X-ray Inactivation of SARS-CoV-2: A Safe, Cost-effective Approach for Pandemic Testing Workflows.

X-ray Inactivation of SARS-CoV-2: A Safe, Cost-effective Approach for Pandemic Testing Workflows. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article X-ray Inactivation of SARS-CoV-2: A Safe, Cost-effective Approach for Pandemic Testing Workflows. Elle Campbell, Babak Afrough, Laura Bonney, Mollie Curran-French, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4926136/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 14 You are reading this latest preprint version Abstract In response to the unprecedented challenges posed by the COVID-19 pandemic, this study introduces a novel application of X-ray irradiation to rapidly inactivate SARS-CoV-2 variants, enabling safe and efficient virus handling outside high-containment facilities. Unlike traditional methods, X-ray irradiation preserves both the structural and genomic integrity of the virus, allowing for accurate detection through molecular and antigen-based diagnostics. Our findings not only demonstrate the method's superiority over gamma irradiation in terms of safety and cost but also its effectiveness in maintaining antigenic fidelity, critical for diagnostic reliability. Importantly, the scalability and accessibility of X-ray technology provide a transformative approach for managing future pandemic outbreaks, offering a robust tool for rapid viral inactivation that can significantly enhance global testing and research capabilities without the logistical and safety constraints of high-containment processing. Biological sciences/Microbiology Physical sciences/Physics/Techniques and instrumentation X-Ray MultiRad 225 Inactivation SARS-CoV-2 Pandemic and Lateral Flow Device Figures Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction In the 21st century, the emergence of infectious diseases has accelerated, driven by factors such as globalisation, urbanisation, deforestation, and climate change. [ 1 – 4 ] The COVID-19 pandemic has underscored the urgent need for flexible and robust diagnostic tools capable of quickly adapting to new pathogens. Between January 2020 and December 2021, an estimated 18.2 million people died due to SARS-CoV-2 related illnesses globally. [ 5 ] Leading to a significant global economic downturn, in the UK, gross domestic product dropped to a record low of 19.4% during the first UK lockdown. [ 6 ] The likelihood of pandemics is expected to rise, with mathematical modellers estimating a 38% probability that individuals will experience another pandemic in their lifetimes [ 7 ] . This highlights the critical need to prepare robust and responsive diagnostic and research workflows that can quickly adapt to future outbreaks caused by both new and existing high-risk pathogens. Necessary safety and legal requirements related to the isolation and culture of high-risk pathogens in finite, labour-intensive, high containment facilities however, pose significant physical barriers against public health responses to new pandemic outbreaks. The development of effective inactivation techniques that can render infected samples or isolated (reference) pathogens non-infectious, yet structurally intact, is vital for the rapid distribution of inactivated pathogens to multiple laboratories. This enables the development and validation of diagnostic assays within widely available low containment facilities. [ 8 ] This study introduces a novel application of X-ray irradiation, proposing it as a safer, more cost-effective alternative to gamma radiation sources, that preserves the antigenic and genomic integrity of viruses. By demonstrating the efficacy of X-ray irradiation in inactivating various SARS-CoV-2 variants, this research aims to provide a scalable solution for rapid pandemic response, crucial for both current and future outbreak scenarios. In contrast to other inactivation techniques, gamma irradiation is notable for its ability to retain the structural integrity of viral epitopes. [ 9 – 11 ] Without the use of toxic chemicals, gamma irradiation has been shown to effectively inactivate several high consequence pathogens, including Lassa, Marburg and Ebola viruses. [ 12 , 13 ] Gamma sources, as a form of ionising radiation, primarily inactivates viruses through target matter ionisation, resulting in direct crosslinking and cleavage of viral nucleic acid. This prevents viral replication and produces viruses with preserved viral structures and superior immunogenicity compared to chemical or heat inactivation methods, which maintain their ability to selectively bind and become internalised into susceptible cells. [ 14 – 16 ] Gamma irradiated influenza stocks for example, have been shown to elicit both humoral and cell-mediated immunogenicity, protecting against both homologous and heterologous strains. [ 17 – 19 ] Due to these advantages, gamma inactivation provides a method to produce antigenic, non-infectious whole virus particles capable of supporting further development of multiple specialisms, both for research and diagnostic development, as well as candidates for future vaccines. [ 9 , 14 ] The generation of gamma irradiation using ‘live’ radioactive isotopes is impeded by major economic, safety and legal constraints, prompting the investigation of alternative generators to support the radiobiology field. [ 20 ] Gamma and X-rays are both highly penetrating photons, that damage biological specimens through the direct ionisation of viral genomes. These photons can also interact with water molecules and other organic molecules within biological samples, generating unpaired electrons (referred to as free radicals), which are highly reactive and can cause subsequent indirect ionisation. [ 21 , 22 ] Due to their shared underlying mechanistic inactivation processes, both forms of ionising radiation are believed to hold similar benefits. [ 8 , 22 ] X-rays are highly penetrating and can pass through multiple layers of biosafety packaging allowing large volumes of infectious material to be inactivated more effectively than with alternative radiation techniques, such as UV and electron bombardment. [ 8 , 22 – 24 ] X-rays are typically generated by propelling electrons from a metal filament cathode towards a tungsten target anode, within a vacuum X-ray tube. [ 22 ] When electrons strike the target atoms, they emit photons, in the form of X-rays, through two distinct mechanisms. The primary mechanism, Bremsstrahlung, involves the deceleration of electrons as they pass through the atomic electric field within the target material. [ 25 ] The second mechanism involves an electron transitioning from an outer to an inner shell, which also results in the emission of an X-ray photon. [ 22 ] X-rays offer a safer and more cost-effective alternative to gamma irradiation, largely because they do not involve the use of radioactive isotopes, which pose significant safety and decommissioning challenges related to radiative decay. [ 8 ] Unlike gamma rays, which emit radiation at a fixed quality (i.e. a fixed energy distribution and source emission strength) due to their reliance on specific isotopes, X-ray machines operate using electrical currents that can be easily started, finely adjusted, and stopped. This plasticity allows for the customisation of the radiation field to meet specific dosimetry needs across various applications. The ability to adjust the voltage potential and current in X-ray machines not only enhances their safety but also increases their efficacy and efficiency, making them particularly suitable where flexibility and precise control are required. [ 26 ] Using a multidisciplinary approach that includes Monte Carlo modelling and virology techniques, we have previously determined the necessary inactivation parameters and X-Ray doses using the MultiRad 225 X-ray Irradiator system to effectively inactivate a variety of viruses from the Togaviridae, Flaviviridae, Nairoviridae and Phenuividae , families which are known to cause significant disease. [ 8 , 27 ] X-ray irradiation left no signs of viral infection in these model viruses, yet allowed the detection of complete genome sequences. Moreover, viral proteins were detectable in assays such as Western blot and ELISA. [ 8 ] These findings confirm that X-ray irradiated viruses retain key molecular markers, making them suitable for a range of diagnostic and research applications, including next generation sequencing, qPCR and serological detection assays, during pandemic outbreaks. Here we demonstrate the successful generation of X-ray inactivated SARS-CoV-2 material in real-time for deployment throughout the COVID-19 pandemic, to support the development and further validation of Lateral Flow devices (LFDs). X-ray irradiation successfully inactivated 8 different SARS-CoV-2 variants of concern (VOCs). Imaging of whole virus particles from these X-ray irradiated stocks revealed that SARS-CoV-2 nucleoprotein and spike proteins remained detectable across all tested variants by ELISA and LFDs. This demonstrates the utility of X-ray irradiated material for diagnostic evaluation and highlights its ability to enhance throughput and testing capacity during pandemics without the need for labour intensive, high-containment handling. Results X-ray irradiation inactivation kinetics determine a SARS-CoV-2 D-value of 1.02 kilograys (kGy). The X-ray D-value or decimal reduction dose, quantifies to the amount of X-ray irradiation required to reduce the viral titre of a specific pathogen by 1-Log, in a known medium. This rate of inactivation rate helps predict the necessary X-ray dose for SARS-CoV-2 variants assuming experiments are conducted under consistent conditions. Inactivation dynamics were initially evaluated by incrementally irradiating 1 ml aliquots of SARS-CoV-2 England/02/2020 with high energy X-rays, using the MultiRad 225 Irradiator system following previously determined methodologies and an average temperature of 9°C . [ 8 ] Both high and low titre virus stocks were tested to assess if the rate of inactivation was consistent across different starting titres under controlled conditions. The viral titre post irradiation was assessed by plaque assay. The low titre stock of 3.0 x 10 5 plaque forming units (PFU)/ml, was fully inactivated at 4 kGy. The high titre stocks, with reported titres of 2.13 X 10 7 PFU/ml and 1.87 X 10 7 PFU/ml, collectively had a mean inactivation dose of 6.39 kGy (Supplementary Fig. 1A). Survival curves were generated by plotting the Log10 viral titre (Log(10PFU/ml)) against X-ray inactivation dose (kGy) for each experimental repeat (Fig. 1 ). All regression lines had an R 2 - value above 0.95 indicating high reliability of the fits and a residual value ranging between − 0.6 to 0.4 (Supplementary Fig. 1). For the high titre aliquots, regression lines had gradients of -1.002 (95% Confident Intervals: -1.042 to -0.9539, Fig. 1 , blue) and − 1.241 (95% Confident Intervals: -0.9021 to -0.7089, Fig. 1 , green). The low titre aliquots showed a gradient of -0.8295 (95% Confident Intervals: -1.416 to -0.9956, Fig. 1 , red). D-values, representing the dose required to reduce the viral titre by 1-Log, were calculated from the inverse slope of these lines. Averaging these values yielding a final D-value of 1.02, which can be used to predict the minimum X-ray dose needed for effective inactivation of SARS-CoV-2 variants with different starting titres. X-ray irradiation can successfully inactivate SARS-CoV-2 variants of concerns . Throughout the pandemic, emerging SARS-CoV-2 VOCs were successfully inactivated through X-ray irradiation, making them suitable for use as positive controls in diagnostic assays within low containment facilities. The inactivation of all X-ray treated variants was rigorously confirmed through a two-step process. Initially, plaque assays compared plaque counts before and after irradiation (Fig. 2 A), consistently showing no plaque formation in the irradiated variants (Fig. 2 C). Subsequently the irradiated variants then underwent three weeks of serial passage in a susceptible cell line. During this period, cell monolayers were monitored for any visible signs of infection and nucleic acid were periodically extracted to track trends in detection of viral RT-qPCR targets. The X-ray irradiated stocks displayed no cytopathic effects (CPE) throughout the serial passages, whereas control groups with non-irradiated variants exhibited obvious signs of infection. (Fig. 2B2). Additionally, RT-qPCR analysis revealed a decrease in viral target copies, for irradiated viruses, contrasting with an increase observed in the non-irradiated controls, indicating active viral replication in the latter (Fig. 2B1). X-ray irradiated variants then underwent 3 weeks of sterility passage within a susceptible cell line. Throughout sterility, infected flasks were observed for visible signs of infection and AVL samples were taken at regular intervals to track trends in detection of viral RT-qPCR targets. All X-Ray irradiated stocks showed no visible signs of cytopathic effect (CPE) on the susceptible cell culture during all rounds of sterility passage, while identical, non-irradiated SARS-Cov-2 variants showed visible signs of infection (Fig. 2B2). To support this, non-irradiated variants demonstrated a clear increase in viral RT-qPCR target copies, indicating clear signs of active viral replication. The opposite effect was found for X-ray irradiated viruses, which saw a reduction in viral target copies by RT-qPCR (Fig. 2B1). X-Ray irradiated SARS-CoV-2 variants show comparable sequencing depth and coverage to live sequenced viruses. All X-ray irradiated SARS-CoV-2 variants demonstrated sequencing depth and coverage comparable to that of non-irradiated SARS-CoV-2. Whole genome sequencing was performed on all irradiated variants to determine whether X-ray irradiation impacted the viral RNA and its suitability for downstream molecular assays. No differences were found in the depth coverage between live and X-ray irradiated SARS-CoV-2 Omicron BA.2 variants across their entire genomes with all tested variants showing a depth coverage above 99% (Fig. 3 A and Fig. 3 B). Furthermore, phylogenetic analysis using NextClade algorithms revealed that all irradiated viruses were accurately characterised within their respective clades, exhibiting identical results to non-irradiated counterparts with a pairwise distance of 0% calculated in all cases (Fig. 3 B). Whole virus SARS-CoV-2 particles are preserved after X-ray irradiation and viral proteins detectable by antigen detection assays. The applicability of inactivated viruses as reagents and controls in diagnostics assays hinges on the preservation of viral proteins. To evaluate this, the structural integrity and detection sensitivity of X-ray irradiated viruses were assessed and compared with live viruses. Transmission electron microscopy (TEM) was used to image both X-ray irradiated Delta and Omicron BA.2 variants. The images confirmed that both treated and untreated viruses maintained similar structural morphologies and densities (Fig. 4 ). To further assess the impact of X-ray irradiation on viral protein structures, both live and irradiated SARS-CoV-2 Omicron BA.2 variants were evaluated for their sensitivity in both LFD and ELISA assays. The Orient Gene Rapid COVID-19 (Antigen) Self-Test, which detects the presence of the SARS-CoV-2 nucleocapsid protein and displays a positive result with a clear red test line, was used to gauge sensitivity. A scoring system was employed for LFD test line intensity, with strong positives graded as 3, weak positives as 2 and very weak positives as 1 and negatives as 0 (Fig. 5 A). Both nucleoproteins from all tested irradiated variants were detectable by LFD. (Fig. 5 B). Furthermore, live and X-ray irradiated Omicron BA.2 variants showed equivalent test line intensities, achieving identical scoring down to a viral titre of 1.00E + 03 FFU/ml (Fig. 5 C). This consistent performance demonstrates the utility of X-ray irradiated material in LFD validation, confirming its effectiveness as a diagnostic tool. Detection of the receptor binding detection (RBD) site of the spike protein in X-ray irradiated SARS-CoV-2 variants was evaluated using a commercially available Human SARS-CoV-2 RBD ELISA Kit. All tested irradiated SARS-CoV-2 variants showed detectable spike proteins by ELISA, with readings consistently above background levels (Fig. 6 A). A statistically significant difference was observed in the absorbance curves between live and X-ray irradiated Omicron BA.2 variants, with a t-value of 4.436, (df = 16, p = 0.0004), indicating a robust statistical support for the findings. Despite this difference the absorbance curves of both live and X-ray irradiated viruses followed similar trends, with the irradiated viruses producing an absorbance value only 0.35 lower than that of the live virus at the highest tested titre of 2.5 X 10 5 FFU/ml. (Fig. 6 B). Discussion An effective, safe and reliable, ‘one shot’ viral inactivation method, applicable across several downstream assays, is essential to overcoming physical bottlenecks related to responding to outbreaks caused by highly infectious pathogens. X-ray irradiation is a safe, chemically-free method to produce non-infectious, structurally intact, whole virus particles, offering a timely solution during the COVID-19 pandemic. This methods ability to maintain the structural integrity of viruses underscores its potential in real-time support of pandemic response efforts. Initially, SARS-CoV-2 sensitivity to X-ray inactivation was investigated by observing the drop in viral infectivity between incremental doses of X-ray irradiation. The resulting survival curves enabled the determination of a D-value of 1.02 kGy. It is important to note that D-values can vary depending on the apparatus set-up and sample medium preparation. [ 15 ] Despite these variables, the close correspondence of X-ray D-values with those of gamma irradiation studies highlights a similar mechanism of action, where both rely on high-energy photons for viral inactivation. [ 8 , 13 , 30 – 32 ] For example, Jain et al. reported that duplicate inactivation runs of an initial titred stock of 10 6.5 TCID50/ml performed under non-frozen conditions with a GC-5000 gamma chamber resulted in a D-value of 1.09 kGy. [ 30 ] Significant methodological differences, however, do exist between different titration methods, such as plaque and TCID50 assays, with the former generally producing higher calculated titres and showing greater sensitivity. [ 33 ] Throughout our experiments, X-ray irradiation effectively inactivated multiple SARS-CoV-2 variants, as confirmed by cytopathic effect measurements and nucleic acid trends observed during three weeks of serial passage. Further analysis using Illumina sequencing demonstrated that X-ray irradiated variants maintained over 99% sequence coverage, comparable to non-irradiated controls and no significant genomic variances were noted. This agrees with previous X-ray inactivation data, where no correlation was found between X-ray dose and genome variance for Zika (ZIKV) and Rift valley fever viruses (RVFV). Additionally, ZIKV and RVFV retained detectability and function post-irradiation demonstrating antigenic stability. [ 8 ] Our current results provide further evidence of antigenic stability, with whole SARS-CoV-2 virus particles observed post irradiation by TEM. Furthermore, X-ray irradiated Omicron BA.2 variants showed similar sensitivity to live variants in LFD testing, down to a viral titre of 1.00E + 03 FFU/ml. Differences in protein detection between tested samples could be attributed to inconsistencies in protein expression or differences in the ELISA kit affinity for the S1 region of different VOC. [ 34 ] Notably, ELISA results showed only a marginal reduction in absorbance for irradiated samples compared to live ones, suggesting minimal impact on the proteins' detectability. An interesting and important observation was that freezing samples before irradiation could better preserve structural integrity and reduce damage from indirect radiation effects, such as those caused by reactive oxygen species and free radicals primarily formed from the radiolysis of water and oxygen molecules. [ 35 – 39 ] This type of ‘indirect’ damage, although short lived (~ 10 − 9 s), are responsible for the majority of the damage that occurs in protein samples during irradiation. [ 40 ] For example, Influenza stocks irradiated to 50 kGy at room temperature (RT) showed a greater reduction in haemagglutination titres compared to stocks irradiated on dry ice to the same dose, supported by visualisation of clear virus particles only being successful at a higher magnification for Influenza viruses inactivated in thawed conditions. [ 36 ] These results suggest that similar to gamma irradiation, X-ray preparations destined for downstream immunological assays or vaccine development, freezing should be considered as a preferred method for irradiation to reduce unwanted, indirect damage to protein structure. [ 17 , 36 ] Another advantage is that irradiating frozen samples reduces the risk of sample leakage which enhances overall biosafety, making it an appealing option for irradiation protocols of hazardous pathogens. [ 15 ] Overall, these results demonstrate how X-ray irradiation can successfully inactivate SARS-CoV-2 preparations and produce useful whole virus inactivated particles, applicable for an array of different assays to be performed in low containment facilities. Throughout the pandemic, X-ray irradiated SARS-CoV-2 variants were distributed to research and diagnostic facilities across the UK and internationally via the European Virus Archive – GLOBAL programme, playing a pivotal role in the validation of LFDs against emerging variants of concern and enhancing the global response capability. This broad application and effectiveness highlights the signification potential of X-ray irradiation as a versatile inactivation technique for pandemic preparedness and response across a spectrum of serological and molecular diagnostic assays. In conclusion, the utility of X-ray irradiation as demonstrated by this study reveals a pivotal advancement in our approach to pandemic preparedness and response. Unlike conventional methods, X-ray irradiation effectively preserves the structural and antigenic integrity of viruses, which is essential for the reliable performance of diagnostic assays. The rapid and safe inactivation process, which does not require high-containment facilities, represents a transformative step forward. This method not only enhances the safety and efficiency of handling highly infectious pathogens, but also significantly expands the capacity for high-throughput testing, vaccine development and potentially high-resolution structural analysis of viral pathogens. Importantly, the scalability of X-ray irradiation technology ensures that it can be swiftly deployed worldwide, offering a robust tool for the global health community in combating future infectious disease outbreaks. This study underscores the potential of X-ray irradiation to deliver a versatile, cost-effective, and secure method, making it an indispensable asset in the arsenal against pandemics. Material and Methods Virus stocks and cell lines: Specific growth conditions and SARS-CoV-2 stock information for all variants can be found in Supplementary Fig. 2. In general, SARS-CoV-2 variants were grown up in Vero/hSLAM (ECACC, Cat.no: 04091501) with MEM (Gibco™, Cat.no: 15188319) containing 2–4% Heat-inactivated FCS, 25 mM HEPES (Cat.no: 15630080, Gibco™), 2 mM L-glutamine (Sigma-Aldrich, Cat.no: G7513), and 0.4mg/ml Geneticin (Roche Diagnostics GmbH, Cat.no: 4727878001). Viruses were grown at 37°C with 0% CO 2 for 3–4 days, depending on development of visual cytopathic effects and frozen down in 1ml aliquots in a -80°C freezer. Non-Omicron variants’ titres were then determined by plaque assay, through adding 100 µl of 10-fold serial diluted virus onto Vero E6 cells (ECACC, Cat.no: 85020206) seeded to 75–90% confluency within a 24-well plate in triplicate. The virus infected wells were incubated for 1 hour at 37°C, 0% CO 2 before adding 1ml of pre-warmed overlay containing 3% CMC per well and incubating for 4 days. Cells were then fixed with 4% formaldehyde diluted in PBS and stained with 0.2% crystal violet solution in 50% methanol. Omicron BA.2 titres were compared for pre- and post-irradiation titres by TCID 50 using 96-well plates seeded with Vero/hSLAM following established methodologies. Titres were then calculated using the Spearman–Karber method. [ 41 ] X-ray irradiation parameters X-ray irradiations were undertaken on the MULTIRAD225 X-ray Irradiators (Precision X-ray Irradiation, USA) installed with an MXR-225/26 X-ray source (225 kV 4 kW). The voltage potential of an X-ray tube governs the energy distribution of the resulting radiation field, whilst its dose rate depends linearly on the current, all other factors being equal. Run settings were set to 220kV and 17.5 mA, based on a combination of previous Monte Carlo Modelling of the chamber’s dosimetry and confirmatory real-time dose testing data. [ 8 ] All X-ray irradiations were undertaken with a 0.5 mm thick Aluminium filter covering the beam’s entrance port into the chamber, as this was seen to produce reduced dose variability compared to the 0.2 mm Aluminium filter used in previous publications. [ 27 ] Specifically, by preferentially supressing the lower energy components of the photon distribution, using a thicker filter leads to an X-ray field that is both higher in mean energy and sharper, which in turn allows for more precise dosimetry and more uniform dose deposition within samples. During irradiation, viral stocks were maintained in liquid phase by placing samples upon a 5.3 cm non-conductive plastic platform placed centrally on a dry ice chamber (DIC), designed to contain dry ice within its interior circular wells during radiation runs. [ 27 ] Ice within the DIC was replenished every 2.5-3 hours. D-value Calculations One millilitre aliquots of SARS-CoV-2 Eng.2 02/2020 P3 were subjected to incremental levels of X-ray irradiation up to 8 kGy. Each irradiation dose interval was performed as an independent run and samples were packaged within 2 layers of 500-gauge polyethylene plastic. Samples were irradiated in a non-frozen state, at an average sample temperature of 9°C. In addition to the samples being subjected to the parameters stated above, the sample was positioned in a defined location 14.5 cm away from the irradiation source. Sample dose exposure rates were predetermined prior to experimental irradiation runs by undergoing extensive dose mapping at ambient temperatures, using an ionisation chamber (PTW Dosimetry, Cat.no: TW31010) calibrated in terms of absorbed dose to water (D w ). Dose rates were corrected for pressure and temperature discrepancies compared to calibration conditions using the air density correction equation. [ 42 ] Dose rates were also multiplied by a factor of 1.1 to calculate the amount of X-ray irradiation deposited within a sample. [ 43 ] This allowed an average dose rate to be calculated for the predefined exposure area and irradiation times to be calculated for subsequent irradiation runs. Survival curves were then generated for each separate repeat through plotting the Log10 Viral Titre (Log10(PFU/ml)) versus X-ray irradiation dose (kGy). The D-value derived from each repeat could then be calculated through determining the inverse slope of the calculated linear regression lines. [ 15 , 44 ] The final reported D-value was calculated from the average of all separately calculated D-values derived from all repeats. Batch Inactivation The minimum X-ray inactivation doses were calculated by multiplying the Log10 pre-irradiated titre of SARS-CoV-2 virus stocks by the D-value (Fig. 2 ). Omicron variants were titred using a focus forming assay and then this was multiplied by a factor of 10 to estimate plaque forming assay counts, in line with previous publications which have found a 1 Log difference in observed titres between conventional plaque assays and focus forming assays. [ 29 ] Each viral stock’s irradiation dose in practise was however calculated with inclusion of an additional minimum 25% dose contingency in addition to this, to mitigate against viral titration assays variability and optimise chances of full inactivation. For batch irradiations up to 10ml, 1ml of viral supernatant was aliquoted into 2ml Starstedt screw cap micro tubes (Starstedt, Cat.no: 72.694.406.) and then 10 tubes were placed within 2 layers of heat-sealed 500-gauge polyethylene plastic. Larger batch irradiations up to 60ml could be conducted by dispensing virus into a CELLSTAR AutoFlask (CELLSTAR, Cat.no: 779160). The flask was heat-sealed within 2 layers of 500-gauge polyethylene plastic and then placed within a Clip down HPL815 clip-lock box filled with 5 layers of PinkPig absorbent material. Samples were irradiated using the settings stated above with a minimum source to sample distance (SSD) of 20.6 cm. Dose rate measurements were taken at each of the 4 sample corners and the time taken (minutes) to reach the desired dose was calculated based on the lowest value. The cumulative dose and dose rate was monitored throughout the experiment on a UNIDOS TANGO (PTW Dosimetry, Cat.no: TW10052) connected an ionisation chamber (PTW Dosimetry, Cat.no: TW31010) placed in situ. Sterility of X-ray irradiated SARS-CoV-2 variants. All X-ray treated and live SARS-CoV-2 variants were subjected to 3 rounds of 1-week in vitro passage within consecutively larger flasks (T12.5, T25 and T75) seeded with a susceptible cell line. Flasks destined to be inoculated with non-Omicron variants were seeded a day before inoculation with Vero E6 cells (ECACC, Cat.no: 04091501) at a seeding density of 4.0 x 10 4 cells/cm 2 and then incubated at 37°C with 5% CO 2 . Alternatively, Omicron variant flasks were seeded a day before inoculation with Vero/hSLAMs (ECACC. Cat.no: 04091501), following ECACCs recommendations for seeding density, media and culturing conditions. At the beginning of sterility, flasks were either inoculated with irradiated virus and signs of visual infection were monitored visually by grading the level of cytopathic effect (CPE). Scoring was classified as followed: 0: No CPE (0% CPE), 1: Early CPE (10% CPE), 2: CPE (50% CPE) and 3: Full CPE (100% CPE). Negative and positive matched live control flasks were also run alongside irradiated flasks throughout the experiment. Samples were taken every 48 hours for nucleic extraction (QIAmp viral RNA extraction kit) during the serial passage. This was achieved by 140µl being taken from each infected flask and then inactivated with 560 µl of AVL buffer, followed by 10 minutes incubation before 560µl 100% ethanol was also added to the inactivated sample. RNA isolation and reverse-transcriptase qPCR. All AVL samples taken during sterility testing were extracted using the BioSprint™96 One-For-All vet kit (Indical, Cat.no.: SP947057) and Kingfisher Flex platform (ThermoFisher Scientific, Cat.no: 5400630) into a final elution volume of 80 µl, following the manufacturer’s instructions. Extracted samples were then subjected to a SARS-CoV-2 sub-genomic E gene RT-PCR, using primer and probe sequences obtained from Wölfel et al, 2020. [ 28 ] In preparation for the qPCR, primer-probe mixes were mass prepared using 200 µl sgLead Forward primer (CGATCTCTTGTAGATCTGTTCTC), 400µl E-Sarbeco Reverse primer (ATATTGCAGCAGTACGCACACA) and 100µl E-Sarbeco P probe (FAM-ACACTAGCCATCCTTACTGCGCTTCG-BFQ) all at a 100 µM concentration and were then added to 39.3 ml of RNAse-free water. Samples were then tested using a final reaction volume of 20 µl, including 10 µl primer/probe mix, 5µl 4x TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems™, Cat.no: 4444432) and 5 µl extracted RNA template. Samples were tested utilising a QuantStudio 7 Flex Real-Time PCR System platform, through using the cycling parameters: Hold Stage: 50°C 10 minutes, 95°C 2 minutes and PCR Stage (45 cycles): 95°C 10 seconds and 60°C 30 seconds. Quantification of viral target copies within samples were calculated using a standard curve derived 10-fold dilutions of an in vitro transcribed RNA standard of the full-length SARS-CoV-2 E ORF (accession number NC_045512.2) led by the UTR leader sequence and putative E gene transcription regulatory sequence. A Wild-type Victoria-01 extracted control was run on each individual plate as a positive control. Transmission Electron Microscopy. X-ray irradiated SARS-CoV-2 variants were compared to Live SARS-CoV-2 variants through Transmission Electron Microscopy. Samples were fixed through adding 90 µl of viral supernatant to 12 µl of 37–40% EM grade formaldehyde and left overnight at room temperature to allow full inactivation. Then, 3 µl of fixed samples were loaded onto an Old 400 pattern, copper TEM grid (Agar Scientific Ltd. Cat.no AGG204) coated with formvar (Agar Scientific Ltd. Cat.no. AGR1201) using a 0.5% formvar solution in chloroform (Sigma-Aldrich, Cat.no. 372978). The sample was left to settle for 30 seconds to 10 minutes before the grids were then blotted to dry on moist filter paper, washed in distilled water and then stained with 2–3 µl of 2% Methylamine tungstate. (Bio-Rad, Cat.no. A2315.) The stain was then quickly removed after 10 seconds with moist filter paper and left to air dry. Images were then taken on a Philips / FEI CM100 Transmission Electron Microscope operated at 80kV. Lateral Flow Devices X-ray irradiated variants were evaluated for the detection of SARS-CoV-2 Nucleocapsid proteins using the Orient Gene Rapid COVID-19 (Antigen) Self-Tests (Orient Gene, Cat.no: GCCOV-502a-H70GE). X-ray irradiated and non-X-ray irradiated SARS-CoV-2 variants were both 10-fold serially diluted in 2 X MEM (Gibco™, Cat.no: 11935046) to a final dilution of 10 − 5 . Then, 100µl of each diluted samples were mixed with 300 µl of the kit extraction tube fluid, after which 4 drops were added to each LFD cassette in triplicate. After 15 minutes, cassette results were scored depending on the band intensity of the test line. Strong positive bands were scored a number 3, weak bands were scored a number 2 and very weak bands were scored 1. Tests with no test band were considered negative and scored 0. Enzyme-linked immunosorbent assays. The abundance of Human SARS-CoV-2 Spike Protein on X-ray irradiated SARS-CoV-2 variants was evaluated using the Human SARS-CoV-2 RBD ELISA Kit (Invitrogen, Cat.no: # EH492RB) following the manufacturer’s instructions. Initially, five X-ray irradiated SARS-CoV-2 variants were tested to determine if Human SARS-CoV-2 Spike Proteins were still detectable through ELISA after X-ray irradiation. All variants were diluted to an initial titre of 2 x 10 5 PFU/ml; except for the X-ray irradiated SARS-CoV-2 Omicron variants which were diluted to a starting titre of 1.25 x 10 4 PFU/ml, due to a low starting titre. All variants were diluted in MEM α, nucleosides, GlutaMAX™ Supplement (Gibco™, Cat.no: 32571036) with 4% heat-inactivated Fetal Bovine Serum, qualified, Australia (Gibco™, Cat.no: 10099141), which had been X-ray irradiated to a dose of 8 kGy. This X-ray irradiated media was also used as a negative control, which along with all the X-ray irradiated variants, were subjected to a 4-fold dilution series before being added to the plate in duplicate. On each plate a kit standard and a 10-fold dilution series of the positive control in the form of a SARS-CoV-2 Spike Protein (RBD) (aa319-541), His Tag Recombinant Protein (Invitrogen, Cat.no: RP-87678) reconstructed to starting concentration of 5µg/ml were run in duplicate. Plates were read at an absorbance wavelength of 450nm and 620nm on a plate reader. Before analysis, the absorbance values at 620nm were subtracted from absorbance values at 450nm for each well. All data analysis was performed using GraphPad Prism 9.2.0 (GraphPad Software, USA). Sample concentrations were interpolated by fitting a sigmoidal, 4PL, X is log(concentration) model to the absorbance values of the standard provided. Read-off values were back transformed and multiplied by the dilution factor of the sample to get the final protein concentration values. Mean protein concentrations were obtained through averaging concentration values within the range of 0.5-3, which was determined to be placed on the exponential part of the curve. SARS-CoV-2 Omicron BA.2 Live and X-ray irradiated variants were tested as stated above within Containment Level 3 facilities. Matched negative controls of non-irradiated and irradiated media were also tested on each plate and used as the dilution medium for matched samples. Negative control absorbance values were then subtracted from virus absorbance values. Absorbance curves were compared by statistically comparing interpolate values, derived from an absorbance value of 1.0, by an unpaired two-way T-test calculated from GraphPad Prism 9. Next generation sequencing. Total nucleic acid was extracted from paired X-ray irradiated and non-irradiated SARS-CoV-2 variants following QIAamp Viral RNA Mini Kit manufacturer’s instructions. (Qiagen, Cat.no: 52904). Forty-Five microlitres of total nucleic acid per sample was then mixed with Turbo DNAse I (Invitrogen, Cat.no: AM2238) according to the manufacturer’s instructions, before purification using an RNA Clean and Concentrator—5 kit (Zymo Research, Cat.no: R101). The purified RNA was used to generate amplified cDNA libraries using sequence-independent single-primer amplification (SISPA) as previously described. [ 45 , 46 ] Amplified cDNA was subsequently washed and purified using AMPure XP beads (Beckman Coulter, Cat.no: A63880) at a 1:2 ratio and quantified via a Qubit high-sensitivity double-stranded DNA (dsDNA) kit (ThermoScientific, Cat.no: 15860210), both following the manufacturer’s instructions. Illumina sequencing libraries utilising 1.5 ng of cDNA were then prepared using the Nextera XT V2 kit (Illumina, Cat.no: FC-131-1024), according to manufacturer’s instructions. Barcoded libraries were then sequenced on the 2 × 150-bp paired-end Illumina MiSeq ran by the Genomics Services Development Unit (Colindale) at The UK Health Security Agency (UKHSA). Genome assembly and variant calling. Paired reads were mapped against the Wuhan Hu-1 complete genome reference sequence (NCBI reference sequence: NC_045512.2) with BWA MEM utilising default settings. Consensus and variants were then generated utilising Quasi_BAM version 2.8 with default settings. [ 47 ] Phylogenetic analysis and clade designation was achieved through running the generated consensus sequences through NextClade. [ 48 ] Pairwise distances between non-irradiated and irradiated strains were calculated on the platform MEGA7, with sequences previously aligned by Muscle. [ 49 ] When no in-house, non-irradiated derived VOC sequences were available, alternative sequences were utilised from the available open-source databases. For example, the non-irradiated sequence utilised for the Beta variant was derived from NCBI reference: OX746033.1 and the non-irradiated sequences for the gamma variant was soured from GISAID Reference: EPI_ISL_833366. Declarations Additional Information: The views expressed in this article are those of the author(s) and are not necessarily those of UK Health Security Agency or the Department of Health and Social Care. Competing interests: The authors declare no competing interests. Author Contribution M.CF, EA.C, B.A, E.D and L.B conducted X-ray irradiations for D-value quantification and inactivation of SARS-CoV-2 variants throughout the pandemic. EA.C, P.F and S.D conducted dose mapping experimentation on the MultiRad 225. B.A and EA.C conducted data analysis for D-value calculations. M.CF, J.C, L.E, E.D, L.B and J.B were involved in sterility testing of X-ray irradiated variants throughout the pandemic. H.T conducted TEM image processing M.S, P.F and EA.C conducted ELISAs at Containment Level 2 on a range of variants, while V.F conducted LFDs at Containment Level 2. All ELISAs and LFDs conducted at Containment Level 3 were conducted by EA.C. Genome assembly and variant calling was conducted by J.D, and subsequent pairwise distance analysis and phylogenetics was conducted by EA.C. EA.C and R.H wrote the scientific manuscript and other authors were involved in the review process. Acknowledgement The views expressed in this article are those of the author(s) and are not necessarily those of UK Health Security Agency or the Department of Health and Social Care. Data Availability The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. References Patz, J. & Reissen, W. K. Immunology, climate change and vector-borne diseases. Trends Immunol. 22 , 171–172 (2001). Mackenzie, J. S., Williams, D. & Zoonoses Microbiol. Australia 41 , 3–5 https://doi.org:https://doi.org/10.1071/MA20002 (2020). Graham, B. S. & Sullivan, N. J. Emerging viral diseases from a vaccinology perspective: preparing for the next pandemic. Nat. Immunol. 19 , 20–28. https://doi.org:10.1038/s41590-017-0007-9 (2018). Leroy, E. M. et al. Multiple Ebola virus transmission events and rapid decline of central African wildlife. Science . 303 , 387–390. https://doi.org:10.1126/science.1092528 (2004). Wang, H. et al. Estimating excess mortality due to the COVID-19 pandemic: a systematic analysis of COVID-19-related mortality, 2020-21. Lancet . 399 , 1513–1536 (2022). Office of National Statistics. GDP and events in history: how the COVID-19 pandemic shocked the UK economy , (2021). https://www.ons.gov.uk/economy/grossdomesticproductgdp/articles/gdpandeventsinhistoryhowthecovid19p andemicshockedtheukeconomy/2022-05-24 Marani, M., Katul, G. G., Pan, W. K. & Parolari, A. J. Intensity and frequency of extreme novel epidemics. Proc. Natl. Acad. Sci. U S A . 118 , e2105482118. https://doi.org:10.1073/pnas.2105482118 (2021). Afrough, B. et al. X-ray inactivation of RNA viruses without loss of biological characteristics. Sci. Rep. 10 , 21431. https://doi.org:10.1038/s41598-020-77972-5 (2020). Alsharifi, M. & Müllbacher, A. The gamma-irradiated influenza vaccine and the prospect of producing safe vaccines in general. Immunol. Cell. Biol. 88 , 103–104. https://doi.org:10.1038/icb.2009.81 (2010). Mollaei Alamuti, M. et al. Immune Response of Gamma-Irradiated Inactivated Bivalent Polio Vaccine Prepared plus Trehalose as a Protein Stabilizer in a Mouse Model. Intervirology . 64 , 140–146. https://doi.org:10.1159/000515392 (2021). Salehi, B. et al. Analysis of antigen conservation and inactivation of gamma-irradiated avian influenza virus subtype H9N2. Acta Microbiol. Immunol. Hung. 65 , 163–171. https://doi.org:10.1556/030.65.2018.025 (2018). Elliott, L. H., McCormick, J. B. & Johnson, K. M. Inactivation of Lassa, Marburg, and Ebola viruses by gamma irradiation. J. Clin. Microbiol. 16 , 704–708. https://doi.org:doi:10.1128/jcm.16.4.704-708.1982 (1982). Feldmann, F., Shupert, W. L., Haddock, E., Twardoski, B. & Feldmann, H. Gamma Irradiation as an Effective Method for Inactivation of Emerging Viral Pathogens. Am. J. Trop. Med. Hyg. 100 , 1275–1277. https://doi.org:10.4269/ajtmh.18-0937 (2019). Chen, F. et al. Characterization of humoral and cellular immune features of gamma-irradiated influenza vaccine. Hum. Vaccin Immunother . 17 , 485–496 (2021). Hume, A. J. et al. Inactivation of RNA Viruses by Gamma Irradiation: A Study on Mitigating Factors. Viruses . 8 https://doi.org:10.3390/v8070204 (2016). Ward, R. L. Mechanisms of poliovirus inactivation by the direct and indirect effects of ionizing radiation. Radiat. Res. 83 , 330–344 (1980). Furuya, Y. et al. Effect of inactivation method on the cross-protective immunity induced by whole 'killed' influenza A viruses and commercial vaccine preparations. J. Gen. Virol. 91 , 1450–1460. https://doi.org:10.1099/vir.0.018168-0 (2010). Müllbacher, A., Lobigs, M., Alsharifi, M. & Regner, M. Cytotoxic T-cell immunity as a target for influenza vaccines. Lancet. Infect. Dis . 6 , 255–256. https://doi.org:https://doi.org/10.1016/S1473-3099(06)70443-1 (2006). Furuya, Y. et al. Gamma-irradiated influenza virus uniquely induces IFN-I mediated lymphocyte activation independent of the TLR7/MyD88 pathway. PLoS One . 6 , e25765. https://doi.org:10.1371/journal.pone.0025765 (2011). Barnard, S., Daniels, A. L., Eakins, T., Tanner, J. & Bouffler, S. R and Alternatives to caesium irradiators for biological sciences and blood transfusion services. (Public Health England Report CRCE-RED-001-2020, (2020). Desouky, O., Ding, N. & Zhou, G. Targeted and non-targeted effects of ionizing radiation. J. Radiation Res. Appl. Sci. 8 , 247–254. https://doi.org/10.1016/j.jrras.2015.03.003 (2015). https://doi.org:. Sadraeian, M., Zhang, L., Aavani, F., Biazar, E. & Jin, D. Viral inactivation by light. eLight . 2 , 18. https://doi.org:10.1186/s43593-022-00029-9 (2022). Furuya, Y. Return of inactivated whole-virus vaccine for superior efficacy. Immunol. Cell. Biol. 90 , 571–578. https://doi.org:10.1038/icb.2011.70 (2012). Fertey, J. et al. Pathogens Inactivated by Low-Energy-Electron Irradiation Maintain Antigenic Properties and Induce Protective Immune Responses. Viruses . 8 , 319 (2016). McEvoy, B., Michel, H., Howell, D. & Roxby, P. X-ray: An Effective Photon. Biomedical Instrum. Technol. 54 , 23–30. https://doi.org:10.2345/0899-8205-54.s3.23 (2020). Turner, G. S., Squires, E. J. & Murray, H. G. S. Inactivated smallpox vaccine. A comparison of inactivation methods. J. Hygiene . 68 , 197–210. https://doi.org:10.1017/S0022172400028679 (1970). Eakins, J. S., Afrough, B. & Hewson, R. Monte Carlo modelling of an x-ray chamber for providing inactivation exposures to viruses. J. Radiol. Prot. 41 , 962–981. https://doi.org:10.1088/1361-6498/ac2f85 (2021). Wölfel, R. et al. Virological assessment of hospitalized patients with COVID-2019. Nature . 581 , 465–469 (2020). Jureka, A. S., Silvas, J. A. & Basler, C. F. Propagation, Inactivation, and Safety Testing of SARS-CoV-2. Viruses 12 (2020). https://doi.org:10.3390/v12060622 Jain, R. et al. Inactivation of SARS-CoV-2 by gamma irradiation. Indian J. Med. Res. 153 , 196–198. https://doi.org:10.4103/ijmr.IJMR_2789_20 (2021). Leung, A. et al. In Vitro Inactivation of SARS-CoV-2 Using Gamma Radiation. Appl. Biosaf. 25 , 157–160. https://doi.org:10.1177/1535676020934242 (2020). McEvoy, B. et al. Studies on the comparative effectiveness of X-rays, gamma rays and electron beams to inactivate microorganisms at different dose rates in industrial sterilization of medical devices. Radiat. Phys. Chem. 208 , 110915. https://doi.org:https://doi.org/10.1016/j.radphyschem.2023.110915 (2023). Zapata-Cardona, M. I. et al. Comparison among plaque assay, tissue culture infectious dose (TCID(50)) and real-time RT-PCR for SARS-CoV-2 variants quantification. Iran. J. Microbiol. 14 , 291–299. https://doi.org:10.18502/ijm.v14i3.9758 (2022). Mittal, A., Khattri, A. & Verma, V. Structural and antigenic variations in the spike protein of emerging SARS-CoV-2 variants. PLoS Pathog . 18 , e1010260. https://doi.org:10.1371/journal.ppat.1010260 (2022). Furuya, Y. et al. Cytotoxic T cells are the predominant players providing cross-protective immunity induced by {gamma}-irradiated influenza A viruses. J. Virol. 84 , 4212–4221. https://doi.org:10.1128/jvi.02508-09 (2010). David, S. C. et al. The effect of gamma-irradiation conditions on the immunogenicity of whole-inactivated Influenza A virus vaccine. Vaccine . 35 , 1071–1079. https://doi.org/10.1016/j.vaccine.2016.12.044 (2017). https://doi.org:. Sullivan, R., Scarpino, P. V., Fassolitis, A. C., Larkin, E. P. & Peeler, J. T. Gamma radiation inactivation of coxsackievirus B-2. Appl. Microbiol. 26 , 14–17 (1973). Ormerod, M. G. Free-radical Formation in Irradiated Deoxyribonucleic Acid. Int. J. Radiation Biology Relat. Stud. Phys. Chem. Med. 9 , 291–300 (1965). Grieb, T. A. et al. Effective use of optimized, high-dose (50kGy) gamma irradiation for pathogen inactivation of human bone allografts. Biomaterials . 26 , 2033–2042. https://doi.org/10.1016/j.biomaterials.2004.06.028 (2005). https://doi.org:. Grieb, T. et al. Effective use of Gamma Irradiation for Pathogen Inactivation of Monoclonal Antibody Preparations. Biologicals . 30 , 207–216. https://doi.org/10.1006/biol.2002.0330 (2002). https://doi.org:. Bullen, C. K., Davis, S. L. & Looney, M. M. Quantification of Infectious SARS-CoV-2 by the 50% Tissue Culture Infectious Dose Endpoint Dilution Assay in SARS-CoV-2: Methods and Protocols (eds Justin Jang Hann Chu, Bintou Ahmadou Ahidjo, & Chee Keng Mok) 131–146Springer US, (2022). Taylor, L. S. & Singer, G. Air Density Corrections for Temperature and Pressure Applied to X-Ray Ionization Chambers. Radiology . 23 , 404–409 (1934). Csete, I. et al. Comparison of air kerma and absorbed dose to water measurements of Co-60 radiation beams for radiotherapy Report on EUROMET project 813, identifiers in the BIPM key comparison database (KCDB) are EUROMET.RI(I)-K1 and EUROMET.RI(I)-K4. Metrologia 47 (2010). Mazzola, P. G., Penna, T. C. & Martins, A. M. Determination of decimal reduction time (D value) of chemical agents used in hospitals for disinfection purposes. BMC Infect. Dis. 3 , 24. https://doi.org:10.1186/1471-2334-3-24 (2003). Greninger, A. L. et al. Rapid metagenomic identification of viral pathogens in clinical samples by real-time nanopore sequencing analysis. Genome Med. 7 , 99. https://doi.org:10.1186/s13073-015-0220-9 (2015). Lewandowski, K. et al. Metagenomic Nanopore Sequencing of Influenza Virus Direct from Clinical Respiratory Samples. J. Clin. Microbiol. 58 . Penedos, A. R., Myers, R., Hadef, B., Aladin, F. & Brown, K. E. Assessment of the Utility of Whole Genome Sequencing of Measles Virus in the Characterisation of Outbreaks. PLOS ONE . 10 , e0143081. https://doi.org:10.1371/journal.pone.0143081 (2015). Aksamentov, I., Roemer, C., Hodcroft, E. A. & Neher, R. A. Nextclade: clade assignment, mutation calling and quality control for viral genomes. J. Open. Source Softw. 6 , 3773. https://doi.org/10.21105/joss.03773 (2021). Kumar, S., Stecher, G. & Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 33 , 1870–1874. https://doi.org:10.1093/molbev/msw054 (2016). Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigureforpapersubmission.pdf Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 04 Mar, 2025 Reviewers agreed at journal 03 Mar, 2025 Reviews received at journal 01 Mar, 2025 Reviewers agreed at journal 01 Mar, 2025 Reviews received at journal 06 Jan, 2025 Reviewers agreed at journal 30 Dec, 2024 Reviewers agreed at journal 28 Dec, 2024 Reviewers agreed at journal 27 Dec, 2024 Reviewers agreed at journal 27 Dec, 2024 Reviewers invited by journal 26 Dec, 2024 Editor assigned by journal 21 Nov, 2024 Editor invited by journal 05 Sep, 2024 Submission checks completed at journal 03 Sep, 2024 First submitted to journal 16 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4926136","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":360746851,"identity":"87f32ee8-41b5-42e9-9ac5-2094aa0929de","order_by":0,"name":"Elle Campbell","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Elle","middleName":"","lastName":"Campbell","suffix":""},{"id":360746852,"identity":"328f5c95-bcb1-4a9d-a036-e6f75a749e3c","order_by":1,"name":"Babak Afrough","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABI0lEQVRIiWNgGAWjYBACewYeBsYGBgl+EIeZoYLBwAAux4Ndi2EDWIuNZANYyxkitBgcAGtJg2hhbCPGlvazBz/OYDgsYd7eY/y6cN5hY3P+ww8Yv1QcZjA4cwC7X3jykiU3ALXInDljZj1z22EzyxlpBswyZ4Bazjbg8EuOgeQDhsN1EhI5Zsa82w7bGNxgMGCWbEtjMDiPwy/n3xj/fMDwXwKiZQ5Qy/njH/BruZFjBnYYUIvxY96Gw2YGB3IMGD+22eB22Ix3aZYzDIBaeI6VMfMcSzcGGlJwmOGMDY8kLu/z5x6+2VMB1MLevPkzT4214Ybzxzc+/FEhIcd3JgG7yyDOA5NsEjD+YR6csYIKmD/AWIw/iFE/CkbBKBgFIwUAAE9/YfV7EIPuAAAAAElFTkSuQmCC","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":true,"prefix":"","firstName":"Babak","middleName":"","lastName":"Afrough","suffix":""},{"id":360746853,"identity":"b7ee234b-1c0b-45a7-83cf-ce49edfc2435","order_by":2,"name":"Laura Bonney","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Laura","middleName":"","lastName":"Bonney","suffix":""},{"id":360746854,"identity":"78c80f20-2fbb-4c63-b4e8-e285b3f43336","order_by":3,"name":"Mollie Curran-French","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Mollie","middleName":"","lastName":"Curran-French","suffix":""},{"id":360746855,"identity":"8956c0cc-9c00-4644-b5ac-a8e8fe3295bc","order_by":4,"name":"John Chamberlain","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"John","middleName":"","lastName":"Chamberlain","suffix":""},{"id":360746856,"identity":"fa9cbc6c-9f52-48e5-b50b-648d9255475e","order_by":5,"name":"Jake Daddiego","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Jake","middleName":"","lastName":"Daddiego","suffix":""},{"id":360746857,"identity":"feb0bc12-7d4a-4ec6-a71c-37f9e6f0fb8c","order_by":6,"name":"Verity Fotheringham","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Verity","middleName":"","lastName":"Fotheringham","suffix":""},{"id":360746858,"identity":"0dbd4780-adf2-4770-9c76-514d6a8313d5","order_by":7,"name":"Megan Stanley","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Megan","middleName":"","lastName":"Stanley","suffix":""},{"id":360746859,"identity":"1320f66c-ca5a-4f4d-a9a3-3bd4033f698a","order_by":8,"name":"Ellie Drinkwater","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Ellie","middleName":"","lastName":"Drinkwater","suffix":""},{"id":360746860,"identity":"3f282f86-642f-44ed-9175-92602033ba18","order_by":9,"name":"Pedro Ferreira","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Pedro","middleName":"","lastName":"Ferreira","suffix":""},{"id":360746861,"identity":"9bed77d1-f98e-4580-a366-fd399058323c","order_by":10,"name":"Howard Tolley","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Howard","middleName":"","lastName":"Tolley","suffix":""},{"id":360746862,"identity":"1ab9289f-e5ac-4266-8352-bccb3efdbc7b","order_by":11,"name":"Sahil Dugg","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Sahil","middleName":"","lastName":"Dugg","suffix":""},{"id":360746863,"identity":"a1f8b8d0-4e48-4a96-a56e-8d4aac4dea6c","order_by":12,"name":"Jane Burton","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Jane","middleName":"","lastName":"Burton","suffix":""},{"id":360746864,"identity":"7274ee54-df0e-4466-99b8-2abc996cfdef","order_by":13,"name":"Linda Easterbrook","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Linda","middleName":"","lastName":"Easterbrook","suffix":""},{"id":360746865,"identity":"7b80d4eb-645d-4d6b-a480-8eaca269250b","order_by":14,"name":"Roger Hewson","email":"","orcid":"","institution":"UK Health Security Agency","correspondingAuthor":false,"prefix":"","firstName":"Roger","middleName":"","lastName":"Hewson","suffix":""}],"badges":[],"createdAt":"2024-08-16 16:03:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4926136/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4926136/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":65897291,"identity":"008f9a88-6bf9-4288-856b-09ce268947c2","added_by":"auto","created_at":"2024-10-04 06:51:10","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":982623,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSuccessful Inactivation of SARS-CoV-2 VOCs via X-Ray Irradiation. \u003c/strong\u003e(A) After irradiation, titration results were compared to confirm complete inactivation of the virus. The results for the Gamma variant are shown above. (B1) Inactivation was also confirmed through serial passage in a susceptible cell line. Nucleic acid samples were extracted regularly, and viral RNA was subjected to the SARS-CoV-2 sub-genomic E gene RT-PCR.\u003csup\u003e[28]\u003c/sup\u003e A significant decrease in viral target copies in the Gamma variants’ X-ray irradiated samples, compared to an increase in the live control, confirmed inactivation. (B2) Cytopathic effects (CPE) were monitored and scored as follows: 0 (no CPE), 1 (early CPE, 10% CPE), 2 (moderate CPE, 50% CPE), and 3 (full CPE, 100% CPE). These observations helped further validate the absence of viral activity in irradiated samples compared to active infection in non-irradiated controls. (C) The MultiRad225 system was used to irradiate SARS-CoV-2 variant Gamma, among others, under predefined settings.\u003csup\u003e8\u003c/sup\u003e Pre-irradiation titres were assessed using plaque assay for non-Omicron variants, while focus forming assays used for all Omicron variants with Omicron titres converted to PFU/ML for accurate irradiation dose calculations, based on prior comparative studies.\u003csup\u003e29\u003c/sup\u003e The variants underwent three 1-week serial passages in susceptible cells, with no signs of plaque formation in any X-ray irradiated variants, confirming full viral inactivation. This comprehensive evaluation demonstrates the effectiveness of X-ray irradiation in rendering SARS-CoV-2 non-infectious.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4926136/v1/9ea26ff634d793347850f2a3.jpg"},{"id":65896826,"identity":"f259a5e6-84dd-4d9f-be31-de14111e29ef","added_by":"auto","created_at":"2024-10-04 06:43:10","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":282041,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eComparative analysis of sequence depth and quality in X-ray Irradiated and non-irradiated SARS-CoV-2 variants. \u003c/strong\u003e(A) Both live and X-ray irradiated SARS-CoV-2 Omicron BA.2 variants showed comparable depth coverage across their entire genomes, demonstrating that X-ray irradiation preserves genomic integrity. (B) All tested SARS-CoV-2 variants were phylogenetically analysed using NextClade which confirmed their classification into the correct clades. Illumina sequencing showed that both live and X-ray Irradiated genomes exhibited comparable sequence coverage with a pairwise distance of 0% indicating no discernible genetic drift between the variants in all cases.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4926136/v1/3f8fabb97dd1bf4aa0408ada.jpg"},{"id":65896828,"identity":"8132bff9-9f08-44fb-8d37-b520fed1215e","added_by":"auto","created_at":"2024-10-04 06:43:10","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1427739,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eX-ray Irradiated SARS-CoV-2 Delta and Omicron BA2 variants show evidence of whole virus particles through TEM. \u003c/strong\u003eFixed\u003cstrong\u003e \u003c/strong\u003elive and X-ray irradiated SARS-CoV-2 variants were imaged using a Philips / FEI CM100 Transmission Electron Microscope at 80kV at a magnification of 64000x.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4926136/v1/8a2821dcf7c8d9e4328764f6.jpg"},{"id":65896830,"identity":"343b6781-ddb6-4f77-928f-babfb374cb20","added_by":"auto","created_at":"2024-10-04 06:43:10","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":798038,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eComparable detectability of X-ray inactivated SARS-CoV-2 variants in Lateral Flow Device (LFD). \u003c/strong\u003e(A) LFD results were categorised based on the intensity of the test line and scored as follows: 3: Strong, 2: Weak, 1: Very Weak or 0: Negative. This scoring system facilitated a quantitative evaluation of the test sensitivity across different samples. (B) SARS-CoV-2 nucleoprotein from several earlier variants of concern were detectable using the Orient Gene Rapid COVID-19 (Antigen) Self-Test. (C) Live and X-ray irradiated SARS-CoV-2 Omicron BA.2 isolates were 10-fold serially diluted and tested for the presence of SARS-CoV-2 nucleoprotein using the Orient Gene Rapid COVID-19 (Antigen) Self-Tests. The detection scores were averaged based on three separate experimental repeats.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4926136/v1/be572c0efe54e8af541fd677.jpg"},{"id":65896831,"identity":"ab0b2679-6b88-48de-818f-d8b8f691a3e9","added_by":"auto","created_at":"2024-10-04 06:43:10","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":273979,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eELISA Detection of Spike Proteins in Multiple SARS-CoV-2 variants. \u003c/strong\u003e(A) The Receptor Binding domain of the spike protein of all tested VOCs were consistently detectable by ELISA, across three separate experimental repeats confirming the robustness of the assay. (B) Live and X-ray irradiated SARS-CoV-2 Omicron BA.2 variants were 4-fold serially diluted and analysed using the Human SARS-CoV-2 RBD ELISA Kit. This comparison quantified the abundance of detectable SARS-CoV-2 spike protein illustrating the effectiveness of the assay in measuring protein levels post irradiation.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4926136/v1/ec1dad33212de3f8815ccbf3.jpg"},{"id":65896825,"identity":"b338eed9-ce88-40de-a422-11575f630fdb","added_by":"auto","created_at":"2024-10-04 06:43:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":512220,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4926136/v1/6e1406e3-2cf3-4c6a-8a7e-1179c0d8d1a6.pdf"},{"id":65897290,"identity":"742fce6b-9089-4a91-829d-764d7f2701cd","added_by":"auto","created_at":"2024-10-04 06:51:10","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":625919,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigureforpapersubmission.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4926136/v1/20f677d30420770b9d368f8c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"X-ray Inactivation of SARS-CoV-2: A Safe, Cost-effective Approach for Pandemic Testing Workflows.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn the 21st century, the emergence of infectious diseases has accelerated, driven by factors such as globalisation, urbanisation, deforestation, and climate change.\u003csup\u003e[\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e The COVID-19 pandemic has underscored the urgent need for flexible and robust diagnostic tools capable of quickly adapting to new pathogens. Between January 2020 and December 2021, an estimated 18.2\u0026nbsp;million people died due to SARS-CoV-2 related illnesses globally.\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e Leading to a significant global economic downturn, in the UK, gross domestic product dropped to a record low of 19.4% during the first UK lockdown.\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eThe likelihood of pandemics is expected to rise, with mathematical modellers estimating a 38% probability that individuals will experience another pandemic in their lifetimes\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. This highlights the critical need to prepare robust and responsive diagnostic and research workflows that can quickly adapt to future outbreaks caused by both new and existing high-risk pathogens. Necessary safety and legal requirements related to the isolation and culture of high-risk pathogens in finite, labour-intensive, high containment facilities however, pose significant physical barriers against public health responses to new pandemic outbreaks. The development of effective inactivation techniques that can render infected samples or isolated (reference) pathogens non-infectious, yet structurally intact, is vital for the rapid distribution of inactivated pathogens to multiple laboratories. This enables the development and validation of diagnostic assays within widely available low containment facilities.\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eThis study introduces a novel application of X-ray irradiation, proposing it as a safer, more cost-effective alternative to gamma radiation sources, that preserves the antigenic and genomic integrity of viruses. By demonstrating the efficacy of X-ray irradiation in inactivating various SARS-CoV-2 variants, this research aims to provide a scalable solution for rapid pandemic response, crucial for both current and future outbreak scenarios.\u003c/p\u003e \u003cp\u003eIn contrast to other inactivation techniques, gamma irradiation is notable for its ability to retain the structural integrity of viral epitopes.\u003csup\u003e[\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e Without the use of toxic chemicals, gamma irradiation has been shown to effectively inactivate several high consequence pathogens, including Lassa, Marburg and Ebola viruses.\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e Gamma sources, as a form of ionising radiation, primarily inactivates viruses through target matter ionisation, resulting in direct crosslinking and cleavage of viral nucleic acid. This prevents viral replication and produces viruses with preserved viral structures and superior immunogenicity compared to chemical or heat inactivation methods, which maintain their ability to selectively bind and become internalised into susceptible cells.\u003csup\u003e[\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e Gamma irradiated influenza stocks for example, have been shown to elicit both humoral and cell-mediated immunogenicity, protecting against both homologous and heterologous strains.\u003csup\u003e[\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e Due to these advantages, gamma inactivation provides a method to produce antigenic, non-infectious whole virus particles capable of supporting further development of multiple specialisms, both for research and diagnostic development, as well as candidates for future vaccines.\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eThe generation of gamma irradiation using \u0026lsquo;live\u0026rsquo; radioactive isotopes is impeded by major economic, safety and legal constraints, prompting the investigation of alternative generators to support the radiobiology field.\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e Gamma and X-rays are both highly penetrating photons, that damage biological specimens through the direct ionisation of viral genomes. These photons can also interact with water molecules and other organic molecules within biological samples, generating unpaired electrons (referred to as free radicals), which are highly reactive and can cause subsequent indirect ionisation.\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e Due to their shared underlying mechanistic inactivation processes, both forms of ionising radiation are believed to hold similar benefits.\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eX-rays are highly penetrating and can pass through multiple layers of biosafety packaging allowing large volumes of infectious material to be inactivated more effectively than with alternative radiation techniques, such as UV and electron bombardment.\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e X-rays are typically generated by propelling electrons from a metal filament cathode towards a tungsten target anode, within a vacuum X-ray tube.\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e When electrons strike the target atoms, they emit photons, in the form of X-rays, through two distinct mechanisms. The primary mechanism, Bremsstrahlung, involves the deceleration of electrons as they pass through the atomic electric field within the target material.\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e The second mechanism involves an electron transitioning from an outer to an inner shell, which also results in the emission of an X-ray photon.\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eX-rays offer a safer and more cost-effective alternative to gamma irradiation, largely because they do not involve the use of radioactive isotopes, which pose significant safety and decommissioning challenges related to radiative decay.\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e Unlike gamma rays, which emit radiation at a fixed quality (i.e. a fixed energy distribution and source emission strength) due to their reliance on specific isotopes, X-ray machines operate using electrical currents that can be easily started, finely adjusted, and stopped. This plasticity allows for the customisation of the radiation field to meet specific dosimetry needs across various applications. The ability to adjust the voltage potential and current in X-ray machines not only enhances their safety but also increases their efficacy and efficiency, making them particularly suitable where flexibility and precise control are required.\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eUsing a multidisciplinary approach that includes Monte Carlo modelling and virology techniques, we have previously determined the necessary inactivation parameters and X-Ray doses using the MultiRad 225 X-ray Irradiator system to effectively inactivate a variety of viruses from the \u003cem\u003eTogaviridae, Flaviviridae, Nairoviridae\u003c/em\u003e and \u003cem\u003ePhenuividae\u003c/em\u003e, families which are known to cause significant disease.\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e X-ray irradiation left no signs of viral infection in these model viruses, yet allowed the detection of complete genome sequences. Moreover, viral proteins were detectable in assays such as Western blot and ELISA.\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e These findings confirm that X-ray irradiated viruses retain key molecular markers, making them suitable for a range of diagnostic and research applications, including next generation sequencing, qPCR and serological detection assays, during pandemic outbreaks.\u003c/p\u003e \u003cp\u003eHere we demonstrate the successful generation of X-ray inactivated SARS-CoV-2 material in real-time for deployment throughout the COVID-19 pandemic, to support the development and further validation of Lateral Flow devices (LFDs). X-ray irradiation successfully inactivated 8 different SARS-CoV-2 variants of concern (VOCs). Imaging of whole virus particles from these X-ray irradiated stocks revealed that SARS-CoV-2 nucleoprotein and spike proteins remained detectable across all tested variants by ELISA and LFDs. This demonstrates the utility of X-ray irradiated material for diagnostic evaluation and highlights its ability to enhance throughput and testing capacity during pandemics without the need for labour intensive, high-containment handling.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eX-ray irradiation inactivation kinetics determine a SARS-CoV-2 D-value of 1.02 kilograys (kGy).\u003c/span\u003e \u003c/p\u003e \u003cp\u003eThe X-ray D-value or decimal reduction dose, quantifies to the amount of X-ray irradiation required to reduce the viral titre of a specific pathogen by 1-Log, in a known medium. This rate of inactivation rate helps predict the necessary X-ray dose for SARS-CoV-2 variants assuming experiments are conducted under consistent conditions.\u003c/p\u003e \u003cp\u003eInactivation dynamics were initially evaluated by incrementally irradiating 1 ml aliquots of SARS-CoV-2 England/02/2020 with high energy X-rays, using the MultiRad 225 Irradiator system following previously determined methodologies and an average temperature of 9\u0026deg;C .\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e Both high and low titre virus stocks were tested to assess if the rate of inactivation was consistent across different starting titres under controlled conditions. The viral titre post irradiation was assessed by plaque assay. The low titre stock of 3.0 x 10\u003csup\u003e5\u003c/sup\u003e plaque forming units (PFU)/ml, was fully inactivated at 4 kGy. The high titre stocks, with reported titres of 2.13 X 10\u003csup\u003e7\u003c/sup\u003e PFU/ml and 1.87 X 10\u003csup\u003e7\u003c/sup\u003e PFU/ml, collectively had a mean inactivation dose of 6.39 kGy (Supplementary Fig.\u0026nbsp;1A).\u003c/p\u003e \u003cp\u003eSurvival curves were generated by plotting the Log10 viral titre (Log(10PFU/ml)) against X-ray inactivation dose (kGy) for each experimental repeat (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). All regression lines had an R\u003csup\u003e2\u003c/sup\u003e- value above 0.95 indicating high reliability of the fits and a residual value ranging between \u0026minus;\u0026thinsp;0.6 to 0.4 (Supplementary Fig.\u0026nbsp;1). For the high titre aliquots, regression lines had gradients of -1.002 (95% Confident Intervals: -1.042 to -0.9539, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, blue) and \u0026minus;\u0026thinsp;1.241 (95% Confident Intervals: -0.9021 to -0.7089, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, green). The low titre aliquots showed a gradient of -0.8295 (95% Confident Intervals: -1.416 to -0.9956, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, red). D-values, representing the dose required to reduce the viral titre by 1-Log, were calculated from the inverse slope of these lines. Averaging these values yielding a final D-value of 1.02, which can be used to predict the minimum X-ray dose needed for effective inactivation of SARS-CoV-2 variants with different starting titres.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eX-ray irradiation can successfully inactivate SARS-CoV-2 variants of concerns\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eThroughout the pandemic, emerging SARS-CoV-2 VOCs were successfully inactivated through X-ray irradiation, making them suitable for use as positive controls in diagnostic assays within low containment facilities. The inactivation of all X-ray treated variants was rigorously confirmed through a two-step process. Initially, plaque assays compared plaque counts before and after irradiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), consistently showing no plaque formation in the irradiated variants (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eSubsequently the irradiated variants then underwent three weeks of serial passage in a susceptible cell line. During this period, cell monolayers were monitored for any visible signs of infection and nucleic acid were periodically extracted to track trends in detection of viral RT-qPCR targets. The X-ray irradiated stocks displayed no cytopathic effects (CPE) throughout the serial passages, whereas control groups with non-irradiated variants exhibited obvious signs of infection. (Fig.\u0026nbsp;2B2). Additionally, RT-qPCR analysis revealed a decrease in viral target copies, for irradiated viruses, contrasting with an increase observed in the non-irradiated controls, indicating active viral replication in the latter (Fig.\u0026nbsp;2B1).\u003c/p\u003e \u003cp\u003eX-ray irradiated variants then underwent 3 weeks of sterility passage within a susceptible cell line. Throughout sterility, infected flasks were observed for visible signs of infection and AVL samples were taken at regular intervals to track trends in detection of viral RT-qPCR targets. All X-Ray irradiated stocks showed no visible signs of cytopathic effect (CPE) on the susceptible cell culture during all rounds of sterility passage, while identical, non-irradiated SARS-Cov-2 variants showed visible signs of infection (Fig.\u0026nbsp;2B2). To support this, non-irradiated variants demonstrated a clear increase in viral RT-qPCR target copies, indicating clear signs of active viral replication. The opposite effect was found for X-ray irradiated viruses, which saw a reduction in viral target copies by RT-qPCR (Fig.\u0026nbsp;2B1).\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eX-Ray irradiated SARS-CoV-2 variants show comparable sequencing depth and coverage to live sequenced viruses.\u003c/span\u003e \u003c/p\u003e \u003cp\u003eAll X-ray irradiated SARS-CoV-2 variants demonstrated sequencing depth and coverage comparable to that of non-irradiated SARS-CoV-2. Whole genome sequencing was performed on all irradiated variants to determine whether X-ray irradiation impacted the viral RNA and its suitability for downstream molecular assays. No differences were found in the depth coverage between live and X-ray irradiated SARS-CoV-2 Omicron BA.2 variants across their entire genomes with all tested variants showing a depth coverage above 99% (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Furthermore, phylogenetic analysis using NextClade algorithms revealed that all irradiated viruses were accurately characterised within their respective clades, exhibiting identical results to non-irradiated counterparts with a pairwise distance of 0% calculated in all cases (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eWhole virus SARS-CoV-2 particles are preserved after X-ray irradiation and viral proteins detectable by antigen detection assays.\u003c/span\u003e \u003c/p\u003e \u003cp\u003eThe applicability of inactivated viruses as reagents and controls in diagnostics assays hinges on the preservation of viral proteins. To evaluate this, the structural integrity and detection sensitivity of X-ray irradiated viruses were assessed and compared with live viruses. Transmission electron microscopy (TEM) was used to image both X-ray irradiated Delta and Omicron BA.2 variants. The images confirmed that both treated and untreated viruses maintained similar structural morphologies and densities (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo further assess the impact of X-ray irradiation on viral protein structures, both live and irradiated SARS-CoV-2 Omicron BA.2 variants were evaluated for their sensitivity in both LFD and ELISA assays. The Orient Gene Rapid COVID-19 (Antigen) Self-Test, which detects the presence of the SARS-CoV-2 nucleocapsid protein and displays a positive result with a clear red test line, was used to gauge sensitivity. A scoring system was employed for LFD test line intensity, with strong positives graded as 3, weak positives as 2 and very weak positives as 1 and negatives as 0 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Both nucleoproteins from all tested irradiated variants were detectable by LFD. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Furthermore, live and X-ray irradiated Omicron BA.2 variants showed equivalent test line intensities, achieving identical scoring down to a viral titre of 1.00E\u0026thinsp;+\u0026thinsp;03 FFU/ml (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). This consistent performance demonstrates the utility of X-ray irradiated material in LFD validation, confirming its effectiveness as a diagnostic tool.\u003c/p\u003e \u003cp\u003eDetection of the receptor binding detection (RBD) site of the spike protein in X-ray irradiated SARS-CoV-2 variants was evaluated using a commercially available Human SARS-CoV-2 RBD ELISA Kit. All tested irradiated SARS-CoV-2 variants showed detectable spike proteins by ELISA, with readings consistently above background levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). A statistically significant difference was observed in the absorbance curves between live and X-ray irradiated Omicron BA.2 variants, with a t-value of 4.436, (df\u0026thinsp;=\u0026thinsp;16, p\u0026thinsp;=\u0026thinsp;0.0004), indicating a robust statistical support for the findings. Despite this difference the absorbance curves of both live and X-ray irradiated viruses followed similar trends, with the irradiated viruses producing an absorbance value only 0.35 lower than that of the live virus at the highest tested titre of 2.5 X 10\u003csup\u003e5\u003c/sup\u003e FFU/ml. (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e "},{"header":"Discussion","content":"\u003cp\u003eAn effective, safe and reliable, \u0026lsquo;one shot\u0026rsquo; viral inactivation method, applicable across several downstream assays, is essential to overcoming physical bottlenecks related to responding to outbreaks caused by highly infectious pathogens. X-ray irradiation is a safe, chemically-free method to produce non-infectious, structurally intact, whole virus particles, offering a timely solution during the COVID-19 pandemic. This methods ability to maintain the structural integrity of viruses underscores its potential in real-time support of pandemic response efforts.\u003c/p\u003e \u003cp\u003eInitially, SARS-CoV-2 sensitivity to X-ray inactivation was investigated by observing the drop in viral infectivity between incremental doses of X-ray irradiation. The resulting survival curves enabled the determination of a D-value of 1.02 kGy. It is important to note that D-values can vary depending on the apparatus set-up and sample medium preparation.\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e Despite these variables, the close correspondence of X-ray D-values with those of gamma irradiation studies highlights a similar mechanism of action, where both rely on high-energy photons for viral inactivation.\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e For example, Jain et al. reported that duplicate inactivation runs of an initial titred stock of 10\u003csup\u003e6.5\u003c/sup\u003e TCID50/ml performed under non-frozen conditions with a GC-5000 gamma chamber resulted in a D-value of 1.09 kGy.\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e Significant methodological differences, however, do exist between different titration methods, such as plaque and TCID50 assays, with the former generally producing higher calculated titres and showing greater sensitivity.\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e Throughout our experiments, X-ray irradiation effectively inactivated multiple SARS-CoV-2 variants, as confirmed by cytopathic effect measurements and nucleic acid trends observed during three weeks of serial passage.\u003c/p\u003e \u003cp\u003eFurther analysis using Illumina sequencing demonstrated that X-ray irradiated variants maintained over 99% sequence coverage, comparable to non-irradiated controls and no significant genomic variances were noted. This agrees with previous X-ray inactivation data, where no correlation was found between X-ray dose and genome variance for Zika (ZIKV) and Rift valley fever viruses (RVFV). Additionally, ZIKV and RVFV retained detectability and function post-irradiation demonstrating antigenic stability.\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e Our current results provide further evidence of antigenic stability, with whole SARS-CoV-2 virus particles observed post irradiation by TEM. Furthermore, X-ray irradiated Omicron BA.2 variants showed similar sensitivity to live variants in LFD testing, down to a viral titre of 1.00E\u0026thinsp;+\u0026thinsp;03 FFU/ml. Differences in protein detection between tested samples could be attributed to inconsistencies in protein expression or differences in the ELISA kit affinity for the S1 region of different VOC.\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e Notably, ELISA results showed only a marginal reduction in absorbance for irradiated samples compared to live ones, suggesting minimal impact on the proteins' detectability.\u003c/p\u003e \u003cp\u003eAn interesting and important observation was that freezing samples before irradiation could better preserve structural integrity and reduce damage from indirect radiation effects, such as those caused by reactive oxygen species and free radicals primarily formed from the radiolysis of water and oxygen molecules.\u003csup\u003e[\u003cspan additionalcitationids=\"CR36 CR37 CR38\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e This type of \u0026lsquo;indirect\u0026rsquo; damage, although short lived (~\u0026thinsp;10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003es), are responsible for the majority of the damage that occurs in protein samples during irradiation.\u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e For example, Influenza stocks irradiated to 50 kGy at room temperature (RT) showed a greater reduction in haemagglutination titres compared to stocks irradiated on dry ice to the same dose, supported by visualisation of clear virus particles only being successful at a higher magnification for Influenza viruses inactivated in thawed conditions.\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e These results suggest that similar to gamma irradiation, X-ray preparations destined for downstream immunological assays or vaccine development, freezing should be considered as a preferred method for irradiation to reduce unwanted, indirect damage to protein structure.\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e Another advantage is that irradiating frozen samples reduces the risk of sample leakage which enhances overall biosafety, making it an appealing option for irradiation protocols of hazardous pathogens.\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eOverall, these results demonstrate how X-ray irradiation can successfully inactivate SARS-CoV-2 preparations and produce useful whole virus inactivated particles, applicable for an array of different assays to be performed in low containment facilities. Throughout the pandemic, X-ray irradiated SARS-CoV-2 variants were distributed to research and diagnostic facilities across the UK and internationally via the European Virus Archive \u0026ndash; GLOBAL programme, playing a pivotal role in the validation of LFDs against emerging variants of concern and enhancing the global response capability. This broad application and effectiveness highlights the signification potential of X-ray irradiation as a versatile inactivation technique for pandemic preparedness and response across a spectrum of serological and molecular diagnostic assays.\u003c/p\u003e \u003cp\u003eIn conclusion, the utility of X-ray irradiation as demonstrated by this study reveals a pivotal advancement in our approach to pandemic preparedness and response. Unlike conventional methods, X-ray irradiation effectively preserves the structural and antigenic integrity of viruses, which is essential for the reliable performance of diagnostic assays. The rapid and safe inactivation process, which does not require high-containment facilities, represents a transformative step forward. This method not only enhances the safety and efficiency of handling highly infectious pathogens, but also significantly expands the capacity for high-throughput testing, vaccine development and potentially high-resolution structural analysis of viral pathogens. Importantly, the scalability of X-ray irradiation technology ensures that it can be swiftly deployed worldwide, offering a robust tool for the global health community in combating future infectious disease outbreaks. This study underscores the potential of X-ray irradiation to deliver a versatile, cost-effective, and secure method, making it an indispensable asset in the arsenal against pandemics.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eVirus stocks and cell lines:\u003c/h2\u003e \u003cp\u003eSpecific growth conditions and SARS-CoV-2 stock information for all variants can be found in Supplementary Fig.\u0026nbsp;2. In general, SARS-CoV-2 variants were grown up in Vero/hSLAM (ECACC, Cat.no: 04091501) with MEM (Gibco\u0026trade;, Cat.no: 15188319) containing 2\u0026ndash;4% Heat-inactivated FCS, 25 mM HEPES (Cat.no: 15630080, Gibco\u0026trade;), 2 mM L-glutamine (Sigma-Aldrich, Cat.no: G7513), and 0.4mg/ml Geneticin (Roche Diagnostics GmbH, Cat.no: 4727878001). Viruses were grown at 37\u0026deg;C with 0% CO\u003csub\u003e2\u003c/sub\u003e for 3\u0026ndash;4 days, depending on development of visual cytopathic effects and frozen down in 1ml aliquots in a -80\u0026deg;C freezer. Non-Omicron variants\u0026rsquo; titres were then determined by plaque assay, through adding 100 \u0026micro;l of 10-fold serial diluted virus onto Vero E6 cells (ECACC, Cat.no: 85020206) seeded to 75\u0026ndash;90% confluency within a 24-well plate in triplicate. The virus infected wells were incubated for 1 hour at 37\u0026deg;C, 0% CO\u003csub\u003e2\u003c/sub\u003e before adding 1ml of pre-warmed overlay containing 3% CMC per well and incubating for 4 days. Cells were then fixed with 4% formaldehyde diluted in PBS and stained with 0.2% crystal violet solution in 50% methanol. Omicron BA.2 titres were compared for pre- and post-irradiation titres by TCID\u003csub\u003e50\u003c/sub\u003e using 96-well plates seeded with Vero/hSLAM following established methodologies. Titres were then calculated using the Spearman\u0026ndash;Karber method. \u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eX-ray irradiation parameters\u003c/h2\u003e \u003cp\u003eX-ray irradiations were undertaken on the MULTIRAD225 X-ray Irradiators (Precision X-ray Irradiation, USA) installed with an MXR-225/26 X-ray source (225 kV 4 kW). The voltage potential of an X-ray tube governs the energy distribution of the resulting radiation field, whilst its dose rate depends linearly on the current, all other factors being equal. Run settings were set to 220kV and 17.5 mA, based on a combination of previous Monte Carlo Modelling of the chamber\u0026rsquo;s dosimetry and confirmatory real-time dose testing data.\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e All X-ray irradiations were undertaken with a 0.5 mm thick Aluminium filter covering the beam\u0026rsquo;s entrance port into the chamber, as this was seen to produce reduced dose variability compared to the 0.2 mm Aluminium filter used in previous publications.\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e Specifically, by preferentially supressing the lower energy components of the photon distribution, using a thicker filter leads to an X-ray field that is both higher in mean energy and sharper, which in turn allows for more precise dosimetry and more uniform dose deposition within samples. During irradiation, viral stocks were maintained in liquid phase by placing samples upon a 5.3 cm non-conductive plastic platform placed centrally on a dry ice chamber (DIC), designed to contain dry ice within its interior circular wells during radiation runs.\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e Ice within the DIC was replenished every 2.5-3 hours.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eD-value Calculations\u003c/h2\u003e \u003cp\u003eOne millilitre aliquots of SARS-CoV-2 Eng.2 02/2020 P3 were subjected to incremental levels of X-ray irradiation up to 8 kGy. Each irradiation dose interval was performed as an independent run and samples were packaged within 2 layers of 500-gauge polyethylene plastic. Samples were irradiated in a non-frozen state, at an average sample temperature of 9\u0026deg;C. In addition to the samples being subjected to the parameters stated above, the sample was positioned in a defined location 14.5 cm away from the irradiation source. Sample dose exposure rates were predetermined prior to experimental irradiation runs by undergoing extensive dose mapping at ambient temperatures, using an ionisation chamber (PTW Dosimetry, Cat.no: TW31010) calibrated in terms of absorbed dose to water (D\u003csub\u003ew\u003c/sub\u003e). Dose rates were corrected for pressure and temperature discrepancies compared to calibration conditions using the air density correction equation.\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e Dose rates were also multiplied by a factor of 1.1 to calculate the amount of X-ray irradiation deposited within a sample.\u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/sup\u003e This allowed an average dose rate to be calculated for the predefined exposure area and irradiation times to be calculated for subsequent irradiation runs.\u003c/p\u003e \u003cp\u003eSurvival curves were then generated for each separate repeat through plotting the Log10 Viral Titre (Log10(PFU/ml)) versus X-ray irradiation dose (kGy). The D-value derived from each repeat could then be calculated through determining the inverse slope of the calculated linear regression lines. \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e The final reported D-value was calculated from the average of all separately calculated D-values derived from all repeats.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eBatch Inactivation\u003c/h2\u003e \u003cp\u003eThe minimum X-ray inactivation doses were calculated by multiplying the Log10 pre-irradiated titre of SARS-CoV-2 virus stocks by the D-value (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Omicron variants were titred using a focus forming assay and then this was multiplied by a factor of 10 to estimate plaque forming assay counts, in line with previous publications which have found a 1 Log difference in observed titres between conventional plaque assays and focus forming assays.\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e Each viral stock\u0026rsquo;s irradiation dose in practise was however calculated with inclusion of an additional minimum 25% dose contingency in addition to this, to mitigate against viral titration assays variability and optimise chances of full inactivation.\u003c/p\u003e \u003cp\u003eFor batch irradiations up to 10ml, 1ml of viral supernatant was aliquoted into 2ml Starstedt screw cap micro tubes (Starstedt, Cat.no: 72.694.406.) and then 10 tubes were placed within 2 layers of heat-sealed 500-gauge polyethylene plastic. Larger batch irradiations up to 60ml could be conducted by dispensing virus into a CELLSTAR AutoFlask (CELLSTAR, Cat.no: 779160). The flask was heat-sealed within 2 layers of 500-gauge polyethylene plastic and then placed within a Clip down HPL815 clip-lock box filled with 5 layers of PinkPig absorbent material. Samples were irradiated using the settings stated above with a minimum source to sample distance (SSD) of 20.6 cm. Dose rate measurements were taken at each of the 4 sample corners and the time taken (minutes) to reach the desired dose was calculated based on the lowest value. The cumulative dose and dose rate was monitored throughout the experiment on a UNIDOS TANGO (PTW Dosimetry, Cat.no: TW10052) connected an ionisation chamber (PTW Dosimetry, Cat.no: TW31010) placed in situ.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eSterility of X-ray irradiated SARS-CoV-2 variants.\u003c/span\u003e \u003c/p\u003e \u003cp\u003eAll X-ray treated and live SARS-CoV-2 variants were subjected to 3 rounds of 1-week \u003cem\u003ein vitro\u003c/em\u003e passage within consecutively larger flasks (T12.5, T25 and T75) seeded with a susceptible cell line. Flasks destined to be inoculated with non-Omicron variants were seeded a day before inoculation with Vero E6 cells (ECACC, Cat.no: 04091501) at a seeding density of 4.0 x 10\u003csup\u003e4\u003c/sup\u003e cells/cm\u003csup\u003e2\u003c/sup\u003e and then incubated at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. Alternatively, Omicron variant flasks were seeded a day before inoculation with Vero/hSLAMs (ECACC. Cat.no: 04091501), following ECACCs recommendations for seeding density, media and culturing conditions. At the beginning of sterility, flasks were either inoculated with irradiated virus and signs of visual infection were monitored visually by grading the level of cytopathic effect (CPE). Scoring was classified as followed: 0: No CPE (0% CPE), 1: Early CPE (10% CPE), 2: CPE (50% CPE) and 3: Full CPE (100% CPE). Negative and positive matched live control flasks were also run alongside irradiated flasks throughout the experiment. Samples were taken every 48 hours for nucleic extraction (QIAmp viral RNA extraction kit) during the serial passage. This was achieved by 140\u0026micro;l being taken from each infected flask and then inactivated with 560 \u0026micro;l of AVL buffer, followed by 10 minutes incubation before 560\u0026micro;l 100% ethanol was also added to the inactivated sample.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eRNA isolation and reverse-transcriptase qPCR.\u003c/span\u003e \u003c/p\u003e \u003cp\u003eAll AVL samples taken during sterility testing were extracted using the BioSprint\u0026trade;96 One-For-All vet kit (Indical, Cat.no.: SP947057) and Kingfisher Flex platform (ThermoFisher Scientific, Cat.no: 5400630) into a final elution volume of 80 \u0026micro;l, following the manufacturer\u0026rsquo;s instructions. Extracted samples were then subjected to a SARS-CoV-2 sub-genomic E gene RT-PCR, using primer and probe sequences obtained from W\u0026ouml;lfel et al, 2020. \u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e In preparation for the qPCR, primer-probe mixes were mass prepared using 200 \u0026micro;l sgLead Forward primer (CGATCTCTTGTAGATCTGTTCTC), 400\u0026micro;l E-Sarbeco Reverse primer (ATATTGCAGCAGTACGCACACA) and 100\u0026micro;l E-Sarbeco P probe (FAM-ACACTAGCCATCCTTACTGCGCTTCG-BFQ) all at a 100 \u0026micro;M concentration and were then added to 39.3 ml of RNAse-free water. Samples were then tested using a final reaction volume of 20 \u0026micro;l, including 10 \u0026micro;l primer/probe mix, 5\u0026micro;l 4x TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems\u0026trade;, Cat.no: 4444432) and 5 \u0026micro;l extracted RNA template. Samples were tested utilising a QuantStudio 7 Flex Real-Time PCR System platform, through using the cycling parameters: Hold Stage: 50\u0026deg;C 10 minutes, 95\u0026deg;C 2 minutes and PCR Stage (45 cycles): 95\u0026deg;C 10 seconds and 60\u0026deg;C 30 seconds. Quantification of viral target copies within samples were calculated using a standard curve derived 10-fold dilutions of an in vitro transcribed RNA standard of the full-length SARS-CoV-2 E ORF (accession number NC_045512.2) led by the UTR leader sequence and putative E gene transcription regulatory sequence. A Wild-type Victoria-01 extracted control was run on each individual plate as a positive control.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eTransmission Electron Microscopy.\u003c/span\u003e \u003c/p\u003e \u003cp\u003eX-ray irradiated SARS-CoV-2 variants were compared to Live SARS-CoV-2 variants through Transmission Electron Microscopy. Samples were fixed through adding 90 \u0026micro;l of viral supernatant to 12 \u0026micro;l of 37\u0026ndash;40% EM grade formaldehyde and left overnight at room temperature to allow full inactivation. Then, 3 \u0026micro;l of fixed samples were loaded onto an Old 400 pattern, copper TEM grid (Agar Scientific Ltd. Cat.no AGG204) coated with formvar (Agar Scientific Ltd. Cat.no. AGR1201) using a 0.5% formvar solution in chloroform (Sigma-Aldrich, Cat.no. 372978). The sample was left to settle for 30 seconds to 10 minutes before the grids were then blotted to dry on moist filter paper, washed in distilled water and then stained with 2\u0026ndash;3 \u0026micro;l of 2% Methylamine tungstate. (Bio-Rad, Cat.no. A2315.) The stain was then quickly removed after 10 seconds with moist filter paper and left to air dry. Images were then taken on a Philips / FEI CM100 Transmission Electron Microscope operated at 80kV.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eLateral Flow Devices\u003c/h2\u003e \u003cp\u003eX-ray irradiated variants were evaluated for the detection of SARS-CoV-2 Nucleocapsid proteins using the Orient Gene Rapid COVID-19 (Antigen) Self-Tests (Orient Gene, Cat.no: GCCOV-502a-H70GE). X-ray irradiated and non-X-ray irradiated SARS-CoV-2 variants were both 10-fold serially diluted in 2 X MEM (Gibco\u0026trade;, Cat.no: 11935046) to a final dilution of 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e. Then, 100\u0026micro;l of each diluted samples were mixed with 300 \u0026micro;l of the kit extraction tube fluid, after which 4 drops were added to each LFD cassette in triplicate. After 15 minutes, cassette results were scored depending on the band intensity of the test line. Strong positive bands were scored a number 3, weak bands were scored a number 2 and very weak bands were scored 1. Tests with no test band were considered negative and scored 0.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eEnzyme-linked immunosorbent assays.\u003c/span\u003e \u003c/p\u003e \u003cp\u003eThe abundance of Human SARS-CoV-2 Spike Protein on X-ray irradiated SARS-CoV-2 variants was evaluated using the Human SARS-CoV-2 RBD ELISA Kit (Invitrogen, Cat.no: # EH492RB) following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003eInitially, five X-ray irradiated SARS-CoV-2 variants were tested to determine if Human SARS-CoV-2 Spike Proteins were still detectable through ELISA after X-ray irradiation. All variants were diluted to an initial titre of 2 x 10\u003csup\u003e5\u003c/sup\u003e PFU/ml; except for the X-ray irradiated SARS-CoV-2 Omicron variants which were diluted to a starting titre of 1.25 x 10\u003csup\u003e4\u003c/sup\u003e PFU/ml, due to a low starting titre. All variants were diluted in MEM α, nucleosides, GlutaMAX\u0026trade; Supplement (Gibco\u0026trade;, Cat.no: 32571036) with 4% heat-inactivated Fetal Bovine Serum, qualified, Australia (Gibco\u0026trade;, Cat.no: 10099141), which had been X-ray irradiated to a dose of 8 kGy. This X-ray irradiated media was also used as a negative control, which along with all the X-ray irradiated variants, were subjected to a 4-fold dilution series before being added to the plate in duplicate. On each plate a kit standard and a 10-fold dilution series of the positive control in the form of a SARS-CoV-2 Spike Protein (RBD) (aa319-541), His Tag Recombinant Protein (Invitrogen, Cat.no: RP-87678) reconstructed to starting concentration of 5\u0026micro;g/ml were run in duplicate. Plates were read at an absorbance wavelength of 450nm and 620nm on a plate reader.\u003c/p\u003e \u003cp\u003eBefore analysis, the absorbance values at 620nm were subtracted from absorbance values at 450nm for each well. All data analysis was performed using GraphPad Prism 9.2.0 (GraphPad Software, USA). Sample concentrations were interpolated by fitting a sigmoidal, 4PL, X is log(concentration) model to the absorbance values of the standard provided. Read-off values were back transformed and multiplied by the dilution factor of the sample to get the final protein concentration values. Mean protein concentrations were obtained through averaging concentration values within the range of 0.5-3, which was determined to be placed on the exponential part of the curve.\u003c/p\u003e \u003cp\u003eSARS-CoV-2 Omicron BA.2 Live and X-ray irradiated variants were tested as stated above within Containment Level 3 facilities. Matched negative controls of non-irradiated and irradiated media were also tested on each plate and used as the dilution medium for matched samples. Negative control absorbance values were then subtracted from virus absorbance values. Absorbance curves were compared by statistically comparing interpolate values, derived from an absorbance value of 1.0, by an unpaired two-way T-test calculated from GraphPad Prism 9.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eNext generation sequencing.\u003c/span\u003e \u003c/p\u003e \u003cp\u003eTotal nucleic acid was extracted from paired X-ray irradiated and non-irradiated SARS-CoV-2 variants following QIAamp Viral RNA Mini Kit manufacturer\u0026rsquo;s instructions. (Qiagen, Cat.no: 52904). Forty-Five microlitres of total nucleic acid per sample was then mixed with Turbo DNAse I (Invitrogen, Cat.no: AM2238) according to the manufacturer\u0026rsquo;s instructions, before purification using an RNA Clean and Concentrator\u0026mdash;5 kit (Zymo Research, Cat.no: R101). The purified RNA was used to generate amplified cDNA libraries using sequence-independent single-primer amplification (SISPA) as previously described.\u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e Amplified cDNA was subsequently washed and purified using AMPure XP beads (Beckman Coulter, Cat.no: A63880) at a 1:2 ratio and quantified via a Qubit high-sensitivity double-stranded DNA (dsDNA) kit (ThermoScientific, Cat.no: 15860210), both following the manufacturer\u0026rsquo;s instructions. Illumina sequencing libraries utilising 1.5 ng of cDNA were then prepared using the Nextera XT V2 kit (Illumina, Cat.no: FC-131-1024), according to manufacturer\u0026rsquo;s instructions. Barcoded libraries were then sequenced on the 2 \u0026times; 150-bp paired-end Illumina MiSeq ran by the Genomics Services Development Unit (Colindale) at The UK Health Security Agency (UKHSA).\u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eGenome assembly and variant calling.\u003c/span\u003e \u003c/p\u003e \u003cp\u003ePaired reads were mapped against the Wuhan Hu-1 complete genome reference sequence (NCBI reference sequence: NC_045512.2) with BWA MEM utilising default settings. Consensus and variants were then generated utilising Quasi_BAM version 2.8 with default settings.\u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/sup\u003e Phylogenetic analysis and clade designation was achieved through running the generated consensus sequences through NextClade.\u003csup\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e Pairwise distances between non-irradiated and irradiated strains were calculated on the platform MEGA7, with sequences previously aligned by Muscle.\u003csup\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e When no in-house, non-irradiated derived VOC sequences were available, alternative sequences were utilised from the available open-source databases. For example, the non-irradiated sequence utilised for the Beta variant was derived from NCBI reference: OX746033.1 and the non-irradiated sequences for the gamma variant was soured from GISAID Reference: EPI_ISL_833366.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAdditional Information:\u003c/h2\u003e\n\u003cp\u003eThe views expressed in this article are those of the author(s) and are not necessarily those of UK Health Security Agency or the Department of Health and Social Care.\u003c/p\u003e \u003ch2\u003eCompeting interests:\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eM.CF, EA.C, B.A, E.D and L.B conducted X-ray irradiations for D-value quantification and inactivation of SARS-CoV-2 variants throughout the pandemic. EA.C, P.F and S.D conducted dose mapping experimentation on the MultiRad 225. B.A and EA.C conducted data analysis for D-value calculations. M.CF, J.C, L.E, E.D, L.B and J.B were involved in sterility testing of X-ray irradiated variants throughout the pandemic. H.T conducted TEM image processing M.S, P.F and EA.C conducted ELISAs at Containment Level 2 on a range of variants, while V.F conducted LFDs at Containment Level 2. All ELISAs and LFDs conducted at Containment Level 3 were conducted by EA.C. Genome assembly and variant calling was conducted by J.D, and subsequent pairwise distance analysis and phylogenetics was conducted by EA.C. EA.C and R.H wrote the scientific manuscript and other authors were involved in the review process.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe views expressed in this article are those of the author(s) and are not necessarily those of UK Health Security Agency or the Department of Health and Social Care.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003ePatz, J. \u0026amp; Reissen, W. K. Immunology, climate change and vector-borne diseases. \u003cem\u003eTrends Immunol.\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e, 171\u0026ndash;172 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMackenzie, J. S., Williams, D. \u0026amp; Zoonoses \u003cem\u003eMicrobiol. Australia\u003c/em\u003e \u003cb\u003e41\u003c/b\u003e, 3\u0026ndash;5 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:https://doi.org/10.1071/MA20002\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1071/MA20002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGraham, B. S. \u0026amp; Sullivan, N. J. Emerging viral diseases from a vaccinology perspective: preparing for the next pandemic. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, 20\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/s41590-017-0007-9\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/s41590-017-0007-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeroy, E. M. et al. Multiple Ebola virus transmission events and rapid decline of central African wildlife. \u003cem\u003eScience\u003c/em\u003e. \u003cb\u003e303\u003c/b\u003e, 387\u0026ndash;390. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1126/science.1092528\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1126/science.1092528\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, H. et al. Estimating excess mortality due to the COVID-19 pandemic: a systematic analysis of COVID-19-related mortality, 2020-21. \u003cem\u003eLancet\u003c/em\u003e. \u003cb\u003e399\u003c/b\u003e, 1513\u0026ndash;1536 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOffice of National Statistics. \u003cem\u003eGDP and events in history: how the COVID-19 pandemic shocked the UK economy\u003c/em\u003e, (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ons.gov.uk/economy/grossdomesticproductgdp/articles/gdpandeventsinhistoryhowthecovid19p andemicshockedtheukeconomy/2022-05-24\u003c/span\u003e\u003cspan address=\"https://www.ons.gov.uk/economy/grossdomesticproductgdp/ articles/gdpandeventsinhistoryhowthecovid19pandemicshockedtheukeconomy/2022-05-24\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarani, M., Katul, G. G., Pan, W. K. \u0026amp; Parolari, A. J. Intensity and frequency of extreme novel epidemics. \u003cem\u003eProc. Natl. Acad. Sci. U S A\u003c/em\u003e. \u003cb\u003e118\u003c/b\u003e, e2105482118. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1073/pnas.2105482118\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1073/pnas.2105482118\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAfrough, B. et al. X-ray inactivation of RNA viruses without loss of biological characteristics. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 21431. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/s41598-020-77972-5\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/s41598-020-77972-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlsharifi, M. \u0026amp; M\u0026uuml;llbacher, A. The gamma-irradiated influenza vaccine and the prospect of producing safe vaccines in general. \u003cem\u003eImmunol. Cell. Biol.\u003c/em\u003e \u003cb\u003e88\u003c/b\u003e, 103\u0026ndash;104. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/icb.2009.81\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/icb.2009.81\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMollaei Alamuti, M. et al. Immune Response of Gamma-Irradiated Inactivated Bivalent Polio Vaccine Prepared plus Trehalose as a Protein Stabilizer in a Mouse Model. \u003cem\u003eIntervirology\u003c/em\u003e. \u003cb\u003e64\u003c/b\u003e, 140\u0026ndash;146. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1159/000515392\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1159/000515392\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalehi, B. et al. Analysis of antigen conservation and inactivation of gamma-irradiated avian influenza virus subtype H9N2. \u003cem\u003eActa Microbiol. Immunol. Hung.\u003c/em\u003e \u003cb\u003e65\u003c/b\u003e, 163\u0026ndash;171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1556/030.65.2018.025\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1556/030.65.2018.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElliott, L. H., McCormick, J. B. \u0026amp; Johnson, K. M. Inactivation of Lassa, Marburg, and Ebola viruses by gamma irradiation. \u003cem\u003eJ. Clin. Microbiol.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 704\u0026ndash;708. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:doi:10.1128/jcm.16.4.704-708.1982\u003c/span\u003e\u003cspan address=\"https://doi.org:doi:10.1128/jcm.16.4.704-708.1982\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1982).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeldmann, F., Shupert, W. L., Haddock, E., Twardoski, B. \u0026amp; Feldmann, H. Gamma Irradiation as an Effective Method for Inactivation of Emerging Viral Pathogens. \u003cem\u003eAm. J. Trop. Med. Hyg.\u003c/em\u003e \u003cb\u003e100\u003c/b\u003e, 1275\u0026ndash;1277. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.4269/ajtmh.18-0937\u003c/span\u003e\u003cspan address=\"https://doi.org:10.4269/ajtmh.18-0937\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, F. et al. Characterization of humoral and cellular immune features of gamma-irradiated influenza vaccine. \u003cem\u003eHum. Vaccin Immunother\u003c/em\u003e. \u003cb\u003e17\u003c/b\u003e, 485\u0026ndash;496 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHume, A. J. et al. Inactivation of RNA Viruses by Gamma Irradiation: A Study on Mitigating Factors. \u003cem\u003eViruses\u003c/em\u003e. \u003cb\u003e8\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/v8070204\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/v8070204\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWard, R. L. Mechanisms of poliovirus inactivation by the direct and indirect effects of ionizing radiation. \u003cem\u003eRadiat. Res.\u003c/em\u003e \u003cb\u003e83\u003c/b\u003e, 330\u0026ndash;344 (1980).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFuruya, Y. et al. Effect of inactivation method on the cross-protective immunity induced by whole 'killed' influenza A viruses and commercial vaccine preparations. \u003cem\u003eJ. Gen. Virol.\u003c/em\u003e \u003cb\u003e91\u003c/b\u003e, 1450\u0026ndash;1460. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1099/vir.0.018168-0\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1099/vir.0.018168-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM\u0026uuml;llbacher, A., Lobigs, M., Alsharifi, M. \u0026amp; Regner, M. Cytotoxic T-cell immunity as a target for influenza vaccines. \u003cem\u003eLancet. Infect. Dis\u003c/em\u003e. \u003cb\u003e6\u003c/b\u003e, 255\u0026ndash;256. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:https://doi.org/10.1016/S1473-3099(06)70443-1\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/S1473-3099(06)70443-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFuruya, Y. et al. Gamma-irradiated influenza virus uniquely induces IFN-I mediated lymphocyte activation independent of the TLR7/MyD88 pathway. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e6\u003c/b\u003e, e25765. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1371/journal.pone.0025765\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1371/journal.pone.0025765\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarnard, S., Daniels, A. L., Eakins, T., Tanner, J. \u0026amp; Bouffler, S. R and Alternatives to caesium irradiators for biological sciences and blood transfusion services. (Public Health England Report CRCE-RED-001-2020, (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDesouky, O., Ding, N. \u0026amp; Zhou, G. Targeted and non-targeted effects of ionizing radiation. \u003cem\u003eJ. Radiation Res. Appl. Sci.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 247\u0026ndash;254. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jrras.2015.03.003\u003c/span\u003e\u003cspan address=\"10.1016/j.jrras.2015.03.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015). https://doi.org:.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSadraeian, M., Zhang, L., Aavani, F., Biazar, E. \u0026amp; Jin, D. Viral inactivation by light. \u003cem\u003eeLight\u003c/em\u003e. \u003cb\u003e2\u003c/b\u003e, 18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1186/s43593-022-00029-9\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1186/s43593-022-00029-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFuruya, Y. Return of inactivated whole-virus vaccine for superior efficacy. \u003cem\u003eImmunol. Cell. Biol.\u003c/em\u003e \u003cb\u003e90\u003c/b\u003e, 571\u0026ndash;578. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1038/icb.2011.70\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1038/icb.2011.70\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFertey, J. et al. Pathogens Inactivated by Low-Energy-Electron Irradiation Maintain Antigenic Properties and Induce Protective Immune Responses. \u003cem\u003eViruses\u003c/em\u003e. \u003cb\u003e8\u003c/b\u003e, 319 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcEvoy, B., Michel, H., Howell, D. \u0026amp; Roxby, P. X-ray: An Effective Photon. \u003cem\u003eBiomedical Instrum. Technol.\u003c/em\u003e \u003cb\u003e54\u003c/b\u003e, 23\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.2345/0899-8205-54.s3.23\u003c/span\u003e\u003cspan address=\"https://doi.org:10.2345/0899-8205-54.s3.23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurner, G. S., Squires, E. J. \u0026amp; Murray, H. G. S. Inactivated smallpox vaccine. A comparison of inactivation methods. \u003cem\u003eJ. Hygiene\u003c/em\u003e. \u003cb\u003e68\u003c/b\u003e, 197\u0026ndash;210. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1017/S0022172400028679\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1017/S0022172400028679\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1970).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEakins, J. S., Afrough, B. \u0026amp; Hewson, R. Monte Carlo modelling of an x-ray chamber for providing inactivation exposures to viruses. \u003cem\u003eJ. Radiol. Prot.\u003c/em\u003e \u003cb\u003e41\u003c/b\u003e, 962\u0026ndash;981. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1088/1361-6498/ac2f85\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1088/1361-6498/ac2f85\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eW\u0026ouml;lfel, R. et al. Virological assessment of hospitalized patients with COVID-2019. \u003cem\u003eNature\u003c/em\u003e. \u003cb\u003e581\u003c/b\u003e, 465\u0026ndash;469 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJureka, A. S., Silvas, J. A. \u0026amp; Basler, C. F. Propagation, Inactivation, and Safety Testing of SARS-CoV-2. \u003cem\u003eViruses\u003c/em\u003e 12 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/v12060622\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/v12060622\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJain, R. et al. Inactivation of SARS-CoV-2 by gamma irradiation. \u003cem\u003eIndian J. Med. Res.\u003c/em\u003e \u003cb\u003e153\u003c/b\u003e, 196\u0026ndash;198. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.4103/ijmr.IJMR_2789_20\u003c/span\u003e\u003cspan address=\"https://doi.org:10.4103/ijmr.IJMR_2789_20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeung, A. et al. In Vitro Inactivation of SARS-CoV-2 Using Gamma Radiation. \u003cem\u003eAppl. Biosaf.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 157\u0026ndash;160. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1177/1535676020934242\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1177/1535676020934242\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcEvoy, B. et al. Studies on the comparative effectiveness of X-rays, gamma rays and electron beams to inactivate microorganisms at different dose rates in industrial sterilization of medical devices. \u003cem\u003eRadiat. Phys. Chem.\u003c/em\u003e \u003cb\u003e208\u003c/b\u003e, 110915. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:https://doi.org/10.1016/j.radphyschem.2023.110915\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.radphyschem.2023.110915\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZapata-Cardona, M. I. et al. Comparison among plaque assay, tissue culture infectious dose (TCID(50)) and real-time RT-PCR for SARS-CoV-2 variants quantification. \u003cem\u003eIran. J. Microbiol.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 291\u0026ndash;299. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.18502/ijm.v14i3.9758\u003c/span\u003e\u003cspan address=\"https://doi.org:10.18502/ijm.v14i3.9758\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMittal, A., Khattri, A. \u0026amp; Verma, V. Structural and antigenic variations in the spike protein of emerging SARS-CoV-2 variants. \u003cem\u003ePLoS Pathog\u003c/em\u003e. \u003cb\u003e18\u003c/b\u003e, e1010260. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1371/journal.ppat.1010260\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1371/journal.ppat.1010260\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFuruya, Y. et al. Cytotoxic T cells are the predominant players providing cross-protective immunity induced by {gamma}-irradiated influenza A viruses. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cb\u003e84\u003c/b\u003e, 4212\u0026ndash;4221. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/jvi.02508-09\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/jvi.02508-09\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavid, S. C. et al. The effect of gamma-irradiation conditions on the immunogenicity of whole-inactivated Influenza A virus vaccine. \u003cem\u003eVaccine\u003c/em\u003e. \u003cb\u003e35\u003c/b\u003e, 1071\u0026ndash;1079. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vaccine.2016.12.044\u003c/span\u003e\u003cspan address=\"10.1016/j.vaccine.2016.12.044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017). https://doi.org:.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSullivan, R., Scarpino, P. V., Fassolitis, A. C., Larkin, E. P. \u0026amp; Peeler, J. T. Gamma radiation inactivation of coxsackievirus B-2. \u003cem\u003eAppl. Microbiol.\u003c/em\u003e \u003cb\u003e26\u003c/b\u003e, 14\u0026ndash;17 (1973).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOrmerod, M. G. Free-radical Formation in Irradiated Deoxyribonucleic Acid. \u003cem\u003eInt. J. Radiation Biology Relat. Stud. Phys. Chem. Med.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 291\u0026ndash;300 (1965).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrieb, T. A. et al. Effective use of optimized, high-dose (50kGy) gamma irradiation for pathogen inactivation of human bone allografts. \u003cem\u003eBiomaterials\u003c/em\u003e. \u003cb\u003e26\u003c/b\u003e, 2033\u0026ndash;2042. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biomaterials.2004.06.028\u003c/span\u003e\u003cspan address=\"10.1016/j.biomaterials.2004.06.028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2005). https://doi.org:.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrieb, T. et al. Effective use of Gamma Irradiation for Pathogen Inactivation of Monoclonal Antibody Preparations. \u003cem\u003eBiologicals\u003c/em\u003e. \u003cb\u003e30\u003c/b\u003e, 207\u0026ndash;216. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/biol.2002.0330\u003c/span\u003e\u003cspan address=\"10.1006/biol.2002.0330\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2002). https://doi.org:.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBullen, C. K., Davis, S. L. \u0026amp; Looney, M. M. Quantification of Infectious SARS-CoV-2 by the 50% Tissue Culture Infectious Dose Endpoint Dilution Assay in \u003cem\u003eSARS-CoV-2: Methods and Protocols\u003c/em\u003e (eds Justin Jang Hann Chu, Bintou Ahmadou Ahidjo, \u0026amp; Chee Keng Mok) 131\u0026ndash;146Springer US, (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaylor, L. S. \u0026amp; Singer, G. Air Density Corrections for Temperature and Pressure Applied to X-Ray Ionization Chambers. \u003cem\u003eRadiology\u003c/em\u003e. \u003cb\u003e23\u003c/b\u003e, 404\u0026ndash;409 (1934).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCsete, I. et al. Comparison of air kerma and absorbed dose to water measurements of Co-60 radiation beams for radiotherapy Report on EUROMET project 813, identifiers in the BIPM key comparison database (KCDB) are EUROMET.RI(I)-K1 and EUROMET.RI(I)-K4. \u003cem\u003eMetrologia\u003c/em\u003e \u003cb\u003e47\u003c/b\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazzola, P. G., Penna, T. C. \u0026amp; Martins, A. M. Determination of decimal reduction time (D value) of chemical agents used in hospitals for disinfection purposes. \u003cem\u003eBMC Infect. Dis.\u003c/em\u003e \u003cb\u003e3\u003c/b\u003e, 24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1186/1471-2334-3-24\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1186/1471-2334-3-24\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreninger, A. L. et al. Rapid metagenomic identification of viral pathogens in clinical samples by real-time nanopore sequencing analysis. \u003cem\u003eGenome Med.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1186/s13073-015-0220-9\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1186/s13073-015-0220-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLewandowski, K. et al. Metagenomic Nanopore Sequencing of Influenza Virus Direct from Clinical Respiratory Samples. \u003cem\u003eJ. Clin. Microbiol.\u003c/em\u003e \u003cb\u003e58\u003c/b\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePenedos, A. R., Myers, R., Hadef, B., Aladin, F. \u0026amp; Brown, K. E. Assessment of the Utility of Whole Genome Sequencing of Measles Virus in the Characterisation of Outbreaks. \u003cem\u003ePLOS ONE\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, e0143081. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1371/journal.pone.0143081\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1371/journal.pone.0143081\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAksamentov, I., Roemer, C., Hodcroft, E. A. \u0026amp; Neher, R. A. Nextclade: clade assignment, mutation calling and quality control for viral genomes. \u003cem\u003eJ. Open. Source Softw.\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e, 3773. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.21105/joss.03773\u003c/span\u003e\u003cspan address=\"10.21105/joss.03773\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar, S., Stecher, G. \u0026amp; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. \u003cem\u003eMol. Biol. Evol.\u003c/em\u003e \u003cb\u003e33\u003c/b\u003e, 1870\u0026ndash;1874. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1093/molbev/msw054\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1093/molbev/msw054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"X-Ray, MultiRad 225, Inactivation, SARS-CoV-2, Pandemic and Lateral Flow Device","lastPublishedDoi":"10.21203/rs.3.rs-4926136/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4926136/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn response to the unprecedented challenges posed by the COVID-19 pandemic, this study introduces a novel application of X-ray irradiation to rapidly inactivate SARS-CoV-2 variants, enabling safe and efficient virus handling outside high-containment facilities. Unlike traditional methods, X-ray irradiation preserves both the structural and genomic integrity of the virus, allowing for accurate detection through molecular and antigen-based diagnostics. Our findings not only demonstrate the method's superiority over gamma irradiation in terms of safety and cost but also its effectiveness in maintaining antigenic fidelity, critical for diagnostic reliability. Importantly, the scalability and accessibility of X-ray technology provide a transformative approach for managing future pandemic outbreaks, offering a robust tool for rapid viral inactivation that can significantly enhance global testing and research capabilities without the logistical and safety constraints of high-containment processing.\u003c/p\u003e","manuscriptTitle":"X-ray Inactivation of SARS-CoV-2: A Safe, Cost-effective Approach for Pandemic Testing Workflows.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-04 06:43:05","doi":"10.21203/rs.3.rs-4926136/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-03-04T09:03:51+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"164627506347579482052029481836146256970","date":"2025-03-03T14:54:20+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-03-01T14:54:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"222998104779233798750965537135617083465","date":"2025-03-01T06:09:30+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-01-06T11:11:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"186171581144370271215896154590697900253","date":"2024-12-30T09:05:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"219934456007840852936420677857515943646","date":"2024-12-29T03:08:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"198513431548031385298495646195275288086","date":"2024-12-27T18:40:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"269256729745827864953333114133857897465","date":"2024-12-27T09:09:48+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-12-26T22:58:57+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-11-21T17:11:44+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-09-06T02:10:29+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-09-03T13:14:25+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-08-16T16:01:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c1ac5550-81b3-432f-b254-ce84404ebc39","owner":[],"postedDate":"October 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":38378601,"name":"Biological sciences/Microbiology"},{"id":38378602,"name":"Physical sciences/Physics/Techniques and instrumentation"}],"tags":[],"updatedAt":"2026-04-14T09:40:50+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-04 06:43:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4926136","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4926136","identity":"rs-4926136","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}