RUNX1A isoform is overexpressed in acute myeloid leukemia and is associated with FLT3 internal tandem duplications | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article RUNX1A isoform is overexpressed in acute myeloid leukemia and is associated with FLT3 internal tandem duplications Cosimo Cumbo, Francesco Tarantini, Elisa Parciante, Luisa Anelli, and 23 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5733882/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background. RUNX1A is the shortest and least expressed of the RUNX1 three main isoforms (A, B, C); despite this, the leukemogenic role of its overexpression has been clearly described. Several studies have shown RUNX1A involvement in different blood cancers and pilot observations in acute leukemia have been reported. Methods. In this context, we evaluated RUNX1 isoformsexpression in a cohort of acute myeloid leukemia (AML) patients and associated our data with significant AML clinical and biological parameters. A focus was performed on FLT3 mutated cases. Genome-wide methylation data from the TF-1 cell line were studied to investigate the possible role of epigenetic regulation in RUNX1 expression. To verify whether RUNX1A upregulation is linked to a specific transcriptional profile, high-throughput RNA sequencing was conducted. Results. At diagnosis, we found RUNX1A and RUNX1B overexpression , with higher median levels in thrombocytopenic cases. No difference was observed for RUNX1C . RUNX1A overexpression is higher in more immature AML phenotypes. According to the mutational profile, FLT3 internal tandem duplication (ITD) positive cases have the highest RUNX1A levels and the presence of FLT3 -ITD was the only molecular variable able to influence RUNX1A expression. RUNX1A overexpression is disease-related, associated with a specific transcriptional profile, and reappears at relapse, with no clear kinetics except in FLT3 -ITD cases. Conclusions. Overall, we demonstrate RUNX1A overexpression in AML and its association with the FLT3 -ITD molecular subtype. Our data shed light on the dark side of RUNX1 deregulation, paving the way for further investigations. RUNX1A acute myeloid leukemia FLT3-ITD. Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Background RUNX1 is a transcription factor that plays the role of a “master regulator of hematopoiesis” through the antagonistic action of its three major protein isoforms, named RUNX1A, B and C [ 1 ]. In adult hematopoiesis, RUNX1B/C (453 and 480 amino acids respectively, lacking exon 7a and including exons 7b and 8) are the predominantly expressed isoforms. They are transcribed from two alternative promoters and differ by 27 amino acids at their N-terminus. RUNX1A (250 amino acids, including exon 7a, which has a stop codon) accounts for only a minor fraction of the isoform pool. It is a C-terminally truncated isoform generated by alternative splicing (Fig. 1A) [ 1 ]. RUNX1A shows enhanced DNA binding [ 2 ], specific cofactors [ 3 ] and divergent effects on target gene transcription [ 4 ] as compared to RUNX1B/C. RUNX1A enhances self-renewal activity and hematopoietic stem cell (HSC) expansion ex vivo and in vivo [ 4 ]; furthermore, it suppresses myeloid differentiation [ 2 ]. In contrast, RUNX1B/C overexpression induces HSCs quiescence [ 5 ] and promotes differentiation [ 2 ] in murine models. For these reasons, RUNX1A overexpression can be leukemogenic, as suggested by pilot observations in acute leukemia [ 2 , 6 ], and additional studies have shown the pathogenicity of RUNX1A in other blood diseases [ 3 , 7 – 9 ]. Given the pivotal role of the RUNX1 gene in acute myeloid leukemia (AML), we evaluated the expression of its isoforms in our series, aiming to elucidate the role of RUNX1A in the AML pathogenesis, its possible associations with different disease subtypes, and its influence during the disease course. 2. Materials and methods 2.1. Patients In total, 181 bone marrow (BM) samples were included in the study, from patients observed retrospectively over a period of time ranging from 2014 to 2023: 138 newly diagnosed AML patients, 21 relapsed AML cases, 11 cases in complete remission (CR, evaluated by molecular disease monitoring - see paragraph 2.6) and 10 healthy control (HC) donors, along with a pool of 56 HC samples (Human Bone Marrow Total RNA-Clontech Laboratories, Inc., Mountainview, CA, USA). The main patients clinical data are reported in Supplementary Table 1. The local Ethics Committee approved the study. Informed consent was obtained from all patients before study inclusion, in accordance with the Declaration of Helsinki. Patients' records/information were anonymized and de-identified before analysis. 2.2. RUNX1 isoforms absolute quantification Mononuclear cells were isolated from BM samples by Ficoll separation, and total RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany); the RNA concentration and purity were checked using the Qubit 2.0 fluorometer and NanoDrop UV-Vis spectrometer (Thermo Fisher Scientific, Waltham, MA). One µg of total RNA was reverse transcribed into complementary DNA (cDNA) using the QuantiTect reverse transcription kit (Qiagen). RUNX1A/B/C isoforms were quantified by three assays according to the droplet digital PCR (ddPCR) Gene Expression EvaGreen Assays Protocol (BioRad, Hercules, CA). For RUNX1A (NM_001122607) and RUNX1C (NM_001754) two distinct pairs of specific primers were used (RUNX1A_F: AACCCTCGTGCCTCCCTGAA and RUNX1A_R: AGCTCTATCCTGGCTGGGGA; RUNX1C_F: GGCTTCAGACAGCATATTTGAG and RUNX1C_R: AACGCCTCGCTCATCTTG). For the RUNX1B transcript isoform (NM_001001890), a primer pair quantifying RUNX1A + B was used (RUNX1A + B_F: CCGTCTGGTAGGAGCTGTTT and RUNX1B_R: AACGCCTCGCTCATCTTG) because no unique exon-usage exists unlike for the other isoforms. Therefore, to perform the absolute quantification of RUNX1B , the RUNX1A quantification was subtracted from the RUNX1A + B quantification. All assays were performed as already reported [ 10 , 11 ]. The target quantification was calculated as the ratio between each RUNX1 isoform and the number of copies of GUSB (R/G); RUNX1 gene expression (RUNX1all) was calculated as the sum of its three isoforms. 2.3. RUNX1A protein quantification Mononuclear cells isolated from BM samples by Ficoll separation or purchased from StemCell™ Technologies (Cologne, Germany) were mechanically lysed using the homogenizer T10 basic Ultra-Turrax1 (IKA, Staufen, Germany) in RIPA buffer (Thermo Fisher Scientific), supplemented with cOmplete™ Protease Inhibitor Cocktail and PhosSTOP™ phosphatase inhibitor (Roche, Basel, Switzerland) to extract total proteins. The lysates were centrifuged at 13,000 x g at 4°C for 10 minutes to remove debris, and total protein levels were quantified using the BioRad Protein Assay. Equal amounts of protein were mixed with Laemmli sample buffer, resolved by SDS-PAGE and blotted on nitrocellulose membranes using a Trans-Blot Turbo Transfer System (BioRad). Membranes were blocked with the EveryBlot Blocking Buffer (BioRad), incubated with primary antibodies (anti-RUNX1 antibody ab240639, Abcam, MA, USA; anti-beta-actin antibody C4, sc-47778, Santa Cruz Biotechnology, Inc., TX, USA; 1:1000 dilution) overnight at 4°C, and washed with 1X TBS-Tween 0.1%. After incubation with a horseradish-peroxidase-conjugated secondary antibody (1:3000 dilution, BioRad) for 1 h at room temperature, Clarity Western ECL Substrate (BioRad) was used for protein visualization with a ChemiDoc Imaging System (Bio-Rad). The signal intensity of the protein bands was measured using Image Lab Software (BioRad). The target quantification was calculated as the ratio between RUNX1A and beta-actin (R/B). AML samples were compared with those from HC donors and with commercial human bone marrow mononuclear cells (BMMCs) StemCell™ Technologies (Cologne, Germany). 2.4. Targeted next-generation sequencing (NGS) NGS analysis was performed on genomic DNA extracted from BM samples at diagnosis using an AmpliSeq customized panel (Thermo Fisher Scientific) encompassing the full coding regions or specific exons of 26 target genes involved in the pathogenesis of myeloid malignancies ( ANKRD26, ASXL1, CALR, CBL, CEBPA, DDX41, DNMT3A, ETV6, EZH2, FLT3, GATA2, IDH1, IDH2, JAK2, KIT, KRAS, MPL, NPM1, NRAS, RUNX1, SF3B1, SRSF2, TET2, TP53, U2AF1, ZRSR2 ), as previously reported [ 12 – 14 ]. Torrent Suite Software (Thermo Fisher) was used for quality control, alignment to the human genome (hg19) and variant calling, using the somatic workflow for single samples and the default parameters. Variants were annotated with Ion Reporter Software (Thermo Fisher). Variants located in intronic regions, synonymous or those present with > 1% global minor allele frequency in the normal population were filtered out. Selected variants were investigated for a potential pathogenic role using the SIFT and PolyPhen scores and the Catalogue of Somatic Mutations in Cancer database [ 13 ]. 2.5. FLT3 mutational analysis FLT3 internal tandem duplication (ITD) and D835/I836 variants were investigated on BM samples at disease onset and relapse, as reported [ 15 ]. The FLT3 ITD burden was reported as an allelic ratio (AR). Cases carrying an AR < 0.5 were defined as ITD-low, and patients with an AR ≥ 0.5 as ITD-high, according to the 2017 ELN recommendations [ 16 ]. ITD cases were also distinguished between single ITD (single duplication) and multiple ITD (≥ 2 different duplications), as reported [ 17 ]. According to the duplication length, patients were divided into ITD short and ITD long, using as cut-off value the median ITD length observed in our cohort (50bps), as previously suggested [ 18 ]. Other tyrosine kinase domain (TKD) variants were identified by NGS analysis (see paragraph 2.4.). 2.6. Molecular monitoring of measurable residual disease For AML cases carrying one of the following molecular markers: NPM1 , PML::RARA , RUNX1::RUNX1T1 , CBFB::MYH11 , molecular monitoring was performed by RQ-PCR using the following kits (Ipsogen): NPM1 mutA MutaQuant Kit, PML-RARA bcr1/bcr3 Kit, RUNX1-RUNX1T1 Kit, CBFB-MYH11 A Kit. 2.7. Gene expression profiling Gene expression profiling was performed by RNA-Seq. Twelve patients were sequenced using the massive sequencing Illumina NovaSeq6000 platform: seven cases with “high” RUNX1A expression [fold change (FC) ≥ 5] and five cases expressing “normal/low” levels (FC ≤ 3). In brief, paired-end reads obtained in FASTQ format were quality checked using FastQC version 0.12.1. and the analysis results were summarized in a single HTML report using MultiQC [ 19 ]. Reads were trimmed using the Trimmomatic tool version 0.32 [ 20 ] to remove sequences and adapters and then mapped against the Homo sapiens reference genome (GRCh.38: https://ftp.ensembl.org/pub/release-109/fasta/homo_sapiens/dna/ ) using the STAR aligner [ 21 ]. Reads mapped to each gene were summarized based on the genome annotation (version 109) from the ESEMBL database ( https://ftp.ensembl.org/pub/release-109/gtf/homo_sapiens/Homo_sapiens.GRCh38.109.gtf.gz ) using the FeatureCounts algorithm [ 22 ]. Principal Component Analysis (PCA) was performed using the DESeq2 R package by means of regularized log transformation (rld) of read counts to illustrate the overall distance between “high” and “normal/low” RUNX1A expression groups. RUNX1A reads for each sample were calculated using the TMM (Trimmed Mean of M-values), while DESeq2 was used to detect differentially expressed genes (DEGs) [ 23 ]. DEGs were selected by filtering them for Log2FC > 1.5 and < -1.5, and adjusted (adj) p value < 0.05. Data were visualized on a volcano plot. Gene names and gene ontology annotations (BP: Biological Process, CC: Cellular Component, MF: Molecular Function) of DEGs were retrieved from the Human Genome Annotation Resource (available via the org.Hs.eg.db R package) in combination with the AnnotationHub and AnnotationDbi R packages, and analyzed using the Database for Annotation, Visualization and Integrated Discovery (DAVID) v2024q2 (July 2024) [ 24 , 25 ]. DEGs were analyzed in QIAGEN Ingenuity Pathways Analysis (IPA) software (QIAGEN, Hilden, Germany) to categorize differentially expressed transcripts and identify significantly regulated functional pathways. The list of DEGs was used as a query in IPA. The ‘core analysis’ function was run to identify canonical pathways [ 26 ]. 2.8. Methylation analysis To investigate the possible role of epigenetic regulation in RUNX1 expression, genome-wide methylation data from the TF-1 cell line stably expressing DNMT3A isoform 1 were used to evaluate the methylation status of CpG sites mapped to the RUNX1 gene according to the DNMT3A mutation status. Specifically, methylation data from the TF-1 cell line stably expressing DNMT3A wild-type (WT) or AML-associated mutant hotspots at Arg822 (R882) [specifically R882C or R882H, which induce macro-oligomer formation, alone or in combination with R676K, a macro-oligomerization-reducing mutation (GEO Datasets ID: GSE226062)] were analyzed [ 27 ]. Data analysis of the IDAT raw methylation files from the Illumina Methylation EPIC BeadChip microarrays was performed using a dedicated R Bioconductor workflow that incorporated several packages for the analysis of methylation array data ( https://www.bioconductor.org/packages/devel/workflows/vignettes/methylationArrayAnalysis/inst/doc/methylationArrayAnalysis.html ). The IlluminaHumanMethylationEPICanno.ilm10b4.hg19 R package was used for the annotation of Illumina EPIC methylation arrays. Unsupervised hierarchical clustering of CpG sites mapping to the RUNX1 gene was performed to assess their correlation according to the methylation status in the aforementioned cell lines. 2.9. Statistical analysis All statistical analyses were carried out using GraphPad Prism version 8.3.0 (GraphPad Software Inc., San Diego, CA, USA). Continuous variables were presented as median (minimum-maximum). The Shapiro-Wilk test was performed to check for the normal distribution of continuous variables. The differences in the distribution of continuous variables between categories were compared using either paired or unpaired t-test (for variables passing the normality test) or Mann–Whitney and Wilcoxon matched pairs tests (for variables not passing the normality test). One-way ANOVA and Kruskal-Wallis tests were used to compare the distributions of more than two groups of continuous variables. Multiple linear regression analysis was performed to test the influence of gene mutations (independent variables) on RUNX1A levels (dependent variable). Spearman's rank-order correlation test was conducted to determine the relationship between the RUNX1A transcript and protein levels. Simple linear regression analysis was performed to predict RUNX1A protein levels from transcript levels. Spearman's rank-order correlation test was also performed to study the relationship between ddPCR and RNA-Seq RUNX1A quantifications. A p-value < 0.05 was considered statistically significant. 3. Results 3.1. RUNX1A and RUNX1B isoforms are overexpressed in newly diagnosed AML, with higher levels in thrombocytopenic cases. As observed in the normal hematopoietic system [ 5 ], among AML patients, considering median values, RUNX1B/C were confirmed as the dominantly expressed isoforms: 73% and 25% of the total RUNX1 transcripts, respectively, whereas RUNX1A accounted for 2% of the isoforms pool (Fig. 1B). When we examined the absolute quantification of each isoform, comparing AML cases (n = 138) with HC (n = 11), we confirmed RUNX1 overexpression in AML (1.209 vs 0.747 R/G; p = 0.028), as already known [ 28 ]. Moreover, we observed overexpression of RUNX1A (0.027 vs 0.003 R/G; p < 0.0001) and RUNX1B (0.827 vs 0.433 R/G; p = 0.006), whereas no difference was observed for RUNX1C (Fig. 1C). Interestingly, when comparing RUNX1 isoforms expression with the patients’ main clinical and biological data (Supplementary Table 1), thrombocytopenic cases (n = 93, < 150,000 PLTs/ul) exhibited higher levels of the RUNX1A and RUNX1B isoforms compared to AMLs with normal PLTs levels (n = 23) (0.030 vs 0.014 R/G; p = 0.002 and 0.876 vs 0.517 R/G; p = 0.007 respectively), confirming the previously established involvement of the RUNX1 gene in megakaryocytopoiesis (Fig. 1D) [ 29 ]. No other associations emerged from the comparisons. Given the known leukemogenic role of RUNX1A and its more pronounced overexpression compared to the other RUNX1 isoforms (⁓10-fold increase between AML and HC median levels – Fig. 1C), we decided to focus on RUNX1A expression and its possible association with AML pathogenesis. Firstly, we verified the RUNX1A overexpression at the protein level by immunoblot analysis (Fig. 1E). Increased RUNX1A protein levels were observed in AML patients compared to HC (2.018 vs 0.082 R/B, p = 0.0005), and a positive correlation was found between the RUNX1A transcript and protein levels (r s =0.805, p = 0.025) (Fig. 1E). Using simple linear regression analysis to predict protein levels from transcript levels, a significant regression equation was identified [ F (1,6) = 53.55, p = 0.0003] with R 2 = 0.899. Therefore, RUNX1A protein and transcript quantities are correlated and as expected, the former depends on the latter. 3.2. RUNX1A overexpression is independent of patient classification but related to the disease phenotype. The increased RUNX1A expression (in AMLs vs HC) was confirmed even when our AML cases were classified according to the latest edition of the WHO classification [ 30 ]. Considering the RUNX1A median value for each AML class ( PML::RARA , n = 12; RUNX1::RUNX1T1 , n = 8; CBFB::MYH11 , n = 8; NPM1 , n = 22; AML-MR, n = 46), the difference compared to HC remained statistically significant (Fig. 1F), whereas no changes were observed when comparing disease classes (p = 0.371). These observations suggested a possible RUNX1A involvement in AML pathogenesis independent of patient classification. The comparisons BCR::ABL1 vs HC and CEBPA vs HC were not performed, given the rarity of these cases among those enrolled (n = 2 and n = 2, respectively). Because preliminary data on acute leukemia indicated higher expression levels of RUNX1A in acute lymphoblastic leukemia and in AML-M2 patients [ 6 ], we classified our cases according to the older FAB classification [ 31 ], eliciting a significant difference for all morphological subtypes (M0, n = 11; M1, n = 14; M2, n = 30; M3, n = 12; M4, n = 26; M5, n = 9; M6, n = 8; M7, n = 3) compared to HC (Fig. 1G). Interestingly, the comparison between classes highlighted significant differences (Fig. 1H). In particular, the RUNX1A levels were higher in AML patients with a more immature phenotype and characterized by impaired granulocytic differentiation (M0-M3) as compared to cases showing a monocytic morphology (M4-M5), in line with the known RUNX1A ability to suppress myeloid differentiation, enhancing the self-renewal HSCs capacity [ 2 , 4 , 32 ]. In this context, M6 and M7 classes appeared to follow other pathways, which we cannot address given the rarity of cases among those enrolled. 3.3. FLT3-ITD mutated patients show the highest median levels of the RUNX1A isoform. Then, we subdivided our patients according to their mutational profile. Overall, FLT3 -ITD positive cases (n = 23) presented the highest median RUNX1A levels at the disease onset (0.071 R/G), as shown in Fig. 2 A. A strong relationship between the FLT3 -ITD mutations and RUNX1A transcript levels was confirmed by multiple linear regression analysis. Specifically, between all gene mutations detected in our cohort ( TP53 , n = 7; NPM1 , n = 22; CEBPA , n = 2; RUNX1 , n = 11; FLT3 -ITD, n = 23; FLT3 -TKD, n = 10; DNMT3A , n = 8; TET2 , n = 17; IDH2 , n = 8; EZH2 , n = 3; ASXL1 , n = 16; SRSF2 , n = 6; SF3B1 , n = 3; U2AF1 , n = 5; ETV6 , n = 3; CBL , n = 3; NRAS , n = 15; GATA2 , n = 3), the presence of FLT3 -ITD was the only variable able to influence the RUNX1A levels (p = 0.0005; Supplementary Table 2). On this basis, we explored the possible connection between FLT3 mutational status and RUNX1A expression (Fig. 2 B). A significant difference was observed between FLT3 -mutated (n = 33) and FLT3 -wt AML (n = 82) (0.048 vs 0.020 R/G, p = 0.019), but this difference became more evident when we compared FLT3 -ITD (n = 23) with FLT3 -wt (n = 82) cases (0.071 vs 0.020 R/G, p < 0.0001). While FLT3 -ITD AML exhibited higher RUNX1A levels than FLT3 -wt cases, FLT3 -TKD patients (n = 10) had lower RUNX1A levels than FLT3 -wt ones (0.006 vs 0.020 R/G, p = 0.025). Again, this observation supports the connection between the ITD mutation and RUNX1A expression. Focusing on this aspect, we found that neither the ITD allelic ratio (low vs high) nor the ITD number (single vs multiple) seemed to influence RUNX1A transcript levels. However, RUNX1A overexpression was higher in long ITD cases (n = 11, characterized by more FLT3 auto-phosphorylation and poorer survival outcomes [ 18 ]) compared to short ITD ones (n = 8) (0.131 vs 0.037 R/G, p = 0.02) (Fig. 2 C). The association between FLT3 -ITD and RUNX1A overexpression indirectly influenced the median levels of the isoform in the three risk categories according to the ELN 2022 recommendations [ 33 ]. AML patients in the intermediate category (where all FLT3 -ITD but not FLT3 -TKD are included) showed higher RUNX1A levels than those in the favorable and adverse categories (0.070 vs 0.024 R/G, p = 0.003 and 0.070 vs 0.015 R/G, p = 0.0004 respectively), whereas no differences were observed between the latter two categories (Fig. 2 D). Finally, the close relationship between FLT3 -ITD and RUNX1A expression was observed again at disease relapse (DR), but this aspect will be discussed later. 3.4. DNMT3A-mutated AMLs present higher RUNX1A levels than DNMT3A-wt cases. Although there is a clear association between RUNX1A overexpression and the FLT3 -ITD mutation, we considered other possible genetic mechanisms influencing RUNX1A levels in AML, namely RUNX1 gene alterations (SNVs and INDELs, RUNX1::RUNX1T1 and trisomy 21), spliceosome mutations ( SRSF2 , SF3B1 and U2AF1 variants) and epigenetic modifiers mutations ( DNMT3A , TET2 , IDH2 , EZH2 , ASXL1 ). None of the explored RUNX1 gene alterations appeared to be associated with isoform A overexpression, including trisomy 21 (as somatic event), unlike what has been described in Down Syndrome – associated myeloid leukemia (ML-DS) [ 3 ] (Supplementary Fig. 1A). Conversely, lower RUNX1A /RUNX1all levels were observed in RUNX1 -mutated cases (n = 11) compared to wild type ones (n = 43)(0.010 vs 0.018 R/G, p = 0.015), suggesting a mutually exclusive relationship between gene mutations (loss of function and/or altered function [ 34 ]) and the expression of the leukemogenic isoform A (Fig. 2 E). Although RUNX1A is generated by alternative splicing [ 35 , 36 ], no differences in RUNX1A levels were observed in AML patients carrying spliceosome mutations compared to wild type cases, neither considering its absolute quantification nor the ratio between the two splicing isoforms RUNX1A and RUNX1B (Supplementary Fig. 1B/C). Last but not least, we investigated the possible role of epigenetic modifiers mutations on the RUNX1 isoforms disequilibrium, focusing on the ratio between RUNX1A and RUNX1C transcribed from the P2 and P1 promoters, respectively. Interestingly, DNMT3A -mutated AMLs (n = 8) presented a higher RUNX1A / RUNX1C ratio than DNMT3A -wt cases (n = 46)(0.304 vs 0.045 R/G, p = 0.0029), suggesting a possible different methylation activity of DNMT3A on the two promoters (Fig. 2 F). The difference remained significant when considering RUNX1A absolute levels (see Supplementary Fig. 1D) so we decided to study the relationship between DNMT3A mutational status and the methylation profile of RUNX1 gene. Recently, TF-1 cell line was engineered to stably expressed DNMT3A (isoform 1), including WT and AML-associated hotspot mutants (either R882C or R882H) alone or in combination with R676K, an additional macro-oligomerization-decreasing mutation: R882C/R676K (DNMT3A_CK) and R882H/R676K (DNMT3A_HK) [ 27 ]. Comparing their methylation profile, a global hypomethylation of RUNX1 CpG sites was observed in all DNMT3A mutated TF-1 cells compared to DNMT3A _WT cells (Fig. 2 G). Differential methylation analysis between WT and all DNMT3A mutant cell lines revealed statistically significant hypomethylation of almost all CpG sites of RUNX1 , regardless of the genomic location of the CpG site (data not shown). 3.5. RUNX1A overexpression is disease-related and reappears at relapse, with no clear kinetics, except in FLT3-ITD cases. With the aim of studying RUNX1A kinetic expression during the disease course, we evaluated the levels at the CR stage and at DR. When patients achieved CR, their RUNX1A levels reverted to normal values (Fig. 3 A). In fact, no differences were found between patients at this stage and HC (0.002 vs 0.003, p = 0.298) (Fig. 3 B). At DR, we again quantified the expression of all three isoforms. As observed at disease onset, when comparing relapsing AML cases (n = 21) with HC we confirmed the overexpression of RUNX1A (0.020 vs 0.003 R/G, p < 0.0001) and RUNX1B (1.167 vs 0.433 R/G, p = 0.0012), whereas no difference was observed for RUNX1C (0.376 vs 0.322 R/G, p = 0.341) (Fig. 3 C). Considering, for each patient, the evolution of RUNX1 isoforms expression between the diagnosis and DR, no clear kinetics emerged from the analyzed cases (Fig. 3 D-G). Notably, when we focused on four cases that were FLT3 -ITD negative at disease onset but FLT3 -ITD mutated at DR, all of these cases exhibited an increased RUNX1A expression compared to the values at diagnosis (p = 0.033), confirming once again the close connection previously demonstrated between FLT3 -ITD mutations and RUNX1A overexpression (Fig. 3 H). Overall, no differences emerged when comparing median RUNX1A expression levels between diagnosis and DR (0.027 vs 0.02 R/G, p = 0.728), as also when comparing patients in CR with HC (Fig. 3 B). In short, RUNX1A overexpression was disease-related. 3.6. RUNX1A overexpression is associated with a specific transcriptional profile. To verify whether RUNX1A upregulation is linked to a specific transcriptional profile, high-throughput RNA sequencing was conducted. Interestingly, patients with “high” RUNX1A expression (FC ≥ 5) also produced a greater number of RUNX1A reads (≥ 18,000 reads) compared to patients with “normal/low” (FC ≤ 3) RUNX1A expression (< 12,000 reads), demonstrating a positive correlation of about 90% (r s =0.89, p = 0.0002), indicating the reliability of the sequencing approach. PCA showed the separation between the two groups of samples (high and normal/low RUNX1A expression) and highlighted the homogeneity of samples within each group (Fig. 3 I). A total of 3,622 protein coding genes (1,491 up and 2,131 down) and 3,108 elements belonging to other categories (lncRNAs, miRNAs, pseudogenes, etc.) were found to be differentially expressed between the two groups of patients. The complete list of differentially expressed elements is reported in Supplementary Table 3. Among these, 756 protein-coding genes (557 up and 199 down) and 1,159 elements belonging to other categories (lncRNAs, miRNAs, pseudogenes, etc.) were differentially expressed, with a Log2FC > 1.5 or < -1.5 and with a p-value and a padj value < 0.05 between the two groups of patients. Statistically significant (padj < 0.05) DEGs were categorized into Gene Ontology (GO) categories using the online software DAVID ( https://david.ncifcrf.gov/tools.jsp ). “Signal Transduction” was identified as the TOP BP (p = 7.00E-07), “Plasma membrane” the TOP CC (p = 3.02E-23) and “serine-type endopeptidase activity” the TOP MF (p = 2.07E-6) items. The complete list of gene ontology categories (BP, CC, MF) and the categorized genes is reported in Supplementary Table 4. Then, a “core analysis” was performed using IPA software, to investigate canonical pathways enriched in DEGs. “Neutrophil degranulation” (p = 5.85E-20) was identified as the TOP canonical pathway deregulated, with 56 DEGs; the majority of them being downregulated genes. The activation state of the pathway was identified as “decreased” (z-score = -6,682) (Fig. 3 L). Interestingly, this observation is in line with the known RUNX1A ability to suppress myeloid differentiation [ 2 , 4 , 32 ] and with the higher RUNX1A levels observed in our AML cases with a more immature phenotype and characterized by impaired granulocytic differentiation (M0-M3). The complete list of canonical pathways resulting from the analysis is reported in Supplementary Table 5. Notably, when focusing on the TOP five DEGs (upregulated and downregulated) between the two groups (Fig. 3 M), the POU4F1 (Log2FC = 6.72, padj = 0.009) and SFRP1 (Log2FC=-5.33, padj = 0.005) genes stand out. In fact, POU4F1 overexpression has already been associated with RUNX1::RUNX1T1 AML and is known to contribute directly to its unique transcriptional signature; on the contrary, SFRP1 is a transcriptional repression target of the RUNX1::RUNX1T1 fusion protein in AML [ 37 , 38 ]. 4. Discussion The pivotal role of RUNX1 in the control of hematopoiesis has been amply demonstrated [ 39 ]. Dysregulated RUNX1 can contribute to blood diseases in many ways, whereby either an excess or a deficiency of RUNX1 , or an altered function, can promote leukemogenesis [ 34 ]. Among the main RUNX1 alterations, gene mutations (germline and somatic) and RUNX1::RUNX1T1 fusion are the most common events, widely studied in AML pathogenesis [ 34 , 40 , 41 ]. However, additional genetic aberrations (copy number events or further genomic rearrangements) can affect its function [ 42 , 43 ]. Conversely, less attention has been paid to RUNX1 expression in AML, even if its overexpression has been associated with poorer outcomes in cytogenetically normal AML [ 28 ]. To the best of our knowledge, this is the first study to report the absolute quantification of the three main RUNX1 isoforms in an AML series. The observed RUNX1A and RUNX1B overexpression suggests a possible different epigenetic regulation of these two isoforms, transcribed from the P2 promoter (proximal), whereas the expression of RUNX1C (transcribed from the P1 promotor – distal) [ 44 , 45 ] remains unchanged. Among the three main RUNX1 isoforms, several studies have shown the leukemogenic role of RUNX1A in different hematological diseases. A study on myelodysplastic/myeloproliferative neoplasms (MDS/MPN) showed the involvement of RUNX1A in disease progression [ 7 ]. A recent study on ML-DS demonstrated the key role of a RUNX1 isoform disequilibrium favoring RUNX1A in the pathogenesis of this rare disease [ 3 ]. Even though based on a limited number of cases, RUNX1A overexpression was also observed in two previous studies on acute leukemia [ 2 , 6 ]. In our study, we investigated RUNX1A levels in AML and linked its overexpression with key clinical and biological parameters and the disease course. Interestingly, our observations align with the already known role of RUNX1 in hematopoiesis. Specifically, the higher levels of RUNX1A observed in thrombocytopenic cases confirm the widely demonstrated involvement of the RUNX1 gene in megakaryocytopoiesis [ 29 ]. Furthermore, RUNX1A overexpression was recently described in the familial platelet disorder with associated myeloid malignancy (FPDMM), suggesting a new potential role for RUNX1 isoforms disequilibrium in the development of myeloid malignancy in FPD [ 8 , 9 ]. The ability of RUNX1A to suppress myeloid differentiation while enhancing the HSC self-renewal capacity [ 2 , 4 , 32 ] aligns with the higher RUNX1A overexpression observed in the more undifferentiated cases in our cohort. In murine models, enforced expression of RUNX1A expanded the immature hematopoietic cell population, conferring the potential to differentiate into multiple lineages ex vivo [ 4 ]. Other data showed that overexpressed RUNX1A inhibits myeloid cell differentiation and stimulates cell proliferation upon granulocyte colony-stimulating factor (G-CSF) treatment [ 2 ]. However, the highest RUNX1A levels were observed in FLT3 -ITD AML patients. The RUNX1 cooperation with FLT3 -ITD in leukemia induction is already known [ 46 , 47 ]. FLT3 -ITD AML patients express high levels of RUNX1 ; FLT3 -ITD directly impacts RUNX1 activity, whereby upregulated and phosphorylated RUNX1 cooperates with FLT3 -ITD to induce AML [ 46 , 47 ]. Notably, no studies have specifically focused on the expression of the three RUNX1 isoforms. However, Cauchy et al. demonstrated that the RUNX1 upregulation in FLT3-ITD positive AML may partially result from the presence of an ITD-specific open region of chromatin (a DNase I hypersensitive site - DHS) within the RUNX1 gene, approximately 10kb upstream of exon 6, whose alternative splicing generates the RUNX1A isoform (Fig. 4 ) [ 46 ]. Although we cannot verify this direct connection, it is conceivable that in FLT3 -ITD AML, this open region at the 5’ end of exon 6 may facilitate regulator access, promoting alternative splicing in favor of RUNX1A production, as recently described [ 35 ]. Moreover, RUNX1A overexpression could also result partially from epigenetic mechanisms, as suggested by the higher levels detected in our DNMT3A -mutated cases. In fact, as we observed in TF-1 cells, DNMT3A dysfunction impacts the RUNX1 methylation profile. By studying RUNX1A kinetics during follow-up, we highlighted its close association with the disease course. RUNX1A overexpression is disease-related and drives a specific transcriptional profile which, in some respects, overlaps the RUNX1::RUNX1T1 gene expression signature. Notably, RUNX1A overexpression is closely linked to POU4F1 upregulation and SFRP1 downregulation, two events already observed in RUNX1::RUNX1T1 AML [ 37 , 38 ]. The main strength of this study is the strong association observed between RUNX1A deregulation and significant AML clinical and biological parameters, particularly the FLT3 -ITD mutation. However, the hypotheses presented were not verified through functional models (the main limitation of our work); further studies are required to validate these findings. 5. Conclusion The AML biological heterogeneity underscores the need for deeper insights into the molecular mechanisms underlying disease development. Our data aims to contribute a new piece to the jigsaw of the AML molecular pathogenesis, in which RUNX1 involvement is established. Our effort to shed light on the dark side of RUNX1 dysregulation may also offer the opportunity to look on RUNX1A as a new AML therapeutic target. In fact, restoring the RUNX1 isoforms equilibrium could reverse the oncogenic potential of isoform A, as recently shown in ML-DS. In FLT3 -ITD AML cases, for which targeted treatment are already available, clarifying unknown aspects of the FLT3 pathway could identify new druggable molecules whose synergistic action with FLT3 inhibitors warrants investigation. In the meantime, another piece has been added to the complex scenario of the AML pathogenesis. Abbreviations HSC hematopoietic stem cell AML acute myeloid leukemia BM bone marrow CR complete remission HC healthy control cDNA complementary DNA NGS next-generation sequencing ITD internal tandem duplication AR allelic ratio TKD tyrosine kinase domain FC fold change PCA principal component analysis DEGs differentially expressed genes BP Biological Process CC Cellular Component MF Molecular Function DAVID Database for Annotation, Visualization and Integrated Discovery IPA Ingenuity Pathways Analysis WT wild type DR disease relapse ML-DS Down Syndrome – associated myeloid leukemia GO Gene Ontology MDS/MPN myelodysplastic/myeloproliferative neoplasms FPDMM familial platelet disorder with associated myeloid malignancy G-CSF granulocyte colony-stimulating factor DHS DNase I hypersensitive site Declarations Ethics approval and consent to participate The local ethics committee approved the study. Informed consent was obtained from all patients before their study inclusion, in accordance with the Declaration of Helsinki. Patients' records/information were anonymized and de-identified before analysis. Consent for publication Consent for publication was obtained from patients before their enrolment in the present study. Availability of data and materials Not applicable. Competing interests The authors declare that they have no competing interests. Funding Not applicable. Authors' contributions Conception and design of the study: CC and FA. Acquisition of data and/or analysis and interpretation of data: CC, FT, EP, LA, AZ, NC, GT, IR, MRC, AM, CFM, GS, PM and FA. Clinical data acquisition: FT, VPG and MD. Protein quantification: GB, AN and FG. RNA-sequencing: MFC, FM, CT, SNC, BB and AT. Methylation analysis: PO and MG. Drafting of the manuscript: FA. All authors revised the manuscript for important intellectual content and approved the final version submitted for publication. Acknowledgements This work was supported by “Associazione Italiana contro le Leucemie (AIL)-BARI”. References Miyoshi H, Ohira M, Shimizu K, Mitani K, Hirai H, Imai T, et al. Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia. Nucleic Acids Res. 1995;23:2762–9. Tanaka T, Tanaka K, Ogawa S, Kurokawa M, Mitani K, Nishida J, et al. An acute myeloid leukemia gene, AML1, regulates hemopoietic myeloid cell differentiation and transcriptional activation antagonistically by two alternative spliced forms. EMBO J. 1995;14:341–50. Gialesaki S, Bräuer-Hartmann D, Issa H, Bhayadia R, Alejo-Valle O, Verboon L, et al. RUNX1 isoform disequilibrium promotes the development of trisomy 21–associated myeloid leukemia. Blood. 2023;141:1105–18. Tsuzuki S, Seto M. Expansion of functionally defined mouse hematopoietic stem and progenitor cells by a short isoform of RUNX1/AML1. Blood. 2012;119:727–35. Challen GA, Goodell MA. Runx1 isoforms show differential expression patterns during hematopoietic development but have similar functional effects in adult hematopoietic stem cells. Exp Hematol [Internet]. ISEH - Society for Hematology and Stem Cells; 2010;38:403–16. Available from: http://dx.doi.org/10.1016/j.exphem.2010.02.011 Liu X, Zhang Q, Zhang DE, Zhou C, Xing H, Tian Z, et al. Overexpression of an isoform of AML1 in acute leukemia and its potential role in leukemogenesis. Leuk Nat Publishing Group. 2009;23:739–45. Sakurai H, Harada Y, Ogata Y, Kagiyama Y, Shingai N, Doki N, et al. Overexpression of RUNX1 short isoform has an important role in the development of myelodysplastic/myeloproliferative neoplasms. Blood Adv. 2017;1:1382–6. Engvall M, Karlsson Y, Kuchinskaya E, Jörnegren Å, Mathot L, Pandzic T, et al. Familial platelet disorder due to germline exonic deletions in RUNX1: a diagnostic challenge with distinct alterations of the transcript isoform equilibrium. Volume 63. Leuk Lymphoma. Taylor & Francis; 2022. pp. 2311–20. Cabrerizo Granados D, Barbosa I, Baliakas P, Hellström-Lindberg E, Lundin V. The clinical phenotype of germline RUNX1 mutations in relation to the accompanying somatic variants and RUNX1 isoform expression. Genes Chromosom Cancer. 2023;62:672–7. Cumbo C, Tarantini F, Anelli L, Zagaria A, Redavid I, Minervini CF et al. IRF4 expression is low in Philadelphia negative myeloproliferative neoplasms and is associated with a worse prognosis. Exp Hematol Oncol [Internet]. BioMed Central; 2021;10:1–4. Available from: https://doi.org/10.1186/s40164-021-00253-y Tarantini F, Cumbo C, Parciante E, Anelli L, Zagaria A, Coccaro N et al. IRF4 gene expression on the trail of molecular response: looking at chronic myeloid leukemia from another perspective. Acta Haematol. 2022. Cumbo C, Tarantini F, Zagaria A, Anelli L, Minervini CF, Coccaro N, et al. Clonal Hematopoiesis at the Crossroads of Inflammatory Bowel Diseases and Hematological Malignancies: A Biological Link? Front Oncol. 2022;12:1–5. Coccaro N, Zagaria A, Orsini P, Anelli L, Tota G, Casieri P et al. RARA and RARG gene downregulation associated with EZH2 mutation in acute promyelocytic-like morphology leukemia. Hum Pathol [Internet]. Elsevier Inc.; 2018;80:82–6. Available from: https://doi.org/10.1016/j.humpath.2018.02.023 Cumbo C, Orsini P, Tarantini F, Anelli L, Zagaria A, Tragni V, et al. TNFRSF13B gene mutation in familial acute myeloid leukemia: A new piece in the complex scenario of hereditary predisposition? Hematol Oncol. 2023;41:942–6. Murphy KM, Levis M, Hafez MJ, Geiger T, Cooper LC, Smith BD, et al. Detection of FLT3 internal tandem duplication and D835 mutations by a multiplex polymerase chain reaction and capillary electrophoresis assay. J Mol Diagnostics. 2003;5:96–102. Döhner H, Estey E, Grimwade D, Amadori S, Appelbaum FR, Büchner T et al. Diagnosis and management of AML in adults: 2017 ELN recommendations from an international expert panel. Blood. 2017. Cumbo C, Tarantini F, Anelli L, Zagaria A, Specchia G, Musto P et al. FLT3 mutational analysis in acute myeloid leukemia: Advantages and pitfalls with different approaches. Blood Rev [Internet]. Elsevier Ltd; 2022;54:100928. Available from: https://doi.org/10.1016/j.blre.2022.100928 Polak TB, van Rosmalen J, Dirven S, Herzig JK, Cloos J, Meshinchi S, et al. Association of FLT3-internal tandem duplication length with overall survival in acute myeloid leukemia: a systematic review and meta-analysis. Haematologica. 2022;107:2506–10. Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: Summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016;32:3047–8. Bolger AM, Lohse M, Usadel B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–20. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15–21. Liao Y, Smyth GK, Shi W, FeatureCounts. An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30:923–30. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:1–21. Sherman BT, Hao M, Qiu J, Jiao X, Baseler MW, Lane HC, et al. DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. Volume 50. Oxford University Press; 2022. pp. W216–21. Huang DW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4:44–57. Krämer A, Green J, Pollard J, Tugendreich S. Causal analysis approaches in ingenuity pathway analysis. Bioinformatics. 2014;30:523–30. Lu J, Guo Y, Yin J, Chen J, Wang Y, Wang GG, et al. Structure-guided functional suppression of AML-associated DNMT3A hotspot mutations. Nat Commun Springer US. 2024;15:1–16. Fu L, Fu H, Tian L, Xu K, Hu K, Wang J, et al. High expression of RUNX1 is associated with poorer outcomes in cytogenetically normal acute myeloid leukemia. Oncotarget. 2016;7:15828–39. Wang C, Tu Z, Cai X, Wang W, Davis AK, Nattamai K et al. A critical role of RUNX1 in governing megakaryocyte-primed hematopoietic stem cell differentiation. Blood Adv [Internet]. The American Society of Hematology; 2023;7:2590–605. Available from: https://doi.org/10.1182/bloodadvances.2022008591 Khoury JD, Solary E, Abla O, Akkari Y, Alaggio R, Apperley JF, et al. The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours: Myeloid and Histiocytic/Dendritic Neoplasms. Leuk Springer US. 2022;36:1703–19. Bennett JM, Catovsky D, Daniel M-T, Flandrin G, Galton DAG, Gralnick HR, et al. Proposals for the Classification of the Acute Leukaemias French‐American‐British (FAB) Co‐operative Group. Br J Haematol. 1976;33:451–8. Tsuzuki S, Hong D, Gupta R, Matsuo K, Seto M, Enver T. Isoform-specific potentiation of stem and progenitor cell engraftment by AML1/RUNX1. PLoS Med. 2007;4:0880–96. Döhner H, Wei AH, Appelbaum FR, Craddock C, DiNardo CD, Dombret H, et al. Diagnosis and management of AML in adults: 2022 recommendations from an international expert panel on behalf of the ELN. Blood. 2022;140:1345–77. Kellaway SG, Coleman DJL, Cockerill PN, Raghavan M, Bonifer C. Molecular Basis of Hematological Disease Caused by Inherited or Acquired RUNX1 Mutations. Exp Hematol [Internet]. Elsevier Inc.; 2022;111:1–12. Available from: https://doi.org/10.1016/j.exphem.2022.03.009 Davis AG, Einstein JM, Zheng D, Jayne ND, Fu XD, Tian B, et al. A CRISPR RNA-binding protein screen reveals regulators of RUNX1 isoform generation. Blood Adv. 2021;5:1310–23. Komeno Y, Yan M, Matsuura S, Lam K, Lo MC, Huang YJ, et al. Runx1 exon 6-related alternative splicing isoforms differentially regulate hematopoiesis in mice. Blood. 2014;123:3760–9. Fortier JM, Payton JE, Cahan P, Ley TJ, Walter MJ, Graubert TA. POU4F1 is associated with t(8;21) acute myeloid leukemia and contributes directly to its unique transcriptional signature. Leukemia [Internet]. Nature Publishing Group; 2010;24:950–7. Available from: http://dx.doi.org/10.1038/leu.2010.61 Cheng CK, Li L, Cheng SH, Ng K, Chan NPH, Ip RKL, et al. Secreted-frizzled related protein 1 is a transcriptional repression target of the t(8;21) fusion protein in acute myeloid leukemia. Blood. 2011;118:6638–48. De Bruijn M, Dzierzak E. Runx transcription factors in the development and function of the definitive hematopoietic system. Blood. 2017;129:2061–9. Bellissimo DC, Speck NA. RUNX1 mutations in inherited and sporadic leukemia. Front Cell Dev Biol. 2017;5:1–11. Sood R, Kamikubo Y, Liu P. Role of RUNX1 in hematological malignancies. Blood. 2017;129:2070–82. Cumbo C, Tota G, De Grassi A, Anelli L, Zagaria A, Coccaro N et al. RUNX1 gene alterations characterized by allelic preference in adult acute myeloid leukemia. Leuk Lymphoma [Internet]. Taylor & Francis; 2021;0:1–9. Available from: https://doi.org/10.1080/10428194.2021.1929960 Zagaria A, Anelli L, Coccaro N, Tota G, Casieri P, Cellamare A, et al. 5′RUNX1-3′USP42 chimeric gene in acute myeloid leukemia can occur through an insertion mechanism rather than translocation and may be mediated by genomic segmental duplications. Mol Cytogenet. 2014;7:1–8. Levanon D, Glusman G, Bangsow T, Ben-Asher E, Male DA, Avidan N, et al. Architecture and anatomy of the genomic locus encoding the human leukemia-associated transcription factor RUNX1/AML1. Gene. 2001;262:23–33. Ghozi MC, Bernstein Y, Negreanu V, Levanon D, Groner Y. Expression of the human acute myeloid leukemia gene AML1 is regulated by two promoter regions. Proc Natl Acad Sci U S A. 1996;93:1935–40. Cauchy P, James SR, Zacarias-Cabeza J, Ptasinska A, Imperato MR, Assi SA, et al. Chronic FLT3-ITD Signaling in Acute Myeloid Leukemia Is Connected to a Specific Chromatin Signature. Cell Rep Elsevier. 2015;12:821–36. Behrens K, Maul K, Tekin N, Kriebitzsch N, Indenbirken D, Prassolov V, et al. RUNX1 cooperates with FLT3-ITD to induce leukemia. J Exp Med. 2017;214:737–52. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure1.pdf SupplementaryFigure2.pdf SupplementaryTable1.docx SupplementaryTable2.docx SupplementaryTable3.xlsx SupplementaryTable4.xlsx SupplementaryTable5.xls Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5733882","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":395818643,"identity":"4d241796-766d-40ab-87a8-3cb5e7716da7","order_by":0,"name":"Cosimo Cumbo","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Cosimo","middleName":"","lastName":"Cumbo","suffix":""},{"id":395818644,"identity":"58261ccf-ba1e-47d7-95ab-c598000bb07d","order_by":1,"name":"Francesco Tarantini","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Francesco","middleName":"","lastName":"Tarantini","suffix":""},{"id":395818645,"identity":"2780cb89-68c9-4574-a23a-99d4b7cffc5f","order_by":2,"name":"Elisa Parciante","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Elisa","middleName":"","lastName":"Parciante","suffix":""},{"id":395818646,"identity":"bd1526ac-674b-4637-b5b4-50fe3038d94b","order_by":3,"name":"Luisa Anelli","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Luisa","middleName":"","lastName":"Anelli","suffix":""},{"id":395818647,"identity":"b5f746f6-c90e-48cd-815c-569cdbc046ae","order_by":4,"name":"Antonella Zagaria","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Antonella","middleName":"","lastName":"Zagaria","suffix":""},{"id":395818648,"identity":"1cea13b8-3547-42fb-ad64-7fd640724db1","order_by":5,"name":"Giuseppina Biondi","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Giuseppina","middleName":"","lastName":"Biondi","suffix":""},{"id":395818649,"identity":"b5a6f0ef-01f4-4eed-aeda-6ed9ca5bbc03","order_by":6,"name":"Mariano Francesco Caratozzolo","email":"","orcid":"","institution":"National Research Council (CNR)","correspondingAuthor":false,"prefix":"","firstName":"Mariano","middleName":"Francesco","lastName":"Caratozzolo","suffix":""},{"id":395818650,"identity":"698487f0-a68d-499d-a35f-7b073a124f45","order_by":7,"name":"Paola Orsini","email":"","orcid":"","institution":"ASL Bari","correspondingAuthor":false,"prefix":"","firstName":"Paola","middleName":"","lastName":"Orsini","suffix":""},{"id":395818651,"identity":"5c62031a-7db3-4128-bb8a-0594e1515fe4","order_by":8,"name":"Nicoletta Coccaro","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Nicoletta","middleName":"","lastName":"Coccaro","suffix":""},{"id":395818652,"identity":"16e1eaff-473a-4a80-853a-99bcedd1e481","order_by":9,"name":"Giuseppina Tota","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Giuseppina","middleName":"","lastName":"Tota","suffix":""},{"id":395818653,"identity":"bbd752c1-c824-4bb2-af8d-b7b9aa5f6ef7","order_by":10,"name":"Immacolata Redavid","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Immacolata","middleName":"","lastName":"Redavid","suffix":""},{"id":395818654,"identity":"3915e245-dac1-4681-a0d2-76d3a2819cf9","order_by":11,"name":"Maria Rosa Conserva","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"Rosa","lastName":"Conserva","suffix":""},{"id":395818655,"identity":"8b53689a-eb99-42cd-a326-74336d9da9c4","order_by":12,"name":"Angela Minervini","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Angela","middleName":"","lastName":"Minervini","suffix":""},{"id":395818656,"identity":"92764ac0-8d48-45f3-a96b-f633f0944e1b","order_by":13,"name":"Crescenzio Francesco Minervini","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Crescenzio","middleName":"Francesco","lastName":"Minervini","suffix":""},{"id":395818657,"identity":"367300bb-c358-41dd-ba2d-916fe23226a5","order_by":14,"name":"Vito Pier Gagliardi","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Vito","middleName":"Pier","lastName":"Gagliardi","suffix":""},{"id":395818658,"identity":"2f6d4ac7-71e9-4234-a020-1d8f69acc7a1","order_by":15,"name":"Mario Delia","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Mario","middleName":"","lastName":"Delia","suffix":""},{"id":395818660,"identity":"8108dafd-348f-42c0-b73c-a9557635b1a7","order_by":16,"name":"Flaviana Marzano","email":"","orcid":"","institution":"National Research Council (CNR)","correspondingAuthor":false,"prefix":"","firstName":"Flaviana","middleName":"","lastName":"Marzano","suffix":""},{"id":395818663,"identity":"e5addd54-2fad-4318-8ead-70b68c60c32b","order_by":17,"name":"Claudia Telegrafo","email":"","orcid":"","institution":"National Research Council (CNR)","correspondingAuthor":false,"prefix":"","firstName":"Claudia","middleName":"","lastName":"Telegrafo","suffix":""},{"id":395818665,"identity":"1c2348ac-bcc6-4bd2-8995-57fce78d5ca8","order_by":18,"name":"Sharon Natasha Cox","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Sharon","middleName":"Natasha","lastName":"Cox","suffix":""},{"id":395818666,"identity":"e5978c60-c079-41d3-8c74-7ffff603caaa","order_by":19,"name":"Annalisa Natalicchio","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Annalisa","middleName":"","lastName":"Natalicchio","suffix":""},{"id":395818667,"identity":"04f4c95f-b632-43d7-88b3-317eeb3ec796","order_by":20,"name":"Bachir Balech","email":"","orcid":"","institution":"National Research Council (CNR)","correspondingAuthor":false,"prefix":"","firstName":"Bachir","middleName":"","lastName":"Balech","suffix":""},{"id":395818668,"identity":"b227ccbd-d008-4559-a55f-34ccfc539e9a","order_by":21,"name":"Apollonia Tullo","email":"","orcid":"","institution":"National Research Council (CNR)","correspondingAuthor":false,"prefix":"","firstName":"Apollonia","middleName":"","lastName":"Tullo","suffix":""},{"id":395818669,"identity":"149be58e-81db-4ca7-a4b6-6e4941f154ee","order_by":22,"name":"Mattia Gentile","email":"","orcid":"","institution":"ASL Bari","correspondingAuthor":false,"prefix":"","firstName":"Mattia","middleName":"","lastName":"Gentile","suffix":""},{"id":395818670,"identity":"b5fcfb1f-8971-4552-b435-9385682f6030","order_by":23,"name":"Francesco Giorgino","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Francesco","middleName":"","lastName":"Giorgino","suffix":""},{"id":395818671,"identity":"e363459c-b5c7-4016-b6ac-0fe1c0b9f833","order_by":24,"name":"Giorgina Specchia","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Giorgina","middleName":"","lastName":"Specchia","suffix":""},{"id":395818672,"identity":"15d9495d-a91f-46e6-8fa9-62741883fefb","order_by":25,"name":"Pellegrino Musto","email":"","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":false,"prefix":"","firstName":"Pellegrino","middleName":"","lastName":"Musto","suffix":""},{"id":395818673,"identity":"a109e223-c024-4b43-92b7-b2dc73846c00","order_by":26,"name":"Francesco Albano","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+0lEQVRIiWNgGAWjYBAC9gYEm/EwiOQHYhCDB5cWngNIHLAWyQaoFlx6MLUYAEWYGfBYwyN9+NmDHxV18vwMzA8OF9TckTO+kXsQyGCQscelhS/N3LDnzGHDmQ1sBodnHHtmbHYjLwHIwO0wex4GM2nGtgMJQPcYHOZhO5y47UYOiIHHLzzs36QZ/9UBtbB/OMzz73Di5hkgLf/waeEB2tLADNTCY3CYt+1w4gaJHBADr5YyyZ5jQL808xQcntl32FjizBsDIEOCByUwUR22TeJHDTDE2Ns3Pi74dliOvz3H+HPBNxt75FjGDphRuRKE1I+CUTAKRsEowAMAuwtUiSlvJJ0AAAAASUVORK5CYII=","orcid":"","institution":"University of Bari “Aldo Moro”","correspondingAuthor":true,"prefix":"","firstName":"Francesco","middleName":"","lastName":"Albano","suffix":""}],"badges":[],"createdAt":"2024-12-30 08:23:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5733882/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5733882/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":72754928,"identity":"4beea781-dd79-4c92-948f-7c066b3ca796","added_by":"auto","created_at":"2025-01-01 16:53:11","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":528265,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eSchematic representation of \u003cem\u003eRUNX1\u003c/em\u003e three main transcript isoforms (top) and their respective protein products (bottom). \u003cstrong\u003e(B) \u003c/strong\u003e\u003cem\u003eRUNX1 A\u003c/em\u003e, \u003cem\u003eB\u003c/em\u003e and \u003cem\u003eC\u003c/em\u003e relative quantification (as the fraction of total RUNX1 transcripts) in HC and AML samples. \u003cstrong\u003e(C) \u003c/strong\u003eComparison of \u003cem\u003eRUNX1 \u003c/em\u003eexpression between healthy controls and AML cases at disease onset (single isoforms and their sum are reported). \u003cstrong\u003e(D)\u003c/strong\u003e \u003cem\u003eRUNX1\u003c/em\u003eexpression according to patient PLTs number. \u003cstrong\u003e(E)\u003c/strong\u003e Representative immunoblot image of RUNX1A and beta-actin (top-left). As made explicit by the separating lines, the final image was obtained by splicing different sections of the same image (raw images are reported in Supplementary Figure 2). HC#4: commercial bone marrow mononuclear cells. Densitometric analysis of RUNX1A bands, expressed as relative optical density and normalized to beta-actin (bottom–left). Comparison between HC and AML RUNX1A protein levels (top–right). Simple linear regression between the \u003cem\u003eRUNX1A\u003c/em\u003e transcript and protein levels (bottom-right). \u003cstrong\u003e(F)\u003c/strong\u003e \u003cem\u003eRUNX1A \u003c/em\u003eexpression according to the latest WHO AML classes. The comparisons \u003cem\u003eBCR::ABL1\u003c/em\u003e vs HC and \u003cem\u003eCEBPA\u003c/em\u003evs HC were not performed, given the rarity of cases among those enrolled (n=2 and n=2, respectively). \u003cstrong\u003e(G-H) \u003c/strong\u003eRUNX1A transcript levels according to the FAB classes. \u003cstrong\u003e(C-H)\u003c/strong\u003e Boxplots representing the distribution. The boxes extend from the 25th to 75th percentiles. The line in the box represents the median value. The whiskers range from the smallest value to the largest. P1: distal promoter; P2: proximal promoter; RHD: runt-homology domain; TAD: transactivation domain; HC: healthy controls; AML: acute myeloid leukemia; PLT-: thrombocytopenic cases (\u0026lt;150.000 PLTs/ul); AML-MR: AML, myelodysplasia-related.\u003c/p\u003e","description":"","filename":"11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/b0fd435c4b9f323600a68394.jpg"},{"id":72754962,"identity":"9f308e65-ca8b-4357-9897-b218034661f3","added_by":"auto","created_at":"2025-01-01 16:53:13","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":688562,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003e\u003cem\u003eRUNX1A\u003c/em\u003e expression according to the patients’ mutational profile (from the highest to the lowest \u003cem\u003eRUNX1A\u003c/em\u003e level). \u003cstrong\u003e(B)\u003c/strong\u003e \u003cem\u003eRUNX1A\u003c/em\u003e transcript level in AML cases subdivided by \u003cem\u003eFLT3\u003c/em\u003e mutational status; \u003cstrong\u003e(C)\u003c/strong\u003e a detailed analysis of \u003cem\u003eFLT3\u003c/em\u003e-ITD patients is reported. \u003cstrong\u003e(D)\u003c/strong\u003e The expression of \u003cem\u003eRUNX1A\u003c/em\u003e in the AML cases subdivided into the three risk categories according to the ELN 2022 recommendations [33]. \u003cstrong\u003e(E)\u003c/strong\u003e \u003cem\u003eRUNX1A\u003c/em\u003e abundance as a proportion of total \u003cem\u003eRUNX1\u003c/em\u003e transcripts in patients categorized by main\u003cem\u003e RUNX1 \u003c/em\u003egene alterations. \u003cstrong\u003e(F) \u003c/strong\u003eThe\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003eRUNX1A\u003c/em\u003e/\u003cem\u003eRUNX1C\u003c/em\u003e ratio in AML cases stratified according to the mutational status of key epigenetic modifiers. \u003cstrong\u003e(G)\u003c/strong\u003e Hierarchical clustering of methylation values of CpG sites mapping to \u003cem\u003eRUNX1\u003c/em\u003e based on Illumina methylation annotation in the TF-1 cell line stably expressing wild-type DNMT3A (isoform 1) or AML-associated hotspot mutants (either R882C or R882H) alone or in combination with R676K [27]. CK: R882C/R676K; HK: R882H/R676K. †Probe names.\u003c/p\u003e","description":"","filename":"12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/332ced92750fb57244ced751.jpg"},{"id":72754925,"identity":"dc513e2b-b804-4a8c-af1a-633b063b4665","added_by":"auto","created_at":"2025-01-01 16:53:11","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":432559,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003e\u003cem\u003eRUNX1A\u003c/em\u003e kinetics from diagnosis to CR. \u003cstrong\u003e(B) \u003c/strong\u003e\u003cem\u003eRUNX1A\u003c/em\u003e expression during the disease course. \u003cstrong\u003e(C) \u003c/strong\u003eComparison of \u003cem\u003eRUNX1 \u003c/em\u003eexpression between healthy controls and AML cases at disease relapse (single isoforms and their sum are reported). \u003cstrong\u003e(D-G) \u003c/strong\u003e\u003cem\u003eRUNX1\u003c/em\u003e isoforms kinetics\u003cem\u003e \u003c/em\u003efrom diagnosis to disease relapse for each patient. \u003cstrong\u003e(H) \u003c/strong\u003e\u003cem\u003eRUNX1A\u003c/em\u003ekinetics from diagnosis to disease relapse, for four cases that were \u003cem\u003eFLT3\u003c/em\u003e-ITD negative at disease onset but \u003cem\u003eFLT3\u003c/em\u003e-ITD mutated at relapse. \u003cstrong\u003e(I) \u003c/strong\u003ePrincipal Component Analysis (PCA) showing the separation between the two groups of samples (high and normal/low \u003cem\u003eRUNX1A \u003c/em\u003eexpression) and highlighting the homogeneity of samples within each group. \u003cstrong\u003e(L) \u003c/strong\u003eTop ten deregulated canonical pathways identified from IPA analysis.\u003cstrong\u003e (M) \u003c/strong\u003eVolcano plot visualizing differentially expressed protein-coding genes (with p-value \u0026lt;0.05) between the two groups of patients (high and normal/low \u003cem\u003eRUNX1A\u003c/em\u003eexpression). Upregulated (Log2FC \u0026gt; 1.5) and downregulated (Log2FC \u0026lt; -1.5) genes are marked in red and green, respectively. The top five deregulated protein-coding genes are reported in the table (top–right).\u003c/p\u003e","description":"","filename":"13.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/7c9d2231d59e5ba4fdfa97b4.jpg"},{"id":72754936,"identity":"6d566dde-ad6e-4e22-aacd-8d02723706d2","added_by":"auto","created_at":"2025-01-01 16:53:12","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1602209,"visible":true,"origin":"","legend":"\u003cp\u003eIllustration of a possible molecular connection between \u003cem\u003eFLT3\u003c/em\u003e-ITD and \u003cem\u003eRUNX1A \u003c/em\u003eoverexpression, based on recent literature data [35,46]. CR: complete remission; HC: healthy controls; AML: acute myeloid leukemia; DHS: DNase I hypersensitive site.\u003c/p\u003e","description":"","filename":"14.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/78743a4732ca56476d5e70b1.jpg"},{"id":72756273,"identity":"92fb75e0-5647-4c9c-a8f3-d80054ef6b65","added_by":"auto","created_at":"2025-01-01 17:09:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4179495,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/ff3c773f-86a2-4923-a273-8117709b624a.pdf"},{"id":72754930,"identity":"4a90a971-3afd-48f3-b38c-e5cc1e900bc8","added_by":"auto","created_at":"2025-01-01 16:53:11","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":119730,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/b221410d06a7ef2001eccdae.pdf"},{"id":72754939,"identity":"1c524390-6d6d-45a6-b11b-b51cc714667a","added_by":"auto","created_at":"2025-01-01 16:53:12","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":95826,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/ed4d19318405060009d3c1a4.pdf"},{"id":72754922,"identity":"c0027881-2712-454b-a4ad-ccf2ac7d2948","added_by":"auto","created_at":"2025-01-01 16:53:11","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":15756,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/c1bbb2a2d8a36eb2dc59a167.docx"},{"id":72754904,"identity":"874d23da-b36f-4459-a5a5-3512379e96ce","added_by":"auto","created_at":"2025-01-01 16:53:09","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":18072,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable2.docx","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/d9327c0f989aa50c92a45586.docx"},{"id":72754935,"identity":"cb720c22-b050-4e09-a133-e3b4e3cd7bcf","added_by":"auto","created_at":"2025-01-01 16:53:12","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":1170912,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/4bccd2557c15a0d9fc6e9927.xlsx"},{"id":72754923,"identity":"cc261968-007d-41e4-bc9e-1fa77b904633","added_by":"auto","created_at":"2025-01-01 16:53:11","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":414595,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/dacfa79ea3a7996496d5274b.xlsx"},{"id":72754903,"identity":"5dc28e01-7d58-47f2-a492-14e45f250a5b","added_by":"auto","created_at":"2025-01-01 16:53:09","extension":"xls","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":189440,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable5.xls","url":"https://assets-eu.researchsquare.com/files/rs-5733882/v1/c269a5148071592713bb07e2.xls"}],"financialInterests":"No competing interests reported.","formattedTitle":"RUNX1A isoform is overexpressed in acute myeloid leukemia and is associated with FLT3 internal tandem duplications","fulltext":[{"header":"1. Background","content":"\u003cp\u003eRUNX1 is a transcription factor that plays the role of a \u0026ldquo;master regulator of hematopoiesis\u0026rdquo; through the antagonistic action of its three major protein isoforms, named RUNX1A, B and C [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In adult hematopoiesis, RUNX1B/C (453 and 480 amino acids respectively, lacking exon 7a and including exons 7b and 8) are the predominantly expressed isoforms. They are transcribed from two alternative promoters and differ by 27 amino acids at their N-terminus. RUNX1A (250 amino acids, including exon 7a, which has a stop codon) accounts for only a minor fraction of the isoform pool. It is a C-terminally truncated isoform generated by alternative splicing (Fig.\u0026nbsp;1A) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. RUNX1A shows enhanced DNA binding [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], specific cofactors [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] and divergent effects on target gene transcription [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] as compared to RUNX1B/C.\u003c/p\u003e \u003cp\u003eRUNX1A enhances self-renewal activity and hematopoietic stem cell (HSC) expansion ex vivo and in vivo [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]; furthermore, it suppresses myeloid differentiation [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In contrast, RUNX1B/C overexpression induces HSCs quiescence [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] and promotes differentiation [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] in murine models. For these reasons, \u003cem\u003eRUNX1A\u003c/em\u003e overexpression can be leukemogenic, as suggested by pilot observations in acute leukemia [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], and additional studies have shown the pathogenicity of \u003cem\u003eRUNX1A\u003c/em\u003e in other blood diseases [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGiven the pivotal role of the \u003cem\u003eRUNX1\u003c/em\u003e gene in acute myeloid leukemia (AML), we evaluated the expression of its isoforms in our series, aiming to elucidate the role of \u003cem\u003eRUNX1A\u003c/em\u003e in the AML pathogenesis, its possible associations with different disease subtypes, and its influence during the disease course.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Patients\u003c/h2\u003e \u003cp\u003eIn total, 181 bone marrow (BM) samples were included in the study, from patients observed retrospectively over a period of time ranging from 2014 to 2023: 138 newly diagnosed AML patients, 21 relapsed AML cases, 11 cases in complete remission (CR, evaluated by molecular disease monitoring - see paragraph 2.6) and 10 healthy control (HC) donors, along with a pool of 56 HC samples (Human Bone Marrow Total RNA-Clontech Laboratories, Inc., Mountainview, CA, USA). The main patients clinical data are reported in Supplementary Table\u0026nbsp;1. The local Ethics Committee approved the study. Informed consent was obtained from all patients before study inclusion, in accordance with the Declaration of Helsinki. Patients' records/information were anonymized and de-identified before analysis.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2.2. RUNX1 isoforms absolute quantification\u003c/h3\u003e\n\u003cp\u003eMononuclear cells were isolated from BM samples by Ficoll separation, and total RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany); the RNA concentration and purity were checked using the Qubit 2.0 fluorometer and NanoDrop UV-Vis spectrometer (Thermo Fisher Scientific, Waltham, MA). One \u0026micro;g of total RNA was reverse transcribed into complementary DNA (cDNA) using the QuantiTect reverse transcription kit (Qiagen).\u003c/p\u003e \u003cp\u003e \u003cem\u003eRUNX1A/B/C\u003c/em\u003e isoforms were quantified by three assays according to the droplet digital PCR (ddPCR) Gene Expression EvaGreen Assays Protocol (BioRad, Hercules, CA). For \u003cem\u003eRUNX1A\u003c/em\u003e (NM_001122607) and \u003cem\u003eRUNX1C\u003c/em\u003e (NM_001754) two distinct pairs of specific primers were used (RUNX1A_F: AACCCTCGTGCCTCCCTGAA and RUNX1A_R: AGCTCTATCCTGGCTGGGGA; RUNX1C_F: GGCTTCAGACAGCATATTTGAG and RUNX1C_R: AACGCCTCGCTCATCTTG). For the \u003cem\u003eRUNX1B\u003c/em\u003e transcript isoform (NM_001001890), a primer pair quantifying \u003cem\u003eRUNX1A\u0026thinsp;+\u0026thinsp;B\u003c/em\u003e was used (RUNX1A\u0026thinsp;+\u0026thinsp;B_F: CCGTCTGGTAGGAGCTGTTT and RUNX1B_R: AACGCCTCGCTCATCTTG) because no unique exon-usage exists unlike for the other isoforms. Therefore, to perform the absolute quantification of \u003cem\u003eRUNX1B\u003c/em\u003e, the \u003cem\u003eRUNX1A\u003c/em\u003e quantification was subtracted from the \u003cem\u003eRUNX1A\u0026thinsp;+\u0026thinsp;B\u003c/em\u003e quantification. All assays were performed as already reported [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The target quantification was calculated as the ratio between each \u003cem\u003eRUNX1\u003c/em\u003e isoform and the number of copies of \u003cem\u003eGUSB\u003c/em\u003e (R/G); \u003cem\u003eRUNX1\u003c/em\u003e gene expression (RUNX1all) was calculated as the sum of its three isoforms.\u003c/p\u003e\n\u003ch3\u003e2.3. RUNX1A protein quantification\u003c/h3\u003e\n\u003cp\u003eMononuclear cells isolated from BM samples by Ficoll separation or purchased from StemCell\u0026trade; Technologies (Cologne, Germany) were mechanically lysed using the homogenizer T10 basic Ultra-Turrax1 (IKA, Staufen, Germany) in RIPA buffer (Thermo Fisher Scientific), supplemented with cOmplete\u0026trade; Protease Inhibitor Cocktail and PhosSTOP\u0026trade; phosphatase inhibitor (Roche, Basel, Switzerland) to extract total proteins. The lysates were centrifuged at 13,000 x g at 4\u0026deg;C for 10 minutes to remove debris, and total protein levels were quantified using the BioRad Protein Assay. Equal amounts of protein were mixed with Laemmli sample buffer, resolved by SDS-PAGE and blotted on nitrocellulose membranes using a Trans-Blot Turbo Transfer System (BioRad). Membranes were blocked with the EveryBlot Blocking Buffer (BioRad), incubated with primary antibodies (anti-RUNX1 antibody ab240639, Abcam, MA, USA; anti-beta-actin antibody C4, sc-47778, Santa Cruz Biotechnology, Inc., TX, USA; 1:1000 dilution) overnight at 4\u0026deg;C, and washed with 1X TBS-Tween 0.1%. After incubation with a horseradish-peroxidase-conjugated secondary antibody (1:3000 dilution, BioRad) for 1 h at room temperature, Clarity Western ECL Substrate (BioRad) was used for protein visualization with a ChemiDoc Imaging System (Bio-Rad). The signal intensity of the protein bands was measured using Image Lab Software (BioRad). The target quantification was calculated as the ratio between RUNX1A and beta-actin (R/B). AML samples were compared with those from HC donors and with commercial human bone marrow mononuclear cells (BMMCs) StemCell\u0026trade; Technologies (Cologne, Germany).\u003c/p\u003e\n\u003ch3\u003e2.4. Targeted next-generation sequencing (NGS)\u003c/h3\u003e\n\u003cp\u003eNGS analysis was performed on genomic DNA extracted from BM samples at diagnosis using an AmpliSeq customized panel (Thermo Fisher Scientific) encompassing the full coding regions or specific exons of 26 target genes involved in the pathogenesis of myeloid malignancies (\u003cem\u003eANKRD26, ASXL1, CALR, CBL, CEBPA, DDX41, DNMT3A, ETV6, EZH2, FLT3, GATA2, IDH1, IDH2, JAK2, KIT, KRAS, MPL, NPM1, NRAS, RUNX1, SF3B1, SRSF2, TET2, TP53, U2AF1, ZRSR2\u003c/em\u003e), as previously reported [\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Torrent Suite Software (Thermo Fisher) was used for quality control, alignment to the human genome (hg19) and variant calling, using the somatic workflow for single samples and the default parameters. Variants were annotated with Ion Reporter Software (Thermo Fisher). Variants located in intronic regions, synonymous or those present with \u0026gt;\u0026thinsp;1% global minor allele frequency in the normal population were filtered out. Selected variants were investigated for a potential pathogenic role using the SIFT and PolyPhen scores and the Catalogue of Somatic Mutations in Cancer database [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003e2.5. FLT3 mutational analysis\u003c/h3\u003e\n\u003cp\u003e \u003cem\u003eFLT3\u003c/em\u003e internal tandem duplication (ITD) and D835/I836 variants were investigated on BM samples at disease onset and relapse, as reported [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The \u003cem\u003eFLT3\u003c/em\u003e ITD burden was reported as an allelic ratio (AR). Cases carrying an AR\u0026thinsp;\u0026lt;\u0026thinsp;0.5 were defined as ITD-low, and patients with an AR\u0026thinsp;\u0026ge;\u0026thinsp;0.5 as ITD-high, according to the 2017 ELN recommendations [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. ITD cases were also distinguished between single ITD (single duplication) and multiple ITD (\u0026ge;\u0026thinsp;2 different duplications), as reported [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. According to the duplication length, patients were divided into ITD short and ITD long, using as cut-off value the median ITD length observed in our cohort (50bps), as previously suggested [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Other tyrosine kinase domain (TKD) variants were identified by NGS analysis (see paragraph 2.4.).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Molecular monitoring of measurable residual disease\u003c/h2\u003e \u003cp\u003eFor AML cases carrying one of the following molecular markers: \u003cem\u003eNPM1\u003c/em\u003e, \u003cem\u003ePML::RARA\u003c/em\u003e, \u003cem\u003eRUNX1::RUNX1T1\u003c/em\u003e, \u003cem\u003eCBFB::MYH11\u003c/em\u003e, molecular monitoring was performed by RQ-PCR using the following kits (Ipsogen): NPM1 mutA MutaQuant Kit, PML-RARA bcr1/bcr3 Kit, RUNX1-RUNX1T1 Kit, CBFB-MYH11 A Kit.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2.7. Gene expression profiling\u003c/h3\u003e\n\u003cp\u003eGene expression profiling was performed by RNA-Seq.\u0026nbsp;Twelve patients were sequenced using the massive sequencing Illumina NovaSeq6000 platform: seven cases with \u0026ldquo;high\u0026rdquo; \u003cem\u003eRUNX1A\u003c/em\u003e expression [fold change (FC)\u0026thinsp;\u0026ge;\u0026thinsp;5] and five cases expressing \u0026ldquo;normal/low\u0026rdquo; levels (FC\u0026thinsp;\u0026le;\u0026thinsp;3). In brief, paired-end reads obtained in FASTQ format were quality checked using FastQC version 0.12.1. and the analysis results were summarized in a single HTML report using MultiQC [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Reads were trimmed using the Trimmomatic tool version 0.32 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] to remove sequences and adapters and then mapped against the Homo sapiens reference genome (GRCh.38: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ftp.ensembl.org/pub/release-109/fasta/homo_sapiens/dna/\u003c/span\u003e\u003cspan address=\"https://ftp.ensembl.org/pub/release-109/fasta/homo_sapiens/dna/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) using the STAR aligner [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eReads mapped to each gene were summarized based on the genome annotation (version 109) from the ESEMBL database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ftp.ensembl.org/pub/release-109/gtf/homo_sapiens/Homo_sapiens.GRCh38.109.gtf.gz\u003c/span\u003e\u003cspan address=\"https://ftp.ensembl.org/pub/release-109/gtf/homo_sapiens/Homo_sapiens.GRCh38.109.gtf.gz\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) using the FeatureCounts algorithm [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Principal Component Analysis (PCA) was performed using the DESeq2 R package by means of regularized log transformation (rld) of read counts to illustrate the overall distance between \u0026ldquo;high\u0026rdquo; and \u0026ldquo;normal/low\u0026rdquo; \u003cem\u003eRUNX1A\u003c/em\u003e expression groups.\u003c/p\u003e \u003cp\u003e \u003cem\u003eRUNX1A\u003c/em\u003e reads for each sample were calculated using the TMM (Trimmed Mean of M-values), while DESeq2 was used to detect differentially expressed genes (DEGs) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. DEGs were selected by filtering them for Log2FC\u0026thinsp;\u0026gt;\u0026thinsp;1.5 and \u0026lt; -1.5, and adjusted (adj) p value\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Data were visualized on a volcano plot.\u003c/p\u003e \u003cp\u003eGene names and gene ontology annotations (BP: Biological Process, CC: Cellular Component, MF: Molecular Function) of DEGs were retrieved from the Human Genome Annotation Resource (available via the org.Hs.eg.db R package) in combination with the AnnotationHub and AnnotationDbi R packages, and analyzed using the Database for Annotation, Visualization and Integrated Discovery (DAVID) v2024q2 (July 2024) [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. DEGs were analyzed in QIAGEN Ingenuity Pathways Analysis (IPA) software (QIAGEN, Hilden, Germany) to categorize differentially expressed transcripts and identify significantly regulated functional pathways. The list of DEGs was used as a query in IPA. The \u0026lsquo;core analysis\u0026rsquo; function was run to identify canonical pathways [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003e2.8. Methylation analysis\u003c/h3\u003e\n\u003cp\u003eTo investigate the possible role of epigenetic regulation in \u003cem\u003eRUNX1\u003c/em\u003e expression, genome-wide methylation data from the TF-1 cell line stably expressing \u003cem\u003eDNMT3A\u003c/em\u003e isoform 1 were used to evaluate the methylation status of CpG sites mapped to the \u003cem\u003eRUNX1\u003c/em\u003e gene according to the \u003cem\u003eDNMT3A\u003c/em\u003e mutation status. Specifically, methylation data from the TF-1 cell line stably expressing \u003cem\u003eDNMT3A\u003c/em\u003e wild-type (WT) or AML-associated mutant hotspots at Arg822 (R882) [specifically R882C or R882H, which induce macro-oligomer formation, alone or in combination with R676K, a macro-oligomerization-reducing mutation (GEO Datasets ID: GSE226062)] were analyzed [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Data analysis of the IDAT raw methylation files from the Illumina Methylation EPIC BeadChip microarrays was performed using a dedicated R Bioconductor workflow that incorporated several packages for the analysis of methylation array data (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.bioconductor.org/packages/devel/workflows/vignettes/methylationArrayAnalysis/inst/doc/methylationArrayAnalysis.html\u003c/span\u003e\u003cspan address=\"https://www.bioconductor.org/packages/devel/workflows/vignettes/methylationArrayAnalysis/inst/doc/methylationArrayAnalysis.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The IlluminaHumanMethylationEPICanno.ilm10b4.hg19 R package was used for the annotation of Illumina EPIC methylation arrays. Unsupervised hierarchical clustering of CpG sites mapping to the \u003cem\u003eRUNX1\u003c/em\u003e gene was performed to assess their correlation according to the methylation status in the aforementioned cell lines.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Statistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were carried out using GraphPad Prism version 8.3.0 (GraphPad Software Inc., San Diego, CA, USA). Continuous variables were presented as median (minimum-maximum). The Shapiro-Wilk test was performed to check for the normal distribution of continuous variables. The differences in the distribution of continuous variables between categories were compared using either paired or unpaired t-test (for variables passing the normality test) or Mann\u0026ndash;Whitney and Wilcoxon matched pairs tests (for variables not passing the normality test). One-way ANOVA and Kruskal-Wallis tests were used to compare the distributions of more than two groups of continuous variables. Multiple linear regression analysis was performed to test the influence of gene mutations (independent variables) on \u003cem\u003eRUNX1A\u003c/em\u003e levels (dependent variable). Spearman's rank-order correlation test was conducted to determine the relationship between the RUNX1A transcript and protein levels. Simple linear regression analysis was performed to predict RUNX1A protein levels from transcript levels. Spearman's rank-order correlation test was also performed to study the relationship between ddPCR and RNA-Seq \u003cem\u003eRUNX1A\u003c/em\u003e quantifications. A p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e "},{"header":"3. Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003cp\u003e \u003cb\u003e3.1. RUNX1A and RUNX1B isoforms are overexpressed in newly diagnosed AML, with higher levels in thrombocytopenic cases.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAs observed in the normal hematopoietic system [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], among AML patients, considering median values, \u003cem\u003eRUNX1B/C\u003c/em\u003e were confirmed as the dominantly expressed isoforms: 73% and 25% of the total \u003cem\u003eRUNX1\u003c/em\u003e transcripts, respectively, whereas \u003cem\u003eRUNX1A\u003c/em\u003e accounted for 2% of the isoforms pool (Fig.\u0026nbsp;1B). When we examined the absolute quantification of each isoform, comparing AML cases (n\u0026thinsp;=\u0026thinsp;138) with HC (n\u0026thinsp;=\u0026thinsp;11), we confirmed \u003cem\u003eRUNX1\u003c/em\u003e overexpression in AML (1.209 vs 0.747 R/G; p\u0026thinsp;=\u0026thinsp;0.028), as already known [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Moreover, we observed overexpression of \u003cem\u003eRUNX1A\u003c/em\u003e (0.027 vs 0.003 R/G; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and \u003cem\u003eRUNX1B\u003c/em\u003e (0.827 vs 0.433 R/G; p\u0026thinsp;=\u0026thinsp;0.006), whereas no difference was observed for \u003cem\u003eRUNX1C\u003c/em\u003e (Fig.\u0026nbsp;1C).\u003c/p\u003e \u003cp\u003eInterestingly, when comparing \u003cem\u003eRUNX1\u003c/em\u003e isoforms expression with the patients\u0026rsquo; main clinical and biological data (Supplementary Table\u0026nbsp;1), thrombocytopenic cases (n\u0026thinsp;=\u0026thinsp;93, \u0026lt;\u0026thinsp;150,000 PLTs/ul) exhibited higher levels of the \u003cem\u003eRUNX1A\u003c/em\u003e and \u003cem\u003eRUNX1B\u003c/em\u003e isoforms compared to AMLs with normal PLTs levels (n\u0026thinsp;=\u0026thinsp;23) (0.030 vs 0.014 R/G; p\u0026thinsp;=\u0026thinsp;0.002 and 0.876 vs 0.517 R/G; p\u0026thinsp;=\u0026thinsp;0.007 respectively), confirming the previously established involvement of the \u003cem\u003eRUNX1\u003c/em\u003e gene in megakaryocytopoiesis (Fig.\u0026nbsp;1D) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. No other associations emerged from the comparisons.\u003c/p\u003e \u003cp\u003eGiven the known leukemogenic role of \u003cem\u003eRUNX1A\u003c/em\u003e and its more pronounced overexpression compared to the other \u003cem\u003eRUNX1\u003c/em\u003e isoforms (⁓10-fold increase between AML and HC median levels \u0026ndash; Fig.\u0026nbsp;1C), we decided to focus on \u003cem\u003eRUNX1A\u003c/em\u003e expression and its possible association with AML pathogenesis.\u003c/p\u003e \u003cp\u003eFirstly, we verified the RUNX1A overexpression at the protein level by immunoblot analysis (Fig.\u0026nbsp;1E). Increased RUNX1A protein levels were observed in AML patients compared to HC (2.018 vs 0.082 R/B, p\u0026thinsp;=\u0026thinsp;0.0005), and a positive correlation was found between the RUNX1A transcript and protein levels (r\u003csub\u003es\u003c/sub\u003e=0.805, p\u0026thinsp;=\u0026thinsp;0.025) (Fig.\u0026nbsp;1E). Using simple linear regression analysis to predict protein levels from transcript levels, a significant regression equation was identified [\u003cem\u003eF\u003c/em\u003e(1,6)\u0026thinsp;=\u0026thinsp;53.55, p\u0026thinsp;=\u0026thinsp;0.0003] with R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.899. Therefore, RUNX1A protein and transcript quantities are correlated and as expected, the former depends on the latter.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2. RUNX1A overexpression is independent of patient classification but related to the disease phenotype.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe increased \u003cem\u003eRUNX1A\u003c/em\u003e expression (in AMLs vs HC) was confirmed even when our AML cases were classified according to the latest edition of the WHO classification [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Considering the \u003cem\u003eRUNX1A\u003c/em\u003e median value for each AML class (\u003cem\u003ePML::RARA\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;12; \u003cem\u003eRUNX1::RUNX1T1\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;8; \u003cem\u003eCBFB::MYH11\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;8; \u003cem\u003eNPM1\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;22; AML-MR, n\u0026thinsp;=\u0026thinsp;46), the difference compared to HC remained statistically significant (Fig.\u0026nbsp;1F), whereas no changes were observed when comparing disease classes (p\u0026thinsp;=\u0026thinsp;0.371). These observations suggested a possible \u003cem\u003eRUNX1A\u003c/em\u003e involvement in AML pathogenesis independent of patient classification. The comparisons \u003cem\u003eBCR::ABL1\u003c/em\u003e vs HC and \u003cem\u003eCEBPA\u003c/em\u003e vs HC were not performed, given the rarity of these cases among those enrolled (n\u0026thinsp;=\u0026thinsp;2 and n\u0026thinsp;=\u0026thinsp;2, respectively).\u003c/p\u003e \u003cp\u003eBecause preliminary data on acute leukemia indicated higher expression levels of \u003cem\u003eRUNX1A\u003c/em\u003e in acute lymphoblastic leukemia and in AML-M2 patients [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], we classified our cases according to the older FAB classification [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], eliciting a significant difference for all morphological subtypes (M0, n\u0026thinsp;=\u0026thinsp;11; M1, n\u0026thinsp;=\u0026thinsp;14; M2, n\u0026thinsp;=\u0026thinsp;30; M3, n\u0026thinsp;=\u0026thinsp;12; M4, n\u0026thinsp;=\u0026thinsp;26; M5, n\u0026thinsp;=\u0026thinsp;9; M6, n\u0026thinsp;=\u0026thinsp;8; M7, n\u0026thinsp;=\u0026thinsp;3) compared to HC (Fig.\u0026nbsp;1G). Interestingly, the comparison between classes highlighted significant differences (Fig.\u0026nbsp;1H). In particular, the \u003cem\u003eRUNX1A\u003c/em\u003e levels were higher in AML patients with a more immature phenotype and characterized by impaired granulocytic differentiation (M0-M3) as compared to cases showing a monocytic morphology (M4-M5), in line with the known \u003cem\u003eRUNX1A\u003c/em\u003e ability to suppress myeloid differentiation, enhancing the self-renewal HSCs capacity [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In this context, M6 and M7 classes appeared to follow other pathways, which we cannot address given the rarity of cases among those enrolled.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.3. FLT3-ITD mutated patients show the highest median levels of the RUNX1A isoform.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThen, we subdivided our patients according to their mutational profile. Overall, \u003cem\u003eFLT3\u003c/em\u003e-ITD positive cases (n\u0026thinsp;=\u0026thinsp;23) presented the highest median \u003cem\u003eRUNX1A\u003c/em\u003e levels at the disease onset (0.071 R/G), as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eA. A strong relationship between the \u003cem\u003eFLT3\u003c/em\u003e-ITD mutations and \u003cem\u003eRUNX1A\u003c/em\u003e transcript levels was confirmed by multiple linear regression analysis. Specifically, between all gene mutations detected in our cohort (\u003cem\u003eTP53\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;7; \u003cem\u003eNPM1\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;22; \u003cem\u003eCEBPA\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;2; \u003cem\u003eRUNX1\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;11; \u003cem\u003eFLT3\u003c/em\u003e-ITD, n\u0026thinsp;=\u0026thinsp;23; \u003cem\u003eFLT3\u003c/em\u003e-TKD, n\u0026thinsp;=\u0026thinsp;10; \u003cem\u003eDNMT3A\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;8; \u003cem\u003eTET2\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;17; \u003cem\u003eIDH2\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;8; \u003cem\u003eEZH2\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;3; \u003cem\u003eASXL1\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;16; \u003cem\u003eSRSF2\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;6; \u003cem\u003eSF3B1\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;3; \u003cem\u003eU2AF1\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;5; \u003cem\u003eETV6\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;3; \u003cem\u003eCBL\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;3; \u003cem\u003eNRAS\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;15; \u003cem\u003eGATA2\u003c/em\u003e, n\u0026thinsp;=\u0026thinsp;3), the presence of \u003cem\u003eFLT3\u003c/em\u003e-ITD was the only variable able to influence the \u003cem\u003eRUNX1A\u003c/em\u003e levels (p\u0026thinsp;=\u0026thinsp;0.0005; Supplementary Table\u0026nbsp;2). On this basis, we explored the possible connection between \u003cem\u003eFLT3\u003c/em\u003e mutational status and \u003cem\u003eRUNX1A\u003c/em\u003e expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). A significant difference was observed between \u003cem\u003eFLT3\u003c/em\u003e-mutated (n\u0026thinsp;=\u0026thinsp;33) and \u003cem\u003eFLT3\u003c/em\u003e-wt AML (n\u0026thinsp;=\u0026thinsp;82) (0.048 vs 0.020 R/G, p\u0026thinsp;=\u0026thinsp;0.019), but this difference became more evident when we compared \u003cem\u003eFLT3\u003c/em\u003e-ITD (n\u0026thinsp;=\u0026thinsp;23) with \u003cem\u003eFLT3\u003c/em\u003e-wt (n\u0026thinsp;=\u0026thinsp;82) cases (0.071 vs 0.020 R/G, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). While \u003cem\u003eFLT3\u003c/em\u003e-ITD AML exhibited higher \u003cem\u003eRUNX1A\u003c/em\u003e levels than \u003cem\u003eFLT3\u003c/em\u003e-wt cases, \u003cem\u003eFLT3\u003c/em\u003e-TKD patients (n\u0026thinsp;=\u0026thinsp;10) had lower \u003cem\u003eRUNX1A\u003c/em\u003e levels than \u003cem\u003eFLT3\u003c/em\u003e-wt ones (0.006 vs 0.020 R/G, p\u0026thinsp;=\u0026thinsp;0.025). Again, this observation supports the connection between the ITD mutation and \u003cem\u003eRUNX1A\u003c/em\u003e expression. Focusing on this aspect, we found that neither the ITD allelic ratio (low vs high) nor the ITD number (single vs multiple) seemed to influence \u003cem\u003eRUNX1A\u003c/em\u003e transcript levels. However, \u003cem\u003eRUNX1A\u003c/em\u003e overexpression was higher in long ITD cases (n\u0026thinsp;=\u0026thinsp;11, characterized by more \u003cem\u003eFLT3\u003c/em\u003e auto-phosphorylation and poorer survival outcomes [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]) compared to short ITD ones (n\u0026thinsp;=\u0026thinsp;8) (0.131 vs 0.037 R/G, p\u0026thinsp;=\u0026thinsp;0.02) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The association between \u003cem\u003eFLT3\u003c/em\u003e-ITD and \u003cem\u003eRUNX1A\u003c/em\u003e overexpression indirectly influenced the median levels of the isoform in the three risk categories according to the ELN 2022 recommendations [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. AML patients in the intermediate category (where all \u003cem\u003eFLT3\u003c/em\u003e-ITD but not \u003cem\u003eFLT3\u003c/em\u003e-TKD are included) showed higher \u003cem\u003eRUNX1A\u003c/em\u003e levels than those in the favorable and adverse categories (0.070 vs 0.024 R/G, p\u0026thinsp;=\u0026thinsp;0.003 and 0.070 vs 0.015 R/G, p\u0026thinsp;=\u0026thinsp;0.0004 respectively), whereas no differences were observed between the latter two categories (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Finally, the close relationship between \u003cem\u003eFLT3\u003c/em\u003e-ITD and \u003cem\u003eRUNX1A\u003c/em\u003e expression was observed again at disease relapse (DR), but this aspect will be discussed later.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.4. DNMT3A-mutated AMLs present higher RUNX1A levels than DNMT3A-wt cases.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAlthough there is a clear association between \u003cem\u003eRUNX1A\u003c/em\u003e overexpression and the \u003cem\u003eFLT3\u003c/em\u003e-ITD mutation, we considered other possible genetic mechanisms influencing \u003cem\u003eRUNX1A\u003c/em\u003e levels in AML, namely \u003cem\u003eRUNX1\u003c/em\u003e gene alterations (SNVs and INDELs, \u003cem\u003eRUNX1::RUNX1T1\u003c/em\u003e and trisomy 21), spliceosome mutations (\u003cem\u003eSRSF2\u003c/em\u003e, \u003cem\u003eSF3B1\u003c/em\u003e and \u003cem\u003eU2AF1\u003c/em\u003e variants) and epigenetic modifiers mutations (\u003cem\u003eDNMT3A\u003c/em\u003e, \u003cem\u003eTET2\u003c/em\u003e, \u003cem\u003eIDH2\u003c/em\u003e, \u003cem\u003eEZH2\u003c/em\u003e, \u003cem\u003eASXL1\u003c/em\u003e).\u003c/p\u003e \u003cp\u003eNone of the explored \u003cem\u003eRUNX1\u003c/em\u003e gene alterations appeared to be associated with isoform A overexpression, including trisomy 21 (as somatic event), unlike what has been described in Down Syndrome \u0026ndash; associated myeloid leukemia (ML-DS) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] (Supplementary Fig.\u0026nbsp;1A). Conversely, lower \u003cem\u003eRUNX1A\u003c/em\u003e/RUNX1all levels were observed in \u003cem\u003eRUNX1\u003c/em\u003e-mutated cases (n\u0026thinsp;=\u0026thinsp;11) compared to wild type ones (n\u0026thinsp;=\u0026thinsp;43)(0.010 vs 0.018 R/G, p\u0026thinsp;=\u0026thinsp;0.015), suggesting a mutually exclusive relationship between gene mutations (loss of function and/or altered function [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]) and the expression of the leukemogenic isoform A (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eAlthough \u003cem\u003eRUNX1A\u003c/em\u003e is generated by alternative splicing [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], no differences in \u003cem\u003eRUNX1A\u003c/em\u003e levels were observed in AML patients carrying spliceosome mutations compared to wild type cases, neither considering its absolute quantification nor the ratio between the two splicing isoforms \u003cem\u003eRUNX1A\u003c/em\u003e and \u003cem\u003eRUNX1B\u003c/em\u003e (Supplementary Fig.\u0026nbsp;1B/C).\u003c/p\u003e \u003cp\u003eLast but not least, we investigated the possible role of epigenetic modifiers mutations on the \u003cem\u003eRUNX1\u003c/em\u003e isoforms disequilibrium, focusing on the ratio between \u003cem\u003eRUNX1A\u003c/em\u003e and \u003cem\u003eRUNX1C\u003c/em\u003e transcribed from the P2 and P1 promoters, respectively. Interestingly, \u003cem\u003eDNMT3A\u003c/em\u003e-mutated AMLs (n\u0026thinsp;=\u0026thinsp;8) presented a higher \u003cem\u003eRUNX1A\u003c/em\u003e/\u003cem\u003eRUNX1C\u003c/em\u003e ratio than \u003cem\u003eDNMT3A\u003c/em\u003e-wt cases (n\u0026thinsp;=\u0026thinsp;46)(0.304 vs 0.045 R/G, p\u0026thinsp;=\u0026thinsp;0.0029), suggesting a possible different methylation activity of \u003cem\u003eDNMT3A\u003c/em\u003e on the two promoters (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). The difference remained significant when considering \u003cem\u003eRUNX1A\u003c/em\u003e absolute levels (see Supplementary Fig.\u0026nbsp;1D) so we decided to study the relationship between \u003cem\u003eDNMT3A\u003c/em\u003e mutational status and the methylation profile of \u003cem\u003eRUNX1\u003c/em\u003e gene. Recently, TF-1 cell line was engineered to stably expressed \u003cem\u003eDNMT3A\u003c/em\u003e (isoform 1), including WT and AML-associated hotspot mutants (either R882C or R882H) alone or in combination with R676K, an additional macro-oligomerization-decreasing mutation: R882C/R676K (DNMT3A_CK) and R882H/R676K (DNMT3A_HK) [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Comparing their methylation profile, a global hypomethylation of \u003cem\u003eRUNX1\u003c/em\u003e CpG sites was observed in all \u003cem\u003eDNMT3A\u003c/em\u003e mutated TF-1 cells compared to \u003cem\u003eDNMT3A\u003c/em\u003e_WT cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Differential methylation analysis between WT and all \u003cem\u003eDNMT3A\u003c/em\u003e mutant cell lines revealed statistically significant hypomethylation of almost all CpG sites of \u003cem\u003eRUNX1\u003c/em\u003e, regardless of the genomic location of the CpG site (data not shown).\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.5. RUNX1A overexpression is disease-related and reappears at relapse, with no clear kinetics, except in FLT3-ITD cases.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWith the aim of studying \u003cem\u003eRUNX1A\u003c/em\u003e kinetic expression during the disease course, we evaluated the levels at the CR stage and at DR.\u003c/p\u003e \u003cp\u003eWhen patients achieved CR, their \u003cem\u003eRUNX1A\u003c/em\u003e levels reverted to normal values (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). In fact, no differences were found between patients at this stage and HC (0.002 vs 0.003, p\u0026thinsp;=\u0026thinsp;0.298) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAt DR, we again quantified the expression of all three isoforms. As observed at disease onset, when comparing relapsing AML cases (n\u0026thinsp;=\u0026thinsp;21) with HC we confirmed the overexpression of \u003cem\u003eRUNX1A\u003c/em\u003e (0.020 vs 0.003 R/G, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and \u003cem\u003eRUNX1B\u003c/em\u003e (1.167 vs 0.433 R/G, p\u0026thinsp;=\u0026thinsp;0.0012), whereas no difference was observed for \u003cem\u003eRUNX1C\u003c/em\u003e (0.376 vs 0.322 R/G, p\u0026thinsp;=\u0026thinsp;0.341) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eConsidering, for each patient, the evolution of \u003cem\u003eRUNX1\u003c/em\u003e isoforms expression between the diagnosis and DR, no clear kinetics emerged from the analyzed cases (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-G). Notably, when we focused on four cases that were \u003cem\u003eFLT3\u003c/em\u003e-ITD negative at disease onset but \u003cem\u003eFLT3\u003c/em\u003e-ITD mutated at DR, all of these cases exhibited an increased \u003cem\u003eRUNX1A\u003c/em\u003e expression compared to the values at diagnosis (p\u0026thinsp;=\u0026thinsp;0.033), confirming once again the close connection previously demonstrated between \u003cem\u003eFLT3\u003c/em\u003e-ITD mutations and \u003cem\u003eRUNX1A\u003c/em\u003e overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eOverall, no differences emerged when comparing median \u003cem\u003eRUNX1A\u003c/em\u003e expression levels between diagnosis and DR (0.027 vs 0.02 R/G, p\u0026thinsp;=\u0026thinsp;0.728), as also when comparing patients in CR with HC (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). In short, \u003cem\u003eRUNX1A\u003c/em\u003e overexpression was disease-related.\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.6. RUNX1A overexpression is associated with a specific transcriptional profile.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo verify whether \u003cem\u003eRUNX1A\u003c/em\u003e upregulation is linked to a specific transcriptional profile, high-throughput RNA sequencing was conducted. Interestingly, patients with \u0026ldquo;high\u0026rdquo; \u003cem\u003eRUNX1A\u003c/em\u003e expression (FC\u0026thinsp;\u0026ge;\u0026thinsp;5) also produced a greater number of \u003cem\u003eRUNX1A\u003c/em\u003e reads (\u0026ge;\u0026thinsp;18,000 reads) compared to patients with \u0026ldquo;normal/low\u0026rdquo; (FC\u0026thinsp;\u0026le;\u0026thinsp;3) \u003cem\u003eRUNX1A\u003c/em\u003e expression (\u0026lt;\u0026thinsp;12,000 reads), demonstrating a positive correlation of about 90% (r\u003csub\u003es\u003c/sub\u003e=0.89, p\u0026thinsp;=\u0026thinsp;0.0002), indicating the reliability of the sequencing approach. PCA showed the separation between the two groups of samples (high and normal/low RUNX1A expression) and highlighted the homogeneity of samples within each group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eI).\u003c/p\u003e \u003cp\u003eA total of 3,622 protein coding genes (1,491 up and 2,131 down) and 3,108 elements belonging to other categories (lncRNAs, miRNAs, pseudogenes, etc.) were found to be differentially expressed between the two groups of patients. The complete list of differentially expressed elements is reported in Supplementary Table\u0026nbsp;3. Among these, 756 protein-coding genes (557 up and 199 down) and 1,159 elements belonging to other categories (lncRNAs, miRNAs, pseudogenes, etc.) were differentially expressed, with a Log2FC\u0026thinsp;\u0026gt;\u0026thinsp;1.5 or \u0026lt; -1.5 and with a p-value and a padj value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 between the two groups of patients.\u003c/p\u003e \u003cp\u003eStatistically significant (padj\u0026thinsp;\u0026lt;\u0026thinsp;0.05) DEGs were categorized into Gene Ontology (GO) categories using the online software DAVID (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://david.ncifcrf.gov/tools.jsp\u003c/span\u003e\u003cspan address=\"https://david.ncifcrf.gov/tools.jsp\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). \u0026ldquo;Signal Transduction\u0026rdquo; was identified as the TOP BP (p\u0026thinsp;=\u0026thinsp;7.00E-07), \u0026ldquo;Plasma membrane\u0026rdquo; the TOP CC (p\u0026thinsp;=\u0026thinsp;3.02E-23) and \u0026ldquo;serine-type endopeptidase activity\u0026rdquo; the TOP MF (p\u0026thinsp;=\u0026thinsp;2.07E-6) items. The complete list of gene ontology categories (BP, CC, MF) and the categorized genes is reported in Supplementary Table\u0026nbsp;4.\u003c/p\u003e \u003cp\u003eThen, a \u0026ldquo;core analysis\u0026rdquo; was performed using IPA software, to investigate canonical pathways enriched in DEGs. \u0026ldquo;Neutrophil degranulation\u0026rdquo; (p\u0026thinsp;=\u0026thinsp;5.85E-20) was identified as the TOP canonical pathway deregulated, with 56 DEGs; the majority of them being downregulated genes. The activation state of the pathway was identified as \u0026ldquo;decreased\u0026rdquo; (z-score = -6,682) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eL). Interestingly, this observation is in line with the known \u003cem\u003eRUNX1A\u003c/em\u003e ability to suppress myeloid differentiation [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] and with the higher \u003cem\u003eRUNX1A\u003c/em\u003e levels observed in our AML cases with a more immature phenotype and characterized by impaired granulocytic differentiation (M0-M3). The complete list of canonical pathways resulting from the analysis is reported in Supplementary Table\u0026nbsp;5.\u003c/p\u003e \u003cp\u003eNotably, when focusing on the TOP five DEGs (upregulated and downregulated) between the two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eM), the \u003cem\u003ePOU4F1\u003c/em\u003e (Log2FC\u0026thinsp;=\u0026thinsp;6.72, padj\u0026thinsp;=\u0026thinsp;0.009) and \u003cem\u003eSFRP1\u003c/em\u003e (Log2FC=-5.33, padj\u0026thinsp;=\u0026thinsp;0.005) genes stand out. In fact, \u003cem\u003ePOU4F1\u003c/em\u003e overexpression has already been associated with \u003cem\u003eRUNX1::RUNX1T1\u003c/em\u003e AML and is known to contribute directly to its unique transcriptional signature; on the contrary, \u003cem\u003eSFRP1\u003c/em\u003e is a transcriptional repression target of the RUNX1::RUNX1T1 fusion protein in AML [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e "},{"header":"4. Discussion","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003cp\u003eThe pivotal role of \u003cem\u003eRUNX1\u003c/em\u003e in the control of hematopoiesis has been amply demonstrated [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Dysregulated \u003cem\u003eRUNX1\u003c/em\u003e can contribute to blood diseases in many ways, whereby either an excess or a deficiency of \u003cem\u003eRUNX1\u003c/em\u003e, or an altered function, can promote leukemogenesis [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Among the main \u003cem\u003eRUNX1\u003c/em\u003e alterations, gene mutations (germline and somatic) and \u003cem\u003eRUNX1::RUNX1T1\u003c/em\u003e fusion are the most common events, widely studied in AML pathogenesis [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. However, additional genetic aberrations (copy number events or further genomic rearrangements) can affect its function [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Conversely, less attention has been paid to \u003cem\u003eRUNX1\u003c/em\u003e expression in AML, even if its overexpression has been associated with poorer outcomes in cytogenetically normal AML [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo the best of our knowledge, this is the first study to report the absolute quantification of the three main \u003cem\u003eRUNX1\u003c/em\u003e isoforms in an AML series. The observed \u003cem\u003eRUNX1A\u003c/em\u003e and \u003cem\u003eRUNX1B\u003c/em\u003e overexpression suggests a possible different epigenetic regulation of these two isoforms, transcribed from the P2 promoter (proximal), whereas the expression of \u003cem\u003eRUNX1C\u003c/em\u003e (transcribed from the P1 promotor \u0026ndash; distal) [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] remains unchanged.\u003c/p\u003e \u003cp\u003eAmong the three main \u003cem\u003eRUNX1\u003c/em\u003e isoforms, several studies have shown the leukemogenic role of \u003cem\u003eRUNX1A\u003c/em\u003e in different hematological diseases. A study on myelodysplastic/myeloproliferative neoplasms (MDS/MPN) showed the involvement of \u003cem\u003eRUNX1A\u003c/em\u003e in disease progression [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. A recent study on ML-DS demonstrated the key role of a \u003cem\u003eRUNX1\u003c/em\u003e isoform disequilibrium favoring \u003cem\u003eRUNX1A\u003c/em\u003e in the pathogenesis of this rare disease [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Even though based on a limited number of cases, \u003cem\u003eRUNX1A\u003c/em\u003e overexpression was also observed in two previous studies on acute leukemia [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn our study, we investigated \u003cem\u003eRUNX1A\u003c/em\u003e levels in AML and linked its overexpression with key clinical and biological parameters and the disease course. Interestingly, our observations align with the already known role of \u003cem\u003eRUNX1\u003c/em\u003e in hematopoiesis. Specifically, the higher levels of \u003cem\u003eRUNX1A\u003c/em\u003e observed in thrombocytopenic cases confirm the widely demonstrated involvement of the \u003cem\u003eRUNX1\u003c/em\u003e gene in megakaryocytopoiesis [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Furthermore, \u003cem\u003eRUNX1A\u003c/em\u003e overexpression was recently described in the familial platelet disorder with associated myeloid malignancy (FPDMM), suggesting a new potential role for \u003cem\u003eRUNX1\u003c/em\u003e isoforms disequilibrium in the development of myeloid malignancy in FPD [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe ability of \u003cem\u003eRUNX1A\u003c/em\u003e to suppress myeloid differentiation while enhancing the HSC self-renewal capacity [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] aligns with the higher \u003cem\u003eRUNX1A\u003c/em\u003e overexpression observed in the more undifferentiated cases in our cohort. In murine models, enforced expression of \u003cem\u003eRUNX1A\u003c/em\u003e expanded the immature hematopoietic cell population, conferring the potential to differentiate into multiple lineages ex vivo [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Other data showed that overexpressed \u003cem\u003eRUNX1A\u003c/em\u003e inhibits myeloid cell differentiation and stimulates cell proliferation upon granulocyte colony-stimulating factor (G-CSF) treatment [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, the highest \u003cem\u003eRUNX1A\u003c/em\u003e levels were observed in \u003cem\u003eFLT3\u003c/em\u003e-ITD AML patients. The \u003cem\u003eRUNX1\u003c/em\u003e cooperation with \u003cem\u003eFLT3\u003c/em\u003e-ITD in leukemia induction is already known [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. \u003cem\u003eFLT3\u003c/em\u003e-ITD AML patients express high levels of \u003cem\u003eRUNX1\u003c/em\u003e; \u003cem\u003eFLT3\u003c/em\u003e-ITD directly impacts \u003cem\u003eRUNX1\u003c/em\u003e activity, whereby upregulated and phosphorylated \u003cem\u003eRUNX1\u003c/em\u003e cooperates with \u003cem\u003eFLT3\u003c/em\u003e-ITD to induce AML [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Notably, no studies have specifically focused on the expression of the three \u003cem\u003eRUNX1\u003c/em\u003e isoforms. However, Cauchy et al. demonstrated that the \u003cem\u003eRUNX1\u003c/em\u003e upregulation in FLT3-ITD positive AML may partially result from the presence of an ITD-specific open region of chromatin (a DNase I hypersensitive site - DHS) within the \u003cem\u003eRUNX1\u003c/em\u003e gene, approximately 10kb upstream of exon 6, whose alternative splicing generates the \u003cem\u003eRUNX1A\u003c/em\u003e isoform (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e) [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Although we cannot verify this direct connection, it is conceivable that in \u003cem\u003eFLT3\u003c/em\u003e-ITD AML, this open region at the 5\u0026rsquo; end of exon 6 may facilitate regulator access, promoting alternative splicing in favor of \u003cem\u003eRUNX1A\u003c/em\u003e production, as recently described [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Moreover, \u003cem\u003eRUNX1A\u003c/em\u003e overexpression could also result partially from epigenetic mechanisms, as suggested by the higher levels detected in our \u003cem\u003eDNMT3A\u003c/em\u003e-mutated cases. In fact, as we observed in TF-1 cells, \u003cem\u003eDNMT3A\u003c/em\u003e dysfunction impacts the \u003cem\u003eRUNX1\u003c/em\u003e methylation profile.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBy studying \u003cem\u003eRUNX1A\u003c/em\u003e kinetics during follow-up, we highlighted its close association with the disease course. \u003cem\u003eRUNX1A\u003c/em\u003e overexpression is disease-related and drives a specific transcriptional profile which, in some respects, overlaps the \u003cem\u003eRUNX1::RUNX1T1\u003c/em\u003e gene expression signature. Notably, \u003cem\u003eRUNX1A\u003c/em\u003e overexpression is closely linked to \u003cem\u003ePOU4F1\u003c/em\u003e upregulation and \u003cem\u003eSFRP1\u003c/em\u003e downregulation, two events already observed in \u003cem\u003eRUNX1::RUNX1T1\u003c/em\u003e AML [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe main strength of this study is the strong association observed between \u003cem\u003eRUNX1A\u003c/em\u003e deregulation and significant AML clinical and biological parameters, particularly the \u003cem\u003eFLT3\u003c/em\u003e-ITD mutation. However, the hypotheses presented were not verified through functional models (the main limitation of our work); further studies are required to validate these findings.\u003c/p\u003e \u003c/div\u003e "},{"header":"5. Conclusion","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003cp\u003eThe AML biological heterogeneity underscores the need for deeper insights into the molecular mechanisms underlying disease development. Our data aims to contribute a new piece to the jigsaw of the AML molecular pathogenesis, in which \u003cem\u003eRUNX1\u003c/em\u003e involvement is established. Our effort to shed light on the dark side of \u003cem\u003eRUNX1\u003c/em\u003e dysregulation may also offer the opportunity to look on \u003cem\u003eRUNX1A\u003c/em\u003e as a new AML therapeutic target. In fact, restoring the \u003cem\u003eRUNX1\u003c/em\u003e isoforms equilibrium could reverse the oncogenic potential of isoform A, as recently shown in ML-DS. In \u003cem\u003eFLT3\u003c/em\u003e-ITD AML cases, for which targeted treatment are already available, clarifying unknown aspects of the FLT3 pathway could identify new druggable molecules whose synergistic action with FLT3 inhibitors warrants investigation. In the meantime, another piece has been added to the complex scenario of the AML pathogenesis.\u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHSC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehematopoietic stem cell\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAML\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eacute myeloid leukemia\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ebone marrow\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecomplete remission\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehealthy control\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ecDNA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecomplementary DNA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNGS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003enext-generation sequencing\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eITD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003einternal tandem duplication\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eallelic ratio\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTKD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etyrosine kinase domain\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efold change\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePCA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eprincipal component analysis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDEGs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edifferentially expressed genes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBiological Process\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCellular Component\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMolecular Function\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDAVID\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDatabase for Annotation, Visualization and Integrated Discovery\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIPA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eIngenuity Pathways Analysis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eWT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ewild type\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edisease relapse\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eML-DS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDown Syndrome \u0026ndash; associated myeloid leukemia\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGene Ontology\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMDS/MPN\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emyelodysplastic/myeloproliferative neoplasms\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFPDMM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efamilial platelet disorder with associated myeloid malignancy\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eG-CSF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003egranulocyte colony-stimulating factor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDHS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDNase I hypersensitive site\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe local ethics committee approved the study. Informed consent was obtained from all patients before their study inclusion, in accordance with the Declaration of Helsinki. Patients\u0026apos; records/information were anonymized and de-identified before analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConsent for publication was obtained from patients before their enrolment in the present study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConception and design of the study: CC and FA. Acquisition of data and/or analysis and interpretation of data: CC, FT, EP, LA, AZ, NC, GT, IR, MRC, AM, CFM, GS, PM and FA. Clinical data acquisition: FT, VPG and MD. Protein quantification: GB, AN and FG. RNA-sequencing: MFC, FM, CT, SNC, BB and AT. Methylation analysis: PO and MG. Drafting of the manuscript: FA. All authors revised the manuscript for important intellectual content and approved the final version submitted for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by \u0026ldquo;Associazione Italiana contro le Leucemie (AIL)-BARI\u0026rdquo;.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMiyoshi H, Ohira M, Shimizu K, Mitani K, Hirai H, Imai T, et al. Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia. Nucleic Acids Res. 1995;23:2762\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanaka T, Tanaka K, Ogawa S, Kurokawa M, Mitani K, Nishida J, et al. An acute myeloid leukemia gene, AML1, regulates hemopoietic myeloid cell differentiation and transcriptional activation antagonistically by two alternative spliced forms. EMBO J. 1995;14:341\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGialesaki S, Br\u0026auml;uer-Hartmann D, Issa H, Bhayadia R, Alejo-Valle O, Verboon L, et al. RUNX1 isoform disequilibrium promotes the development of trisomy 21\u0026ndash;associated myeloid leukemia. Blood. 2023;141:1105\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsuzuki S, Seto M. Expansion of functionally defined mouse hematopoietic stem and progenitor cells by a short isoform of RUNX1/AML1. Blood. 2012;119:727\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChallen GA, Goodell MA. Runx1 isoforms show differential expression patterns during hematopoietic development but have similar functional effects in adult hematopoietic stem cells. Exp Hematol [Internet]. ISEH - Society for Hematology and Stem Cells; 2010;38:403\u0026ndash;16. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1016/j.exphem.2010.02.011\u003c/span\u003e\u003cspan address=\"10.1016/j.exphem.2010.02.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Zhang Q, Zhang DE, Zhou C, Xing H, Tian Z, et al. Overexpression of an isoform of AML1 in acute leukemia and its potential role in leukemogenesis. Leuk Nat Publishing Group. 2009;23:739\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakurai H, Harada Y, Ogata Y, Kagiyama Y, Shingai N, Doki N, et al. Overexpression of RUNX1 short isoform has an important role in the development of myelodysplastic/myeloproliferative neoplasms. Blood Adv. 2017;1:1382\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEngvall M, Karlsson Y, Kuchinskaya E, J\u0026ouml;rnegren \u0026Aring;, Mathot L, Pandzic T, et al. Familial platelet disorder due to germline exonic deletions in RUNX1: a diagnostic challenge with distinct alterations of the transcript isoform equilibrium. Volume 63. Leuk Lymphoma. Taylor \u0026amp; Francis; 2022. pp. 2311\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCabrerizo Granados D, Barbosa I, Baliakas P, Hellstr\u0026ouml;m-Lindberg E, Lundin V. The clinical phenotype of germline RUNX1 mutations in relation to the accompanying somatic variants and RUNX1 isoform expression. Genes Chromosom Cancer. 2023;62:672\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCumbo C, Tarantini F, Anelli L, Zagaria A, Redavid I, Minervini CF et al. IRF4 expression is low in Philadelphia negative myeloproliferative neoplasms and is associated with a worse prognosis. Exp Hematol Oncol [Internet]. BioMed Central; 2021;10:1\u0026ndash;4. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s40164-021-00253-y\u003c/span\u003e\u003cspan address=\"10.1186/s40164-021-00253-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTarantini F, Cumbo C, Parciante E, Anelli L, Zagaria A, Coccaro N et al. IRF4 gene expression on the trail of molecular response: looking at chronic myeloid leukemia from another perspective. Acta Haematol. 2022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCumbo C, Tarantini F, Zagaria A, Anelli L, Minervini CF, Coccaro N, et al. Clonal Hematopoiesis at the Crossroads of Inflammatory Bowel Diseases and Hematological Malignancies: A Biological Link? Front Oncol. 2022;12:1\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoccaro N, Zagaria A, Orsini P, Anelli L, Tota G, Casieri P et al. RARA and RARG gene downregulation associated with EZH2 mutation in acute promyelocytic-like morphology leukemia. Hum Pathol [Internet]. Elsevier Inc.; 2018;80:82\u0026ndash;6. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.humpath.2018.02.023\u003c/span\u003e\u003cspan address=\"10.1016/j.humpath.2018.02.023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCumbo C, Orsini P, Tarantini F, Anelli L, Zagaria A, Tragni V, et al. TNFRSF13B gene mutation in familial acute myeloid leukemia: A new piece in the complex scenario of hereditary predisposition? Hematol Oncol. 2023;41:942\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurphy KM, Levis M, Hafez MJ, Geiger T, Cooper LC, Smith BD, et al. Detection of FLT3 internal tandem duplication and D835 mutations by a multiplex polymerase chain reaction and capillary electrophoresis assay. J Mol Diagnostics. 2003;5:96\u0026ndash;102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026ouml;hner H, Estey E, Grimwade D, Amadori S, Appelbaum FR, B\u0026uuml;chner T et al. Diagnosis and management of AML in adults: 2017 ELN recommendations from an international expert panel. Blood. 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCumbo C, Tarantini F, Anelli L, Zagaria A, Specchia G, Musto P et al. FLT3 mutational analysis in acute myeloid leukemia: Advantages and pitfalls with different approaches. Blood Rev [Internet]. Elsevier Ltd; 2022;54:100928. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.blre.2022.100928\u003c/span\u003e\u003cspan address=\"10.1016/j.blre.2022.100928\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePolak TB, van Rosmalen J, Dirven S, Herzig JK, Cloos J, Meshinchi S, et al. Association of FLT3-internal tandem duplication length with overall survival in acute myeloid leukemia: a systematic review and meta-analysis. Haematologica. 2022;107:2506\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEwels P, Magnusson M, Lundin S, K\u0026auml;ller M. MultiQC: Summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016;32:3047\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolger AM, Lohse M, Usadel B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao Y, Smyth GK, Shi W, FeatureCounts. An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30:923\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLove MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:1\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSherman BT, Hao M, Qiu J, Jiao X, Baseler MW, Lane HC, et al. DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res. Volume 50. Oxford University Press; 2022. pp. W216\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang DW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4:44\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKr\u0026auml;mer A, Green J, Pollard J, Tugendreich S. Causal analysis approaches in ingenuity pathway analysis. Bioinformatics. 2014;30:523\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu J, Guo Y, Yin J, Chen J, Wang Y, Wang GG, et al. Structure-guided functional suppression of AML-associated DNMT3A hotspot mutations. Nat Commun Springer US. 2024;15:1\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu L, Fu H, Tian L, Xu K, Hu K, Wang J, et al. High expression of RUNX1 is associated with poorer outcomes in cytogenetically normal acute myeloid leukemia. Oncotarget. 2016;7:15828\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Tu Z, Cai X, Wang W, Davis AK, Nattamai K et al. A critical role of RUNX1 in governing megakaryocyte-primed hematopoietic stem cell differentiation. Blood Adv [Internet]. The American Society of Hematology; 2023;7:2590\u0026ndash;605. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1182/bloodadvances.2022008591\u003c/span\u003e\u003cspan address=\"10.1182/bloodadvances.2022008591\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhoury JD, Solary E, Abla O, Akkari Y, Alaggio R, Apperley JF, et al. The 5th edition of the World Health Organization Classification of Haematolymphoid Tumours: Myeloid and Histiocytic/Dendritic Neoplasms. Leuk Springer US. 2022;36:1703\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBennett JM, Catovsky D, Daniel M-T, Flandrin G, Galton DAG, Gralnick HR, et al. Proposals for the Classification of the Acute Leukaemias French‐American‐British (FAB) Co‐operative Group. Br J Haematol. 1976;33:451\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsuzuki S, Hong D, Gupta R, Matsuo K, Seto M, Enver T. Isoform-specific potentiation of stem and progenitor cell engraftment by AML1/RUNX1. PLoS Med. 2007;4:0880\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026ouml;hner H, Wei AH, Appelbaum FR, Craddock C, DiNardo CD, Dombret H, et al. Diagnosis and management of AML in adults: 2022 recommendations from an international expert panel on behalf of the ELN. Blood. 2022;140:1345\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKellaway SG, Coleman DJL, Cockerill PN, Raghavan M, Bonifer C. Molecular Basis of Hematological Disease Caused by Inherited or Acquired RUNX1 Mutations. Exp Hematol [Internet]. Elsevier Inc.; 2022;111:1\u0026ndash;12. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.exphem.2022.03.009\u003c/span\u003e\u003cspan address=\"10.1016/j.exphem.2022.03.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavis AG, Einstein JM, Zheng D, Jayne ND, Fu XD, Tian B, et al. A CRISPR RNA-binding protein screen reveals regulators of RUNX1 isoform generation. Blood Adv. 2021;5:1310\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKomeno Y, Yan M, Matsuura S, Lam K, Lo MC, Huang YJ, et al. Runx1 exon 6-related alternative splicing isoforms differentially regulate hematopoiesis in mice. Blood. 2014;123:3760\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFortier JM, Payton JE, Cahan P, Ley TJ, Walter MJ, Graubert TA. POU4F1 is associated with t(8;21) acute myeloid leukemia and contributes directly to its unique transcriptional signature. Leukemia [Internet]. Nature Publishing Group; 2010;24:950\u0026ndash;7. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/leu.2010.61\u003c/span\u003e\u003cspan address=\"10.1038/leu.2010.61\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng CK, Li L, Cheng SH, Ng K, Chan NPH, Ip RKL, et al. Secreted-frizzled related protein 1 is a transcriptional repression target of the t(8;21) fusion protein in acute myeloid leukemia. Blood. 2011;118:6638\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Bruijn M, Dzierzak E. Runx transcription factors in the development and function of the definitive hematopoietic system. Blood. 2017;129:2061\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBellissimo DC, Speck NA. RUNX1 mutations in inherited and sporadic leukemia. Front Cell Dev Biol. 2017;5:1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSood R, Kamikubo Y, Liu P. Role of RUNX1 in hematological malignancies. Blood. 2017;129:2070\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCumbo C, Tota G, De Grassi A, Anelli L, Zagaria A, Coccaro N et al. RUNX1 gene alterations characterized by allelic preference in adult acute myeloid leukemia. Leuk Lymphoma [Internet]. Taylor \u0026amp; Francis; 2021;0:1\u0026ndash;9. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/10428194.2021.1929960\u003c/span\u003e\u003cspan address=\"10.1080/10428194.2021.1929960\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZagaria A, Anelli L, Coccaro N, Tota G, Casieri P, Cellamare A, et al. 5\u0026prime;RUNX1-3\u0026prime;USP42 chimeric gene in acute myeloid leukemia can occur through an insertion mechanism rather than translocation and may be mediated by genomic segmental duplications. Mol Cytogenet. 2014;7:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevanon D, Glusman G, Bangsow T, Ben-Asher E, Male DA, Avidan N, et al. Architecture and anatomy of the genomic locus encoding the human leukemia-associated transcription factor RUNX1/AML1. Gene. 2001;262:23\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhozi MC, Bernstein Y, Negreanu V, Levanon D, Groner Y. Expression of the human acute myeloid leukemia gene AML1 is regulated by two promoter regions. Proc Natl Acad Sci U S A. 1996;93:1935\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCauchy P, James SR, Zacarias-Cabeza J, Ptasinska A, Imperato MR, Assi SA, et al. Chronic FLT3-ITD Signaling in Acute Myeloid Leukemia Is Connected to a Specific Chromatin Signature. Cell Rep Elsevier. 2015;12:821\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBehrens K, Maul K, Tekin N, Kriebitzsch N, Indenbirken D, Prassolov V, et al. RUNX1 cooperates with FLT3-ITD to induce leukemia. J Exp Med. 2017;214:737\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"RUNX1A, acute myeloid leukemia, FLT3-ITD.","lastPublishedDoi":"10.21203/rs.3.rs-5733882/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5733882/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground. \u003c/strong\u003e\u003cem\u003eRUNX1A \u003c/em\u003eis the shortest and least expressed of the \u003cem\u003eRUNX1\u003c/em\u003e three main isoforms (A, B, C); despite this, the leukemogenic role of its overexpression has been clearly described. Several studies have shown \u003cem\u003eRUNX1A \u003c/em\u003einvolvement in different blood cancers and pilot observations in acute leukemia have been reported.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods. \u003c/strong\u003eIn this context, we evaluated \u003cem\u003eRUNX1\u003c/em\u003e isoformsexpression in a cohort of acute myeloid leukemia (AML) patients and associated our data with significant AML clinical and biological parameters. A focus was performed on \u003cem\u003eFLT3\u003c/em\u003e mutated cases. Genome-wide methylation data from the TF-1 cell line were studied to investigate the possible role of epigenetic regulation in \u003cem\u003eRUNX1\u003c/em\u003e expression. To verify whether \u003cem\u003eRUNX1A\u003c/em\u003eupregulation is linked to a specific transcriptional profile, high-throughput RNA sequencing was conducted.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults. \u003c/strong\u003eAt diagnosis, we found \u003cem\u003eRUNX1A \u003c/em\u003eand \u003cem\u003eRUNX1B \u003c/em\u003eoverexpression\u003cem\u003e,\u003c/em\u003ewith higher median levels in thrombocytopenic cases. No difference was observed for \u003cem\u003eRUNX1C\u003c/em\u003e. \u003cem\u003eRUNX1A\u003c/em\u003e overexpression is higher in more immature AML phenotypes. According to the mutational profile, \u003cem\u003eFLT3\u003c/em\u003e internal tandem duplication (ITD) positive cases have the highest \u003cem\u003eRUNX1A\u003c/em\u003e levels and the presence of \u003cem\u003eFLT3\u003c/em\u003e-ITD was the only molecular variable able to influence \u003cem\u003eRUNX1A\u003c/em\u003eexpression. \u003cem\u003eRUNX1A\u003c/em\u003e overexpression is disease-related, associated with a specific transcriptional profile, and reappears at relapse, with no clear kinetics except in \u003cem\u003eFLT3\u003c/em\u003e-ITD cases.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions. \u003c/strong\u003eOverall, we demonstrate \u003cem\u003eRUNX1A\u003c/em\u003e overexpression in AML and its association with the \u003cem\u003eFLT3\u003c/em\u003e-ITD molecular subtype. Our data shed light on the dark side of \u003cem\u003eRUNX1\u003c/em\u003e deregulation, paving the way for further investigations.\u003c/p\u003e","manuscriptTitle":"RUNX1A isoform is overexpressed in acute myeloid leukemia and is associated with FLT3 internal tandem duplications","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-01 16:53:03","doi":"10.21203/rs.3.rs-5733882/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b773f4ca-a026-430e-96e9-a1d1ba72524f","owner":[],"postedDate":"January 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-04-28T09:26:01+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-01 16:53:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5733882","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5733882","identity":"rs-5733882","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.