan den Eynde, A. et al. IL-15-secreting CAR Natural Killer Cells Directed Toward the Pan-Cancer Target CD70 Eliminate Both Cancer Cells and Cancer-Associated Fibroblasts. \u003cem\u003eJ. Hematol. Oncol.\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 8 (2024).\u003c/li\u003e\n\u003cli\u003eSafaei, S. et al. Exploring the Dynamic Interplay Between Exosomes and the Immune Tumor Microenvironment: Implications for Breast Cancer Progression and Therapeutic Strategies. \u003cem\u003eBreast Cancer Res.\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 57 (2024).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table 2","content":"\u003cp\u003eTable 2 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Pancreatic cancer, SDC-1 gene, Biological function, Tumor microenvironment, Immune therapy","lastPublishedDoi":"10.21203/rs.3.rs-6802997/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6802997/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eImmunotherapy with PD-1 antibody for pancreatic cancer faces significant challenges due to the intricate tumor microenvironment. Syndecan-1 (\u003cem\u003eSDC-1\u003c/em\u003e), a type I transmembrane heparan sulfate proteoglycan, plays a crucial role in paracrine and epithelial-stromal interactions. However, its functional and clinical significance in the development and immunotherapy of pancreatic cancer remains unclear. Here, we report that targeting \u003cem\u003eSDC-1\u003c/em\u003e is a potential strategy to enhance therapeutic efficacy of PD-1 on pancreatic cancer by regulating tumor microenvironment. Our analysis reveals that \u003cem\u003eSDC-1\u003c/em\u003e is upregulated in pancreatic cancer tissues compared to normal pancreatic tissues. High \u003cem\u003eSDC-1\u003c/em\u003e expression correlates negatively with patient prognosis, as demonstrated through publicly available databases and tissue microarrays from pancreatic cancer patients. Overexpression of \u003cem\u003eSDC-1\u003c/em\u003e in PANC-1 cells promoted proliferation, migration, and invasion of pancreatic cancer cells, while \u003cem\u003eSDC-1\u003c/em\u003e knockdown significantly reduced these activities. In vivo, SDC-1 knockdown inhibited tumor growth and prolonged survival in mice with subcutaneous pancreatic cancer tumors. Crucially, \u003cem\u003eSDC-1\u003c/em\u003e ablation significantly enhanced the response of pancreatic cancer to PD-1 antibody treatment by reducing collagen deposition and cancer-associated fibroblast (CAF) levels in the stroma, while promoting increased infiltration of CD4\u0026thinsp;+\u0026thinsp;and CD8\u0026thinsp;+\u0026thinsp;T cells. Taken together, our findings suggest that \u003cem\u003eSDC-1\u003c/em\u003e is a critical oncogene in pancreatic cancer. Its deficiency leads to significant sensitization to immunotherapy by reprogramming the tumor microenvironment, offering a promising strategy to improve PD-1 antibody efficacy in pancreatic cancer treatment.\u003c/p\u003e","manuscriptTitle":"SDC-1 deficiency enhances the pancreatic cancer response to PD-1 antibody by reprogramming tumor microenvironment","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-22 16:33:44","doi":"10.21203/rs.3.rs-6802997/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1bd5345e-9af9-4392-83c5-20236c4ecfd5","owner":[],"postedDate":"July 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":51585709,"name":"Biological sciences/Cancer"},{"id":51585710,"name":"Biological sciences/Immunology"},{"id":51585711,"name":"Health sciences/Biomarkers"}],"tags":[],"updatedAt":"2025-08-29T10:38:54+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-22 16:33:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6802997","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6802997","identity":"rs-6802997","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00