Tropomyosin 1 promotes platelet adhesion and clot contraction separate from its roles in developmental hematopoiesis

Tropomyosin 1 promotes platelet adhesion and clot contraction separate from its roles in developmental hematopoiesis | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Tropomyosin 1 promotes platelet adhesion and clot contraction separate from its roles in developmental hematopoiesis Po-Lun Kung , Victor Tsao , Alina D Peshkova , Oscar A. Marcos-Contreras , Kim Ha , Gennadiy Fonar , Nkemdilim Okoli , Brian M Dulmovits , Rong Qiu , Rolf D Bates , Janelle Yeboah , Carson Shalaby , Tyler Truex , Soomin Jeong , Vladimir R Muzykantov , Jacob W Myerson , View ORCID Profile Christopher S Thom doi: https://doi.org/10.1101/2025.07.31.667883 Po-Lun Kung 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Victor Tsao 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Alina D Peshkova 2 Department of Pharmacology, University of Pennsylvania School of Medicine , Philadelphia, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Oscar A. Marcos-Contreras 3 Department of Systems Pharmacology and Translational Therapeutics, Perelman School of Medicine, University of Pennsylvania , Philadelphia, PA USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kim Ha 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Gennadiy Fonar 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Nkemdilim Okoli 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Brian M Dulmovits 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Rong Qiu 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Rolf D Bates 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Janelle Yeboah 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Carson Shalaby 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Tyler Truex 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Soomin Jeong 3 Department of Systems Pharmacology and Translational Therapeutics, Perelman School of Medicine, University of Pennsylvania , Philadelphia, PA USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Vladimir R Muzykantov 2 Department of Pharmacology, University of Pennsylvania School of Medicine , Philadelphia, PA, USA 3 Department of Systems Pharmacology and Translational Therapeutics, Perelman School of Medicine, University of Pennsylvania , Philadelphia, PA USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jacob W Myerson 3 Department of Systems Pharmacology and Translational Therapeutics, Perelman School of Medicine, University of Pennsylvania , Philadelphia, PA USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christopher S Thom 1 Division of Neonatology, Children’s Hospital of Philadelphia , Pennsylvania, PA, USA 4 Department of Pediatrics, University of Pennsylvania Perelman School of Medicine , Philadelphia, PA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Christopher S Thom For correspondence: thomc{at}chop.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Genome-wide associations studies (GWAS) have linked the Tropomyosin 1 ( Tpm1 ) gene locus to quantitative blood trait variation, but related mechanisms are unclear. Tpm1 encodes an actin-binding protein that stabilizes actin filaments and influences cell adhesion, signaling, and actomyosin contractility. Murine Tpm1 deficiency enhances embryonic hemogenic endothelial cell specification, but it was unclear if these effects extended to postnatal hematopoiesis. We used Cdh5 Cre or Vav Cre models to conditionally ablate Tpm1 in endothelium or hematopoietic cells. Both models produced knockout mice in normal Mendelian ratios with complete Tpm1 ablation in postnatal blood. Endothelial Tpm1 deletion increased hemogenic endothelial cell specification, but did not change hematopoietic progenitor cell production nor adult blood counts. This suggested separate roles for Tpm1 in the embryonic and adult blood systems. GWAS suggested genetic architecture specifically linking decreased TPM1 expression to increased platelet count. We examined platelet lifespan and function to explain these findings. Tpm1KO increased platelet lifespan and diminished adhesion to fibronectin and fibrinogen. Decreased platelet clearance could explain increased platelet count in GWAS. Platelet fibrin binding is necessary for blood clot contraction, which reduces vascular occlusion following initial hemostasis. Tpm1KO reduced clot contraction and enhanced clot formation with worsened vascular occlusion in a ferric chloride-induced stroke model. These findings reveal a new role for Tpm1 in platelet function, offering insight into how cytoskeletal regulation impacts human platelet traits and pointing to novel targets to modify stroke risk and thrombotic disease. Introduction Genome-wide associations studies (GWAS) have linked thousands of loci to quantitative blood trait variation, but related genes and mechanisms remain elusive for most sites 1 , 2 . Platelet traits, such as platelet count (PLT) and mean platelet volume (MPV), are highly heritable (∼54-87%) 3 . Yet mechanisms and cell types that are relevant for altered platelet traits are complex. Factors intrinsic to developing blood cells (hematopoiesis), megakaryocytes (megakaryopoiesis), or platelets (thrombopoiesis) can influence platelet formation, Systemic factors like obesity or inflammation - extrinsic to developing blood cells - also influence platelet traits via influences on the bone marrow microenvironment or mature platelet lifespan in circulation 4 . Blood cells interact with all organs and impact complex disease states, highlighting a need to reveal mechanisms underlying blood trait variation 5 . We identified the Tropomyosin 1 (TPM1) gene locus from blood trait GWAS 6 . Tpm1 encodes an actin-binding protein that regulates actin cytoskeletal dynamics in many cell types 7 . Actin broadly impacts cell structure, movement, and signaling. TPM1 deficiency increases the formation of hemogenic endothelial cells (HEC), the embryonic precursors to hematopoietic stem and progenitor cells (HSPCs) that ultimately colonize the bone marrow and support lifelong hematopoiesis 8 ( Fig. 1 ). Embryonic lethality from Tpm1 -related cardiac dysmorphology prevented assessment of how Tpm1 knockout impacted postnatal hematopoiesis and blood cell function 8 , 9 . Download figure Open in new tab Figure 1. Tropomyosin 1 deficiency impacts formation of hemogenic endothelium but not postnatal bone marrow HSPC quantity,. A. Schematic of Cdh5 Cre and Vav Cre models that are induced at specific stages of developmental hematopoiesis. B. Tpm1 mRNA is eliminated in adult peripheral blood cells following conditional embryonic deletion. Semiquantitative real time PCR results normalized to TBP . C. Embryonic Tpm1 deletion in endothelial cells increases the incidence of Runx1 HECs. D. Embryonic Tpm1 deletion with Cdh5 Cre does not increase bone marrow LSK abundance. E. Tpm1 deletion in embryonic HSPCs with Vav Cre does not change bone marrow LSK abundance. **** p<0.0001, *** p<0.001, ** p<0.01, ns, not significant. The strongest GWAS signals at the TPM1 gene locus relate to platelet traits (p<10 −100 ) 1 , 2 . Platelets produced from megakaryocytes are critical for hemostasis and inflammation 10 . Blood vessel injury exposes factors that cause platelet activation and adherence to the site, initiating hemostatic responses 11 . Aggregated platelets form a temporary clot and entrap erythrocytes and white blood cells to enhance plug formation and inflammatory responses. These processes prevent hemorrhage and initiate wound healing, but large clots can obstruct blood flow and risk embolization 11 . Clot contraction is necessary to stabilize clots and permit resumption of blood flow. Clot formation demands platelet activation, fibrin binding, and actin-mediated cytoskeletal remodeling 12 , 13 . Therefore, effective hemostasis requires platelet activation, adhesion, cytoskeletal remodeling – all of which are actin-based properties to varying degrees. We hypothesized that Tpm1 impacted platelet function via actin regulation. We designed this study ascertain if the effects of Tpm1 perturbation during embryonic life carried through to postnatal hematopoiesis, or if Tpm1 has separable effects on platelet function. Using conditional knockout mice, we reveal novel roles for Tpm1 in platelet adhesion, clot formation and thrombosis that are distinct from effects on embryonic hematopoiesis. Our findings advance our understanding of how cytoskeletal regulatory factors impact hemostasis. Results Tpm1 has separable roles in embryonic and postnatal hematopoiesis To circumvent cardiac-related embryonic lethality from Tpm1 deficiency 8 , 9 , we generated conditional Tpm1 knockout ( KO ) models with a floxed Tpm1 exon 3 ( Tpm1 fl ) 14 . Exon 3 is present in all known Tpm1 isoforms. We crossed Tpm1 fl mice with Cdh5 Cre or Vav Cre mice to abrogate Tpm1 expression in endothelial and nascent hematopoietic stem and progenitor cells (HSPCs), respectively 15 , 16 . We used Cdh5 Cre -mediated deletion evaluate the effects of Tpm1 deletion that occurred at different stages of developmental hematopoiesis ( Fig. 1A ). The Cdh5 Cre construct is active in HE cells 15 , which we presumed would result in deletion in all HSPCs and peripheral blood cells through adulthood. The Vav Cre allele can efficiently abrogate gene expression in HSPCs and peripheral blood through postnatal life 16 , 17 . Both models are well validated in the context of developmental hematopoiesis. We validated efficient recombination and abrogation of Tpm1 mRNA in peripheral mononuclear blood cells in adult mice compared to littermate controls in both Cdh5 Cre and Vav Cre models ( Fig. 1B ). We further validated by whole mount immunostaining that E9.5 Cdh5 Cre Tpm1 fl/fl embryos exhibited increased Runx1 + HE cell production at E9.5 compared with littermate controls ( Fig. 1C ), similar to Tpm1- deficient mouse embryos 8 . Cdh5 Cre Tpm1 fl/fl and Vav Cre Tpm1 fl/fl pups were born at expected Mendelian ratios and exhibited normal viability into adulthood. We next asked if increased HE cell production in Cdh5 Cre Tpm1 fl/fl embryos conferred an increase in HSPCs in postnatal bone marrow hematopoiesis ( Fig. 1A ). By flow cytometry, we observed no differences in Lin - cKit + Sca1 + bone marrow HSPCs or peripheral blood counts at steady state ( Fig. 1D and Supplementary Table S1 ). We similarly found no significant differences in adult bone marrow of Vav Cre Tpm1 fl/fl mice compared to littermate controls, despite previously confirmed Cre activation during fetal life 16 ( Fig. 1E and Supplementary Table S2 ). The lack of change in the postnatal blood progenitors after Tpm1 deletion led us to conclude that the effects of Tpm1 deficiency during embryonic hematopoiesis separate from any effects on postnatal hematopoiesis. Human genetics implicates Tpm1 in mature platelet function Human genome wide association study (GWAS) data have linked single nucleotide polymorphisms at the TPM1 gene locus with quantitative blood trait variation 1 , 2 . In light of the disconnect between fetal hematopoietic biology and postnatal bone marrow traits, these GWAS signals suggested that TPM1 had some role in hematopoietic stem and progenitor cells and/or mature blood cells in circulation. The most statistically significant associations are with platelet traits, including platelet count (PLT) and mean platelet volume (MPV, Fig. 2A ). However, there are also genome-wide significant signal associations with hemoglobin (HGB, Fig. 2A ). There is also sub-genome-wide significant signal for variation in red blood cell (RBC) and white blood cell count (WBC, Fig. 2A ). Download figure Open in new tab Figure 2. Genetic colocalization analysis points to separate genetic signals for altered platelet count vs erythroid and white blood cell parameters. A. Locus zoom plots suggest separate genetic signals for platelet traits and erythroid traits at the TPM1 gene locus. Purple box indicates loci with statistically significant signals for increased platelet count. Red box indicates loci with significant signals for erythroid traits. B. Key single nucleotide polymorphisms (SNPs) at the TPM1 gene locus that impact blood traits in human GWAS. SNPs that act as quantitative trait loci for TPM1 expression (eQTL) and/or splice variation (sQTL) are indicated. Effect alleles (EA) and other alleles (OA) for the indicated directional effects are shown. Our prior work revealed that systemic factors like obesity can have coordinate impacts on blood traits across lineages, reflecting perturbations in HSPC metabolism and development 4 , 5 . In other cases, GWAS signals can have lineage-specific effects more likely to reflect impacts on mature blood cells in circulation. For example, genetically influenced lipid traits and tobacco use have erythroid-specific effects that suggest impacts on peripheral erythrocytes 18 . To discern if TPM1 locus-related GWAS effects indicated coordinate effects across blood lineages, we performed genetic colocalization analysis 19 . Comparisons of PLT, HGB, and WBC effects revealed platelet-specific effects at the TPM1 gene promoter and transcriptional start site that did not colocalize with erythroid or white cell traits (PP4 < 0.02, Fig. 2B ). These sites include expression quantitative trait loci (eQTL) that overlie relevant hematopoietic transcription factor binding sites and alter TPM1 expression 6 . Erythroid and white cell traits shared colocalized signal within the gene body (PP4 = 0.94, Fig. 2B ). SNPs in this region include splice quantitative trait loci (sQTL) that alter splicing between TPM1 exons without altering total TPM1 mRNA levels 20 . These colocalization findings indicate separate lineage-specific effects on mature platelets and erythrocytes, or late-stage precursors for these blood cells, rather than effects on common progenitors for multiple lineages (e.g., HSPCs). Tpm1 impacts murine platelet lifespan and adhesion capabilities We next chose to interrogate TPM1 effects on platelet biology, given that these were statistically the strongest GWAS effects. SNPs that decrease TPM1 expression are linked with increased PLT count ( Fig. 2A ). We reasoned that TPM1 deficiency could either increase platelet formation and/or decrease platelet clearance in circulation. We have previously shown using in vitro models that TPM1KO megakaryocyte formation and maturation is normal 6 . Thus, we asked if platelet clearance was increased in Vav Cre Tpm1 fl/fl mice, which could help explain an increased steady state platelet count. To elucidate the lifespan of platelets lacking Tpm1 , we injected mice with anti-platelet CD42c DyLt488 antibody and monitored the lifespan of labelled CD42c DyLt488+ /CD41 APC+ platelets over time by flow cytometry. Tpm1KO mice had longer platelet lifespan compared to littermate controls, as evidenced by an increased area under the curve (5366±153 KO vs 4741±148 Ctrl, p<0.0001) and a ∼50% increased half-life (86 h vs 58 h in littermate controls by linear regression, Fig. 3A ). Thus, Tpm1 normally limits platelet lifespan in murine circulation. Download figure Open in new tab Figure 3. Tpm1 knockout prolongs platelet lifespan and limits platelet adhesion. A. Platelet half-life measurement after labeling indicates longer time in circulation for Tpm1KO platelets. Platelets were labeled with anti-CD42c DyLight488 antibody and the percentage of platelets was measured by flow cytometry over time. B. Static focal adhesion experiments show decreased Tpm1KO platelet adhesion to Fibrinogen and Fibronectin-coated coverslips compared to wild type controls, but no significant change in adhesion to collage-coated coverslips (CTRL n=6-8, KO n=4-8 per substrate). Scale bar, 25 um. C. Tpm1KO platelets show variably reduced activation in response to agonists. * p<0.05. **** p<0.0001. We hypothesized that Tpm1 deficiency could increase platelet lifespan by limiting clearance from circulation, via limiting adhesion to vascular walls and/or decreasing activation potential. Focal adhesion biology directly impacts platelet clearance by regulating interactions with vascular walls 21 , 22 . Focal adhesions contain nanoscale layers that are functionally specified by tropomyosin isoforms 23 . Tpm1 regulates adhesion maturation and disassembly in these structures 23 . To test Tpm1KO platelet adhesion, we compared adhesion of platelets from Vav Cre Tpm1 fl/fl mice vs littermate controls in static cell adhesion assays using fibrinogen, fibronectin, or collagen substrates. These substrates directly bind and activate platelets through dedicated platelet membrane receptor protein complexes and can lead to adhesion and activation 22 . After incubating blood with matrix-coated coverslips for 30 min, we found more platelets retained on all substrate-coated cover slips compared with bovine serum albumin-coated controls ( Fig. 3B ). Tpm1KO compromised platelet adhesion to fibrinogen and fibronectin, and to a lesser (non-significant) effect on collagen ( Fig. 3B ). We next evaluated murine platelet activation potential ex vivo using primary murine platelets from Vav Cre Tpm1 fl/fl mice or littermate controls 24 . We measured integrin αIIbβ3 activation (CD41 + JON/A-PE + ) and degranulation (CD41 + P-Selectin + ) after incubation with thrombin, collagen-related peptide A (CRP-A), and adenosine diphosphate (ADP) agonists. Tpm1KO platelets showed mild changes in activation potential that were inconsistent across agonists ( Fig. 3C ). Our findings suggest that platelet Tpm1KO activation may be altered in certain contexts, but that Tpm1 exerts more prominent effects on platelet adhesion properties. Tpm1 deficiency impairs clot contraction We then sought to determine the functional consequences of altered platelet properties in Tpm1KO platelets. Hemostasis involves both clot formation and subsequent contraction, which together produce a stable hemostatic plug that stops bleeding effectively without obstructing blood flow 11 , 12 , 25 . Clot contraction is driven by activated platelets that adhere to fibrin fibers, forming a three-dimensional viscoelastic scaffold. One of the downstream effects of platelet activation is the interaction between intracellular actin and non-muscle Myosin IIA 26 . We tested Tpm1KO platelet functionality using a blood clot contraction assay, which quantifies the degree of clot volume reduction as a measure of actomyosin-dependent platelet contractility 27 – 29 ( Fig. 4A ). 12 , 13 , 30 , 29 , 30 Compared to littermate controls, whole blood samples from Tpm1KO mice showed a significant delay in the initiation of clot contraction and decreased area under the curve for total clot contraction, while retaining normal contraction velocity and extent of maximal contraction ( Fig. 4B and Supplementary Fig. 1A ). Download figure Open in new tab Figure 4. Tpm1KO delays initiation of clot contraction. A. Clot contraction assay schematic. B,. Clot contraction initiation is delayed and the area under the curve for clot contraction is limited in Tpm1KO whole blood compared to littermate controls. C. Clot contraction is delayed in Tpm1KO platelet-rich plasma (PRP) compared to littermate controls. * p<0.05. ns, not significant. We then determined if these findings were due to platelet-specific effects. Using platelet-rich plasma isolated from Tpm1KO and littermate controls, we observed a significant delay in the initiation of clot contraction lag time ( Fig. 4C and Supplementary Fig. 1B ). These results confirm a functional consequence for abnormal platelet function in the context of Tpm1 deficiency, which is consistent with ex vivo functional readouts and associated with potential physiologic implications. Tpm1KO accentuates murine stroke formation and severity Platelet focal adhesion is necessary for efficient clot contraction and prevention of pathologic thrombotic extension 30 . These effects are somewhat counterintuitive, since defective focal adhesion or platelet activation can also compromise hemostasis and result in bleeding 31 , 32 . To define the hemostatic implications for altered focal adhesion in Tpm1 deficiency, we tested the effects of Tpm1KO in an established murine stroke model 33 . After ferric chloride-induced injury to the middle cerebral artery, we monitored blood flow and subsequent clot pathology. Compared to littermate controls, Tpm1KO shortened the time to abrogation of blood flow at the injury site (flow rate x time area under the curve [AUC] 30.1±5.1 vs 13.4±3.6, mean±SD, p=0.01, Fig. 5A-B ). Download figure Open in new tab Figure 5. Tpm1KO enhances ferric chloride-induced middle cerebral artery (MCA) occlusion via enhanced platelet interactions with vWF. A. Flow rate curves depicting time to MCA occlusion (n=3 per genotype). B. Quantitative changes for MCA occlusion area under the curve (n=3 per genotype). * p<0.05. C. Clot histology showing platelets (CD42d + ) and vWF aggregation at the site of MCA vessel injury. KO mice showed more circumferential platelet aggregation and vWF accumulation. MCA blood clot histology from control and KO mice confirmed an enhanced interaction of TPM1KO platelets with von Willebrand factor (vWF) in the context of vessel injury ( Fig. 5C ). However, we did not detect significant changes in bleeding times nor coagulation pathway activation at steady state in TPM1KO mice compared to littermate controls ( Supplementary Fig. 2 ). These findings demonstrate that in the context of ferric chloride-induced vessel injury and inflammation, TPM1KO platelets have an enhanced response to promote blood clotting. These results provide a novel functional consequence for Tpm1KO on platelet biology and hemostasis. Discussion This study reveals a novel role for TPM1 in platelet adhesion and clot contraction. These effects appear distinct from TPM1 impacts on embryonic hematopoiesis 8 ( Fig. 1 ) and are intrinsic to platelets, as opposed to endothelial cells or non-hematopoietic cell types that support vascular niches during embryonic development 34 . Our findings agree with emerging roles for TPM1 in mediating focal adhesion stability 23 and actomyosin contractility during clot contraction 11 , 12 . To our knowledge, TPM1 is the first actin regulatory molecule implicated in clot contraction outside of Myosin IIA and fibrin 11 , 12 . We anticipate that our findings will lead to further insights into platelet biology and hemostasis, given the extensive prior work on TPM1 in the context of cardiac sarcomeres 9 . Mammalian actin filament diversity is achieved through expression of 4 genes ( TPM1- 4) that encode more than 40 isoforms through alternative splicing 7 . Each isoform can impart unique properties on actin filaments. Our murine and iPSC models disrupt all TPM1 isoforms 6 , 8 , 35 so we cannot yet parse isoform-specific TPM1 functions in platelets. In fact, high molecular weight and low molecular weight TPM1 isoforms have distinct actin regulatory roles in some cell types 36 . Future isoform-specific perturbation will parse individual tropomyosin contributions to actin cytoskeletal regulation of platelet functions. In addition, TPM4 is highly expressed in platelets and TPM4 loss causes macrothrombocytopenia (i.e., reducing platelet counts) with a mild effect on platelet function 37 . TPM1 and TPM4 may genetically interact to regulate distinct but complementary aspects of platelet biology, which could be elucidated through combined perturbation using genetic models. Our findings can help explain GWAS signal at the TPM1 gene locus 1 , 2 . Rather than effects on platelet production 37 , we propose that SNPs at the TPM1 locus extend platelet lifespan to increase steady-state platelet count. We suspect that species-specific differences or environmental variations may underlie the normal platelet counts in Tpm1KO mice. Human exposure to infections, inflammation, and other stressors could amplify functional consequences of altered human platelet lifespan, enhancing the impact of allelic variation that changes TPM1 expression ( Fig. 2 ). The controlled living conditions of our inbred mice may mask phenotypic variation that emerges in real world human cohorts with large sample sizes. Future studies will explore the functional consequences of recurrent infection or inflammation on platelet biology in the context of Tpm1 deficiency. TPM1 likely facilitates platelet adhesion by stabilizing actin filaments at focal adhesion sites, possibly through binding and/or stabilizing Talin and integrin complexes at a nanoscale level 23 . Interestingly, Tpm1 cardiac pathology is ameliorated with concurrent Talin mutation 38 . This genetic interaction in cardiac dysfunction may extend to platelets. Our static adhesion results indicate that Tpm1 loss perturbs platelet adhesion to fibrinogen and fibronectin, but not collagen ( Fig. 3 ). Talin facilitates platelet adhesion to fibrinogen and fibronectin, while collagen binding can be Talin-independent through GPVI 22 . Thus, our findings agree with a molecular role for Tpm1 in conjunction with Talin at the platelet cell surface. Our findings add a novel actin regulatory protein (TPM1) to the small group of molecules known to impair clot contraction and enhance thrombosis, which also includes fibrinogen, integrins, protease-activated receptors (PARs), and myosin IIA 11 . Defective clot contraction results in larger, less dense, mechanically fragile thrombi with increased risks of embolization and vascular occlusion 11 , 30 . Our findings highlight the role of actomyosin regulation in clot contraction, an established role for Tpm1 in cardiac muscle 7 . We expect Tpm1 is relevant in platelets and potentially other cell types (e.g., erythrocytes 39 ), since we identified defective clot contraction in assays of Tpm1KO whole blood but not PRP ( Fig. 4 ). Promoting Tpm1 activity or otherwise targeting related mechanisms offers a novel translational strategy to prevent or ameliorate thrombosis and stroke pathology. This study supports the potential translational utility linked to defining genetic determinants of platelet and blood trait variation. Our findings define a novel factor ( Tpm1 ) governing platelet adhesion, clot contraction, and thrombosis. Further work to establish developmental and postnatal roles of Tpm1 will undoubtedly reveal links between actomyosin contractility, cytoskeletal regulation, and hemostasis. Materials and Methods Mouse model derivation and validation All mouse experiments were approved by the Children’s Hospital Institutional Animal Care and Use Committee (IACUC). The floxed Tpm1 allele was derived from the EUCOMM Tpm1 GeneTrap-Reporter ( Tpm1 GT ) mouse construct described in our prior publication 8 . We crossed the Tpm1 GT with a FlpO recombinase mouse (Jackson Laboratories, strain 011065) to remove the GeneTrap-Reporter cassette, leaving exon 3 flanked by loxP sites. After confirming accurate recombination by sequencing and backcrossing 3 generations on a C57BL6/J background, we crossed the Tpm1 fl mice with Cdh5 Cre mice 15 or Vav Cre mice 16 to generate experimental mice for this study. All mice were genotyped by tail snip PCR (Transnetyx). Genotypes were additionally confirmed for experimental mice by PCR of murine whole blood using the following primers: Tpm1 proximal loxP Forward: AAGGCGCATAACGATACCAC Tpm1 distal loxP Forward: GAGGAGGCCGAGAAGGCTG Tpm1 distal loxP Reverse: CACAGGCTGGAGTCCCTGC Semiquantitative real time PCR We confirmed excision of Tpm1 exon 3 in the context of Cdh5 Cre or Vav Cre by monitoring Tpm1 mRNA expression by semiquantitative real time PCR on a QuantStudio 5 instrument (Applied Biosystems). We constructed cDNA libraries from whole mouse blood using Qiagen RNeasy kits according to the manufacturer’s instructions. We used the following primers to measure total Tpm1 and TATA Binding Protein (Tbp) mRNA expression: Tpm1 Forward: CTGGTTGAGGAGGAGTTGGA Tpm1 Reverse: ATGTGCTTGGCCTCTTTCAG Tbp Forward: CTCAGTTACAGGTGGCAGCA Tbp Reverse: ACCAACAATCACCAACAGCA Similar results were obtained using primers designed to specifically measure low molecular weight Tpm1 mRNA transcripts, which we previously found to be the abundant. Whole mount immunohistochemistry We set up timed matings to generate Cdh5 Cre Tpm1 fl/fl embryos and littermate controls. We harvested E9.5 embryos and genotyped tail remnants using the following primers (as also described in the genotyping strategy in Shibata et al 14 ): Tpm1 proximal loxP Forward: AAGGCGCATAACGATACCAC Tpm1 proximal loxP Reverse: CCGCCTACTGCGACTATAGAGA We then performed whole mount immunostaining and quantifications as previously described 8 , using antibodies to detect CD31 + endothelial cells (anti-mouse CD31 MEC13.3, BD Biosciences) and Runx1 + hemogenic cells (Runx1 monoclonal antibody EPR3099, Abcam). Secondary antibodies were Goat anti-Mouse AF488 and Goat anti-Rat AF555 (Abcam). We collected images using a Leica confocal microscope and manually quantified flat HECs using ImageJ software. Bone marrow isolation and analysis Bone marrow from adult mice aged 2-3 months was isolated, stained, and analyzed as previously described 8 , 17 . We analyzed data using FlowJo software (v10, BD Biosciences). Complete blood counts We collected blood into EDTA-coated tubes via retro-orbital collection and obtained total blood counts using a Hemavet V5 instrument (Drew Scientific). Genetic colocalization studies We collected and analyzed publicly available genome wide association study (GWAS) data 1 , 2 using established genetic colocalization software 19 . We inferred a PP4 > 0.8 to indicate true colocalization between two traits 5 . We generated LocusZoom plots using a web-based plotting interface ( https://locuszoom.org ). Platelet half-life experiments We injected anti-CD42c DyLight488 antibody (Emfret Analytics). into Vav Cre Tpm fl/fl and littermate controls ( Vav WT Tpm fl/fl ) and monitored the percentage of CD41 APC+ platelets that were also CD42c DyLight488+ over time via serial blood collection. We performed flow cytometry on a BD Cytoflex instrument (Beckman Coulter). Platelet adhesion and immunofluorescence staining We pre-treated glass cover slips with fibrinogen, fibronectin, or collagen for >2 hrs and blocked with 3% bovine serum albumin (Sigma Aldrich) for 2 h. We collected whole blood into 20 units/mL heparin and incubated on cover slips for 30 min. After washing gently with PBS, we fixed adherent cells in 4% paraformaldehyde, stained with Phalloidin-AF488 (Invitrogen) per manufacturer’s instructions, and mounted on glass slides using ProlongGold with DAPI (Invitrogen). We found that this staining strategy effectively highlighted actin-rich DAPI-negative platelets while excluding erythrocytes and rare DAPI + white blood cells. We imaged slides using an Olympus XL microscope and quantified actin + DAP I- platelets using ImageJ. Platelet activation experiments We conducted platelet activation experiments as previously described 24 . We collected whole blood via retro-orbital collection into 20 U/mL heparin (Sigma Aldrich) and activated for 10 min with indicated concentrations of Thrombin (Sigma Aldrich), Collagen Related Peptide A (CRP-A, Aniara Diagnostica). We measured αIIbβ3 integrin activation (JON/A-PE + , Emfret Analytics) and degranulation (CD62p/P-Selectin-FITC + , BD Biosciences) among CD41 + platelets (CD41-APC + , Thermo Invitrogen) by flow cytometry using a BD Cytoflex instrument (Beckman Coulter). We used FlowJo v10 (BD Biosciences) to analyze data. Clot contraction assay and measurement We performed clot contraction assays as previously described 27 , 29 , 40 . Whole blood was collected directly from the inferior vena cava into syringes containing 3.2% sodium citrate as an anticoagulant at a blood-to-anticoagulant ratio of 9:1. For some experiments, platelet-rich plasma (PRP) was subsequently isolated by centrifugation of whole blood at 200g for 10 minutes. Citrated mouse blood and PRP samples were activated with 5 U/mL thrombin and 4 mM CaCl², then transferred to transparent plastic cuvettes (7×12×1 mm) prelubricated with 4% (vol/vol) Triton X-100 in 150 mM NaCl for whole blood and 1% Pluronic in 150 mM NaCl for PRP to prevent clot adhesion to the cuvette walls. Using light scatter-based tracking, changes in clot size during contraction were measured every 15 seconds over a 20-minute period. Serial images of the contracting clot were used to generate a kinetic curve, from which the extent of contraction— defined as the relative reduction in clot size after 20 minutes—was determined. Murine stroke model and histology We chose to monitor the effects of ferric chloride-induced injury to the middle cerebral artery (MCA) to assess the role of platelets in this established stroke model 33 . The MCA was exposed in anesthetized mice and treated with FeCl 3 (10% w/v, Sigma Aldrich). Laser Doppler was used to monitor MCA flow cessation following injury. The MCA clot region was then excised, sectioned, and stained for vWF and CD42d to ascertain clot morphology. Images were obtained on an epifluorescence microscope and graphical overlays were created using ImageJ. Tail bleeding and aPTT measurement Tail bleeding experiments were performed as described 33 . Briefly, an incision was made in anesthetized mice and the tail submerged in 50 mL warm PBS. The time to initial cessation of bleeding, total bleeding time, amount of blood lost (as a function of murine weight), and optical density of exsanguinated blood in PBS were quantitated. We also measured activated partial thromboplastin clotting time (aPTT) in primary murine blood using standard assays 33 . Statistical and graphical output Statistics were calculated using GraphPad Prism (v10) or R (v4.4). Graphical outputs used these same software packages. Conflict of Interest OAMC is a cofounder of NanoMuse, a startup company developing treatments for stroke and other neuroinflammatory conditions. Acknowledgements This study was supported by the National Institutes of Health (NHLBI K99 HL156052 to CST, NINDS R01 NS131279 to OAMC) and the American Heart Association (25POST1357254/2025 to ADP). Funder Information Declared NHLBI , K99HL156052 NINDS , R01NS131279 American Heart Association , 25POST1357254/2025 References 1. ↵ Chen , M. H. et al. Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations . Cell 182 , 1198 – 1213 ( 2020 ). OpenUrl CrossRef PubMed 2. ↵ Vuckovic , D. et al. The Polygenic and Monogenic Basis of Blood Traits and Diseases . Cell 182 , 1214 – 1231 ( 2020 ). OpenUrl CrossRef PubMed 3. ↵ Daly , M. E. Determinants of platelet count in humans . Haematologica 96 , 10 – 13 ( 2011 ). OpenUrl FREE Full Text 4. ↵ Thom , C. S. , Wilken , M. B. , Chou , S. T. & Voight , B. F. Body mass index and adipose distribution have opposing genetic impacts on human blood traits . Elife 11 , e75317 ( 2022 ). OpenUrl CrossRef PubMed 5. ↵ Thom , C. & Voight , B. Genetic colocalization atlas points to common regulatory sites and genes for hematopoietic traits and hematopoietic contributions to disease phenotypes . BMC Med Genomics 13 , 89 ( 2020 ). OpenUrl CrossRef PubMed 6. ↵ Thom , C. S. et al. Tropomyosin 1 genetically constrains in vitro hematopoiesis . BMC Biol 18 , 52 ( 2020 ). OpenUrl CrossRef PubMed 7. ↵ Gunning , P. W. & Hardeman , E. C. Tropomyosins . Current Biology 27 , R8 – R13 ( 2017 ). OpenUrl PubMed 8. ↵ Wilken , M. B. et al. Tropomyosin 1 deficiency facilitates cell state transitions and enhances hemogenic endothelial cell specification during hematopoiesis . Stem Cell Reports 19 , 1264 – 1276 ( 2024 ). OpenUrl PubMed 9. ↵ Mckeown , C. R. , Nowak , R. B. , Gokhin , D. S. & Fowler , V. M. Tropomyosin is required for cardiac morphogenesis, myofibril assembly, and formation of adherens junctions in the developing mouse embryo . Developmental Dynamics 243 , 800 – 817 ( 2014 ). OpenUrl CrossRef PubMed 10. ↵ Thom , C. S. et al. Quantitative label-free mass spectrometry reveals content and signaling differences between neonatal and adult platelets . Journal of Thrombosis and Haemostasis 5 , 1447 – 1462 ( 2023 ). OpenUrl 11. ↵ Litvinov , R. I. & Weisel , J. W. Blood clot contraction: Mechanisms, pathophysiology, and disease . Res Pract Thromb Haemost 7 , 100023 ( 2022 ). OpenUrl PubMed 12. ↵ Kim , O. V. , Litvinov , R. I. , Alber , M. S. & Weisel , J. W. Quantitative structural mechanobiology of platelet-driven blood clot contraction . Nat Commun 8 , ( 2017 ). 13. ↵ Kim , O. V. et al. Megakaryocyte-induced contraction of plasma clots: cellular mechanisms and structural mechanobiology . Blood 143 , 548 – 560 ( 2024 ). OpenUrl CrossRef PubMed 14. ↵ Shibata , T. et al. Lens-specific conditional knockout of tropomyosin 1 gene in mice causes abnormal fiber differentiation and lens opacity . Mech Ageing Dev 196 , 111492 ( 2021 ). OpenUrl PubMed 15. ↵ Chen , M. J. , Yokomizo , T. , Zeigler , B. M. , Dzierzak , E. & Speck , N. A. Runx1 is required for the endothelial to haematopoietic cell transition but not thereafter . Nature 457 , 887 – 891 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 16. ↵ de Boer , J. et al. Transgenic mice with hematopoietic and lymphoid specific expression of Cre . Eur J Immunol 33 , 314 – 325 ( 2003 ). OpenUrl CrossRef PubMed Web of Science 17. ↵ Tomishima , S. A. et al. The E3 ubiquitin ligase Cul5 regulates hematopoietic stem cell function for steady-state hematopoiesis in mice . Journal of Clinical Investigation e180913 ( 2025 ) 18. ↵ Shivakumar , S. , Wilken , M. B. , Tsao , V. , Bitarello , B. D. & Thom , C. S. Genetically influenced tobacco and alcohol use behaviors impact erythroid trait variation . PLoS One 19 , e0309608 ( 2024 ). OpenUrl PubMed 19. ↵ Giambartolomei , C. et al. Bayesian Test for Colocalisation between Pairs of Genetic Association Studies Using Summary Statistics . PLoS Genet 10 , e1004383 ( 2014 ). OpenUrl CrossRef PubMed 20. ↵ Aguet , F. et al. The GTEx Consortium atlas of genetic regulatory effects across human tissues . Science (1979) 369 , 1318 – 1330 ( 2020 ). OpenUrl Abstract / FREE Full Text 21. ↵ Aggarwal , A. , Jennings , C. L. , Manning , E. & Cameron , S. J. Platelets at the Vessel Wall in Non-Thrombotic Disease . Circ Res 132 , 775 – 790 ( 2023 ). OpenUrl CrossRef PubMed 22. ↵ Varga-Szabo , D. , Pleines , I. & Nieswandt , B. Cell adhesion mechanisms in platelets . Arterioscler Thromb Vasc Biol 28 , 403 – 413 ( 2008 ). OpenUrl Abstract / FREE Full Text 23. ↵ Kumari , R. et al. Focal adhesions contain three specialized actin nanoscale layers . Nat Commun 15 , 2547 ( 2024 ). OpenUrl CrossRef PubMed 24. ↵ Gupta , S. et al. A regulatory node involving Gαq, PLCβ, and RGS proteins modulates platelet reactivity to critical agonists . Journal of Thrombosis and Haemostasis 21 , 3633 – 3639 ( 2023 ). OpenUrl 25. ↵ Carr , M. E. Development of platelet contractile force as a research and clinical measure of platelet function . Cell Biochem Biophys 38 , 55 – 78 ( 2003 ). OpenUrl CrossRef PubMed 26. ↵ Johnson , G. J. , Leis , L. A. , Krumwiede , M. D. & White , J. G. The critical role of myosin IIA in platelet internal contraction . J Thromb Haemost 5 , 1516 – 1529 ( 2007 ). OpenUrl CrossRef PubMed 27. ↵ Tutwiler , V. et al. Kinetics and mechanics of clot contraction are governed by the molecular and cellular composition of the blood . Blood 127 , 149 – 159 ( 2016 ). OpenUrl Abstract / FREE Full Text 28. Evtugina , N. G. et al. Activation of Piezo1 channels in compressed red blood cells augments platelet-driven contraction of blood clots . J Thromb Haemost 21 , 2418 – 2429 ( 2023 ). OpenUrl CrossRef PubMed 29. ↵ Peshkova , A. D. et al. Red blood cell aggregation within a blood clot causes platelet-independent clot shrinkage . Blood Adv 9 , ( 2025 ). 30. ↵ Tutwiler , V. et al. Blood clot contraction differentially modulates internal and external fibrinolysis . Journal of Thrombosis and Haemostasis 17 , 361 – 370 ( 2019 ). OpenUrl 31. ↵ Guidetti , G. F. , Torti , M. & Canobbio , I. Focal Adhesion Kinases in Platelet Function and Thrombosis . Arterioscler Thromb Vasc Biol 39 , 857 – 868 ( 2019 ). OpenUrl PubMed 32. ↵ Sambrano , G. R. , Weiss , E. J. , Zheng , Y. W. , Huang , W. & Coughlin , S. R. Role of thrombin signalling in platelets in haemostasis and thrombosis . Nature 413 , 74 – 78 ( 2001 ). OpenUrl CrossRef PubMed 33. ↵ Marcos-Contreras , O. A. et al. Effective Prevention of Arterial Thrombosis with Albumin-Thrombin Inhibitor Conjugates . Mol Pharm 20 , 5476 – 5485 ( 2023 ). OpenUrl 34. ↵ Shalaby , C. , Garifallou , J. & Thom , C. S. Integrated local and systemic communication factors regulate nascent hematopoietic progenitor escape during developmental hematopoiesis . Int J Mol Sci 26 , 301 ( 2024 ). OpenUrl PubMed 35. ↵ Wilken , M. B. et al. Generation of a human Tropomyosin 1 knockout iPSC line . Stem Cell Res 71 , 103161 ( 2023 ). OpenUrl PubMed 36. ↵ Gateva , G. et al. Tropomyosin Isoforms Specify Functionally Distinct Actin Filament Populations In Vitro . Current Biology 27 , 705 – 713 ( 2017 ). OpenUrl CrossRef PubMed 37. ↵ Pleines , I. et al. Mutations in tropomyosin 4 underlie a rare form of human macrothrombocytopenia . Journal of Clinical Investigation 127 , 814 – 829 ( 2017 ). OpenUrl CrossRef PubMed 38. ↵ Teekakirikul , P. et al. Genetic resiliency associated with dominant lethal TPM1 mutation causing atrial septal defect with high heritability . Cell Rep Med 3 , 100501 ( 2022 ). OpenUrl PubMed 39. ↵ An , X. , Salomao , M. , Guo , X. , Gratzer , W. & Mohandas , N. Tropomyosin modulates erythrocyte membrane stability . 109 , 1284 – 1288 ( 2007 ). OpenUrl 40. ↵ Chakravarty , D. et al. β-actin function in platelets and red blood cells can be performed by γ-actin and is therefore independent of actin isoform protein sequence . Mol Biol Cell 36 , ( 2025 ). View the discussion thread. Back to top Previous Next Posted August 02, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Tropomyosin 1 promotes platelet adhesion and clot contraction separate from its roles in developmental hematopoiesis Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Tropomyosin 1 promotes platelet adhesion and clot contraction separate from its roles in developmental hematopoiesis Po-Lun Kung , Victor Tsao , Alina D Peshkova , Oscar A. Marcos-Contreras , Kim Ha , Gennadiy Fonar , Nkemdilim Okoli , Brian M Dulmovits , Rong Qiu , Rolf D Bates , Janelle Yeboah , Carson Shalaby , Tyler Truex , Soomin Jeong , Vladimir R Muzykantov , Jacob W Myerson , Christopher S Thom bioRxiv 2025.07.31.667883; doi: https://doi.org/10.1101/2025.07.31.667883 Share This Article: Copy Citation Tools Tropomyosin 1 promotes platelet adhesion and clot contraction separate from its roles in developmental hematopoiesis Po-Lun Kung , Victor Tsao , Alina D Peshkova , Oscar A. Marcos-Contreras , Kim Ha , Gennadiy Fonar , Nkemdilim Okoli , Brian M Dulmovits , Rong Qiu , Rolf D Bates , Janelle Yeboah , Carson Shalaby , Tyler Truex , Soomin Jeong , Vladimir R Muzykantov , Jacob W Myerson , Christopher S Thom bioRxiv 2025.07.31.667883; doi: https://doi.org/10.1101/2025.07.31.667883 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cell Biology Subject Areas All Articles Animal Behavior and Cognition (7618) Biochemistry (17637) Bioengineering (13864) Bioinformatics (41853) Biophysics (21403) Cancer Biology (18540) Cell Biology (25429) Clinical Trials (138) Developmental Biology (13356) Ecology (19862) Epidemiology (2067) Evolutionary Biology (24287) Genetics (15585) Genomics (22464) Immunology (17701) Microbiology (40300) Molecular Biology (17142) Neuroscience (88440) Paleontology (666) Pathology (2825) Pharmacology and Toxicology (4814) Physiology (7633) Plant Biology (15107) Scientific Communication and Education (2042) Synthetic Biology (4285) Systems Biology (9809) Zoology (2268)