piRNA-823 exerts protective effects on high glucose concentration–induced HUVEC pyroptosis by targeting LCN2 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article piRNA-823 exerts protective effects on high glucose concentration–induced HUVEC pyroptosis by targeting LCN2 Yao Tan, Qian Zeng, Xinguo Sun, Jianning Qin, Yang Han, Simin Zhao, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4371914/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose It has been reported that non-coding RNAs can regulate endothelial cell pyroptosis, thereby playing a role in diabetes and its vascular complications, however, few studies have been conducted to date to explore the effect of PIRNA in diabetic vascular complications, and we aimed to explore the effect of piRNA-823 on hyperglycemia-induced pyroptosis of human umbilical vein endothelial cells and the specific mechanism Methods LDH was detected in the supernatant of different groups, The levels of IL-1βand IL-18 were detected by ELISA. The protein expression levels of NLRP3, caspase-1, GSDMD and ASC were detected by WB, Total RNA was extracted from piRNA-823 mimics and piRNA-823 NC cells for high-throughput sequencing, and differentially expressed genes were screened by bioinformatics analysis. The expressions of pyroptosis-related proteins in different groups were detected and the morphological changes of cells were observed by fluorescence microscopy. Results High glucose can reduce piRNA-823 expression, and increasing piRNA-823 expression can inhibit hyperglucose-induced endothelial cell pyroptosis, and the mechanism is to reverse hyperglucose-induced HUVEC cell pyroptosis by targeting LCN2. Conclusion piRNA-823 targets LCN2 to inhibit hyperglycemic induced pyroptosis in human umbilical vein endothelial cells. piRNA-823 LCN2 pyroptosis caspase-1 NLRP3 GSDMD Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction In 2019, the number of cardiovascular diseases in China accounted for nearly a quarter of the national population, reaching 330 million and accounting for 46.74% and 44.26% of deaths in rural areas and cities, respectively[ 1 ]. Diabetes mellitus is a chronic metabolic disease characterized by hyperglycemia, and long-term hyperglycemia causes vascular complications, such as heart, brain, and kidney diseases, which are the main causes of death[ 2 ]. Vascular endothelial injury and dysfunction are the early pathological basis of diabetic vascular complications, and endothelial cell pyroptosis is an important cause of endothelial dysfunction. Improving endothelial cell dysfunction induced by a high glucose concentration can effectively inhibit the progression of diabetic vascular lesions[ 3 ]. Therefore, how to reduce and prevent the pyroptosis of vascular endothelial cells is of great significance because it improves endothelial cell function and treat or prevent diabetic angiopathy. High glucose concentrations cause endothelial cells to produce excessive amounts of oxygen radicals and glycosylated end products, thereby inducing the formation of NOD-like receptor family pyrin domain-containing 3 (NLRP3) inflammasomes, triggering cell pyrosis and inflammation, and promoting the occurrence of various cardiovascular diseases, such as diabetes, atherosclerosis, and myocardial ischemia–reperfusion injury (I/R)[ 4 – 6 ] . Pyroptosis is a new form of pro-inflammatory programmed cell death. The classical pyroptosis pathway relies on the activation of caspase-1, and the pattern recognition receptor in a cell senses the stimulation of signals from bacteria, viruses, cholesterol, and other signals. Then, it recruits apoptosis-associated speck-like protein containing a CARD (ASC) to bind to caspase-1 precursors and form NLRP3 inflammatory complexes and activate caspase-1. Activated caspase-1 directly shears gasdermin D (GSDMD) to produce N-terminal amino acid peptides, which have lipophilicity at the N-terminus and combine with the lipid layer inside the cell membrane to form 10–20 mm pores. The subsequent release of inflammatory factors and cell contents result in an inflammatory response. It can cut the precursors of interleukin-1β (IL-1β) and interleukin 18 (IL-18), promote their maturation, and release them outside cells, expanding the inflammatory response. Moreover, pyroptosis leads to endothelial cell damage and dysfunction, thereby promoting the development of cardiovascular diseases[ 7 – 9 ]. PIWI-interacting RNA (piRNA) is a class of short-chain noncoding RNA (ncRNA) found in germ cells in 2006 and approximately 24–31 nt long, named because it binds to the PIWI protein family to function[ 10 – 12 ]. piRNA can bind to PIWI proteins to form piRNA–PIWI complexes, which play an important role in spermatogenesis, transposon silencing, genomic rearrangement, and epigenetic regulation. piRNA was thought to be specific in germ cells, but recent studies have shown that it is also widely present in other tissues, such as heart, brain, liver, kidney, lung, small intestine, skeletal muscle, and pancreas tissues[ 13 – 16 ]. Studies have shown that piRNA is abnormally expressed in a variety of tumors and is closely related to the disease process by regulating tumor cell proliferation, apoptosis, and autophagy[ 17 ]. piRNA-823 is a member of the piRNA family and can inhibit the proliferation and invasion of gastric and renal cancer cells and exert antitumor effects[ 18 ] , [ 19 ]. However, in tumors such as multiple myeloma (MM), liver cancer, and colon cancer, the expression of piRNA-823 is upregulated, which can promote tumor cell proliferation and invasion and inhibit tumor cell apoptosis[ 20 – 22 ]. The coculture of MM and endothelial cells showed significant increase in piRNA-823 expression in endothelial cells, promoted proliferation of and invasion by endothelial cells, inhibited apoptosis and enhanced vascular endothelial-derived growth factor (VEGF), and intercellular adhesion molecule-1 (ICAM-1) promotes angiogenesis[ 23 ]. The role of piRNA in cardiovascular disease is poorly studied, but piRNA is abnormally expressed in a variety of cardiovascular diseases and involved in disease progression[ 24 , 25 ]. However, the role and potential mechanism of piRNA-823 in endothelial pyrosis are unclear. In this study, we used high glucose concentrations to induce endothelial cell pyroptosis and found that piRNA-823 inhibited high glucose concentration–induced endothelial cell pyroptosis. We then found that LCN2 is a potential regulatory target of piRNA-823 through high-throughput sequencing. In addition, we modulated the expression levels of piRNA-823 and LCN2 to explore the role of piRNA-823 in endothelial cell pyroptosis and possible mechanism, providing a novel theoretical basis for the prevention and treatment of cardiovascular diseases. Materials and Methods Materials Caspase-1 antibody was purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies directed against β-actin, NLRP3, ASC, and anti-rabbit IgG were provided by Proteintech (Rosemount, IL, USA). GSDMD antibody was purchased from Abcam (Cambridge, UK). LCN2 was obtained from ABclonal (Wuhan, China). Lipofectamine TM2000 were purchased from Invitrogen (Carlsbad, CA, USA). Cell culture Human umbilical vein endothelial cells (HUVECs) were purchased from Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). The HUVECs were cultured in Dulbecco’s modifed Eagle’s medium containing 10% fetal bovine serum in an incubator at 37 C, 5% CO 2 . RNA sequencing (RNA-seq) piRNA-823mimics (HG + piRNA-823 mimics group) and piRNA-823 mimics-control (HG + piRNA-823 mimics-control group) were transfected into cells, which in turn were inoculated into 6 cm cell culture dishes, placed in a CO 2 constant temperature incubator with 5% CO 2 at 37°C for 24 h. After the cells were washed, 1 mL of TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Waltham, MA) was added to each vial, and the mixtures was slowly shaken to make full contact with the cells. The cell suspensions were left to stand for 2 min at room temperature. The cells were carefully pipetted after all the cells fell off and transferred to RNase-free cryopreservation tubes. Three replicates were established for each group, and sample data analysis was performed at Genergy Biotechnology Co., Ltd. (Shanghai, China). Cell viability and LDH activity detection HUVECs (2 × 10 3 cells per well) were inoculated in a 96-well plate, and three multiple holes were set in each well. PBS was added to the outermost ring of the well plate to prevent evaporation. The culture plates were placed in the incubator for 12 h and then treated according to the experimental groups. Approximately 10 µL of CCK8 (Hanbio, Shanghai, China) solution was added to each well in the dark to prevent bubbles. The plate was placed in the incubator for 2 h, and the absorbance was measured at 450 nm using a microplate reader. The cell supernatants of each group were collected for lactate dehydrogenase (LDH) activity detection. A commercial assay kit for LDH activity (Jiancheng Bioeng Inst., China) was used according to the kit’s manual. The samples were identified using a microplate reader at 450 nm absorbance wavelength. Reverse transcription and quantitative PCR assays Total RNA was extracted with MiPure cell/tissue miRNA kit (Vazyme,Nanjing, China) and was reverse transcribed to obtain cDNA using the miRNA first-strand cDNA synthesis kit (Vazyme, Nanjing, China). For assays of mRNA, cDNA was generated using the ChamQ Universal SYBR qPCR master mix (Vazyme, Nanjing, China), quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was carried out using ABI StepOne plus real-time PCR system and 48-well optical reaction plates (Applied Biosystems, Foster City, CA, USA). The primer sequences are as follows: piRNA-hsa-823 R: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACG; piRNA-hsa-823 F: GTTGGTGGTATAGTGGTGAGCAT; LCN2 R:AAGCGGATGAAGTTCTCCTTTA; LCN2 F:GAGTTACCCTGGATTAACGAGT; U6 R:AACGCTTCACGAATTTGCGT; U6 F: CTCGCTTCGGCAGCACA. Enzyme-linked immunosorbent assay (ELISA) Culture supernatants were collected and the concentrations of IL-1β and IL-18 in the supernatants were assessed by enzyme-linked immunosorbent assay (ELISA) (Elabscience, China) according to the manufacturer’s instructions. The levels were normalized to cell protein concentrations. Western blotting Protein samples (100 µg each) were loaded on a 10% SDS polyacrylamide gel and transferred onto a nitrocellulose filter membrane, which was subsequently blocked by 5% nonfat milk dissolved in TBST for 2 h. The blots were probed with primary antibodies against LCN2, GSDMD, caspase-1, NLRP3, and ASC. β-Actin was used as the internal control. The band intensities of target proteins were analyzed using ImageJ. Electrophoresis and immunoblotting were employed as described previously. Immunofluorescence staining For immunofluorescence staining, HUVECs were fixed with 4% paraformaldehyde for 15 min, subjected to different stimulations, washed three times with PBS, and treated with 0.2% Triton X-100 (Solarbio, China) at room temperature for 20 min. Blocking solution (1% BSA and 0.1% Triton-X in PBS) was used to penetrate and incubate fixed cells at room temperature for 2 h. Primary antibodies against LCN2 was placed in PBS overnight at 4°C and then incubated with an appropriate secondary antibody (Proteintech Wuhan, China) for 1 h at room temperature. The nuclei were stained using 4′,6-diamidino-2-phenylindole (DAPI, Beyotime, Shanghai, China) for 10 min at room temperature. Immunofluorescence was examined under a fluorescence microscope (Thermo M5000, Invitrogen, MA, USA). Scanning electron microscopy After the cells of each group were cultured, they were rinsed gently with PBS. Electron microscopy fixation solution (Servicebio Technology CO., LTD., Wuhan, China) was added at room temperature for 2 h to fix the cells after PBS was discarded. Severe shock was prevented, which would detach the cells from the cover glass. Tissue blocks were washed with 0.1 M PB (pH 7.4) three times for 15 min each and then transferred to 1% OsO4 in 0.1 M PB (pH 7.4) for 1–2 h at room temperature. Then, the tissue blocks were washed with 0.1M PB (pH 7.4) three times for 15 min each. The cells are sequentially fed with 30% 50%, 70%, 80%, 90%, 95%, and 100% alcohol successively for 15 min each and then with isoamyl acetate for 15 min for dehydration. The samples were dried and then conductively treated. Images were collected with a scanning electron microscope (Servicebio Technology CO., LTD., Wuhan, China). Statistical analysis Continuous variables were presented as mean ± s.e.m. One-way ANOVA was carried out for multiple comparisons, and GraphPad Prism 6.0 (GraphPad Software, Inc., La Jolla, CA, USA) was used. P values < 0.05 indicated statistically significant differences. Results High glucose concentrations induce HUVEC pyroptosis After the treatment of endothelial cells with high levels of glucose for 0, 6, 12, 24, and 48 h successively, the growth viability of endothelial cells at 24 and 48 h was reduced, and the difference was statistically significant (Fig. 1 A). Compared with the NG group (5.6 mmol/L glucose), the cell growth viability of endothelial cells was significantly reduced after 24 h of high-glucose treatment (25 mmol/L glucose ), and the mannitol isotonic control group (5.6 mmol/L glucose + 19.4mmol/L mannitol) had no significant effect on endothelial cell growth viability after 24 h of treatment (Fig. 1 B). This result showed that the LDH level in the HG group was significantly higher than that in the NG and MG groups (Fig. 1 C). In addition, ELISA results showed that the levels of pro-inflammatory factors IL-1β and IL-18 in the supernatant of the culture medium were significantly upregulated after 24 h of high-glucose treatment of the endothelial cells (Figs. 1 D,E). The expression levels of NLRP3, caspase-1, GSDMD, and ASC significantly increased (Fig. 1 F). These results showed that high glucose concentrations promote endothelial cell pyroptosis. piRNA-823 inhibited the high glucose concentration–induced pyroptosis in HUVECs To determine whether piRNA-823 is involved in high glucose concentration–induced endothelial cell pyroptosis, we examined the expression levels of different groups of piRNA-823. After 24 h of high-glucose treatment, piRNA-823 expression was detected by RT-qPCR. The results showed a decrease in the expression of piRNA-823 after HG treatment (Fig. 2 A), suggesting that piRNA-823 is involved in high glucose concentration–induced endothelial cell pyroptosis. We transfected endothelial cells with piRNA-823 mimics and piRNA-823 mimics-NC with a transfection kit. The expression level of piRNA-823 in endothelial cells increased significantly compared with that in the NC group after the transfection of the piRNA-823 mimics (Figs. 2 B,C). To explore the role of piRNA-823 in high glucose concentration–induced endothelial cell pyroptosis, we divided the cells into five groups: HG, HG + piRNA-823 mimics, HG + piRNA-823 mimics-control, HG + piRNA-823 inhibitor, and HG + piRNA-823 inhibitor-control. The experimental results showed that the levels of LDH, IL-1β, and IL-18 in the culture supernatant of the HG + piRNA-823 mimics group decreased, whereas the levels of LDH, IL-1β, and IL-18 increased after the addition of the piRNA-823 inhibitor (Figs. 2 D–F). In addition, Western blot results showed that the expression of pyroptosis-associated proteins NLRP3, caspase-1, GSDMD, and ASC in the HG + piRNA-823 mimics group decreased, and the inhibition of piRNA-823 upregulated the expression of pyroptosis-associated protein (Fig. 2 G). The above results indicated that piRNA-823 inhibits high glucose concentration–induced pyroptosis in endothelial cells. LCN2 is the target of piRNA-823 To explore the specific mechanism of the piRNA-823 inhibition of high glucose concentration–induced pyroptosis in endothelial cells, we performed high-throughput sequencing analysis. Total RNA was extracted from the HG + piRNA-823 mimics and HG + piRNA-823 mimics-control groups for microarray expression analysis (Figs. 3 A,B). A total of 29,595 genes were found in the HG + piRNA-823 mimics group and had |log2FC| ≥1 and P value ≤ 0.05. Furthermore, 371 differentially expressed genes were obtained: 140 upregulated and 231 downregulated. The top five genes with the largest differential expression were SFRP1 , LCN2 , PSME3 , NTF4 , and MAGEA3 . The interaction relationship between piRNA-823 and these five genes were analyzed through RNAInter (RNA Interactome Database). The absolute value of the negative value between LCN2 and piRNA-823 was the largest, indicating that they were tightly bound and the structure was stable. Although LCN2 is involved in inflammation, lipid metabolism, and iron transport in the body[ 26 , 27 ], its role in hyperglycemic endothelial cell pyrosis has not been reported. Thus, this study focused on the LCN2 gene. We detected the mRNA expression of LCN2 through RT-qPCR. The expression of mRNA in LCN2 in the HG + piRNA-823 mimics group was significantly reduced compared with that in the control group (Fig. 3 C), consistent with our previous results from high-throughput sequencing. The cells were divided into five groups, HG group, HG + piRNA-823 mimics, HG + piRNA-823 mimics-control, HG + piRNA-823 inhibitor and HG + piRNA-823 inhibitor-control. The results shown that overexpression of piRNA-823 significantly inhibited the expression of LCN2. Conversely, after interfering with piRNA-823, LCN2 expression increased (Fig. 3 D). In addition, the cell fluorescence of CY-3-labeled LCN2 was also the same as above (Fig. 3 E), these suggest that LCN2 is the target of piRNA-823. piRNA-823 inhibited HUVEC pyroptosis induced by high glucose concentration by targeting LCN2 To further verify whether high glucose concentration–induced pyroptosis in endothelial cells is associated with piRNA-823-targeted regulation of LCN2, LCN2 recombinant plasmids were transfected into cells, transfection efficiency was observed under a fluorescence microscope (Fig. 4 A), and the expression of the LCN2 protein was detected by western blotting (Fig. 4 B). Cells were divided into five groups: HG, HG + piRNA-823 mimics, HG + piRNA-823 mimics-control, HG + piRNA-823mimics + pcDNA-LCN2, and HG + piRNA-823mimics + pcDNA-vector. The levels of LDH, IL-1β, and IL-18 in the supernatants of the cell cultures were consistent with our previous study. Under high glucose culture conditions, the expression of piRNA-823 reduced the expression levels of LDH, IL-1β and IL-18. Conversely, the expression levels of LDH, IL-1β, and IL-18 increased after the expression of piRNA-823 was inhibited. These results were reversed after transfection with LCN2 recombinant plasmid (Figs. 4 C–E). Similarly, the expression levels of pyroptosis-associated proteins NLRP3, caspase-1, GSDMD, and ASC were consistent with the results described above (Fig. 4 F). In addition, to further observe the effect of piRNA-823 targeting LCN2 on high glucose concentration–induced endothelial cell morphology, we observed cell morphological changes through scanning electron microscopy. Compared with the NG group, the HG group had irregular cell edges, swollen and flattened cells, significantly reduced surface microvilli, lost cell membrane integrity, ruptured plasma membrane, cell content extrusion, and visible differently sized membrane pores the cell surface (indicated by the red arrow; Fig. 5 ). Under high-glucose culture conditions, the expression of piRNA-823 increased, and some microvilli appeared on the cell surface. The number of pores on the cell membrane was significantly reduced compared with that in the HG group, and the degree of cell apoptosis was reduced (HG + piR-823mimics). After the upregulation of LCN2 expression (HG + piRNA-823mimics + pcDNA-LCN2), the degree of cell apoptosis significantly decreased, and the swelling and enlargement of cells were observed. Moreover, surface microvilli disappeared, and pores on the cell surface increased in number and size. These results indicated that piRNA-823 targeting LCN2 inhibits high glucose concentration–induced HUVEC pyroptosis. Discussion The prevalence of diabetes is increasing year by year, which has imposed economic burden on patients and caused their suffering. Cardiovascular complications are the main causes of death. In vivo, vascular endothelial cells are damaged and vascular diastolic function is reduced as blood glucose concentration increases. These effects lead to endothelial cell dysfunction, which in turn leads to vascular complications in diabetic patients. These complications can be reduced by controlling the blood glucose levels of diabetic patients. ncRNA can regulate endothelial cell pyroptosis and is involved in a variety of cardiovascular diseases[ 28 , 29 ]. However, the role of piRNA in endothelial cell pyroptosis is unclear. This experiment used high glucose concentrations to establish a cell pyroptosis model and then explored the role and possible mechanism of piRNA-823 in endothelial cell pyroptosis. Pyroptosis is a new form of pro-inflammatory programmed cell death. NLRP3 inflammasomes play an important role in cell pyroptosis and are multiprotein complexes composed of the receptor proteins NLRP3, ASC, and caspase-1, which lead to the excessive activation of the complexes under cell stress or in the presence of tissue damage or infectious pathogens. The activation of the downstream target caspase-1 promotes the secretion of inflammatory factors, such as IL-1β, and the occurrence of cell pyroptosis. Yang et al.[ 30 ] showed that in a high-glucose environment, NLRP3 inflammasomes are overactivated, the secretion of inflammatory factors IL-1β and IL-18 increases, and the inhibited activation of NLRP3 inflammasomes can inhibit cell pyroptosis. Gu et al.[ 31 ] found that the amounts of released LDH, IL-1β, and IL-18 increased in endothelial cells treated with glucose at high concentrations, and the expression levels of GSDMD and caspase-1 proteins increased. Our study found that high glucose concentrations significantly increase the expression of pyroptosis-related proteins and promote the secretion of inflammatory factors, indicating that high-glucose treatment significantly promotes pyroptosis in endothelial cells. ncRNA is involved in the occurrence and development of a variety of cardiovascular diseases by regulating cell pyroptosis. In myocardial I/R, miR-132 expression is significantly upregulated, and the PGC-1α/NRF2 signaling pathway is activated by targeting Sirt1 and promotes pyroptosis, thereby aggravating myocardial I/R injury[ 32 ]. lncRNA KLF3-AS1 competitively binds to miR-138-5p to regulate the expression of Sirt1, thereby inhibiting cell pyroptosis and inhibiting the process of myocardial infarction[ 33 ]. In addition, in diabetic nephropathy, miR-497 expression is reduced, and miR-497 overexpression inhibits caspase-1-dependent cell pyroptosis[ 34 ]. miR-130a mitigates cell damage by regulating cell pyroptosis caused by the TNF-α/SOD1/ROS axis[ 35 ]. We also found observed in our previous studies that miRNA-223-3p promotes cardiomyocyte pyroptosis by downregulating the release of inflammasome factor SPI1 (PU.1)[ 36 ]. piRNA is a class of small-molecule ncRNAs. Little research into the role of piRNA in cardiovascular diseases has been conducted. piRNA is abnormally expressed in cardiovascular diseases and may be involved in the occurrence and development of diabetes and heart-related diseases, but the molecular mechanisms and signaling pathways involved in piRNA function have not been fully elucidated. One study analyzed piRNA expression profiling of islet cells in a rat model of type 2 diabetes mellitus was analyzed by using a gene chip technology and found that the expression levels of DQ732700 and DQ746748 significantly increased; these effects led to glucose-induced insulin secretion defects, but the specific mechanism is unclear[ 37 ]. Gao et al.[ 38 ] found that a type of piRNA (CHAPIR) is abundantly expressed in myocardial hypertrophy and can promote myocardial pathological hypertrophy and cardiac remodeling by targeting the m6A methylation of METTL3-mediated Parp10 mRNA transcripts. These studies provided novel insights into the potential value of piRNA in the clinical diagnosis, prognosis, and treatment of diabetes and heart diseases. piRNA-823 is an important piRNA that is abnormally expressed in a variety of tumors and is involved in the development of multiple tumors. The expression of piRNA-823 in gastric and kidney cancer tissues is reduced, and the upregulation of piRNA-823 inhibits the growth of gastric cancer cells[ 39 ]. However, the expression of piRNA-823 in colon cancer tissues significantly increased and may have promoted the proliferation, invasion, and anti-apoptosis activity of colorectal cancer cells by regulating the G6PD/HIF-1α pathway[ 23 , 40 ]. The expression of piRNA-823 was upregulated in MM tissues and cell lines, and the disruption of piRNA-823 expression inhibited tumor cell proliferation, induced apoptosis, and inhibited tumor development[ 24 , 41 ]. Extracellular vesicles (EVs) carry a variety of RNA molecules and play a crucial role in the connection between tumors and surrounding stromal cells, including endothelial cells. Li et al.[ 41 ] found that piRNA-823 is mainly present in the peripheral blood of patients with MM and MM-derived EVs. In mice, when MM-derived EVs are cocultured with endothelial cells, piRNA-823 in EVs transfer to endothelial cells and promote the growth of transplanted tumors. The transfection of piRNA-823 mimics or MM-derived EVs significantly promotes endothelial cell proliferation, invasion, and tubule formation, possibly by enhancing the expression of VEGF, IL-6, and ICAM-1 and inhibiting apoptosis. These results suggest that piRNA-823 plays different roles in different tumors and piRNA-823 can be used as a biomarker and therapeutic target for diseases. The results of the present study showed that high glucose concentrations induced pyroptosis in endothelial cells while reducing the expression level of piRNA-823. Therefore, we speculated that piRNA-823 is involved in high glucose concentration–induced endothelial cell pyroptosis. The transfection of piRNA-823 mimics reduced the expression levels of NLRP3, GSDMD, caspase-1, and ASC proteins and inhibited the secretion of LDH and inflammatory factors IL-1β and IL-18 in the supernatant of the culture medium. piRNA-823 can inhibit high glucose concentration–induced endothelial cell pyroptosis. To further explore the specific mechanism of the piRNA-823 inhibition of high glucose concentration–induced epithelial cell pyroptosis, we performed high-throughput sequencing analysis. Gene chip expression analysis indicated that LCN2 is the most tightly bound to piRNA-823 and has the most stable structure. LCN2 is a secreted protein of neutrophil and expressed in the kidneys, brain, lungs, liver, adipocytes, neutrophils, macrophages, endothelial cells, smooth muscle cells, cardiomyocytes[ 42 ] , [ 43 ]. White adipose tissues are the main sources of LCN2. In a low expression state, LCN2 expression is significantly increased when epithelial cells are stimulated by infection, inflammation, or ischemia and is involved in the body's inflammatory response, lipid metabolism, and iron transport[ 26 , 27 ]. LCN2 plays a key role in cardiovascular remodeling and unstable atherosclerotic plaque formation[ 44 ] , [ 45 ]. LCN2 not only is involved in the development of hypertension but also promotes the occurrence of aneurysms through mechanisms, such as inflammatory response[ 42 , 46 ]. At present, LCN2-mediated oxidative stress, chronic inflammatory response, and fibrosis play an important role in the occurrence and development of cardiovascular diseases. Our study showed that increasing the expression of piRNA-823 mimics reduces the degree of pyroptosis under high-glucose culture conditions. LCN2 recombinant plasmids transfected into cells promotes pyroptosis. This result was confirmed by changes in cell morphology observed through scanning electron microscopy. In summary, the expression of piRNA-823 decreased in high glucose conccentration–induced endothelial cells, and increasing the expression of piRNA-823 inhibited high glucose concentration–induced endothelial cell pyroptosis. The mechanism was to reverse hyperglycemia-induced HUVEC pyroptosis by targeting LCN2. This mechanism serves as a basis for the further study of the roles of piRNA in endothelial cell pyroptosis and in the prevention and treatment of cardiovascular diseases caused by diabetes. Declarations Conflict of interests Authors declare no conflict of interests. Funding This work was supported by The National Natural Science Foundation of China, China [NO. 81900424, 81670424]; The National Natural Science Foundation of Hunan Province, China [NO. 218JJ2345]; Hunan Provincial Health Commission key project [NO.202102063633]. Author Contribution Y.T. and Q.Z. were responsible for study design and the conduct of the experiment. SL. Q. and WJ.F. were responsible for technical guidance.XG.S., JN.Q., Y.H., SM.Z., HQ.W., SL.L. were responsible for material preparation, Y.T. wrote the manuscript and researched data, C.Z. contributed to discussion and reviewed manuscript.The guarantor of this study, Y.T. was granted unrestricted access to all the data and assumes full responsibility for ensuring the integrity and accuracy of data analysis. References writing committee of the report on cardiovascular h, diseases in c: Report on Cardiovascular Health and Diseases in China 2021: An Updated Summary. Biomed Environ Sci 2022, 35(7):573–603. Jannapureddy S, Sharma M, Yepuri G, Schmidt AM, Ramasamy R: Aldose Reductase: An Emerging Target for Development of Interventions for Diabetic Cardiovascular Complications. Front Endocrinol (Lausanne) 2021, 12:636267. Coco C, Sgarra L, Potenza MA, Nacci C, Pasculli B, Barbano R, Parrella P, Montagnani M: Can Epigenetics of Endothelial Dysfunction Represent the Key to Precision Medicine in Type 2 Diabetes Mellitus? Int J Mol Sci 2019, 20(12). Gao P, He FF, Tang H, Lei CT, Chen S, Meng XF, Su H, Zhang C: NADPH oxidase-induced NALP3 inflammasome activation is driven by thioredoxin-interacting protein which contributes to podocyte injury in hyperglycemia. J Diabetes Res 2015, 2015:504761. Cong L, Gao Z, Zheng Y, Ye T, Wang Z, Wang P, Li M, Dong B, Yang W, Li Q et al : Electrical stimulation inhibits Val-boroPro-induced pyroptosis in THP-1 macrophages via sirtuin3 activation to promote autophagy and inhibit ROS generation. Aging (Albany NY) 2020, 12(7):6415–6435. Zhang Y, Liu X, Bai X, Lin Y, Li Z, Fu J, Li M, Zhao T, Yang H, Xu R et al : Melatonin prevents endothelial cell pyroptosis via regulation of long noncoding RNA MEG3/miR-223/NLRP3 axis. J Pineal Res 2018, 64(2). Xia M, Boini KM, Abais JM, Xu M, Zhang Y, Li PL: Endothelial NLRP3 inflammasome activation and enhanced neointima formation in mice by adipokine visfatin. Am J Pathol 2014, 184(5):1617–1628. Xia X, Shi Q, Song X, Fu J, Liu Z, Wang Y, Wang Y, Su C, Song E, Song Y: Tetrachlorobenzoquinone Stimulates NLRP3 Inflammasome-Mediated Post-Translational Activation and Secretion of IL-1beta in the HUVEC Endothelial Cell Line. Chem Res Toxicol 2016, 29(3):421–429. Zhang D, Jin W, Wu R, Li J, Park SA, Tu E, Zanvit P, Xu J, Liu O, Cain A et al : High Glucose Intake Exacerbates Autoimmunity through Reactive-Oxygen-Species-Mediated TGF-beta Cytokine Activation. Immunity 2019, 51(4):671–681 e675. Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T et al : A novel class of small RNAs bind to MILI protein in mouse testes. Nature 2006, 442(7099):203–207. Grivna ST, Beyret E, Wang Z, Lin H: A novel class of small RNAs in mouse spermatogenic cells. Genes Dev 2006, 20(13):1709–1714. Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE: Characterization of the piRNA complex from rat testes. Science 2006, 313(5785):363–367. Zhu QJ, Zhu M, Xu XX, Meng XM, Wu YG: Exosomes from high glucose-treated macrophages activate glomerular mesangial cells via TGF-beta1/Smad3 pathway in vivo and in vitro. FASEB J 2019, 33(8):9279–9290. Jiang R, Chen X, Ge S, Wang Q, Liu Y, Chen H, Xu J, Wu J: MiR-21-5p Induces Pyroptosis in Colorectal Cancer via TGFBI. Front Oncol 2020, 10:610545. Yang F, Qin Y, Lv J, Wang Y, Che H, Chen X, Jiang Y, Li A, Sun X, Yue E et al : Silencing long non-coding RNA Kcnq1ot1 alleviates pyroptosis and fibrosis in diabetic cardiomyopathy. Cell Death Dis 2018, 9(10):1000. Tan Y, Qin JN, Wan HQ, Zhao SM, Zeng Q, Zhang C, Qu SL: PIWI/piRNA-mediated regulation of signaling pathways in cell apoptosis. Eur Rev Med Pharmacol Sci 2022, 26(16):5689–5697. Perera BPU, Tsai ZT, Colwell ML, Jones TR, Goodrich JM, Wang K, Sartor MA, Faulk C, Dolinoy DC: Somatic expression of piRNA and associated machinery in the mouse identifies short, tissue-specific piRNA. Epigenetics 2019, 14(5):504–521. Rajan KS, Velmurugan G, Pandi G, Ramasamy S: miRNA and piRNA mediated Akt pathway in heart: antisense expands to survive. Int J Biochem Cell Biol 2014, 55:153–156. Dharap A, Nakka VP, Vemuganti R: Altered expression of PIWI RNA in the rat brain after transient focal ischemia. Stroke 2011, 42(4):1105–1109. Zeng Q, Wan H, Zhao S, Xu H, Tang T, Oware KA, Qu S: Role of PIWI-interacting RNAs on cell survival: Proliferation, apoptosis, and cycle. IUBMB Life 2020, 72(9):1870–1878. Iliev R, Stanik M, Fedorko M, Poprach A, Vychytilova-Faltejskova P, Slaba K, Svoboda M, Fabian P, Pacik D, Dolezel J et al : Decreased expression levels of PIWIL1, PIWIL2, and PIWIL4 are associated with worse survival in renal cell carcinoma patients. Onco Targets Ther 2016, 9:217–222. Cheng J, Deng H, Xiao B, Zhou H, Zhou F, Shen Z, Guo J: piR-823, a novel non-coding small RNA, demonstrates in vitro and in vivo tumor suppressive activity in human gastric cancer cells. Cancer Lett 2012, 315(1):12–17. Yin J, Jiang XY, Qi W, Ji CG, Xie XL, Zhang DX, Cui ZJ, Wang CK, Bai Y, Wang J et al : piR-823 contributes to colorectal tumorigenesis by enhancing the transcriptional activity of HSF1. Cancer Sci 2017, 108(9):1746–1756. Yan H, Wu QL, Sun CY, Ai LS, Deng J, Zhang L, Chen L, Chu ZB, Tang B, Wang K et al : piRNA-823 contributes to tumorigenesis by regulating de novo DNA methylation and angiogenesis in multiple myeloma. Leukemia 2015, 29(1):196–206. Tang X, Xie X, Wang X, Wang Y, Jiang X, Jiang H: The Combination of piR-823 and Eukaryotic Initiation Factor 3 B (EIF3B) Activates Hepatic Stellate Cells via Upregulating TGF-beta1 in Liver Fibrogenesis. Med Sci Monit 2018, 24:9151–9165. Rehwald C, Schnetz M, Urbschat A, Mertens C, Meier JK, Bauer R, Baer P, Winslow S, Roos FC, Zwicker K et al : The iron load of lipocalin-2 (LCN-2) defines its pro-tumour function in clear-cell renal cell carcinoma. Br J Cancer 2020, 122(3):421–433. Zhang Y, Liu J, Yao M, Song W, Zheng Y, Xu L, Sun M, Yang B, Bensoussan A, Chang D et al : Sailuotong Capsule Prevents the Cerebral Ischaemia-Induced Neuroinflammation and Impairment of Recognition Memory through Inhibition of LCN2 Expression. Oxid Med Cell Longev 2019, 2019:8416105. Yuan Y, Xu L, Geng Z, Liu J, Zhang L, Wu Y, He D, Qu P: The role of non-coding RNA network in atherosclerosis. Life Sci 2021, 265:118756. Fang J, Zhang Y, Chen D, Zheng Y, Jiang J: Exosomes and Exosomal Cargos: A Promising World for Ventricular Remodeling Following Myocardial Infarction. Int J Nanomedicine 2022, 17:4699–4719. Yang K, Liu J, Zhang X, Ren Z, Gao L, Wang Y, Lin W, Ma X, Hao M, Kuang H: H3 Relaxin Alleviates Migration, Apoptosis and Pyroptosis Through P2X7R-Mediated Nucleotide Binding Oligomerization Domain-Like Receptor Protein 3 Inflammasome Activation in Retinopathy Induced by Hyperglycemia. Front Pharmacol 2020, 11:603689. Lascano S, Arévalo C, Montealegre-Melendez I, Muñoz S, Rodriguez-Ortiz JA, Trueba P, Torres Y: Porous titanium for biomedical applications: Evaluation of the conventional powder metallurgy frontier and space-holder technique. Applied Sciences 2019, 9(5):982. Zhou Y, Li KS, Liu L, Li SL: MicroRNA–132 promotes oxidative stress–induced pyroptosis by targeting sirtuin 1 in myocardial ischaemia–reperfusion injury. Int J Mol Med 2020, 45(6):1942–1950. Mao Q, Liang XL, Zhang CL, Pang YH, Lu YX: LncRNA KLF3-AS1 in human mesenchymal stem cell-derived exosomes ameliorates pyroptosis of cardiomyocytes and myocardial infarction through miR-138-5p/Sirt1 axis. Stem Cell Res Ther 2019, 10(1):393. Wang J, Zhao SM: LncRNA-antisense non-coding RNA in the INK4 locus promotes pyroptosis via miR-497/thioredoxin-interacting protein axis in diabetic nephropathy. Life Sci 2021, 264:118728. Xi X, Yang Y, Ma J, Chen Q, Zeng Y, Li J, Chen L, Li Y: MiR-130a alleviated high-glucose induced retinal pigment epithelium (RPE) death by modulating TNF-alpha/SOD1/ROS cascade mediated pyroptosis. Biomed Pharmacother 2020, 125:109924. Zhao S, Tan Y, Qin J, Xu H, Liu L, Wan H, Zhang C, Fan W, Qu S: MicroRNA-223-3p promotes pyroptosis of cardiomyocyte and release of inflammasome factors via downregulating the expression level of SPI1 (PU.1). Toxicology 2022, 476:153252. Henaoui IS, Jacovetti C, Guerra Mollet I, Guay C, Sobel J, Eliasson L, Regazzi R: PIWI-interacting RNAs as novel regulators of pancreatic beta cell function. Diabetologia 2017, 60(10):1977–1986. Gao XQ, Zhang YH, Liu F, Ponnusamy M, Zhao XM, Zhou LY, Zhai M, Liu CY, Li XM, Wang M et al : The piRNA CHAPIR regulates cardiac hypertrophy by controlling METTL3-dependent N(6)-methyladenosine methylation of Parp10 mRNA. Nat Cell Biol 2020, 22(11):1319–1331. Iliev R, Fedorko M, Machackova T, Mlcochova H, Svoboda M, Pacik D, Dolezel J, Stanik M, Slaby O: Expression Levels of PIWI-interacting RNA, piR-823, Are Deregulated in Tumor Tissue, Blood Serum and Urine of Patients with Renal Cell Carcinoma. Anticancer Res 2016, 36(12):6419–6423. Feng J, Yang M, Wei Q, Song F, Zhang Y, Wang X, Liu B, Li J: Novel evidence for oncogenic piRNA-823 as a promising prognostic biomarker and a potential therapeutic target in colorectal cancer. J Cell Mol Med 2020, 24(16):9028–9040. Ai L, Mu S, Sun C, Fan F, Yan H, Qin Y, Cui G, Wang Y, Guo T, Mei H et al : Myeloid-derived suppressor cells endow stem-like qualities to multiple myeloma cells by inducing piRNA-823 expression and DNMT3B activation. Mol Cancer 2019, 18(1):88. Buonafine M, Martinez-Martinez E, Amador C, Gravez B, Ibarrola J, Fernandez-Celis A, El Moghrabi S, Rossignol P, Lopez-Andres N, Jaisser F: Neutrophil Gelatinase-Associated Lipocalin from immune cells is mandatory for aldosterone-induced cardiac remodeling and inflammation. J Mol Cell Cardiol 2018, 115:32–38. Tarin C, Fernandez-Garcia CE, Burillo E, Pastor-Vargas C, Llamas-Granda P, Castejon B, Ramos-Mozo P, Torres-Fonseca MM, Berger T, Mak TW et al : Lipocalin-2 deficiency or blockade protects against aortic abdominal aneurysm development in mice. Cardiovasc Res 2016, 111(3):262–273. Amersfoort J, Schaftenaar FH, Douna H, van Santbrink PJ, Kroner MJ, van Puijvelde GHM, Quax PHA, Kuiper J, Bot I: Lipocalin-2 contributes to experimental atherosclerosis in a stage-dependent manner. Atherosclerosis 2018, 275:214–224. Sivalingam Z, Erik Magnusson N, Grove EL, Hvas AM, Dalby Kristensen S, Bojet Larsen S: Neutrophil gelatinase-associated lipocalin (NGAL) and cardiovascular events in patients with stable coronary artery disease. Scand J Clin Lab Invest 2018, 78(6):470–476. Karaolanis G, Moris D, Palla VV, Karanikola E, Bakoyiannis C, Georgopoulos S: Neutrophil Gelatinase Associated Lipocalin (NGAL) as a Biomarker. Does It Apply in Abdominal Aortic Aneurysms? A Review of Literature. Indian J Surg 2015, 77(Suppl 3):1313–1317. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4371914","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":299111921,"identity":"94b70d7d-121f-4be2-9c65-45c635faa271","order_by":0,"name":"Yao Tan","email":"","orcid":"","institution":"Hunan International Scientific and Technological Cooperation Base of Arteriosclerotic disease, University of South China","correspondingAuthor":false,"prefix":"","firstName":"Yao","middleName":"","lastName":"Tan","suffix":""},{"id":299111922,"identity":"f09d4b5e-35d7-4ff1-b1d2-086df5ff7219","order_by":1,"name":"Qian Zeng","email":"","orcid":"","institution":"Xiangtan Central Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Zeng","suffix":""},{"id":299111923,"identity":"b80a43af-cbf8-4611-9ce8-5d097d359ac8","order_by":2,"name":"Xinguo Sun","email":"","orcid":"","institution":"The Affiliated Nanhua Hospital, University of South China,","correspondingAuthor":false,"prefix":"","firstName":"Xinguo","middleName":"","lastName":"Sun","suffix":""},{"id":299111924,"identity":"945f3a3f-8eef-4b4e-881a-9df50edfdd53","order_by":3,"name":"Jianning Qin","email":"","orcid":"","institution":"Hunan International Scientific and Technological Cooperation Base of Arteriosclerotic disease, University of South China","correspondingAuthor":false,"prefix":"","firstName":"Jianning","middleName":"","lastName":"Qin","suffix":""},{"id":299111925,"identity":"d3d9e2c0-ae39-4cbc-922b-2b6f22eb80c4","order_by":4,"name":"Yang Han","email":"","orcid":"","institution":"Hunan International Scientific and Technological Cooperation Base of Arteriosclerotic disease, University of South China","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Han","suffix":""},{"id":299111927,"identity":"f15da709-3fba-4792-bb44-ffd0c5c07ec5","order_by":5,"name":"Simin Zhao","email":"","orcid":"","institution":"Hunan International Scientific and Technological Cooperation Base of Arteriosclerotic disease, University of South China","correspondingAuthor":false,"prefix":"","firstName":"Simin","middleName":"","lastName":"Zhao","suffix":""},{"id":299111929,"identity":"3bf144b9-d921-44b9-b120-904a6e32979b","order_by":6,"name":"Hengquan Wan","email":"","orcid":"","institution":"Hunan International Scientific and Technological Cooperation Base of Arteriosclerotic disease, University of South China","correspondingAuthor":false,"prefix":"","firstName":"Hengquan","middleName":"","lastName":"Wan","suffix":""},{"id":299111931,"identity":"a17e7fdf-3f2e-4844-819e-ba4675a82c45","order_by":7,"name":"Shali Liu","email":"","orcid":"","institution":"Hunan International Scientific and Technological Cooperation Base of Arteriosclerotic disease, University of South China","correspondingAuthor":false,"prefix":"","firstName":"Shali","middleName":"","lastName":"Liu","suffix":""},{"id":299111933,"identity":"d3189714-5e41-4119-9a31-10c93d89b55e","order_by":8,"name":"Chi Zhang","email":"","orcid":"","institution":"Hunan International Scientific and Technological Cooperation Base of Arteriosclerotic disease, University of South China","correspondingAuthor":false,"prefix":"","firstName":"Chi","middleName":"","lastName":"Zhang","suffix":""},{"id":299111935,"identity":"9fbe9218-d08b-4b70-8dff-d0914e33ada9","order_by":9,"name":"Wenjing Fan","email":"","orcid":"","institution":"Hunan International Scientific and Technological Cooperation Base of Arteriosclerotic disease, University of South China","correspondingAuthor":false,"prefix":"","firstName":"Wenjing","middleName":"","lastName":"Fan","suffix":""},{"id":299111937,"identity":"1498096a-e702-40ab-8f9b-cab3792c3784","order_by":10,"name":"Shunlin Qu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1klEQVRIiWNgGAWjYHACNiC24GGQf3zwQUJFDdFaJHgYGNKSDR6cOUa8FiDOMZN82MJMWD3fjfRnj3l3SMiYMxxLq0hsYGPgb+9OwKtF8kaOuTHvGQkey8bmYzcSd8gwSJw5uwGvFoMbOWzSvG0SPAaH2dJuJJ5hYzCQyCWkJf0ZRMsxHrOCxDZmYrQkmEG0nOExYyBKi+SZN2aSc0FabrAlSyScOcZD0C98x9OfSbxts7E3uMF88OOPiho5/vZe/FoYDqDxefArx6ZlFIyCUTAKRgEGAABTaUVyG8ectgAAAABJRU5ErkJggg==","orcid":"","institution":"Hunan International Scientific and Technological Cooperation Base of Arteriosclerotic disease, University of South China","correspondingAuthor":true,"prefix":"","firstName":"Shunlin","middleName":"","lastName":"Qu","suffix":""}],"badges":[],"createdAt":"2024-05-05 13:44:05","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4371914/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4371914/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56265673,"identity":"b9dc6172-7804-41d5-b63e-ce07b1e2f49c","added_by":"auto","created_at":"2024-05-10 15:56:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":228687,"visible":true,"origin":"","legend":"\u003cp\u003eHigh glucose promotes pyroptosis in human umbilical vein endothelial cells. (A) CCK8 assay was used to detect the growth activity of human umbilical vein endothelial cells treated with high glucose for 0-48 h. VS 0h group, #\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, n=3. (B) The cells were seeded in 96-well plates with 2 × 10\u003csup\u003e3 \u003c/sup\u003ecells per well, and the cell growth activity was detected by CCK-8 reagent staining after the cells were treated with high glucose for 24 h. VS NG group, **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, n=3. (C-E) The relative levels of LDH, IL-1β and IL-18 in the culture supernatant of endothelial cells in NG, HG and MG groups. Vs NG group, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, n=3. (F) protein levels of NLRP3, GSDMD, caspase-1 and ASC in NG group, HG group and MG group. Vs NG group, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, n=4.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4371914/v1/804285415f7901a6aba974fc.png"},{"id":56265670,"identity":"59157f15-5bdd-4e8a-8bf4-2025730fbdd1","added_by":"auto","created_at":"2024-05-10 15:56:12","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":444233,"visible":true,"origin":"","legend":"\u003cp\u003epiRNA-823 inhibits HG-induced pyroptosis in human umbilical vein endothelial cells. (A) The expression of piRNA-823 was determined by RT-qPCR after 24 hours of treatment of endothelial cells with HG. VS NG group, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, n=3. (B) The transfection of piRNA-823 mimics labeled with CY3 was observed under a fluorescence microscope 24 hours after transfection. (C) RT-qPCR was used to detect the expression of piRNA-823 in endothelial cells 24 hours after transfection with piRNA-823 mimics. VS NC group, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, n=5. (D-F) The relative levels of LDH, IL-1β and IL-18 in the cell culture supernatant of HG group, HG+piRNA-823 mimics, HG+piRNA-823 mimics-control, HG+piRNA-823 inhibitor, HG+piRNA-823 inhibitor-control group. VS HG group, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, n=3. (G) Protein levels of NLRP3, GSDMD, caspase-1 and ASC in endothelial cells of HG group, HG+piRNA-823 mimics, HG+piRNA-823 mimics-control, HG+piRNA-823 inhibitor, HG+piRNA-823 inhibitor-control group. VS HG group, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, n=4.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4371914/v1/19f9653839f8cb638f21f4ea.png"},{"id":56265671,"identity":"d7375f52-b8dd-46c3-9964-d80412661c13","added_by":"auto","created_at":"2024-05-10 15:56:14","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":602559,"visible":true,"origin":"","legend":"\u003cp\u003eLCN2 is the target of piRNA-823. (A) Scatter plot between the two groups of samples. HG+piRNA-823 mimics group and HG+piRNA-823 mimics-control group. Red dots indicate up-regulated genes and green dots indicate down-regulated genes. (B) Heat map of differentially expressed genes between HG+piRNA-823 mimics group and HG+piRNA-823 mimics-control group. Red and blue represent up-regulated and down-regulated genes, respectively, n=3. (C) mRNA levels of LCN2 in cells of HG+piRNA-823 mimics group and HG+piRNA-823 mimics-control group. VS HG+piRNA-823 mimics-NG group, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, n=6 (D) The expression of LCN2 protein in different groups was detected by Western blotting. VS HG group, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, n=3. (E) Immunofluorescence images showed that LCN2 expression in human umbilical vein endothelial cells in HG group, HG+piRNA-823 mimics, HG+piRNA-823 mimics-control, HG+piRNA-823 inhibitor, HG+piRNA-823 inhibitor-control group. Blue: nuclear staining (DAPI); Red: LCN2 staining. VS HG group, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, n=3.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4371914/v1/b6820aabb268fb42c9d64c7d.png"},{"id":56265672,"identity":"cd23c084-dccd-4f01-a1e6-50148f9f9dcc","added_by":"auto","created_at":"2024-05-10 15:56:14","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":718848,"visible":true,"origin":"","legend":"\u003cp\u003epiRNA-823 targeted LCN2 to inhibit high glucose-induced HUVEC pyroptosis. (A) LCN2 labeled with green light is transfected into cells for 24 hours and the transfection is observed under a fluorescence microscope. (B) LCN2 protein expression in HG+ pcDNA-vector and HG+ pcDNA-LCN2 groups was detected by Western blotting. VS HG+ pcDNA-vector group, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, n=4. (C-E) The relative levels of LDH, IL-1β and IL-18 in the cell culture supernatant of HG group, HG+piRNA-823mimics, HG+piRNA-823 mimics-control, HG+piRNA-823mimics +pcDNA-LCN2, HG+piRNA-823mimics + pcDNA-vector group. VS HG group, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, VS HG+piRNA-823mimics #\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, n=3. (F) Western blotting detection protein levels of NLRP3, GSDMD, caspase-1 and ASC in endothelial cells of HG group, HG+piRNA-823mimics, HG+piRNA-823 mimics-control, HG+piRNA-823mimics+pcDNA-LCN2, HG+piRNA-823mimics + pcDNA-vector group. VS HG group, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, VS HG+piRNA-823mimics #\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, n=4.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4371914/v1/3cc4ad45a578249478fd272d.png"},{"id":56265688,"identity":"29598dc5-edb1-4ebf-825a-720d5984f174","added_by":"auto","created_at":"2024-05-10 15:56:22","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":714431,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of piRNA-823 targeting LCN2 on HG-induced endothelial cell morphology (Scale =5μm). Compared with the NG group, the cell edges of the HG group were irregular, the cells were swollen, enlarged and flattened, the surface microvilli were significantly reduced, and membrane pores and holes of different sizes were visible on the cell surface. Under the conditions of high glucose culture, the expression of piRNA-823 was increased, some microvilli appeared on the cell surface, and the pores on the cell membrane were significantly improved compared with the HG group. After increasing LCN2 expression, cell pyroptosis was significantly aggravated, and cell swelling became larger, surface microvilli disappeared, and enlarged pores could be seen on the cell surface.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4371914/v1/709595b134d1287472bf435e.png"},{"id":56265669,"identity":"1571f8e3-f1b7-41ab-a1dc-ac37e61819c2","added_by":"auto","created_at":"2024-05-10 15:56:12","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":318014,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of piRNA-823 targeting LCN2 to inhibit high glucose-induced HUVEC pyroptosis. Under high glucose conditions, increasing the expression of piRNA-823 in human umbilical vein endothelial cells can inhibit LCN2 expression, thereby downregulating the expression of inflammatory complexes formed by caspase-1, ASC and NLRP3, which in turn affects the mature release of pro-inflammatory cytokines IL-1β and IL-18 and the cleavage of GSDMD, and ultimately exerts a protective effect on cell pyroptosis.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4371914/v1/fdb691d05d31c8657ca6ee01.png"},{"id":56266297,"identity":"1b1195ae-ae7d-4e44-9670-328c6d3bda0d","added_by":"auto","created_at":"2024-05-10 16:04:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3836535,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4371914/v1/d4909612-8a01-4a46-9e96-9df917462bc7.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"piRNA-823 exerts protective effects on high glucose concentration–induced HUVEC pyroptosis by targeting LCN2","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn 2019, the number of cardiovascular diseases in China accounted for nearly a quarter of the national population, reaching 330\u0026nbsp;million and accounting for 46.74% and 44.26% of deaths in rural areas and cities, respectively[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Diabetes mellitus is a chronic metabolic disease characterized by hyperglycemia, and long-term hyperglycemia causes vascular complications, such as heart, brain, and kidney diseases, which are the main causes of death[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Vascular endothelial injury and dysfunction are the early pathological basis of diabetic vascular complications, and endothelial cell pyroptosis is an important cause of endothelial dysfunction. Improving endothelial cell dysfunction induced by a high glucose concentration can effectively inhibit the progression of diabetic vascular lesions[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, how to reduce and prevent the pyroptosis of vascular endothelial cells is of great significance because it improves endothelial cell function and treat or prevent diabetic angiopathy. High glucose concentrations cause endothelial cells to produce excessive amounts of oxygen radicals and glycosylated end products, thereby inducing the formation of NOD-like receptor family pyrin domain-containing 3 (NLRP3) inflammasomes, triggering cell pyrosis and inflammation, and promoting the occurrence of various cardiovascular diseases, such as diabetes, atherosclerosis, and myocardial ischemia\u0026ndash;reperfusion injury (I/R)[\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] .\u003c/p\u003e \u003cp\u003ePyroptosis is a new form of pro-inflammatory programmed cell death. The classical pyroptosis pathway relies on the activation of caspase-1, and the pattern recognition receptor in a cell senses the stimulation of signals from bacteria, viruses, cholesterol, and other signals. Then, it recruits apoptosis-associated speck-like protein containing a CARD (ASC) to bind to caspase-1 precursors and form NLRP3 inflammatory complexes and activate caspase-1. Activated caspase-1 directly shears gasdermin D (GSDMD) to produce N-terminal amino acid peptides, which have lipophilicity at the N-terminus and combine with the lipid layer inside the cell membrane to form 10\u0026ndash;20 mm pores. The subsequent release of inflammatory factors and cell contents result in an inflammatory response. It can cut the precursors of interleukin-1β (IL-1β) and interleukin 18 (IL-18), promote their maturation, and release them outside cells, expanding the inflammatory response. Moreover, pyroptosis leads to endothelial cell damage and dysfunction, thereby promoting the development of cardiovascular diseases[\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePIWI-interacting RNA (piRNA) is a class of short-chain noncoding RNA (ncRNA) found in germ cells in 2006 and approximately 24\u0026ndash;31 nt long, named because it binds to the PIWI protein family to function[\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. piRNA can bind to PIWI proteins to form piRNA\u0026ndash;PIWI complexes, which play an important role in spermatogenesis, transposon silencing, genomic rearrangement, and epigenetic regulation. piRNA was thought to be specific in germ cells, but recent studies have shown that it is also widely present in other tissues, such as heart, brain, liver, kidney, lung, small intestine, skeletal muscle, and pancreas tissues[\u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Studies have shown that piRNA is abnormally expressed in a variety of tumors and is closely related to the disease process by regulating tumor cell proliferation, apoptosis, and autophagy[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. piRNA-823 is a member of the piRNA family and can inhibit the proliferation and invasion of gastric and renal cancer cells and exert antitumor effects[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003csup\u003e,\u003c/sup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, in tumors such as multiple myeloma (MM), liver cancer, and colon cancer, the expression of piRNA-823 is upregulated, which can promote tumor cell proliferation and invasion and inhibit tumor cell apoptosis[\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The coculture of MM and endothelial cells showed significant increase in piRNA-823 expression in endothelial cells, promoted proliferation of and invasion by endothelial cells, inhibited apoptosis and enhanced vascular endothelial-derived growth factor (VEGF), and intercellular adhesion molecule-1 (ICAM-1) promotes angiogenesis[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The role of piRNA in cardiovascular disease is poorly studied, but piRNA is abnormally expressed in a variety of cardiovascular diseases and involved in disease progression[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. However, the role and potential mechanism of piRNA-823 in endothelial pyrosis are unclear.\u003c/p\u003e \u003cp\u003eIn this study, we used high glucose concentrations to induce endothelial cell pyroptosis and found that piRNA-823 inhibited high glucose concentration\u0026ndash;induced endothelial cell pyroptosis. We then found that LCN2 is a potential regulatory target of piRNA-823 through high-throughput sequencing. In addition, we modulated the expression levels of piRNA-823 and LCN2 to explore the role of piRNA-823 in endothelial cell pyroptosis and possible mechanism, providing a novel theoretical basis for the prevention and treatment of cardiovascular diseases.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMaterials\u003c/h2\u003e \u003cp\u003eCaspase-1 antibody was purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies directed against β-actin, NLRP3, ASC, and anti-rabbit IgG were provided by Proteintech (Rosemount, IL, USA). GSDMD antibody was purchased from Abcam (Cambridge, UK). LCN2 was obtained from ABclonal (Wuhan, China). Lipofectamine TM2000 were purchased from Invitrogen (Carlsbad, CA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eHuman umbilical vein endothelial cells (HUVECs) were purchased from Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). The HUVECs were cultured in Dulbecco\u0026rsquo;s modifed Eagle\u0026rsquo;s medium containing 10% fetal bovine serum in an incubator at 37 C, 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eRNA sequencing (RNA-seq)\u003c/h2\u003e \u003cp\u003epiRNA-823mimics (HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics group) and piRNA-823 mimics-control (HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics-control group) were transfected into cells, which in turn were inoculated into 6 cm cell culture dishes, placed in a CO\u003csub\u003e2\u003c/sub\u003e constant temperature incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C for 24 h. After the cells were washed, 1 mL of TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Waltham, MA) was added to each vial, and the mixtures was slowly shaken to make full contact with the cells. The cell suspensions were left to stand for 2 min at room temperature. The cells were carefully pipetted after all the cells fell off and transferred to RNase-free cryopreservation tubes. Three replicates were established for each group, and sample data analysis was performed at Genergy Biotechnology Co., Ltd. (Shanghai, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCell viability and LDH activity detection\u003c/h2\u003e \u003cp\u003eHUVECs (2 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells per well) were inoculated in a 96-well plate, and three multiple holes were set in each well. PBS was added to the outermost ring of the well plate to prevent evaporation. The culture plates were placed in the incubator for 12 h and then treated according to the experimental groups. Approximately 10 \u0026micro;L of CCK8 (Hanbio, Shanghai, China) solution was added to each well in the dark to prevent bubbles. The plate was placed in the incubator for 2 h, and the absorbance was measured at 450 nm using a microplate reader.\u003c/p\u003e \u003cp\u003eThe cell supernatants of each group were collected for lactate dehydrogenase (LDH) activity detection. A commercial assay kit for LDH activity (Jiancheng Bioeng Inst., China) was used according to the kit\u0026rsquo;s manual. The samples were identified using a microplate reader at 450 nm absorbance wavelength.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eReverse transcription and quantitative PCR assays\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted with MiPure cell/tissue miRNA kit (Vazyme,Nanjing, China) and was reverse transcribed to obtain cDNA using the miRNA first-strand cDNA synthesis kit (Vazyme, Nanjing, China). For assays of mRNA, cDNA was generated using the ChamQ Universal SYBR qPCR master mix (Vazyme, Nanjing, China), quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was carried out using ABI StepOne plus real-time PCR system and 48-well optical reaction plates (Applied Biosystems, Foster City, CA, USA). The primer sequences are as follows:\u003c/p\u003e \u003cp\u003epiRNA-hsa-823 R: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACG; piRNA-hsa-823 F: GTTGGTGGTATAGTGGTGAGCAT;\u003c/p\u003e \u003cp\u003eLCN2 R:AAGCGGATGAAGTTCTCCTTTA;\u003c/p\u003e \u003cp\u003eLCN2 F:GAGTTACCCTGGATTAACGAGT;\u003c/p\u003e \u003cp\u003eU6 R:AACGCTTCACGAATTTGCGT;\u003c/p\u003e \u003cp\u003eU6 F: CTCGCTTCGGCAGCACA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eCulture supernatants were collected and the concentrations of IL-1β and IL-18 in the supernatants were assessed by enzyme-linked immunosorbent assay (ELISA) (Elabscience, China) according to the manufacturer\u0026rsquo;s instructions. The levels were normalized to cell protein concentrations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eProtein samples (100 \u0026micro;g each) were loaded on a 10% SDS polyacrylamide gel and transferred onto a nitrocellulose filter membrane, which was subsequently blocked by 5% nonfat milk dissolved in TBST for 2 h. The blots were probed with primary antibodies against LCN2, GSDMD, caspase-1, NLRP3, and ASC. β-Actin was used as the internal control. The band intensities of target proteins were analyzed using ImageJ. Electrophoresis and immunoblotting were employed as described previously.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence staining\u003c/h2\u003e \u003cp\u003eFor immunofluorescence staining, HUVECs were fixed with 4% paraformaldehyde for 15 min, subjected to different stimulations, washed three times with PBS, and treated with 0.2% Triton X-100 (Solarbio, China) at room temperature for 20 min. Blocking solution (1% BSA and 0.1% Triton-X in PBS) was used to penetrate and incubate fixed cells at room temperature for 2 h. Primary antibodies against LCN2 was placed in PBS overnight at 4\u0026deg;C and then incubated with an appropriate secondary antibody (Proteintech Wuhan, China) for 1 h at room temperature. The nuclei were stained using 4\u0026prime;,6-diamidino-2-phenylindole (DAPI, Beyotime, Shanghai, China) for 10 min at room temperature. Immunofluorescence was examined under a fluorescence microscope (Thermo M5000, Invitrogen, MA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eScanning electron microscopy\u003c/h2\u003e \u003cp\u003eAfter the cells of each group were cultured, they were rinsed gently with PBS. Electron microscopy fixation solution (Servicebio Technology CO., LTD., Wuhan, China) was added at room temperature for 2 h to fix the cells after PBS was discarded. Severe shock was prevented, which would detach the cells from the cover glass. Tissue blocks were washed with 0.1 M PB (pH 7.4) three times for 15 min each and then transferred to 1% OsO4 in 0.1 M PB (pH 7.4) for 1\u0026ndash;2 h at room temperature. Then, the tissue blocks were washed with 0.1M PB (pH 7.4) three times for 15 min each. The cells are sequentially fed with 30% 50%, 70%, 80%, 90%, 95%, and 100% alcohol successively for 15 min each and then with isoamyl acetate for 15 min for dehydration. The samples were dried and then conductively treated. Images were collected with a scanning electron microscope (Servicebio Technology CO., LTD., Wuhan, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eContinuous variables were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;s.e.m. One-way ANOVA was carried out for multiple comparisons, and GraphPad Prism 6.0 (GraphPad Software, Inc., La Jolla, CA, USA) was used. P values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicated statistically significant differences.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eHigh glucose concentrations induce HUVEC pyroptosis\u003c/h2\u003e \u003cp\u003eAfter the treatment of endothelial cells with high levels of glucose for 0, 6, 12, 24, and 48 h successively, the growth viability of endothelial cells at 24 and 48 h was reduced, and the difference was statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Compared with the NG group (5.6 mmol/L glucose), the cell growth viability of endothelial cells was significantly reduced after 24 h of high-glucose treatment (25 mmol/L glucose ), and the mannitol isotonic control group (5.6 mmol/L glucose\u0026thinsp;+\u0026thinsp;19.4mmol/L mannitol) had no significant effect on endothelial cell growth viability after 24 h of treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). This result showed that the LDH level in the HG group was significantly higher than that in the NG and MG groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). In addition, ELISA results showed that the levels of pro-inflammatory factors IL-1β and IL-18 in the supernatant of the culture medium were significantly upregulated after 24 h of high-glucose treatment of the endothelial cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD,E). The expression levels of NLRP3, caspase-1, GSDMD, and ASC significantly increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). These results showed that high glucose concentrations promote endothelial cell pyroptosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003epiRNA-823 inhibited the high glucose concentration\u0026ndash;induced pyroptosis in HUVECs\u003c/h2\u003e \u003cp\u003eTo determine whether piRNA-823 is involved in high glucose concentration\u0026ndash;induced endothelial cell pyroptosis, we examined the expression levels of different groups of piRNA-823. After 24 h of high-glucose treatment, piRNA-823 expression was detected by RT-qPCR. The results showed a decrease in the expression of piRNA-823 after HG treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), suggesting that piRNA-823 is involved in high glucose concentration\u0026ndash;induced endothelial cell pyroptosis. We transfected endothelial cells with piRNA-823 mimics and piRNA-823 mimics-NC with a transfection kit. The expression level of piRNA-823 in endothelial cells increased significantly compared with that in the NC group after the transfection of the piRNA-823 mimics (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB,C). To explore the role of piRNA-823 in high glucose concentration\u0026ndash;induced endothelial cell pyroptosis, we divided the cells into five groups: HG, HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics, HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics-control, HG\u0026thinsp;+\u0026thinsp;piRNA-823 inhibitor, and HG\u0026thinsp;+\u0026thinsp;piRNA-823 inhibitor-control. The experimental results showed that the levels of LDH, IL-1β, and IL-18 in the culture supernatant of the HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics group decreased, whereas the levels of LDH, IL-1β, and IL-18 increased after the addition of the piRNA-823 inhibitor (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD\u0026ndash;F). In addition, Western blot results showed that the expression of pyroptosis-associated proteins NLRP3, caspase-1, GSDMD, and ASC in the HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics group decreased, and the inhibition of piRNA-823 upregulated the expression of pyroptosis-associated protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). The above results indicated that piRNA-823 inhibits high glucose concentration\u0026ndash;induced pyroptosis in endothelial cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eLCN2 is the target of piRNA-823\u003c/h2\u003e \u003cp\u003eTo explore the specific mechanism of the piRNA-823 inhibition of high glucose concentration\u0026ndash;induced pyroptosis in endothelial cells, we performed high-throughput sequencing analysis. Total RNA was extracted from the HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics and HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics-control groups for microarray expression analysis (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA,B). A total of 29,595 genes were found in the HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics group and had |log2FC| \u0026ge;1 and P value\u0026thinsp;\u0026le;\u0026thinsp;0.05. Furthermore, 371 differentially expressed genes were obtained: 140 upregulated and 231 downregulated. The top five genes with the largest differential expression were \u003cem\u003eSFRP1\u003c/em\u003e, \u003cem\u003eLCN2\u003c/em\u003e, \u003cem\u003ePSME3\u003c/em\u003e, \u003cem\u003eNTF4\u003c/em\u003e, and \u003cem\u003eMAGEA3\u003c/em\u003e. The interaction relationship between piRNA-823 and these five genes were analyzed through RNAInter (RNA Interactome Database). The absolute value of the negative value between LCN2 and piRNA-823 was the largest, indicating that they were tightly bound and the structure was stable. Although LCN2 is involved in inflammation, lipid metabolism, and iron transport in the body[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], its role in hyperglycemic endothelial cell pyrosis has not been reported. Thus, this study focused on the \u003cem\u003eLCN2\u003c/em\u003e gene.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe detected the mRNA expression of LCN2 through RT-qPCR. The expression of mRNA in LCN2 in the HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics group was significantly reduced compared with that in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), consistent with our previous results from high-throughput sequencing. The cells were divided into five groups, HG group, HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics, HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics-control, HG\u0026thinsp;+\u0026thinsp;piRNA-823 inhibitor and HG\u0026thinsp;+\u0026thinsp;piRNA-823 inhibitor-control. The results shown that overexpression of piRNA-823 significantly inhibited the expression of LCN2. Conversely, after interfering with piRNA-823, LCN2 expression increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). In addition, the cell fluorescence of CY-3-labeled LCN2 was also the same as above (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE), these suggest that LCN2 is the target of piRNA-823.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003epiRNA-823 inhibited HUVEC pyroptosis induced by high glucose concentration by targeting LCN2\u003c/h2\u003e \u003cp\u003eTo further verify whether high glucose concentration\u0026ndash;induced pyroptosis in endothelial cells is associated with piRNA-823-targeted regulation of LCN2, LCN2 recombinant plasmids were transfected into cells, transfection efficiency was observed under a fluorescence microscope (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), and the expression of the LCN2 protein was detected by western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Cells were divided into five groups: HG, HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics, HG\u0026thinsp;+\u0026thinsp;piRNA-823 mimics-control, HG\u0026thinsp;+\u0026thinsp;piRNA-823mimics\u0026thinsp;+\u0026thinsp;pcDNA-LCN2, and HG\u0026thinsp;+\u0026thinsp;piRNA-823mimics\u0026thinsp;+\u0026thinsp;pcDNA-vector. The levels of LDH, IL-1β, and IL-18 in the supernatants of the cell cultures were consistent with our previous study. Under high glucose culture conditions, the expression of piRNA-823 reduced the expression levels of LDH, IL-1β and IL-18. Conversely, the expression levels of LDH, IL-1β, and IL-18 increased after the expression of piRNA-823 was inhibited. These results were reversed after transfection with LCN2 recombinant plasmid (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC\u0026ndash;E). Similarly, the expression levels of pyroptosis-associated proteins NLRP3, caspase-1, GSDMD, and ASC were consistent with the results described above (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn addition, to further observe the effect of piRNA-823 targeting LCN2 on high glucose concentration\u0026ndash;induced endothelial cell morphology, we observed cell morphological changes through scanning electron microscopy. Compared with the NG group, the HG group had irregular cell edges, swollen and flattened cells, significantly reduced surface microvilli, lost cell membrane integrity, ruptured plasma membrane, cell content extrusion, and visible differently sized membrane pores the cell surface (indicated by the red arrow; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Under high-glucose culture conditions, the expression of piRNA-823 increased, and some microvilli appeared on the cell surface. The number of pores on the cell membrane was significantly reduced compared with that in the HG group, and the degree of cell apoptosis was reduced (HG\u0026thinsp;+\u0026thinsp;piR-823mimics). After the upregulation of LCN2 expression (HG\u0026thinsp;+\u0026thinsp;piRNA-823mimics\u0026thinsp;+\u0026thinsp;pcDNA-LCN2), the degree of cell apoptosis significantly decreased, and the swelling and enlargement of cells were observed. Moreover, surface microvilli disappeared, and pores on the cell surface increased in number and size. These results indicated that piRNA-823 targeting LCN2 inhibits high glucose concentration\u0026ndash;induced HUVEC pyroptosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe prevalence of diabetes is increasing year by year, which has imposed economic burden on patients and caused their suffering. Cardiovascular complications are the main causes of death. In vivo, vascular endothelial cells are damaged and vascular diastolic function is reduced as blood glucose concentration increases. These effects lead to endothelial cell dysfunction, which in turn leads to vascular complications in diabetic patients. These complications can be reduced by controlling the blood glucose levels of diabetic patients. ncRNA can regulate endothelial cell pyroptosis and is involved in a variety of cardiovascular diseases[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. However, the role of piRNA in endothelial cell pyroptosis is unclear. This experiment used high glucose concentrations to establish a cell pyroptosis model and then explored the role and possible mechanism of piRNA-823 in endothelial cell pyroptosis.\u003c/p\u003e \u003cp\u003ePyroptosis is a new form of pro-inflammatory programmed cell death. NLRP3 inflammasomes play an important role in cell pyroptosis and are multiprotein complexes composed of the receptor proteins NLRP3, ASC, and caspase-1, which lead to the excessive activation of the complexes under cell stress or in the presence of tissue damage or infectious pathogens. The activation of the downstream target caspase-1 promotes the secretion of inflammatory factors, such as IL-1β, and the occurrence of cell pyroptosis. Yang et al.[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] showed that in a high-glucose environment, NLRP3 inflammasomes are overactivated, the secretion of inflammatory factors IL-1β and IL-18 increases, and the inhibited activation of NLRP3 inflammasomes can inhibit cell pyroptosis. Gu et al.[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] found that the amounts of released LDH, IL-1β, and IL-18 increased in endothelial cells treated with glucose at high concentrations, and the expression levels of GSDMD and caspase-1 proteins increased. Our study found that high glucose concentrations significantly increase the expression of pyroptosis-related proteins and promote the secretion of inflammatory factors, indicating that high-glucose treatment significantly promotes pyroptosis in endothelial cells.\u003c/p\u003e \u003cp\u003encRNA is involved in the occurrence and development of a variety of cardiovascular diseases by regulating cell pyroptosis. In myocardial I/R, miR-132 expression is significantly upregulated, and the PGC-1α/NRF2 signaling pathway is activated by targeting Sirt1 and promotes pyroptosis, thereby aggravating myocardial I/R injury[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. lncRNA KLF3-AS1 competitively binds to miR-138-5p to regulate the expression of Sirt1, thereby inhibiting cell pyroptosis and inhibiting the process of myocardial infarction[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In addition, in diabetic nephropathy, miR-497 expression is reduced, and miR-497 overexpression inhibits caspase-1-dependent cell pyroptosis[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. miR-130a mitigates cell damage by regulating cell pyroptosis caused by the TNF-α/SOD1/ROS axis[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. We also found observed in our previous studies that miRNA-223-3p promotes cardiomyocyte pyroptosis by downregulating the release of inflammasome factor SPI1 (PU.1)[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003epiRNA is a class of small-molecule ncRNAs. Little research into the role of piRNA in cardiovascular diseases has been conducted. piRNA is abnormally expressed in cardiovascular diseases and may be involved in the occurrence and development of diabetes and heart-related diseases, but the molecular mechanisms and signaling pathways involved in piRNA function have not been fully elucidated. One study analyzed piRNA expression profiling of islet cells in a rat model of type 2 diabetes mellitus was analyzed by using a gene chip technology and found that the expression levels of DQ732700 and DQ746748 significantly increased; these effects led to glucose-induced insulin secretion defects, but the specific mechanism is unclear[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Gao et al.[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] found that a type of piRNA (CHAPIR) is abundantly expressed in myocardial hypertrophy and can promote myocardial pathological hypertrophy and cardiac remodeling by targeting the m6A methylation of METTL3-mediated Parp10 mRNA transcripts. These studies provided novel insights into the potential value of piRNA in the clinical diagnosis, prognosis, and treatment of diabetes and heart diseases.\u003c/p\u003e \u003cp\u003epiRNA-823 is an important piRNA that is abnormally expressed in a variety of tumors and is involved in the development of multiple tumors. The expression of piRNA-823 in gastric and kidney cancer tissues is reduced, and the upregulation of piRNA-823 inhibits the growth of gastric cancer cells[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. However, the expression of piRNA-823 in colon cancer tissues significantly increased and may have promoted the proliferation, invasion, and anti-apoptosis activity of colorectal cancer cells by regulating the G6PD/HIF-1α pathway[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. The expression of piRNA-823 was upregulated in MM tissues and cell lines, and the disruption of piRNA-823 expression inhibited tumor cell proliferation, induced apoptosis, and inhibited tumor development[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Extracellular vesicles (EVs) carry a variety of RNA molecules and play a crucial role in the connection between tumors and surrounding stromal cells, including endothelial cells. Li et al.[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] found that piRNA-823 is mainly present in the peripheral blood of patients with MM and MM-derived EVs. In mice, when MM-derived EVs are cocultured with endothelial cells, piRNA-823 in EVs transfer to endothelial cells and promote the growth of transplanted tumors. The transfection of piRNA-823 mimics or MM-derived EVs significantly promotes endothelial cell proliferation, invasion, and tubule formation, possibly by enhancing the expression of VEGF, IL-6, and ICAM-1 and inhibiting apoptosis. These results suggest that piRNA-823 plays different roles in different tumors and piRNA-823 can be used as a biomarker and therapeutic target for diseases. The results of the present study showed that high glucose concentrations induced pyroptosis in endothelial cells while reducing the expression level of piRNA-823. Therefore, we speculated that piRNA-823 is involved in high glucose concentration\u0026ndash;induced endothelial cell pyroptosis. The transfection of piRNA-823 mimics reduced the expression levels of NLRP3, GSDMD, caspase-1, and ASC proteins and inhibited the secretion of LDH and inflammatory factors IL-1β and IL-18 in the supernatant of the culture medium. piRNA-823 can inhibit high glucose concentration\u0026ndash;induced endothelial cell pyroptosis. To further explore the specific mechanism of the piRNA-823 inhibition of high glucose concentration\u0026ndash;induced epithelial cell pyroptosis, we performed high-throughput sequencing analysis. Gene chip expression analysis indicated that LCN2 is the most tightly bound to piRNA-823 and has the most stable structure.\u003c/p\u003e \u003cp\u003eLCN2 is a secreted protein of neutrophil and expressed in the kidneys, brain, lungs, liver, adipocytes, neutrophils, macrophages, endothelial cells, smooth muscle cells, cardiomyocytes[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003csup\u003e,\u003c/sup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. White adipose tissues are the main sources of LCN2. In a low expression state, LCN2 expression is significantly increased when epithelial cells are stimulated by infection, inflammation, or ischemia and is involved in the body's inflammatory response, lipid metabolism, and iron transport[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. LCN2 plays a key role in cardiovascular remodeling and unstable atherosclerotic plaque formation[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003csup\u003e,\u003c/sup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. LCN2 not only is involved in the development of hypertension but also promotes the occurrence of aneurysms through mechanisms, such as inflammatory response[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. At present, LCN2-mediated oxidative stress, chronic inflammatory response, and fibrosis play an important role in the occurrence and development of cardiovascular diseases. Our study showed that increasing the expression of piRNA-823 mimics reduces the degree of pyroptosis under high-glucose culture conditions. LCN2 recombinant plasmids transfected into cells promotes pyroptosis. This result was confirmed by changes in cell morphology observed through scanning electron microscopy.\u003c/p\u003e \u003cp\u003eIn summary, the expression of piRNA-823 decreased in high glucose conccentration\u0026ndash;induced endothelial cells, and increasing the expression of piRNA-823 inhibited high glucose concentration\u0026ndash;induced endothelial cell pyroptosis. The mechanism was to reverse hyperglycemia-induced HUVEC pyroptosis by targeting LCN2. This mechanism serves as a basis for the further study of the roles of piRNA in endothelial cell pyroptosis and in the prevention and treatment of cardiovascular diseases caused by diabetes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interests\u003c/h2\u003e \u003cp\u003eAuthors declare no conflict of interests.\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by The National Natural Science Foundation of China, China [NO. 81900424, 81670424]; The National Natural Science Foundation of Hunan Province, China [NO. 218JJ2345]; Hunan Provincial Health Commission key project [NO.202102063633].\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eY.T. and Q.Z. were responsible for study design and the conduct of the experiment. SL. Q. and WJ.F. were responsible for technical guidance.XG.S., JN.Q., Y.H., SM.Z., HQ.W., SL.L. were responsible for material preparation, Y.T. wrote the manuscript and researched data, C.Z. contributed to discussion and reviewed manuscript.The guarantor of this study, Y.T. was granted unrestricted access to all the data and assumes full responsibility for ensuring the integrity and accuracy of data analysis.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003ewriting committee of the report on cardiovascular h, diseases in c: Report on Cardiovascular Health and Diseases in China 2021: An Updated Summary. Biomed Environ Sci 2022, 35(7):573\u0026ndash;603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJannapureddy S, Sharma M, Yepuri G, Schmidt AM, Ramasamy R: Aldose Reductase: An Emerging Target for Development of Interventions for Diabetic Cardiovascular Complications. Front Endocrinol (Lausanne) 2021, 12:636267.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoco C, Sgarra L, Potenza MA, Nacci C, Pasculli B, Barbano R, Parrella P, Montagnani M: Can Epigenetics of Endothelial Dysfunction Represent the Key to Precision Medicine in Type 2 Diabetes Mellitus? Int J Mol Sci 2019, 20(12).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao P, He FF, Tang H, Lei CT, Chen S, Meng XF, Su H, Zhang C: NADPH oxidase-induced NALP3 inflammasome activation is driven by thioredoxin-interacting protein which contributes to podocyte injury in hyperglycemia. \u003cem\u003eJ Diabetes Res\u003c/em\u003e 2015, 2015:504761.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCong L, Gao Z, Zheng Y, Ye T, Wang Z, Wang P, Li M, Dong B, Yang W, Li Q \u003cem\u003eet al\u003c/em\u003e: Electrical stimulation inhibits Val-boroPro-induced pyroptosis in THP-1 macrophages via sirtuin3 activation to promote autophagy and inhibit ROS generation. Aging (Albany NY) 2020, 12(7):6415\u0026ndash;6435.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Liu X, Bai X, Lin Y, Li Z, Fu J, Li M, Zhao T, Yang H, Xu R \u003cem\u003eet al\u003c/em\u003e: Melatonin prevents endothelial cell pyroptosis via regulation of long noncoding RNA MEG3/miR-223/NLRP3 axis. J Pineal Res 2018, 64(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia M, Boini KM, Abais JM, Xu M, Zhang Y, Li PL: Endothelial NLRP3 inflammasome activation and enhanced neointima formation in mice by adipokine visfatin. Am J Pathol 2014, 184(5):1617\u0026ndash;1628.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia X, Shi Q, Song X, Fu J, Liu Z, Wang Y, Wang Y, Su C, Song E, Song Y: Tetrachlorobenzoquinone Stimulates NLRP3 Inflammasome-Mediated Post-Translational Activation and Secretion of IL-1beta in the HUVEC Endothelial Cell Line. Chem Res Toxicol 2016, 29(3):421\u0026ndash;429.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang D, Jin W, Wu R, Li J, Park SA, Tu E, Zanvit P, Xu J, Liu O, Cain A \u003cem\u003eet al\u003c/em\u003e: High Glucose Intake Exacerbates Autoimmunity through Reactive-Oxygen-Species-Mediated TGF-beta Cytokine Activation. Immunity 2019, 51(4):671\u0026ndash;681 e675.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T \u003cem\u003eet al\u003c/em\u003e: A novel class of small RNAs bind to MILI protein in mouse testes. Nature 2006, 442(7099):203\u0026ndash;207.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrivna ST, Beyret E, Wang Z, Lin H: A novel class of small RNAs in mouse spermatogenic cells. Genes Dev 2006, 20(13):1709\u0026ndash;1714.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE: Characterization of the piRNA complex from rat testes. Science 2006, 313(5785):363\u0026ndash;367.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu QJ, Zhu M, Xu XX, Meng XM, Wu YG: Exosomes from high glucose-treated macrophages activate glomerular mesangial cells via TGF-beta1/Smad3 pathway in vivo and in vitro. FASEB J 2019, 33(8):9279\u0026ndash;9290.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang R, Chen X, Ge S, Wang Q, Liu Y, Chen H, Xu J, Wu J: MiR-21-5p Induces Pyroptosis in Colorectal Cancer via TGFBI. Front Oncol 2020, 10:610545.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang F, Qin Y, Lv J, Wang Y, Che H, Chen X, Jiang Y, Li A, Sun X, Yue E \u003cem\u003eet al\u003c/em\u003e: Silencing long non-coding RNA Kcnq1ot1 alleviates pyroptosis and fibrosis in diabetic cardiomyopathy. Cell Death Dis 2018, 9(10):1000.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan Y, Qin JN, Wan HQ, Zhao SM, Zeng Q, Zhang C, Qu SL: PIWI/piRNA-mediated regulation of signaling pathways in cell apoptosis. Eur Rev Med Pharmacol Sci 2022, 26(16):5689\u0026ndash;5697.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerera BPU, Tsai ZT, Colwell ML, Jones TR, Goodrich JM, Wang K, Sartor MA, Faulk C, Dolinoy DC: Somatic expression of piRNA and associated machinery in the mouse identifies short, tissue-specific piRNA. Epigenetics 2019, 14(5):504\u0026ndash;521.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRajan KS, Velmurugan G, Pandi G, Ramasamy S: miRNA and piRNA mediated Akt pathway in heart: antisense expands to survive. Int J Biochem Cell Biol 2014, 55:153\u0026ndash;156.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDharap A, Nakka VP, Vemuganti R: Altered expression of PIWI RNA in the rat brain after transient focal ischemia. Stroke 2011, 42(4):1105\u0026ndash;1109.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng Q, Wan H, Zhao S, Xu H, Tang T, Oware KA, Qu S: Role of PIWI-interacting RNAs on cell survival: Proliferation, apoptosis, and cycle. IUBMB Life 2020, 72(9):1870\u0026ndash;1878.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIliev R, Stanik M, Fedorko M, Poprach A, Vychytilova-Faltejskova P, Slaba K, Svoboda M, Fabian P, Pacik D, Dolezel J \u003cem\u003eet al\u003c/em\u003e: Decreased expression levels of PIWIL1, PIWIL2, and PIWIL4 are associated with worse survival in renal cell carcinoma patients. Onco Targets Ther 2016, 9:217\u0026ndash;222.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng J, Deng H, Xiao B, Zhou H, Zhou F, Shen Z, Guo J: piR-823, a novel non-coding small RNA, demonstrates in vitro and in vivo tumor suppressive activity in human gastric cancer cells. Cancer Lett 2012, 315(1):12\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin J, Jiang XY, Qi W, Ji CG, Xie XL, Zhang DX, Cui ZJ, Wang CK, Bai Y, Wang J \u003cem\u003eet al\u003c/em\u003e: piR-823 contributes to colorectal tumorigenesis by enhancing the transcriptional activity of HSF1. Cancer Sci 2017, 108(9):1746\u0026ndash;1756.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan H, Wu QL, Sun CY, Ai LS, Deng J, Zhang L, Chen L, Chu ZB, Tang B, Wang K \u003cem\u003eet al\u003c/em\u003e: piRNA-823 contributes to tumorigenesis by regulating de novo DNA methylation and angiogenesis in multiple myeloma. Leukemia 2015, 29(1):196\u0026ndash;206.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang X, Xie X, Wang X, Wang Y, Jiang X, Jiang H: The Combination of piR-823 and Eukaryotic Initiation Factor 3 B (EIF3B) Activates Hepatic Stellate Cells via Upregulating TGF-beta1 in Liver Fibrogenesis. Med Sci Monit 2018, 24:9151\u0026ndash;9165.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRehwald C, Schnetz M, Urbschat A, Mertens C, Meier JK, Bauer R, Baer P, Winslow S, Roos FC, Zwicker K \u003cem\u003eet al\u003c/em\u003e: The iron load of lipocalin-2 (LCN-2) defines its pro-tumour function in clear-cell renal cell carcinoma. Br J Cancer 2020, 122(3):421\u0026ndash;433.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Liu J, Yao M, Song W, Zheng Y, Xu L, Sun M, Yang B, Bensoussan A, Chang D \u003cem\u003eet al\u003c/em\u003e: Sailuotong Capsule Prevents the Cerebral Ischaemia-Induced Neuroinflammation and Impairment of Recognition Memory through Inhibition of LCN2 Expression. \u003cem\u003eOxid Med Cell Longev\u003c/em\u003e 2019, 2019:8416105.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan Y, Xu L, Geng Z, Liu J, Zhang L, Wu Y, He D, Qu P: The role of non-coding RNA network in atherosclerosis. Life Sci 2021, 265:118756.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang J, Zhang Y, Chen D, Zheng Y, Jiang J: Exosomes and Exosomal Cargos: A Promising World for Ventricular Remodeling Following Myocardial Infarction. Int J Nanomedicine 2022, 17:4699\u0026ndash;4719.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang K, Liu J, Zhang X, Ren Z, Gao L, Wang Y, Lin W, Ma X, Hao M, Kuang H: H3 Relaxin Alleviates Migration, Apoptosis and Pyroptosis Through P2X7R-Mediated Nucleotide Binding Oligomerization Domain-Like Receptor Protein 3 Inflammasome Activation in Retinopathy Induced by Hyperglycemia. Front Pharmacol 2020, 11:603689.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLascano S, Ar\u0026eacute;valo C, Montealegre-Melendez I, Mu\u0026ntilde;oz S, Rodriguez-Ortiz JA, Trueba P, Torres Y: Porous titanium for biomedical applications: Evaluation of the conventional powder metallurgy frontier and space-holder technique. Applied Sciences 2019, 9(5):982.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Y, Li KS, Liu L, Li SL: MicroRNA\u0026ndash;132 promotes oxidative stress\u0026ndash;induced pyroptosis by targeting sirtuin 1 in myocardial ischaemia\u0026ndash;reperfusion injury. Int J Mol Med 2020, 45(6):1942\u0026ndash;1950.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMao Q, Liang XL, Zhang CL, Pang YH, Lu YX: LncRNA KLF3-AS1 in human mesenchymal stem cell-derived exosomes ameliorates pyroptosis of cardiomyocytes and myocardial infarction through miR-138-5p/Sirt1 axis. Stem Cell Res Ther 2019, 10(1):393.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Zhao SM: LncRNA-antisense non-coding RNA in the INK4 locus promotes pyroptosis via miR-497/thioredoxin-interacting protein axis in diabetic nephropathy. Life Sci 2021, 264:118728.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXi X, Yang Y, Ma J, Chen Q, Zeng Y, Li J, Chen L, Li Y: MiR-130a alleviated high-glucose induced retinal pigment epithelium (RPE) death by modulating TNF-alpha/SOD1/ROS cascade mediated pyroptosis. Biomed Pharmacother 2020, 125:109924.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao S, Tan Y, Qin J, Xu H, Liu L, Wan H, Zhang C, Fan W, Qu S: MicroRNA-223-3p promotes pyroptosis of cardiomyocyte and release of inflammasome factors via downregulating the expression level of SPI1 (PU.1). Toxicology 2022, 476:153252.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHenaoui IS, Jacovetti C, Guerra Mollet I, Guay C, Sobel J, Eliasson L, Regazzi R: PIWI-interacting RNAs as novel regulators of pancreatic beta cell function. Diabetologia 2017, 60(10):1977\u0026ndash;1986.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao XQ, Zhang YH, Liu F, Ponnusamy M, Zhao XM, Zhou LY, Zhai M, Liu CY, Li XM, Wang M \u003cem\u003eet al\u003c/em\u003e: The piRNA CHAPIR regulates cardiac hypertrophy by controlling METTL3-dependent N(6)-methyladenosine methylation of Parp10 mRNA. Nat Cell Biol 2020, 22(11):1319\u0026ndash;1331.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIliev R, Fedorko M, Machackova T, Mlcochova H, Svoboda M, Pacik D, Dolezel J, Stanik M, Slaby O: Expression Levels of PIWI-interacting RNA, piR-823, Are Deregulated in Tumor Tissue, Blood Serum and Urine of Patients with Renal Cell Carcinoma. Anticancer Res 2016, 36(12):6419\u0026ndash;6423.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng J, Yang M, Wei Q, Song F, Zhang Y, Wang X, Liu B, Li J: Novel evidence for oncogenic piRNA-823 as a promising prognostic biomarker and a potential therapeutic target in colorectal cancer. J Cell Mol Med 2020, 24(16):9028\u0026ndash;9040.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAi L, Mu S, Sun C, Fan F, Yan H, Qin Y, Cui G, Wang Y, Guo T, Mei H \u003cem\u003eet al\u003c/em\u003e: Myeloid-derived suppressor cells endow stem-like qualities to multiple myeloma cells by inducing piRNA-823 expression and DNMT3B activation. Mol Cancer 2019, 18(1):88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuonafine M, Martinez-Martinez E, Amador C, Gravez B, Ibarrola J, Fernandez-Celis A, El Moghrabi S, Rossignol P, Lopez-Andres N, Jaisser F: Neutrophil Gelatinase-Associated Lipocalin from immune cells is mandatory for aldosterone-induced cardiac remodeling and inflammation. J Mol Cell Cardiol 2018, 115:32\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTarin C, Fernandez-Garcia CE, Burillo E, Pastor-Vargas C, Llamas-Granda P, Castejon B, Ramos-Mozo P, Torres-Fonseca MM, Berger T, Mak TW \u003cem\u003eet al\u003c/em\u003e: Lipocalin-2 deficiency or blockade protects against aortic abdominal aneurysm development in mice. Cardiovasc Res 2016, 111(3):262\u0026ndash;273.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmersfoort J, Schaftenaar FH, Douna H, van Santbrink PJ, Kroner MJ, van Puijvelde GHM, Quax PHA, Kuiper J, Bot I: Lipocalin-2 contributes to experimental atherosclerosis in a stage-dependent manner. Atherosclerosis 2018, 275:214\u0026ndash;224.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSivalingam Z, Erik Magnusson N, Grove EL, Hvas AM, Dalby Kristensen S, Bojet Larsen S: Neutrophil gelatinase-associated lipocalin (NGAL) and cardiovascular events in patients with stable coronary artery disease. Scand J Clin Lab Invest 2018, 78(6):470\u0026ndash;476.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaraolanis G, Moris D, Palla VV, Karanikola E, Bakoyiannis C, Georgopoulos S: Neutrophil Gelatinase Associated Lipocalin (NGAL) as a Biomarker. Does It Apply in Abdominal Aortic Aneurysms? A Review of Literature. Indian J Surg 2015, 77(Suppl 3):1313\u0026ndash;1317.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"piRNA-823, LCN2, pyroptosis, caspase-1, NLRP3, GSDMD","lastPublishedDoi":"10.21203/rs.3.rs-4371914/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4371914/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cb\u003ePurpose\u003c/b\u003e It has been reported that non-coding RNAs can regulate endothelial cell pyroptosis, thereby playing a role in diabetes and its vascular complications, however, few studies have been conducted to date to explore the effect of PIRNA in diabetic vascular complications, and we aimed to explore the effect of piRNA-823 on hyperglycemia-induced pyroptosis of human umbilical vein endothelial cells and the specific mechanism\u003c/p\u003e \u003cp\u003e \u003cb\u003eMethods\u003c/b\u003e LDH was detected in the supernatant of different groups, The levels of IL-1βand IL-18 were detected by ELISA. The protein expression levels of NLRP3, caspase-1, GSDMD and ASC were detected by WB, Total RNA was extracted from piRNA-823 mimics and piRNA-823 NC cells for high-throughput sequencing, and differentially expressed genes were screened by bioinformatics analysis. The expressions of pyroptosis-related proteins in different groups were detected and the morphological changes of cells were observed by fluorescence microscopy.\u003c/p\u003e \u003cp\u003e \u003cb\u003eResults\u003c/b\u003e High glucose can reduce piRNA-823 expression, and increasing piRNA-823 expression can inhibit hyperglucose-induced endothelial cell pyroptosis, and the mechanism is to reverse hyperglucose-induced HUVEC cell pyroptosis by targeting LCN2.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConclusion\u003c/b\u003e piRNA-823 targets LCN2 to inhibit hyperglycemic induced pyroptosis in human umbilical vein endothelial cells.\u003c/p\u003e","manuscriptTitle":"piRNA-823 exerts protective effects on high glucose concentration–induced HUVEC pyroptosis by targeting LCN2","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-10 15:56:05","doi":"10.21203/rs.3.rs-4371914/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e8aad496-a3e6-40d2-814c-ba26a79046f3","owner":[],"postedDate":"May 10th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-05-10T15:56:08+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-10 15:56:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4371914","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4371914","identity":"rs-4371914","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.