To evaluate the performance of simultaneous amplification and testing assay for group B Streptococcus detection: comparison with real-time PCR and ddPCR assays

To evaluate the performance of simultaneous amplification and testing assay for group B Streptococcus detection: comparison with real-time PCR and ddPCR assays | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article To evaluate the performance of simultaneous amplification and testing assay for group B Streptococcus detection: comparison with real-time PCR and ddPCR assays LOUKAIYI Lu, Yisheng Chen, Qiang Wang, Jing Gao, Chunmei Ying This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3974857/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Jul, 2024 Read the published version in Annals of Clinical Microbiology and Antimicrobials → Version 1 posted 12 You are reading this latest preprint version Abstract Background To evaluate the performance of simultaneous amplification and testing (SAT) assay for the detection of group B Streptococcus (GBS) in maternal vaginal and perianal swabs compared with real-time polymerase chain reaction (RT‒PCR). Methods We obtained vaginal and perianal swabs from 1474 pregnant women at the Obstetrics and Gynecology Hospital of Fudan University (Shanghai, China) between April 2023 and June 2023. Vaginal and perianal swabs were collected at 35–37 weeks of gestation. Swabs were tested for GBS simultaneously by using the SAT assay and RT‒PCR, and a comparative analysis (kappa coefficient) was performed. Furthermore, we conducted additional droplet digital PCR (ddPCR) tests to confirm the results when there were controversial results between SAT and RT‒PCR. In addition, we compared the limit of detection, technical specificity, repeatability and reproducibility of SAT-GBS with those of routine RT‒PCR assays. Results In our study, the rate of clinical GBS colonization according to the SAT assay was 11.5% (169/1471). The SAT assay showed a sensitivity of 91.8%, a specificity of 99.9%, a diagnostic accuracy of 98.9%, a positive predictive value (PPV) of 99.4% and a negative predictive value (NPV) of 98.8%. The kappa value between RT‒PCR and SAT was 0.917. Conclusions This SAT assay for the detection of group B Streptococcus is not only easy to perform but can also detect GBS sensitively and specifically and may be used in the regular molecular diagnosis of GBS in cases of newborn sepsis and meningitis. simultaneous amplification and testing (SAT) real-time PCR (RT‒PCR) droplet digital PCR (dd PCR) group B Streptococcus (GBS) Figures Figure 1 Figure 2 Background Streptococcus agalactiae , or group B Streptococcus (GBS), is widely acknowledged as a highly infectious bacterium that is associated with severe sepsis and meningitis among neonates and may cause neonatal morbidity and mortality( 1 ). According to previous studies, up to 30% of pregnant women may be infected by GBS( 2 ) in the reproductive tract or the lower end of the digestive tract, and vertical transmission from mothers to newborns is strongly related to neonatal GBS colonization and even early-onset GBS sepsis( 3 ). However, prevention is mainly based on intrapartum antibiotic prophylaxis (IAP) for GBS carriers, and thus, routine GBS screening in late pregnancy (35 − 37 weeks of gestation) is highly important( 4 ). A rational combination of IAP and prenatal GBS screening can effectively reduce the incidence of early-onset disease (EOD)( 5 ). The enrichment culture method is considered the gold standard method and is highly specific and accurate( 6 ); however, it is more time-consuming and less sensitive than molecular assays( 7 ). In the past few decades, molecular assays have been used in hospitals to speed up the diagnostic process so that timely clinical treatment can be provided( 8 ). To meet the demand of rapid diagnosis during late pregnancy or intrapartum detection in the labor ward, we thus call for an easier and faster detection method. The SAT assay requires only a single temperature and is less expensive than the RT‒PCR assay, which often requires particular equipment to ensure rapid heating/cooling cycles( 9 ). Therefore, our study compared the performance of the SAT assay and RT‒PCR in detecting GBS through clinical swabs before/during delivery in a Chinese hospital. Materials and methods Clinical samples We obtained swabs from 1474 pregnant women during late pregnancy (35 − 37 weeks of gestation) at the Obstetrics and Gynecology Hospital of Fudan University (Shanghai, China) from April to June 2023, and the study protocol was approved by the ethics committee of the Obstetrics and Gynecology Hospital of Fudan University (2023-81-X1). Sterile physiological saline was added to the specimens to elute bacterial cells from the swabs within 12 h of collection, and the eluates were divided equally into 3 tubes (Streck, USA). The first and second tubes of eluates were screened for GBS by using RT‒PCR and SAT assays, respectively, and the results were recorded. In addition, the last tube was kept at -80°C for further use. SAT assay for GBS Simultaneous amplification and testing (SAT) is a nucleic acid detection method based on RNA transcription-mediated amplification and real-time testing using a molecular beacon probe( 10 ). The cfb mRNA of GBS was reverse transcribed using Moloney murine leukemia virus (M-MLV) reverse transcriptase to generate a 150 bp DNA fragment with a T7 promoter sequence via specific primers, one containing the T7 promoter sequence and the other lacking it. Subsequently, T7 RNA polymerase recognizes the T7 promoter sequence and performs transcriptional amplification of RNA. The specific RNA beacon probe can hybridize with complementary sequences in the RNA amplicon and emit fluorescence signals. An internal control was included in the SAT assay. In this study, the experiments were conducted using reagents and protocols from Rendu Biotechnology. Briefly, 200 µL samples were mixed with 200 µL sample preservation solution provided by Rendu Biotechnology and heated at 95°C for 10 minutes, followed by extraction using magnetic beads. All the extracted nucleic acids were added to the amplification system. The amplification and testing program was run at 42°C for 40 minutes, and the fluorescence was measured every minute. The detection time (dt) refers to the minimum time (in minutes) when the fluorescence value reaches the threshold level. Specimens with FAM channel (GBS target) dt values ≤ 35 were considered GBS-positive. Specimens with FAM channel dt values > 35 and VIC channel (internal control) dt values ≤ 30 were classified as GBS-negative, while VIC dt values > 30 were deemed invalid. The extraction, amplification, and detection processes were carried out automatically in an automatic nucleic acid detection and analysis system (AutoSAT) manufactured by Rendu Biotechnology. Technical sensitivity, specificity, and repeatability of the SAT-GBS Streptococcus agalactiae strains of different serotypes were purchased from American Type Culture Collection (ATCC). GBS strains were cultured in brain-heart infusion medium at 37°C. The colony number was determined by the flat colony counting method. The initial culture concentrations were 4.35×107 CFU/mL, 3.95×107 CFU/mL, 5.65×107 CFU/mL and 2×108 CFU/mL (serotypes Ia, Ib, III and V, respectively). The technical sensitivity of SAT-GBS was evaluated by testing serial dilutions of the initial culture and reporting the 95% LoD through probability analysis. The endpoint sensitivity of the SAT-GBS and RT‒PCR assays for GBS was estimated using 10-fold serial dilutions of the GBS culture sample (serotype III). The specificity of the SAT-GBS was evaluated by testing microorganisms commonly present in the vaginal/rectal tract or related to the GBS family. The organisms were tested both with and without the GBS analyte at a concentration of 50 CFU/mL. To evaluate the repeatability and reproducibility of SAT-GBS, two different serotypes of GBS culture (Ia and III) were tested at a concentration of 1×106 CFU/mL. Each serotype was tested 10 times by the same operator in the same laboratory but 10 times by another operator in another laboratory on different days for the assessment of repeatability and reproducibility. Droplet digital PCR (ddPCR) assay for GBS When we discovered controversial experimental results between SAT and RT‒PCR for detecting GBS, we performed an extra ddPCR experiment to confirm whether the specimen was GBS positive. A rapid bacterial genomic DNA isolation kit (Sangon Biotech, China) was used to extract DNA from the last tube of eluates after they were incubated at room temperature for 30 min. ddPCR was performed in a QX200™ Droplet Digital PCR System (Bio-Rad Laboratories, CA) according to the manufacturer’s instructions( 11 ). A 20 µl volume of reaction mixture was required for each test, which comprised 10 µL of ddPCR Supermix for Probes (no dUTP; Bio-Rad), 1 µL of probe, 1 µL of forward primer, 1 µL of reverse primer and 5 µL of DNA template. For microdroplet generation, 20 µL of mixture and 70 µL of droplet generation oil were added to the DG8™ cartridge and then loaded into a QX200™ Droplet Generator. After that, 40 µL of the microdroplets were transferred to a 96-well PCR plate and heat-sealed with foil in the case of air pollution. Then, PCR was performed on a Bio-Rad T100™ PCR Thermal Cycler using the following conditions: predenaturation for 1 cycle at 95°C for 3 min; denaturation for 40 cycles at 95°C for 30 s; and annealing and extension for 40 cycles at 59°C for 1 min (with a ramp rate of 2.5°C/s). Finally, the fluorescence signal in each plate was analyzed by a QX200™ Droplet Reader and QuantaSoft™ Version 1.7.4, and each reaction used a negative control( 12 ). The threshold can be manually set according to the results of the negative control. °C In our study, specimens with quantification results > 1 copy/µL were defined as “true positive”, and specimens with quantification results < 0.5 copies/µL or lacking data were defined as “true negative”. When specimens had quantification results ranging from 0.5 copies/µL to 1 copy/µL (including 0.5 copies/µL and 1 copy/µL), the results were considered invalid, and these results were excluded. Primers and Probes For the RT‒PCR assay, the primers and probes for the target and internal control sequences were supplied in the BioChain Strep B assay kit. For the SAT assay, primers and probes were designed to be specific for the mRNA of the GBS cfb gene. The cfb gene of GBS has been used in the detection of GBS in multiple studies, and it has been shown to be highly conserved( 13 ). The cfb sequence of the GBS strain (GenBank Genomic Sequence: NZ_CP012480.1, 1929499 to 1930266) was obtained from the GenBank database and used in the design of primers and probes for SAT-GBS via DNAMAN software (Fig. 1 ). The forward primer contained the T7 promoter sequence (Table 1 ). The probe was labeled with FAM at the 5’ end and with the quencher DABCYL at the 3’ end. The IC probe sequence was labeled with HEX at the 5’ end and with DABCYL at the 3’ end. For the ddPCR assay, we selected the TPK gene as the target gene according to previous studies( 14 ). The sequence of Streptococcus agalactiae TPK was obtained from the NCBI database and used in the design of primers and probes for ddPCR-GBS (Table 2 ). Statistics Statistical data analyses were performed by SPSS Statistics Version 24.0. The specificity, sensitivity, NPV and PPV were calculated with a 2 × 2 contingency table, and chi-square tests/Fisher’s exact tests and kappa tests were carried out where appropriate. A p value < 0.05 was considered to indicate statistical significance. Results Sensitivity of the SAT-GBS By using 10-fold serial dilutions of the GBS culture sample, the technical limit of detection of SAT-GBS was assessed. When the optimal amount of IC was used (5×10 6 copies per reaction), SAT-GBS was found to successfully amplify from 2.5×10 5 CFU/mL to 2.5×10 CFU/mL. To compare the sensitivity of the two assays, the sensitivities of the SAT-GBS and RT‒PCR assays were assessed down to 2.5×10 CFU/mL (Fig. 2 ). In our study, we found that the SAT-GBS assay was more sensitive than the RT‒PCR assay for detecting GBS. Specificity of the SAT-GBS To evaluate the technical specificity of the SAT-GBS, we tested a panel of microorganisms, including viruses, bacteria, fungi and protozoans. Moreover, bacteria were tested at 1×10 6 CFU/mL, viruses and fungi were tested at 1×10 5 copies/mL, and protozoans were tested at 1×10 5 cells/mL. Luckily, none of the pathogens were found to have cross-reacted in the SAT-GBS. Repeatability and reproducibility of the SAT-GBS The repeatability and reproducibility of SAT-GBS were assessed through calculation of the coefficient of variation (CV) in the detection time (dt) of positive amplification plots, in which dt values were regressed to predict the amount of target RNA. In a single run of the two different serotypes at a concentration of 1×10 6 CFU/mL, the CVs were 2.81% and 3.27%, respectively. In different runs, the CVs of the two different serotypes were 4.01% and 4.00%, respectively (Table 3 ). SAT-GBS in clinical specimens The sensitivity and specificity of the SAT-GBS were also evaluated by using 1474 clinical maternal vaginal and perianal swabs. By comparing SAT-GBS with RT‒PCR, we discovered 1448 concordant results and 26 discordant results. Among these discordant results, 20 were negative according to the SAT-GBS assay but positive according to the RT‒PCR assay, and after reconfirmation by the ddPCR assay, 15 were confirmed to be true positive, and these 15 “SAT-GBS assay negative” results were considered false negatives. In addition, 3 of the 20 controversial results were defined as invalid results, were excluded because of relatively low ddPCR quantification results and were considered unreliable. Furthermore, 1 out of the remaining 6 discordant results were false positives since the SAT assay was positive, while the RT‒PCR and ddPCR assays were negative (Table 4 ). After the exclusion of the 3 invalid results, the SAT assay showed a sensitivity of 91.8%, specificity of 99.9% and diagnostic accuracy of 98.9%. The PPV was 99.4%, and the NPV was 98.8% (Table 5 ). The kappa value between RT‒PCR and SAT was 0.917. Discussion In our study, the SAT-GBS revealed a GBS colonization rate of 11.5% (169/1471), which was close to that reported in previous studies in mainland China (14.5%), Korea (11.6%) and Japan (18.2%)( 15 – 18 ) but lower than that reported in America (21.6%)( 19 ) and Hong Kong (21.8%)( 20 ), probably due to various factors, including ethnicity, health conditions, social economy, sampling and screening methods, etc.( 16 ). In addition, the colonization rates determined by the SAT and RT‒PCR showed no significant differences according to the chi-square test ( p = 0.531, data not shown). Despite the fact that enrichment culture has been considered the gold standard for GBS screening in the USA( 6 ) and Europe( 21 ), direct blood agar plate culture has been widely performed in China to save time and reduce costs( 16 ); thus, the false negative rates in Chinese laboratories are high according to previous studies( 22 ). During our preexperiment period (comprising 269 specimens), we compared the SAT assay with a direct culture assay (the swab was collected on blood agar before elution). The preexperiment showed a relatively low culture assay positive rate of 7.06% (19/269), which is similar to that reported in Korea (4.4%), and Korean studies have shown that the rate of GBS colonization determined by culture assay varies depending on the institution, even within the same country( 23 ). In our hospital, RT‒PCR has been applied in routine prenatal examinations for GBS screening since September 2013 in patients’ late pregnancy. Considering these factors, this diagnostic accuracy study focused on comparisons between RT‒PCR assays and SAT assays, unlike most other studies in which enrichment culture was used as the reference method( 9 , 16 ). In addition, in our study, when we found controversial results between the SAT assay and RT‒PCR assay, an extra ddPCR experiment was conducted to confirm the results, which was believed to be able to provide accurate quantification of pathogen nucleic acid( 24 ). The reason why we defined the 3 RT‒PCR assay results as weakly positive (the FAM Ct values of the 3 results were 37.68, 37.99 and 36.15) with negative SAT assay results as “invalid” was that the reexamined ddPCR results were 1 copy/µL, 0.74 copies/µL and 0.85 copies/µL, respectively, and we could not tell whether the 3 samples were negative or positive. Sample-related uninterpretable factors, including inadequate sampling and DNA-degrading substances, may explain the appearance of invalid results. In this study, we found that the SAT assay has relatively good sensitivity, specificity, PPV and NPV. Moreover, since our SAT assay requires only a single temperature for amplification, the turnaround time is superior to that of existing RT‒PCR assays and enrichment cultures( 9 ). Previous studies suggested that GBS screening results should be provided at least 4 hours before the birth process so that targeted intrapartum prophylaxis can be conducted( 4 ), and our SAT-GBS assay may meet this demand if a 24-hour operating diagnostic laboratory is available. A limitation of our study was that our samples were collected from vaginal and perianal regions, while many studies revealed that rectal colonization was more common than vaginal colonization( 25 ), which means that we may have failed to detect some rectally colonized GBS-positive patients, and our GBS colonization rate was relatively lower than the real situation, which may also explain why our GBS-positive rate was much lower than that in the USA( 19 ). Another limitation of our study was that our GBS-SAT assay lacks antimicrobial susceptibility testing, which means that even with the 24-hour availability of GBS screening results, doctors can only treat patients with empirical therapy at the time of membrane rupture or in the laboratory. Moreover, it has been proven that the colonization status of GBS may change during pregnancy, which may explain why a large number of EODs caused by GBS that occur in infants are GBS-tested negative gravidas( 26 ), and there are still many pregnant women who deliver their babies without GBS prenatal screening tests due to preterm birth( 23 ). Overall, our SAT-GBS assay may reach the demand of finding an accurate and rapid method for late antenatal and intrapartum GBS screening. Conclusions The simultaneous amplification and testing assay performed well in detecting GBS, which may satisfy the clinical demand for developing a highly accurate and rapid GBS screening method and reduce the incidence of newborn sepsis and meningitis. Abbreviations SAT Simultaneous amplification and testing GBS Group B Streptococcus RT‒PCR Real-time polymerase chain reaction ddPCR Droplet digital PCR PPV Positive predictive value NPV Negative predictive value IAP Intrapartum antibiotic prophylaxis EOD Early-onset disease M-MLV Moloney murine leukemia virus dt Detection time ATCC American Type Culture Collection CV Coefficient of variation Declarations Author contributions Loukaiyi Lu designed the study and wrote the manuscript. Yisheng Chen and Qiang Wang collected the data and conducted the statistical analysis. Chunmei Ying assisted in revising the manuscript. All the authors have read and approved the final manuscript. Funding This work was supported by the National Nature Science Foundation of China (81873970) and the Science and Technology Planning Project of Shanghai (23ZR1408100). Availability of data and materials The datasets used and analysed during the current study are available from the corresponding author on reasonable request. Ethics approval The present study was approved by the ethics committee of the Obstetrics and Gynecology Hospital of Fudan University (2023-81-X1), in accordance with the Declaration of Helsinki. Consent to participate Informed consent was obtained from all individual participants included in the study. Competing interests None of the authors declare a conflict of interest. Author details 1 Department of Laboratory Medicine, Obstetrics and Gynecology Hospital, Fudan University, Shanghai 200011, China References Trotter CL, Alderson M, Dangor Z, Ip M, Le Doare K, Nakabembe E, et al. Vaccine value profile for Group B streptococcus. Vaccine. 2023;41(Suppl 2):41–S52. Russell NJ, Seale AC, O'Driscoll M, O'Sullivan C, Bianchi-Jassir F, Gonzalez-Guarin J, et al. Maternal Colonization With Group B Streptococcus and Serotype Distribution Worldwide: Systematic Review and Meta-analyses. Clin Infect Dis. 2017;65:100–S11. de-Paris F, Mombach Pinheiro Machado AB, Gheno TC, Ascoli BM, Pilger de Oliveira KR, Barth AL. Group B Streptococcus detection: comparison of PCR assay and culture as a screening method for pregnant women. Brazilian J Infect Dis. 2011;15(4):323–7. Prevention of Group B Streptococcal Early-Onset Disease in Newborns. Obstet Gynecol. 2020;135(2):E51–E72. Lohrmann F, Hufnagel M, Kunze M, Afshar B, Creti R, Detcheva A, et al. Neonatal invasive disease caused by Streptococcus agalactiae in Europe: the DEVANI multi-center study. Infection. 2023;51(4):981–91. Verani JR, McGee L, Schrag SJ. Prevention of Perinatal Group B Streptococcal Disease Revised Guidelines from CDC, 2010. Morb Mortal Wkly Rep. 2010;59(RR10):1–31. Davies HD, Miller MA, Faro S, Gregson D, Kehl SC, Jordan JA. Multicenter study of a rapid molecular-based assay for the diagnosis of group B Streptococcus colonization in pregnant women. Clin Infect Dis. 2004;39(8):1129–35. Koliwer-Brandl H, Nil A, Birri J, Sachs M, Zimmermann R, Zbinden R, et al. Evaluation of two rapid commercial assays for detection of Streptococcus agalactiae from vaginal samples. Acta Obstet Gynecol Scand. 2023;102(4):450–6. Curry A, Bookless G, Donaldson K, Knowles SJ. Evaluation of hibergene loop-mediated isothermal amplification assay for detection of group B streptococcus in recto-vaginal swabs: a prospective diagnostic accuracy study. Clin Microbiol Infect. 2018;24(10):1066–9. Li W, Fang Y, Shen H, Yang D, Shu Q, Shang S. Evaluation of a real-time method of simultaneous amplification and testing in diagnosis of Mycoplasma pneumoniae infection in children with pneumonia. PLoS ONE. 2017;12(5):e0177842. Hindson BJ, Ness KD, Masquelier DA, Belgrader P, Heredia NJ, Makarewicz AJ, et al. High-Throughput Droplet Digital PCR System for Absolute Quantitation of DNA Copy Number. Anal Chem. 2011;83(22):8604–10. Zeng Y-F, Chen C-M, Li X-Y, Chen J-J, Wang Y-G, Ouyang S et al. Development of a droplet digital PCR method for detection of Streptococcus agalactiae. BMC Microbiol. 2020;20(1). Balasubramanian N, Pounpandi P, Varatharaju G, Shanmugaiah V, Balakrishnan K, Thirunarayan MA. Distribution of virulence genes and biofilm characterization of human isolates of Streptococcus agalactiae: A pilot study. Colloids Surf B-Biointerfaces. 2023;223. Teatero S, Ramoutar E, McGeer A, Li A, Melano RG, Wasserscheid J et al. Clonal Complex 17 Group B Streptococcus strains causing invasive disease in neonates and adults originate from the same genetic pool. Sci Rep. 2016;6. Zhu Y, Wu J, Zheng X, Liu D, Xu L, Chen D et al. Etiological serotype and genotype distributions and clinical characteristics of group B streptococcus-inducing invasive disease among infants in South China. BMC Pediatr. 2020;20(1). Gao K, Deng Q, Huang L, Chang C-Y, Zhong H, Xie Y et al. Diagnostic Performance of Various Methodologies for Group B S treptococcus Screening in Pregnant Woman in China. Front Cell Infect Microbiol. 2021;11. Kim DH, Min BJ, Jung EJ, Byun JM, Jeong DH, Lee KB, et al. Prevalence of group B streptococcus colonization in pregnant women in a tertiary care center in Korea. Obstet Gynecol Sci. 2018;61(5):575–83. Tanno D, Saito K, Tomii Y, Nakatsuka Y, Uechi K, Ohashi K et al. A Multicenter Study on the Utility of Selective Enrichment Broth for Detection of Group B Streptococcus in Pregnant Women in Japan. Jpn J Infect Dis. 2023. Edwards JM, Watson N, Focht C, Wynn C, Todd CA, Walter EB, et al. Group B Streptococcus (GBS) Colonization and Disease among Pregnant Women: A Historical Cohort Study. Infect Dis Obstet Gynecol. 2019;2019:5430493. Ma T, Chan V, So C, Hui A, Lee C, Hui A et al. Prevention of early onset group B streptococcal disease by universal antenatal culture-based screening in all public hospitals in Hong Kong. The journal of maternal-fetal & neonatal medicine: the official journal of the European Association of Perinatal Medicine, the Federation of Asia and Oceania Perinatal Societies, the International Society of Perinatal Obstetricians. 2018;31(7):881–7. Di Renzo GC, Melin P, Berardi A, Blennow M, Carbonell-Estrany X, Donzelli GP et al. Intrapartum GBS screening and antibiotic prophylaxis: a European consensus conference. Journal of Maternal-Fetal & Neonatal Medicine. 2015;28(7–8):766 – 82. Lu B, Li D, Cui Y, Sui W, Huang L, Lu X. Epidemiology of Group B streptococcus isolated from pregnant women in Beijing, China. Clin Microbiol Infect. 2014;20(6):O370–O3. Sung J-H, Cha H-H, Lee N-Y, Lee W-K, Choi Y, Han H-S et al. Diagnostic Accuracy of Loop-Mediated Isothermal Amplification Assay for Group B Streptococcus Detection in Recto-Vaginal Swab: Comparison with Polymerase Chain Reaction Test and Conventional Culture. Diagnostics. 2022;12(7). Li Z, Pan L, Lyu L, Li J, Jia H, Du B, et al. Diagnostic accuracy of droplet digital PCR analysis of cerebrospinal fluid for tuberculous meningitis in adult patients. Clin Microbiol Infect. 2020;26(2):213–9. Platt MW, McLaughlin JC, Gilson GJ, Wellhoner MF, Nims LJ, INCREASED RECOVERY OF GROUP-B STREPTOCOCCUS BY THE INCLUSION OF RECTAL CULTURING AND ENRICHMENT. Diagn Microbiol Infect Dis. 1995;21(2):65–8. Towers CV, Rumney PJ, Asrat T, Preslicka C, Ghamsary MG, Nageotte MP. The Accuracy of Late Third-Trimester Antenatal Screening for Group B Streptococcus in Predicting Colonization at Delivery. Am J Perinatol. 2010;27(10):785–9. Tables Table 1. Prime, probe and IC-RNA sequences of SAT assay Forward primer 5’‑CGGTTAATGAGGCTATTACTA‑3’ Reverse primer 5’‑AATTTAATACGACTCACTATAGGGAGAGTTAAGGCTTCTACACGACT‑3’ Probe 5’‑GAGACAGUUUAUGAUUUGUCUC‑3’ IC-probe 5’-CCGACGUGAUACGAGAGAGUCGG-3’ Table 2. Prime and probe sequences of ddPCR assay Primer Sequence Forward primer CGCCGTAAGTAGCAACAGAT Reverse primer AAAGAACAGATGGAACAAAGT Probe AGAATAATACCTAAGAACTTTGAACC Table 3. Coefficient of variation (CV) of serotype Ia and III RUN 1 RUN 2 Serotype Ia III Ia III TEST 1 15.4 15 15.2 13.9 TEST 2 15.2 14.1 14.4 13.9 TEST 3 15.4 14.5 14.5 13.8 TEST 4 16.3 14.7 15.3 13.9 TEST 5 16 15.1 15.2 13.2 TEST 6 16.1 15.2 15 14.1 TEST 7 15.7 15.3 14.3 13.9 TEST 8 14.9 14.6 14.2 13.6 TEST 9 16 14.5 15.3 14.2 TEST 10 15.7 13.8 14.8 14.4 CV of Ia and III in RUN 1 2.8% 3.3% / / CV of Ia and III BETWEEN RUNS 4.0% 4.0% 4.0% 4.0% Table 4. The results of the 26 discordant specimens by RT-PCR assay, SAT assay and ddPCR assay No. SAT Assay (dt value) PCR Assay (Ct value) ddPCR Assay (copies/μL) Result 1 0 36.75 0 N 2 19.3 0 1.5 P 3 0 36.76 1.4 P 4 0 35.8 9.7 P 5 0 37.68 1 un 6 0 33.25 1.2 P 7 0 37.39 2.3 P 8 23.9 0 8.6 P 9 0 38.02 3.7 P 10 0 38.37 2.8 P 11 0 35.83 3.1 P 12 19.6 0 11.2 P 13 0 31.21 40.0 P 14 0 36.21 1.5 P 15 19.9 0 0.47<0.5 N 16 0 37.09 3.3 P 17 0 37.15 1.8 P 18 0 36.98 2.2 P 19 0 36.09 4.3 P 20 0 37.12 12.4 P 21 0 37.47 0 N 22 15.9 0 2.3 P 23 18.4 0 20.1 P 24 0 36.75 2.5 P 25 0 37.99 0.74 un 26 0 36.15 0.85 un Table 5. Diagnostic performance of RT-PCR assay and SAT assay in clinical specimens Methods Turnaround Time TP TN FP FN NPV PPV Sensitivity (95% CI) Specificity (95% CI) Diagnostic Accuracy RT-PCR 4h 182 1287 2 3 99.6% 98.9% 97.3% (93.4-99.0) 99.8% (99.4-100.0) 99.7% SAT 2h 170 1288 1 15 98.8% 99.4% 91.8% (86.6-95.2) 99.9% (99.5-100.0) 98.9% *TP, true positive; TN, true negative; FP, false positive; FN, false negative; CI, confidence interval; PPV, positive predictive value; NPV, negative predictive value; Sensitivity = [TP/(TP + FN)] × 100%; Specificity = [TN/(TN + FP)] × 100%; PPV = [TP/(TP + FP)] × 100%; NPV = [TN/(TN + FN)] × 100%. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 18 Jul, 2024 Read the published version in Annals of Clinical Microbiology and Antimicrobials → Version 1 posted Editorial decision: Revision requested 06 Jul, 2024 Reviews received at journal 06 Jul, 2024 Reviews received at journal 04 Jul, 2024 Reviews received at journal 03 Jul, 2024 Reviewers agreed at journal 02 Jul, 2024 Reviewers agreed at journal 01 Jul, 2024 Reviewers agreed at journal 26 Jun, 2024 Reviewers agreed at journal 25 Jun, 2024 Reviewers invited by journal 19 Jun, 2024 Editor assigned by journal 03 Mar, 2024 Submission checks completed at journal 22 Feb, 2024 First submitted to journal 21 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3974857","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":274254080,"identity":"c01442fa-31eb-430c-bfea-a19949da7da6","order_by":0,"name":"LOUKAIYI Lu","email":"","orcid":"","institution":"Obstetrics and Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"LOUKAIYI","middleName":"","lastName":"Lu","suffix":""},{"id":274254081,"identity":"04949ef7-75ce-4852-afc9-b1d48fc32d5d","order_by":1,"name":"Yisheng Chen","email":"","orcid":"","institution":"Obstetrics and Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Yisheng","middleName":"","lastName":"Chen","suffix":""},{"id":274254082,"identity":"163c24bd-bfea-4dfb-9917-6487433d912f","order_by":2,"name":"Qiang Wang","email":"","orcid":"","institution":"Obstetrics and Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Qiang","middleName":"","lastName":"Wang","suffix":""},{"id":274254083,"identity":"57840cef-50bb-40c7-8aa9-1759126a441e","order_by":3,"name":"Jing Gao","email":"","orcid":"","institution":"Obstetrics and Gynecology Hospital of Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Gao","suffix":""},{"id":274254084,"identity":"61634fe5-b793-4a2c-895e-59b86530f19d","order_by":4,"name":"Chunmei Ying","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYJACZoYKCR5+9sbGhx+I13LGRkay53CzsQTRWhjb0mwMbqS3CfAQo9zg+OnkzwVsh3kYbj5sY5BgsJPTbSCk5UzuBuMZPId5GGcntj0oYEg2NjtASMsN3g3JPBKHeZilE9sNJBgOJG4jRsthHoPDPGySB9skeIjUsrGZJyGNh0eCkUgtkmdyNzPzHLDhkeBJBAayARF+4Tt+dvNn3n8S9vbHjz98+KHCTo6gFgVUBQYElIOAfAMRikbBKBgFo2CEAwC+xkINPJq3OQAAAABJRU5ErkJggg==","orcid":"","institution":"Obstetrics and Gynecology Hospital of Fudan University","correspondingAuthor":true,"prefix":"","firstName":"Chunmei","middleName":"","lastName":"Ying","suffix":""}],"badges":[],"createdAt":"2024-02-21 07:44:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3974857/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3974857/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12941-024-00726-y","type":"published","date":"2024-07-18T16:13:24+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":51563806,"identity":"a8890a8f-3e6e-42a8-83d4-173bfa92a440","added_by":"auto","created_at":"2024-02-23 18:47:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":568005,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of the nucleotide sequences of genomes on the GBS region examined for the SAT-GBS primers and probe\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3974857/v1/d3661d22661238f0516e6f1a.png"},{"id":51563807,"identity":"83666eb4-adb8-4285-bcef-bf5711da3eb9","added_by":"auto","created_at":"2024-02-23 18:47:35","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":151212,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of the sensitivity between the SAT-GBS assay and RT-PCR assay\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3974857/v1/5656b90761dc93edd9124007.png"},{"id":61595388,"identity":"0d90b728-f680-4905-a0b5-7dbc18c4069c","added_by":"auto","created_at":"2024-08-01 17:22:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1302683,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3974857/v1/3b670df2-22ea-4fa3-930c-e759fd02e80a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"To evaluate the performance of simultaneous amplification and testing assay for group B Streptococcus detection: comparison with real-time PCR and ddPCR assays","fulltext":[{"header":"Background","content":"\u003cp\u003e \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e, or group B Streptococcus (GBS), is widely acknowledged as a highly infectious bacterium that is associated with severe sepsis and meningitis among neonates and may cause neonatal morbidity and mortality(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). According to previous studies, up to 30% of pregnant women may be infected by GBS(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) in the reproductive tract or the lower end of the digestive tract, and vertical transmission from mothers to newborns is strongly related to neonatal GBS colonization and even early-onset GBS sepsis(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). However, prevention is mainly based on intrapartum antibiotic prophylaxis (IAP) for GBS carriers, and thus, routine GBS screening in late pregnancy (35\u0026thinsp;\u0026minus;\u0026thinsp;37 weeks of gestation) is highly important(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). A rational combination of IAP and prenatal GBS screening can effectively reduce the incidence of early-onset disease (EOD)(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe enrichment culture method is considered the gold standard method and is highly specific and accurate(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e); however, it is more time-consuming and less sensitive than molecular assays(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). In the past few decades, molecular assays have been used in hospitals to speed up the diagnostic process so that timely clinical treatment can be provided(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). To meet the demand of rapid diagnosis during late pregnancy or intrapartum detection in the labor ward, we thus call for an easier and faster detection method. The SAT assay requires only a single temperature and is less expensive than the RT‒PCR assay, which often requires particular equipment to ensure rapid heating/cooling cycles(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Therefore, our study compared the performance of the SAT assay and RT‒PCR in detecting GBS through clinical swabs before/during delivery in a Chinese hospital.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eClinical samples\u003c/h2\u003e\n \u003cp\u003eWe obtained swabs from 1474 pregnant women during late pregnancy (35\u0026thinsp;\u0026minus;\u0026thinsp;37 weeks of gestation) at the Obstetrics and Gynecology Hospital of Fudan University (Shanghai, China) from April to June 2023, and the study protocol was approved by the ethics committee of the Obstetrics and Gynecology Hospital of Fudan University (2023-81-X1). Sterile physiological saline was added to the specimens to elute bacterial cells from the swabs within 12 h of collection, and the eluates were divided equally into 3 tubes (Streck, USA). The first and second tubes of eluates were screened for GBS by using RT‒PCR and SAT assays, respectively, and the results were recorded. In addition, the last tube was kept at -80\u0026deg;C for further use.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003eSAT assay for GBS\u003c/h2\u003e\n \u003cp\u003eSimultaneous amplification and testing (SAT) is a nucleic acid detection method based on RNA transcription-mediated amplification and real-time testing using a molecular beacon probe(\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e). The cfb mRNA of GBS was reverse transcribed using Moloney murine leukemia virus (M-MLV) reverse transcriptase to generate a 150 bp DNA fragment with a T7 promoter sequence via specific primers, one containing the T7 promoter sequence and the other lacking it. Subsequently, T7 RNA polymerase recognizes the T7 promoter sequence and performs transcriptional amplification of RNA. The specific RNA beacon probe can hybridize with complementary sequences in the RNA amplicon and emit fluorescence signals. An internal control was included in the SAT assay. In this study, the experiments were conducted using reagents and protocols from Rendu Biotechnology. Briefly, 200 \u0026micro;L samples were mixed with 200 \u0026micro;L sample preservation solution provided by Rendu Biotechnology and heated at 95\u0026deg;C for 10 minutes, followed by extraction using magnetic beads. All the extracted nucleic acids were added to the amplification system. The amplification and testing program was run at 42\u0026deg;C for 40 minutes, and the fluorescence was measured every minute. The detection time (dt) refers to the minimum time (in minutes) when the fluorescence value reaches the threshold level. Specimens with FAM channel (GBS target) dt values\u0026thinsp;\u0026le;\u0026thinsp;35 were considered GBS-positive. Specimens with FAM channel dt values\u0026thinsp;\u0026gt;\u0026thinsp;35 and VIC channel (internal control) dt values\u0026thinsp;\u0026le;\u0026thinsp;30 were classified as GBS-negative, while VIC dt values\u0026thinsp;\u0026gt;\u0026thinsp;30 were deemed invalid. The extraction, amplification, and detection processes were carried out automatically in an automatic nucleic acid detection and analysis system (AutoSAT) manufactured by Rendu Biotechnology.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003eTechnical sensitivity, specificity, and repeatability of the SAT-GBS\u003c/h2\u003e\n \u003cp\u003e\u003cem\u003eStreptococcus agalactiae\u003c/em\u003e strains of different serotypes were purchased from American Type Culture Collection (ATCC). GBS strains were cultured in brain-heart infusion medium at 37\u0026deg;C. The colony number was determined by the flat colony counting method. The initial culture concentrations were 4.35\u0026times;107 CFU/mL, 3.95\u0026times;107 CFU/mL, 5.65\u0026times;107 CFU/mL and 2\u0026times;108 CFU/mL (serotypes Ia, Ib, III and V, respectively). The technical sensitivity of SAT-GBS was evaluated by testing serial dilutions of the initial culture and reporting the 95% LoD through probability analysis. The endpoint sensitivity of the SAT-GBS and RT‒PCR assays for GBS was estimated using 10-fold serial dilutions of the GBS culture sample (serotype III).\u003c/p\u003e\n \u003cp\u003eThe specificity of the SAT-GBS was evaluated by testing microorganisms commonly present in the vaginal/rectal tract or related to the GBS family. The organisms were tested both with and without the GBS analyte at a concentration of 50 CFU/mL.\u003c/p\u003e\n \u003cp\u003eTo evaluate the repeatability and reproducibility of SAT-GBS, two different serotypes of GBS culture (Ia and III) were tested at a concentration of 1\u0026times;106 CFU/mL. Each serotype was tested 10 times by the same operator in the same laboratory but 10 times by another operator in another laboratory on different days for the assessment of repeatability and reproducibility.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003eDroplet digital PCR (ddPCR) assay for GBS\u003c/h2\u003e\n \u003cp\u003eWhen we discovered controversial experimental results between SAT and RT‒PCR for detecting GBS, we performed an extra ddPCR experiment to confirm whether the specimen was GBS positive. A rapid bacterial genomic DNA isolation kit (Sangon Biotech, China) was used to extract DNA from the last tube of eluates after they were incubated at room temperature for 30 min. ddPCR was performed in a QX200\u0026trade; Droplet Digital PCR System (Bio-Rad Laboratories, CA) according to the manufacturer\u0026rsquo;s instructions(\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e). A 20 \u0026micro;l volume of reaction mixture was required for each test, which comprised 10 \u0026micro;L of ddPCR Supermix for Probes (no dUTP; Bio-Rad), 1 \u0026micro;L of probe, 1 \u0026micro;L of forward primer, 1 \u0026micro;L of reverse primer and 5 \u0026micro;L of DNA template. For microdroplet generation, 20 \u0026micro;L of mixture and 70 \u0026micro;L of droplet generation oil were added to the DG8\u0026trade; cartridge and then loaded into a QX200\u0026trade; Droplet Generator. After that, 40 \u0026micro;L of the microdroplets were transferred to a 96-well PCR plate and heat-sealed with foil in the case of air pollution. Then, PCR was performed on a Bio-Rad T100\u0026trade; PCR Thermal Cycler using the following conditions: predenaturation for 1 cycle at 95\u0026deg;C for 3 min; denaturation for 40 cycles at 95\u0026deg;C for 30 s; and annealing and extension for 40 cycles at 59\u0026deg;C for 1 min (with a ramp rate of 2.5\u0026deg;C/s). Finally, the fluorescence signal in each plate was analyzed by a QX200\u0026trade; Droplet Reader and QuantaSoft\u0026trade; Version 1.7.4, and each reaction used a negative control(\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e). The threshold can be manually set according to the results of the negative control. \u0026deg;C\u003c/p\u003e\n \u003cp\u003eIn our study, specimens with quantification results\u0026thinsp;\u0026gt;\u0026thinsp;1 copy/\u0026micro;L were defined as \u0026ldquo;true positive\u0026rdquo;, and specimens with quantification results\u0026thinsp;\u0026lt;\u0026thinsp;0.5 copies/\u0026micro;L or lacking data were defined as \u0026ldquo;true negative\u0026rdquo;. When specimens had quantification results ranging from 0.5 copies/\u0026micro;L to 1 copy/\u0026micro;L (including 0.5 copies/\u0026micro;L and 1 copy/\u0026micro;L), the results were considered invalid, and these results were excluded.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003ePrimers and Probes\u003c/h2\u003e\n \u003cp\u003eFor the RT‒PCR assay, the primers and probes for the target and internal control sequences were supplied in the BioChain Strep B assay kit.\u003c/p\u003e\n \u003cp\u003eFor the SAT assay, primers and probes were designed to be specific for the mRNA of the GBS cfb gene. The cfb gene of GBS has been used in the detection of GBS in multiple studies, and it has been shown to be highly conserved(\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e). The cfb sequence of the GBS strain (GenBank Genomic Sequence: NZ_CP012480.1, 1929499 to 1930266) was obtained from the GenBank database and used in the design of primers and probes for SAT-GBS via DNAMAN software (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The forward primer contained the T7 promoter sequence (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The probe was labeled with FAM at the 5\u0026rsquo; end and with the quencher DABCYL at the 3\u0026rsquo; end. The IC probe sequence was labeled with HEX at the 5\u0026rsquo; end and with DABCYL at the 3\u0026rsquo; end.\u003c/p\u003e\n \u003cp\u003eFor the ddPCR assay, we selected the TPK gene as the target gene according to previous studies(\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e). The sequence of \u003cem\u003eStreptococcus agalactiae\u003c/em\u003e TPK was obtained from the NCBI database and used in the design of primers and probes for ddPCR-GBS (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistics\u003c/h2\u003e\n \u003cp\u003eStatistical data analyses were performed by SPSS Statistics Version 24.0. The specificity, sensitivity, NPV and PPV were calculated with a 2 \u0026times; 2 contingency table, and chi-square tests/Fisher\u0026rsquo;s exact tests and kappa tests were carried out where appropriate. A \u003cem\u003ep\u003c/em\u003e value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to indicate statistical significance.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003eSensitivity of the SAT-GBS\u003c/h2\u003e\n \u003cp\u003eBy using 10-fold serial dilutions of the GBS culture sample, the technical limit of detection of SAT-GBS was assessed. When the optimal amount of IC was used (5\u0026times;10\u003csup\u003e6\u003c/sup\u003e copies per reaction), SAT-GBS was found to successfully amplify from 2.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e CFU/mL to 2.5\u0026times;10 CFU/mL. To compare the sensitivity of the two assays, the sensitivities of the SAT-GBS and RT‒PCR assays were assessed down to 2.5\u0026times;10 CFU/mL (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). In our study, we found that the SAT-GBS assay was more sensitive than the RT‒PCR assay for detecting GBS.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eSpecificity of the SAT-GBS\u003c/h2\u003e\n \u003cp\u003eTo evaluate the technical specificity of the SAT-GBS, we tested a panel of microorganisms, including viruses, bacteria, fungi and protozoans. Moreover, bacteria were tested at 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e CFU/mL, viruses and fungi were tested at 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e copies/mL, and protozoans were tested at 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/mL. Luckily, none of the pathogens were found to have cross-reacted in the SAT-GBS.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eRepeatability and reproducibility of the SAT-GBS\u003c/h2\u003e\n \u003cp\u003eThe repeatability and reproducibility of SAT-GBS were assessed through calculation of the coefficient of variation (CV) in the detection time (dt) of positive amplification plots, in which dt values were regressed to predict the amount of target RNA. In a single run of the two different serotypes at a concentration of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e CFU/mL, the CVs were 2.81% and 3.27%, respectively. In different runs, the CVs of the two different serotypes were 4.01% and 4.00%, respectively (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eSAT-GBS in clinical specimens\u003c/h2\u003e\n \u003cp\u003eThe sensitivity and specificity of the SAT-GBS were also evaluated by using 1474 clinical maternal vaginal and perianal swabs. By comparing SAT-GBS with RT‒PCR, we discovered 1448 concordant results and 26 discordant results. Among these discordant results, 20 were negative according to the SAT-GBS assay but positive according to the RT‒PCR assay, and after reconfirmation by the ddPCR assay, 15 were confirmed to be true positive, and these 15 \u0026ldquo;SAT-GBS assay negative\u0026rdquo; results were considered false negatives. In addition, 3 of the 20 controversial results were defined as invalid results, were excluded because of relatively low ddPCR quantification results and were considered unreliable. Furthermore, 1 out of the remaining 6 discordant results were false positives since the SAT assay was positive, while the RT‒PCR and ddPCR assays were negative (Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eAfter the exclusion of the 3 invalid results, the SAT assay showed a sensitivity of 91.8%, specificity of 99.9% and diagnostic accuracy of 98.9%. The PPV was 99.4%, and the NPV was 98.8% (Table \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). The kappa value between RT‒PCR and SAT was 0.917.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn our study, the SAT-GBS revealed a GBS colonization rate of 11.5% (169/1471), which was close to that reported in previous studies in mainland China (14.5%), Korea (11.6%) and Japan (18.2%)(\u003cspan additionalcitationids=\"CR16 CR17\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) but lower than that reported in America (21.6%)(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) and Hong Kong (21.8%)(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e), probably due to various factors, including ethnicity, health conditions, social economy, sampling and screening methods, etc.(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). In addition, the colonization rates determined by the SAT and RT‒PCR showed no significant differences according to the chi-square test (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.531, data not shown). Despite the fact that enrichment culture has been considered the gold standard for GBS screening in the USA(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e) and Europe(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e), direct blood agar plate culture has been widely performed in China to save time and reduce costs(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e); thus, the false negative rates in Chinese laboratories are high according to previous studies(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). During our preexperiment period (comprising 269 specimens), we compared the SAT assay with a direct culture assay (the swab was collected on blood agar before elution). The preexperiment showed a relatively low culture assay positive rate of 7.06% (19/269), which is similar to that reported in Korea (4.4%), and Korean studies have shown that the rate of GBS colonization determined by culture assay varies depending on the institution, even within the same country(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). In our hospital, RT‒PCR has been applied in routine prenatal examinations for GBS screening since September 2013 in patients\u0026rsquo; late pregnancy. Considering these factors, this diagnostic accuracy study focused on comparisons between RT‒PCR assays and SAT assays, unlike most other studies in which enrichment culture was used as the reference method(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). In addition, in our study, when we found controversial results between the SAT assay and RT‒PCR assay, an extra ddPCR experiment was conducted to confirm the results, which was believed to be able to provide accurate quantification of pathogen nucleic acid(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). The reason why we defined the 3 RT‒PCR assay results as weakly positive (the FAM Ct values of the 3 results were 37.68, 37.99 and 36.15) with negative SAT assay results as \u0026ldquo;invalid\u0026rdquo; was that the reexamined ddPCR results were 1 copy/\u0026micro;L, 0.74 copies/\u0026micro;L and 0.85 copies/\u0026micro;L, respectively, and we could not tell whether the 3 samples were negative or positive. Sample-related uninterpretable factors, including inadequate sampling and DNA-degrading substances, may explain the appearance of invalid results.\u003c/p\u003e \u003cp\u003eIn this study, we found that the SAT assay has relatively good sensitivity, specificity, PPV and NPV. Moreover, since our SAT assay requires only a single temperature for amplification, the turnaround time is superior to that of existing RT‒PCR assays and enrichment cultures(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Previous studies suggested that GBS screening results should be provided at least 4 hours before the birth process so that targeted intrapartum prophylaxis can be conducted(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e), and our SAT-GBS assay may meet this demand if a 24-hour operating diagnostic laboratory is available.\u003c/p\u003e \u003cp\u003eA limitation of our study was that our samples were collected from vaginal and perianal regions, while many studies revealed that rectal colonization was more common than vaginal colonization(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e), which means that we may have failed to detect some rectally colonized GBS-positive patients, and our GBS colonization rate was relatively lower than the real situation, which may also explain why our GBS-positive rate was much lower than that in the USA(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAnother limitation of our study was that our GBS-SAT assay lacks antimicrobial susceptibility testing, which means that even with the 24-hour availability of GBS screening results, doctors can only treat patients with empirical therapy at the time of membrane rupture or in the laboratory.\u003c/p\u003e \u003cp\u003eMoreover, it has been proven that the colonization status of GBS may change during pregnancy, which may explain why a large number of EODs caused by GBS that occur in infants are GBS-tested negative gravidas(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e), and there are still many pregnant women who deliver their babies without GBS prenatal screening tests due to preterm birth(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Overall, our SAT-GBS assay may reach the demand of finding an accurate and rapid method for late antenatal and intrapartum GBS screening.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe simultaneous amplification and testing assay performed well in detecting GBS, which may satisfy the clinical demand for developing a highly accurate and rapid GBS screening method and reduce the incidence of newborn sepsis and meningitis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eSAT Simultaneous amplification and testing\u003c/p\u003e \u003cp\u003eGBS Group B Streptococcus\u003c/p\u003e \u003cp\u003eRT‒PCR Real-time polymerase chain reaction\u003c/p\u003e \u003cp\u003eddPCR Droplet digital PCR\u003c/p\u003e \u003cp\u003ePPV Positive predictive value\u003c/p\u003e \u003cp\u003eNPV Negative predictive value\u003c/p\u003e \u003cp\u003eIAP Intrapartum antibiotic prophylaxis\u003c/p\u003e \u003cp\u003eEOD Early-onset disease\u003c/p\u003e \u003cp\u003eM-MLV Moloney murine leukemia virus\u003c/p\u003e \u003cp\u003edt Detection time\u003c/p\u003e \u003cp\u003eATCC American Type Culture Collection\u003c/p\u003e \u003cp\u003eCV Coefficient of variation\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLoukaiyi Lu designed the study and wrote the manuscript. Yisheng Chen and Qiang Wang collected the data and conducted the statistical analysis. Chunmei Ying assisted in revising the manuscript. All the authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Nature Science Foundation of China (81873970) and the Science and Technology Planning Project of Shanghai (23ZR1408100).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present study was approved by the ethics committee of the Obstetrics and Gynecology Hospital of Fudan University (2023-81-X1), in accordance with the Declaration of Helsinki.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed consent was obtained from all individual participants included in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone of the authors declare a conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eDepartment of Laboratory Medicine, Obstetrics and Gynecology Hospital, Fudan University, Shanghai 200011, China\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eTrotter CL, Alderson M, Dangor Z, Ip M, Le Doare K, Nakabembe E, et al. Vaccine value profile for Group B streptococcus. Vaccine. 2023;41(Suppl 2):41\u0026ndash;S52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRussell NJ, Seale AC, O'Driscoll M, O'Sullivan C, Bianchi-Jassir F, Gonzalez-Guarin J, et al. Maternal Colonization With Group B\u0026thinsp;\u0026lt;\u0026thinsp;i\u0026thinsp;\u0026gt;\u0026thinsp;Streptococcus\u0026thinsp;and Serotype Distribution Worldwide: Systematic Review and Meta-analyses. Clin Infect Dis. 2017;65:100\u0026ndash;S11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede-Paris F, Mombach Pinheiro Machado AB, Gheno TC, Ascoli BM, Pilger de Oliveira KR, Barth AL. Group B\u0026thinsp;\u0026lt;\u0026thinsp;i\u0026thinsp;\u0026gt;\u0026thinsp;Streptococcus\u0026thinsp;detection: comparison of PCR assay and culture as a screening method for pregnant women. Brazilian J Infect Dis. 2011;15(4):323\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrevention of Group B Streptococcal Early-Onset Disease in Newborns. Obstet Gynecol. 2020;135(2):E51\u0026ndash;E72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLohrmann F, Hufnagel M, Kunze M, Afshar B, Creti R, Detcheva A, et al. Neonatal invasive disease caused by Streptococcus agalactiae in Europe: the DEVANI multi-center study. Infection. 2023;51(4):981\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerani JR, McGee L, Schrag SJ. Prevention of Perinatal Group B Streptococcal Disease Revised Guidelines from CDC, 2010. Morb Mortal Wkly Rep. 2010;59(RR10):1\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavies HD, Miller MA, Faro S, Gregson D, Kehl SC, Jordan JA. Multicenter study of a rapid molecular-based assay for the diagnosis of group B\u0026thinsp;\u0026lt;\u0026thinsp;i\u0026thinsp;\u0026gt;\u0026thinsp;Streptococcus\u0026thinsp;colonization in pregnant women. Clin Infect Dis. 2004;39(8):1129\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoliwer-Brandl H, Nil A, Birri J, Sachs M, Zimmermann R, Zbinden R, et al. Evaluation of two rapid commercial assays for detection of Streptococcus agalactiae from vaginal samples. Acta Obstet Gynecol Scand. 2023;102(4):450\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCurry A, Bookless G, Donaldson K, Knowles SJ. Evaluation of hibergene loop-mediated isothermal amplification assay for detection of group B streptococcus in recto-vaginal swabs: a prospective diagnostic accuracy study. Clin Microbiol Infect. 2018;24(10):1066\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Fang Y, Shen H, Yang D, Shu Q, Shang S. Evaluation of a real-time method of simultaneous amplification and testing in diagnosis of Mycoplasma pneumoniae infection in children with pneumonia. PLoS ONE. 2017;12(5):e0177842.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHindson BJ, Ness KD, Masquelier DA, Belgrader P, Heredia NJ, Makarewicz AJ, et al. High-Throughput Droplet Digital PCR System for Absolute Quantitation of DNA Copy Number. Anal Chem. 2011;83(22):8604\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng Y-F, Chen C-M, Li X-Y, Chen J-J, Wang Y-G, Ouyang S et al. Development of a droplet digital PCR method for detection of \u0026lt;\u0026thinsp;i\u0026thinsp;\u0026gt;\u0026thinsp;Streptococcus agalactiae. BMC Microbiol. 2020;20(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalasubramanian N, Pounpandi P, Varatharaju G, Shanmugaiah V, Balakrishnan K, Thirunarayan MA. Distribution of virulence genes and biofilm characterization of human isolates of \u0026lt;\u0026thinsp;i\u0026thinsp;\u0026gt;\u0026thinsp;Streptococcus agalactiae: A pilot study. Colloids Surf B-Biointerfaces. 2023;223.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeatero S, Ramoutar E, McGeer A, Li A, Melano RG, Wasserscheid J et al. Clonal Complex 17 Group B\u0026thinsp;\u0026lt;\u0026thinsp;i\u0026thinsp;\u0026gt;\u0026thinsp;Streptococcus\u0026thinsp;strains causing invasive disease in neonates and adults originate from the same genetic pool. Sci Rep. 2016;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu Y, Wu J, Zheng X, Liu D, Xu L, Chen D et al. Etiological serotype and genotype distributions and clinical characteristics of group B\u0026thinsp;\u0026lt;\u0026thinsp;i\u0026thinsp;\u0026gt;\u0026thinsp;streptococcus-inducing invasive disease among infants in South China. BMC Pediatr. 2020;20(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao K, Deng Q, Huang L, Chang C-Y, Zhong H, Xie Y et al. Diagnostic Performance of Various Methodologies for Group B S\u0026thinsp;\u0026lt;\u0026thinsp;i\u0026thinsp;\u0026gt;\u0026thinsp;treptococcus\u0026thinsp;Screening in Pregnant Woman in China. Front Cell Infect Microbiol. 2021;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim DH, Min BJ, Jung EJ, Byun JM, Jeong DH, Lee KB, et al. Prevalence of group B streptococcus colonization in pregnant women in a tertiary care center in Korea. Obstet Gynecol Sci. 2018;61(5):575\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanno D, Saito K, Tomii Y, Nakatsuka Y, Uechi K, Ohashi K et al. A Multicenter Study on the Utility of Selective Enrichment Broth for Detection of Group B Streptococcus in Pregnant Women in Japan. Jpn J Infect Dis. 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdwards JM, Watson N, Focht C, Wynn C, Todd CA, Walter EB, et al. Group B Streptococcus (GBS) Colonization and Disease among Pregnant Women: A Historical Cohort Study. Infect Dis Obstet Gynecol. 2019;2019:5430493.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa T, Chan V, So C, Hui A, Lee C, Hui A et al. Prevention of early onset group B streptococcal disease by universal antenatal culture-based screening in all public hospitals in Hong Kong. The journal of maternal-fetal \u0026amp; neonatal medicine: the official journal of the European Association of Perinatal Medicine, the Federation of Asia and Oceania Perinatal Societies, the International Society of Perinatal Obstetricians. 2018;31(7):881\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Renzo GC, Melin P, Berardi A, Blennow M, Carbonell-Estrany X, Donzelli GP et al. Intrapartum GBS screening and antibiotic prophylaxis: a European consensus conference. Journal of Maternal-Fetal \u0026amp; Neonatal Medicine. 2015;28(7\u0026ndash;8):766\u0026thinsp;\u0026ndash;\u0026thinsp;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu B, Li D, Cui Y, Sui W, Huang L, Lu X. Epidemiology of Group B streptococcus isolated from pregnant women in Beijing, China. Clin Microbiol Infect. 2014;20(6):O370\u0026ndash;O3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSung J-H, Cha H-H, Lee N-Y, Lee W-K, Choi Y, Han H-S et al. Diagnostic Accuracy of Loop-Mediated Isothermal Amplification Assay for Group B Streptococcus Detection in Recto-Vaginal Swab: Comparison with Polymerase Chain Reaction Test and Conventional Culture. Diagnostics. 2022;12(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Z, Pan L, Lyu L, Li J, Jia H, Du B, et al. Diagnostic accuracy of droplet digital PCR analysis of cerebrospinal fluid for tuberculous meningitis in adult patients. Clin Microbiol Infect. 2020;26(2):213\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlatt MW, McLaughlin JC, Gilson GJ, Wellhoner MF, Nims LJ, INCREASED RECOVERY OF GROUP-B STREPTOCOCCUS BY THE INCLUSION OF RECTAL CULTURING AND ENRICHMENT. Diagn Microbiol Infect Dis. 1995;21(2):65\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTowers CV, Rumney PJ, Asrat T, Preslicka C, Ghamsary MG, Nageotte MP. The Accuracy of Late Third-Trimester Antenatal Screening for Group B Streptococcus in Predicting Colonization at Delivery. Am J Perinatol. 2010;27(10):785\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1. Prime, probe and IC-RNA sequences of SAT assay\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.661971830985916%\" valign=\"top\"\u003e\n \u003cp\u003eForward primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"81.33802816901408%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;‑CGGTTAATGAGGCTATTACTA‑3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.661971830985916%\" valign=\"top\"\u003e\n \u003cp\u003eReverse primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"81.33802816901408%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;‑AATTTAATACGACTCACTATAGGGAGAGTTAAGGCTTCTACACGACT‑3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.661971830985916%\" valign=\"top\"\u003e\n \u003cp\u003eProbe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"81.33802816901408%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;‑GAGACAGUUUAUGAUUUGUCUC‑3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.661971830985916%\" valign=\"top\"\u003e\n \u003cp\u003eIC-probe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"81.33802816901408%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;-CCGACGUGAUACGAGAGAGUCGG-3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. Prime and probe sequences of ddPCR assay\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.661971830985916%\" valign=\"top\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"81.33802816901408%\" valign=\"top\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.661971830985916%\" valign=\"top\"\u003e\n \u003cp\u003eForward primer\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"81.33802816901408%\" valign=\"top\"\u003e\n \u003cp\u003eCGCCGTAAGTAGCAACAGAT \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.661971830985916%\" valign=\"top\"\u003e\n \u003cp\u003eReverse primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"81.33802816901408%\" valign=\"top\"\u003e\n \u003cp\u003eAAAGAACAGATGGAACAAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.661971830985916%\" valign=\"top\"\u003e\n \u003cp\u003eProbe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"81.33802816901408%\" valign=\"top\"\u003e\n \u003cp\u003eAGAATAATACCTAAGAACTTTGAACC\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3. Coefficient of variation (CV) of serotype Ia and III\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"99%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"45.91836734693877%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.510204081632654%\" colspan=\"2\"\u003e\n \u003cp\u003eRUN 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.571428571428573%\" colspan=\"2\"\u003e\n \u003cp\u003eRUN 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eSerotype\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003eIa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003eIII\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003eIa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003eIII\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eTEST\u0026nbsp;1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e15.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e15.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e13.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eTEST 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e15.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e13.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eTEST 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e15.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e13.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eTEST 4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e16.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e15.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e13.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eTEST 5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e15.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e15.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e13.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eTEST 6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e16.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e15.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eTEST 7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e15.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e15.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e13.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eTEST 8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e14.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e13.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eTEST 9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e15.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eTEST 10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e15.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e13.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e14.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eCV of Ia and III in RUN 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e2.8%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e3.3%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"46.391752577319586%\"\u003e\n \u003cp\u003eCV of Ia and III BETWEEN RUNS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp\u003e4.0%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e4.0%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e4.0%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.43298969072165%\"\u003e\n \u003cp\u003e4.0%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4. The results of the 26 discordant specimens by RT-PCR assay, SAT assay and ddPCR assay\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"99%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSAT Assay\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(dt value)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePCR Assay\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(Ct value)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eddPCR Assay\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(copies/\u0026mu;L)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eResult\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e36.75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e19.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e1.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e36.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e1.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e35.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e9.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e37.68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eun\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e33.25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e1.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e37.39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e2.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e23.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e8.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e38.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e3.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e38.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e2.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e35.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e3.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e19.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e11.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e31.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e40.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e36.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e1.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e19.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e0.47\u0026lt;0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e37.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e3.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e37.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e1.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e36.98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e2.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e36.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\" valign=\"top\"\u003e\n \u003cp\u003e4.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e37.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e12.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e37.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e15.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e2.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e18.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e20.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e36.75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e2.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e37.99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e0.74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eun\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"19.587628865979383%\" valign=\"top\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.587628865979383%\"\u003e\n \u003cp\u003e36.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003e0.85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.61855670103093%\"\u003e\n \u003cp\u003eun\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 5. Diagnostic performance of RT-PCR assay and SAT assay in clinical specimens\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"127%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"9.574468085106384%\"\u003e\n \u003cp\u003eMethods\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.702127659574469%\"\u003e\n \u003cp\u003eTurnaround Time\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.319148936170213%\"\u003e\n \u003cp\u003eTP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.382978723404255%\"\u003e\n \u003cp\u003eTN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1914893617021276%\"\u003e\n \u003cp\u003eFP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.25531914893617%\"\u003e\n \u003cp\u003eFN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.382978723404255%\"\u003e\n \u003cp\u003eNPV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.446808510638298%\"\u003e\n \u003cp\u003ePPV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.957446808510639%\"\u003e\n \u003cp\u003eSensitivity\u003c/p\u003e\n \u003cp\u003e(95% CI)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.085106382978722%\"\u003e\n \u003cp\u003eSpecificity\u003c/p\u003e\n \u003cp\u003e(95% CI)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.702127659574469%\"\u003e\n \u003cp\u003eDiagnostic Accuracy\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"9.574468085106384%\"\u003e\n \u003cp\u003eRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.702127659574469%\"\u003e\n \u003cp\u003e4h\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.319148936170213%\"\u003e\n \u003cp\u003e182\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.382978723404255%\"\u003e\n \u003cp\u003e1287\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1914893617021276%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.25531914893617%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.382978723404255%\"\u003e\n \u003cp\u003e99.6%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.446808510638298%\"\u003e\n \u003cp\u003e98.9%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.957446808510639%\"\u003e\n \u003cp\u003e97.3% (93.4-99.0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.085106382978722%\"\u003e\n \u003cp\u003e99.8% (99.4-100.0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.702127659574469%\"\u003e\n \u003cp\u003e99.7%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"9.574468085106384%\"\u003e\n \u003cp\u003eSAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.702127659574469%\"\u003e\n \u003cp\u003e2h\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"5.319148936170213%\"\u003e\n \u003cp\u003e170\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.382978723404255%\"\u003e\n \u003cp\u003e1288\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"3.1914893617021276%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"4.25531914893617%\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"6.382978723404255%\"\u003e\n \u003cp\u003e98.8%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.446808510638298%\"\u003e\n \u003cp\u003e99.4%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.957446808510639%\"\u003e\n \u003cp\u003e91.8% (86.6-95.2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.085106382978722%\"\u003e\n \u003cp\u003e99.9% (99.5-100.0)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.702127659574469%\"\u003e\n \u003cp\u003e98.9%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e*TP, true positive; TN, true negative; FP, false positive; FN, false negative; CI, confidence interval; PPV, positive predictive value; NPV, negative predictive value; Sensitivity = [TP/(TP + FN)] \u0026times; 100%; Specificity = [TN/(TN + FP)] \u0026times; 100%; PPV = [TP/(TP + FP)] \u0026times; 100%; NPV = [TN/(TN + FN)] \u0026times; 100%.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"annals-of-clinical-microbiology-and-antimicrobials","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cmam","sideBox":"Learn more about [Annals of Clinical Microbiology and Antimicrobials](http://ann-clinmicrob.biomedcentral.com/)","snPcode":"12941","submissionUrl":"https://submission.nature.com/new-submission/12941/3","title":"Annals of Clinical Microbiology and Antimicrobials","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"simultaneous amplification and testing (SAT), real-time PCR (RT‒PCR), droplet digital PCR (dd PCR), group B Streptococcus (GBS)","lastPublishedDoi":"10.21203/rs.3.rs-3974857/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3974857/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eTo evaluate the performance of simultaneous amplification and testing (SAT) assay for the detection of group B Streptococcus (GBS) in maternal vaginal and perianal swabs compared with real-time polymerase chain reaction (RT‒PCR).\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003e We obtained vaginal and perianal swabs from 1474 pregnant women at the Obstetrics and Gynecology Hospital of Fudan University (Shanghai, China) between April 2023 and June 2023. Vaginal and perianal swabs were collected at 35\u0026ndash;37 weeks of gestation. Swabs were tested for GBS simultaneously by using the SAT assay and RT‒PCR, and a comparative analysis (kappa coefficient) was performed. Furthermore, we conducted additional droplet digital PCR (ddPCR) tests to confirm the results when there were controversial results between SAT and RT‒PCR. In addition, we compared the limit of detection, technical specificity, repeatability and reproducibility of SAT-GBS with those of routine RT‒PCR assays.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn our study, the rate of clinical GBS colonization according to the SAT assay was 11.5% (169/1471). The SAT assay showed a sensitivity of 91.8%, a specificity of 99.9%, a diagnostic accuracy of 98.9%, a positive predictive value (PPV) of 99.4% and a negative predictive value (NPV) of 98.8%. The kappa value between RT‒PCR and SAT was 0.917.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThis SAT assay for the detection of group B Streptococcus is not only easy to perform but can also detect GBS sensitively and specifically and may be used in the regular molecular diagnosis of GBS in cases of newborn sepsis and meningitis.\u003c/p\u003e","manuscriptTitle":"To evaluate the performance of simultaneous amplification and testing assay for group B Streptococcus detection: comparison with real-time PCR and ddPCR assays","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-23 18:47:30","doi":"10.21203/rs.3.rs-3974857/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-06T19:46:04+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-06T18:46:07+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-04T19:46:28+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-03T19:29:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"91454229571650827422051296984459080951","date":"2024-07-02T09:06:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"231806055568816080806009203363224629653","date":"2024-07-01T18:05:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"5206625586865490097674807150946121059","date":"2024-06-26T15:55:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"233102359273633578495126193499240687177","date":"2024-06-25T16:18:42+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-19T18:56:39+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-03T11:42:16+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-02-22T08:33:35+00:00","index":"","fulltext":""},{"type":"submitted","content":"Annals of Clinical Microbiology and Antimicrobials","date":"2024-02-21T07:16:44+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"annals-of-clinical-microbiology-and-antimicrobials","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cmam","sideBox":"Learn more about [Annals of Clinical Microbiology and Antimicrobials](http://ann-clinmicrob.biomedcentral.com/)","snPcode":"12941","submissionUrl":"https://submission.nature.com/new-submission/12941/3","title":"Annals of Clinical Microbiology and Antimicrobials","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0ece9d80-04e2-4cd1-a481-f54ebb692678","owner":[],"postedDate":"February 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-01T16:21:46+00:00","versionOfRecord":{"articleIdentity":"rs-3974857","link":"https://doi.org/10.1186/s12941-024-00726-y","journal":{"identity":"annals-of-clinical-microbiology-and-antimicrobials","isVorOnly":false,"title":"Annals of Clinical Microbiology and Antimicrobials"},"publishedOn":"2024-07-18 16:13:24","publishedOnDateReadable":"July 18th, 2024"},"versionCreatedAt":"2024-02-23 18:47:30","video":"","vorDoi":"10.1186/s12941-024-00726-y","vorDoiUrl":"https://doi.org/10.1186/s12941-024-00726-y","workflowStages":[]},"version":"v1","identity":"rs-3974857","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3974857","identity":"rs-3974857","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}