Effects of intrauterine extracellular vesicle microRNAs on embryonic gene expression in low-fertility cows.

R. Ichikawa, K. Kimura, and S. Matsuyama conceptualized and designed the study. R. Ichikawa and S. Matsuyama performed the experiments. R. Ichikawa and S. Matsuyama analyzed the data. K. Kimura, S. Nakamura, and S. Ohkura contributed to the discussion and helped draft the manuscript. R. Ichikawa and S. Matsuyama drafted the manuscript.

To confirm the presence of EVs in the uteri of cows 7 days post‐estrus, bovine uterine luminal fluid extracts were examined via transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA). TEM identified EVs of 50–150 nm in the uterine luminal fluid extract (Figure  1A ). Based on NTA, EV diameter was 118 ± 2.7 nm (Figure  1B ). Presence of extracellular vesicles (EVs) in bovine uterine luminal fluid. (A) Representative transmission electron microscopy image of isolated EVs in bovine uterine luminal fluid. Scale bar, 100 μm. (B) Size distribution of uterine luminal EVs, determined via nanoparticle tracking analysis. Data are presented as the mean ± SEM. Small RNA‐seq analysis of miRNAs from the intrauterine EVs of low‐ and normal‐fertility cows 7 days post‐estrus identified 16 miRNAs that were differentially expressed (false discovery rate (FDR)‐adjusted p  1) between low‐ and normal‐fertility cows (Figure  2A,B ). Eight microRNAs (bta‐ miR ‐ 181a , ‐155 , ‐935 , ‐34c , ‐1 246, ‐1 , ‐1949 , and ‐130a ) were highly expressed in low‐fertility cows, and eight ( bta‐miR‐204, ‐542‐5p, ‐1260b, ‐2313‐3p, ‐148a, ‐2887, ‐2904, and ‐2478 ) were highly expressed in normal‐fertility cows. Small RNA‐seq analysis of miRNAs extracted from intrauterine extracellular vesicles (EVs) derived from cows with low or normal fertility on day 7 post‐estrus. (A) Volcano plot of miRNAs exhibiting differential expression in low‐fertility cows relative to normal‐fertility cows. Yellow: upregulated and blue: Downregulated. Differentially expressed miRNAs were identified using a false discovery rate (FDR)‐adjusted p  1. (B) Heatmap and cluster analysis of the differentially expressed miRNAs. Yellow: upregulated and blue: downregulated. Bovine‐hatched blastocysts were exposed to green fluorescence‐labeled intrauterine EVs to confirm exosome uptake by the embryos. Green fluorescence emitted by labeled EVs was observed around the nuclei of the inner cell mass and trophoblast cells in the hatched blastocysts (Figure  3 ). No fluorescent signals were observed in the embryonic cells of the negative control group treated with the fluorescence dye for labeling EVs alone. Uptake of uterine luminal extracellular vesicles (EVs) in hatched bovine blastocysts. Representative photomicrographs showing cultured hatched blastocysts following 6 h of green‐fluorescence labeling of EVs. Nuclei were stained with Hoechst 33342 stain. In the negative control, EVs were treated without fluorescent dye. Scale bars, 50 μm. Luciferase reporter assays were performed to investigate whether the miRNA s specifically recognize target sequences and inhibit translation. The prim‐GLO vector containing the matched or mismatched miR‐1 ‐targeting sequence was transfected into endometrial stromal cells (ESCs) (Figure  4A ). Matched‐vector‐transfected ESCs treated with miR‐1 exhibited significantly lower luciferase activity than those not treated with miR‐1 (Figure  4B , p  < .05) and those transfected with the mismatched sequence (Figure  4B , p  < .05). PmirGLO dual‐luciferase assay. (A) miRNA‐target expression vector sequence. The sequence targeted by miR‐1 and its mismatch sequence are presented in bold. The sequence was inserted at multiple cloning sites between the DraI and XbaI sites, which are downstream of the firefly luciferase site. (B) Luciferase activity was measured in endometrial stromal cells transfected with GLO vector with the matched or mismatched sequence and then co‐transfected with bta‐miR‐1 . * p  < .05. To evaluate the effects of uterine miRNA on gene expression in pre‐implantation embryos, low‐ and normal‐fertility miRNAs were transfected into hatched blastocysts, followed by RNA‐seq analysis. Principal component analysis (PCA) revealed that low‐fertility miRNA transfection induced significant changes in the gene expression in the hatched blastocysts relative to the control, whereas normal‐fertility miRNA transfection induced only minor changes in gene expression (Figure  5A ). A total of 424 differentially expressed genes (FDR p  1) were identified following low‐fertility miRNA transfection, whereas only 7 were identified following normal‐fertility miRNA transfection (Figure  5B ). Transcriptome analysis of blastocysts transfected with low‐fertility or normal‐fertility miRNAs. (A) Principal component analysis of the gene expression in each treatment (low‐fertility‐miRNA transfection, normal‐fertility‐miRNA transfection, or the control). (B) Volcano plot of differentially expressed genes (DEGs) in the low‐ and the normal‐fertility miRNA treatment relative to the control. DEGs were identified using a false discovery rate (FDR)‐adjusted p  1. Low‐fertility miRNAs: the eight miRNAs exhibiting elevated expression in low‐fertility cows. Normal‐fertility miRNAs: the eight miRNAs exhibiting elevated expression in normal‐fertility cows. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of DEGs associated with the low‐fertility miRNA treatment revealed enrichment of genes associated with mitogen‐activated protein kinase (MAPK) signaling (Figure  6A ). The plot of KEGG pathway enrichment shows the upregulation (red) or downregulation (blue) of MAPK signaling pathway‐related genes (Figure  6B ). The genes suppressed by low‐fertility miRNA treatment included AP1 . Digital PCR analysis revealed significantly lower ( p  < .01) AP1 expression in low‐fertility miRNA‐treated embryos than that in the controls (Figure  6C ). The expression of IFNT2 , of which the transcription is activated by AP1, was significantly lower ( p  < .01) in low‐fertility miRNA‐treated embryos than that in the controls. KEGG pathways enriched in differentially expressed genes (DEGs) in the low‐fertility miRNA group relative to the control. (A) Top 10 enriched KEGG pathways. (B) MAPK signaling pathway annotated using KEGG Mapper colors. Red: high‐expression DEGs (Log 2 FC >1) and blue: low expression DEGs (Log 2 FC <−1). (C) Relative mRNA expression of AP1 and IFNT2 , determined via digital PCR of embryos following lipofection with control or low‐fertility miRNAs. ** p <  .01. Low‐fertility miRNA: the eight miRNAs exhibiting elevated expression in low‐fertility cows.

EVs were identified in bovine uterine luminal fluid 7 days post‐estrus. Small RNA‐seq analysis revealed that these EVs contained eight miRNAs that were highly expressed in low‐fertility cows and eight that were highly expressed in normal‐fertility cows. Intrauterine EVs were taken up by the hatched blastocysts and could affect the trophoblasts and inner cell mass. When hatched blastocysts were transfected with the low‐fertility miRNAs, their expression of genes related to embryonic MAPK signaling was suppressed. Based on digital PCR, embryonic AP1 and IFNT2 expression was suppressed by the low‐fertility miRNAs. These results suggest that intrauterine EV miRNAs may alter early embryonic development by affecting pre‐implantation embryonic gene expression. These differentially expressed miRNAs were identified in uterine luminal fluid collected 7 days post‐estrus, which is the time when bovine embryos are typically transferred. In women, endometrial miRNA expression changes transiently during the menstrual cycle and participates in the hormonal regulation of endometrial epithelial cell proliferation by estrogen and progesterone. 34 For ewes, small RNA‐seq analysis of EVs from the uterine luminal fluid during the estrous cycle and pregnancy revealed that unique miRNAs are expressed at each reproductive stage, and elucidated their involvement in the establishment and maintenance of pregnancy. 20 In mice, conditional knockout of Dicer1, which is essential for the synthesis of mature miRNAs in the reproductive tract, including the uterus, significantly delayed embryonic development relative to wild‐type mice. 35 Based on these studies, which indicate that uterine EVs and miRNAs are regulated in an estrous‐cycle‐dependent manner and are required for early embryonic development, the miRNAs identified here in bovine intrauterine EVs 7 days post‐estrus may affect fertility by acting on the embryo and endometrium. The low‐ and normal‐fertility miRNAs were transfected into hatched blastocysts, and PCA was performed on the subsequent embryonic gene expression. Relative to the control, embryos transfected with low‐fertility miRNAs exhibited significantly different gene expression, whereas those transfected with normal‐fertility miRNAs exhibited little change in gene expression. Consistent with the results of the PCA analysis, the volcano plot reveals that there were 424 DEGs following low‐fertility miRNAs treatment, but only 7 following normal‐fertility RNAs treatment, relative to the control. Several of the low‐fertility miRNAs have been reported to have detrimental effects on biological processes. bta‐miR‐181a , which is expressed in bovine mammary epithelial cells, negatively regulates lipid synthesis by targeting acyl‐CoA synthetase long‐chain family member 1 . 36 bta‐miR‐1 levels are higher in EVs from embryos arrested at the 8–16 cell stage than in those secreted from blastocysts. 37 bta‐miR‐1246 , which targets tumor‐suppressor genes, is abundant in EVs from the milk of cows with bovine leukemia. 38 The expression of bta‐miR‐155, bta‐miR‐1246 , and bta‐miR‐1949 varies with maternal age and embryo sex; considering that these miRNAs are expressed in elongated embryos, 39 some of the miRNAs in elongated embryos may be derived from EVs in the uterine lumen. Low‐fertility‐associated miRNAs may therefore negatively affect embryo survival and growth. KEGG pathway analysis of the 424 DEGs identified in the low‐fertility miRNA‐treated embryos relative to the controls revealed enrichment of MAPK signaling (Figure  6 ), particularly for the downregulated genes. In mammalian cells, the MAPK cascade is pivotal in cell metabolism, proliferation, and differentiation 40 , 41 , 42 and participates in embryonic cell metabolism, proliferation, and differentiation, contributing to embryo development. 43 , 44 , 45 In pre‐implantation embryos, MAPK signaling regulates INFT expression via AP1 . 46 Here, AP1 and IFNT2 expression was suppressed in low‐fertility miRNA‐transfected embryos. IFNT is secreted from the trophectoderm of the conceptus beginning at the blastocyst stage, 47 and its secretion increases with the elongation of the conceptus. 48 , 49 , 50 Our findings therefore suggest that the low‐fertility‐related miRNAs disrupt MAPK signaling in hatching blastocysts, interfering with early embryonic development. IFNT maintains corpus luteum function by regulating prostaglandin F 2α secretion from the endometrium. 51 , 52 , 53 , 54 , 55 IFNT levels during the pre‐implantation period are therefore considered important for the establishment of pregnancy in ruminants. 56 , 57 , 58 Based on these findings, these low‐fertility‐associated miRNAs, collected 7 days post‐estrus from intrauterine EVs, reduce IFNT expression in blastocysts and may result in pregnancy failure and infertility. To conclusively determine the effects of miRNAs in EVs from low‐fertility cows on infertility, further in vivo studies are required to determine whether supplementation of normal‐fertility cow uterine fluid with EVs derived from low‐fertility cows can suppress embryo growth and decrease fertility.

The authors declare no conflicts of interest with the contents of this article.

The rate of conception following artificial insemination or embryo transfer in cows remains low, contributing to the declining profitability of the livestock industry. The fertilization rate following artificial insemination in cows exceeds 90%, 1 suggesting that most reproductive failure is due to embryonic mortality. Most embryonic mortality occurs before implantation. 2 , 3 , 4 , 5 We previously demonstrated that mortality following embryo transfer typically occurs before the pregnancy recognition period, 6 suggesting that the intrauterine environment during embryo transfer significantly affects embryo survival. Pre‐implantation embryo survival and growth depend on histotrophs secreted by the endometrium. Histotrophs are a complex mixture of enzymes, growth factors, cytokines, nutrients, and extracellular vesicles (EVs) 7 necessary for embryo survival and growth. 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 Intrauterine fluid epidermal growth factor secretion 18 and total protein concentration 19 differ between repeat breeders and fertile cows. EVs secreted by various cells are transported to target cells via body fluids and act within the cells. Intrauterine EVs are taken up by embryos and endometrial cells 20 and participate in inducing trophectoderm proliferation. 11 EVs, which contain proteins, lipids, DNA, RNAs, and microRNAs (miRNAs), originate from secreting cells. 21 miRNAs are abundant in EVs and are responsible for cell–cell communication. Upon binding, miRNAs inhibit target‐gene expression by forming an RNA‐induced silencing complex, which alters various processes such as cell differentiation, proliferation, and apoptosis. 22 , 23 , 24 During the pre‐implantation period, uterine miRNAs participate in conceptus–maternal interactions and are closely involved in embryonic development and uterine receptivity. 25 During the peri‐implantation period, intrauterine miRNAs in EVs may induce endometrial receptivity by suppressing the expression of immune system‐related genes in endometrial epithelial cells. 26 The miR‐17‐5p in bovine oviductal fluid improves the development of zona pellucida‐free 8‐cell stage embryos into blastocysts. 27 In contrast, miRNAs can also negatively affect tissues and trigger various diseases such as endometriosis and endometritis. 28 In endometrial tissue from patients with endometriosis, miR‐1 35 a/b repressed the expression of homeobox A10 , a transcription factor required for endometrial receptivity. 29 , 30 The uteri of cows with chronic endometrial inflammation and infertility were found to specifically express 23 miRNAs. 31 We therefore hypothesized that, in low‐fertility cows, uterine EV miRNAs adversely affect pre‐implantation embryo survival and development. To test this, we examined intrauterine EV miRNAs that were differentially expressed between normal‐ and low‐fertility cows. The differentially expressed miRNAs were transfected into blastocysts, and their effects on embryonic gene expression were evaluated.

Parous female Japanese Black cows were classified as having normal or low fertility, according to their reproductive records. Cows with normal fertility were defined as those that became pregnant within three artificial insemination attempts. Cows that failed to conceive during three consecutive artificial insemination attempts, with no detectable abnormalities in their reproductive tracts and apparently normal estrus cycles, were defined as low‐fertility cows. Data on age, body weight, body condition score, and parity of the experimental animals are provided in Supplementary Table  S1 . The animals were housed in a barn with a concrete floor where they could roam freely and were provided with a diet comprising oat silage and Italian ryegrass silage twice daily and water ad libitum. The diet was formulated to meet the nutritional requirements of nonlactating Japanese beef cows (Japanese Standard for Feeding Beef Cattle, 2008). The experimental procedures involving animals were approved by the Committee for the Care and Use of Experimental Animals at the Graduate School of Bioagricultural Sciences, Nagoya University (No. A230066‐003). The animals were treated with a controlled intravaginal drug release (CIDR) device (Eazi‐Breed CIDR®, Livestock Improvement Association of Japan, Tokyo, Japan), estradiol benzoate (estradiol injection KS, Kyoritsu Seiyaku, Tokyo, Japan), and prostaglandin F 2α analog (Zenoadin C, Nippon Zenyaku Kogyo, Fukushima, Japan) for estrus synchronization, as described in our previous study. 32 The day of standing estrus was defined as day 0. On day 7, the uterine horn ipsilateral to the corpus luteum was non‐surgically flushed with 20 mL of phosphate‐buffered saline using a balloon catheter (Fujihira Industry, Tokyo, Japan). Flushing was performed under anesthesia using prifinium bromide (Padrinium injection; MSD Animal Health, Tokyo, Japan). Extracellular vesicles (EVs) were isolated from the uterine flushing fluid using a MagCapture Exosome Isolation kit PS (Fujifilm Wako Pure Chemical Corporation, Osaka, Japan), according to the manufacturer's instructions. Briefly, the flushing fluid was centrifuged (4°C, 2330  × g , for 2 h) through a 100 kDa pore ultrafiltration filter (Pall Corporation, Port Washington, NY, USA) to remove debris and obtain a concentrated solution. The collected EVs were purified from the ultrafiltrated fluid using magnetic beads conjugated with Tim4, which binds to phosphatidylserine on the exosome membrane. EVs extracted from the uterine luminal fluid were subjected to transmission electron microscopy (TEM; Tokai Electron Microscopy, Inc.; Aichi, Japan). Briefly, the samples were adsorbed onto carbon‐coated copper grids and stained with 2% phosphotungstic acid 11 solution (pH 7.0) for 20 s. The grids were observed using a TEM (JEM‐1400Plus; Jeol Ltd., Tokyo, Japan) at an acceleration voltage of 100 kV. Digital images (3296 × 2472 pixels) were captured using a CCD camera (EM‐14830RUBY2; Joel Ltd., Tokyo). Nanoparticle tracking analysis (NTA), using a NanoSight LM10 (Malvern Panalytical, Almelo, Netherlands), was performed by Fujifilm Wako Bio Solutions Corporation (Fukushima, Japan). Brownian motion images of the nanoparticles were obtained, and particle diameter and concentration were calculated. EVs were extracted from the uterine flushing fluid using ExoQuick‐TC™ Exosome Precipitation Solution (System Biosciences, Palo Alto, CA, USA). The small RNA was then extracted from the intrauterine EVs using a SeraMir™ Exosome RNA Amplification Kit (System Biosciences), after which the cDNA was synthesized. All procedures were performed according to the manufacturer's instructions. cDNA fragment quantity and quality were examined using a 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). A cDNA library for the intrauterine EVs was constructed using a TruSeq Small RNA Library Preparation Kit (Illumina, San Diego, CA, USA) and sequenced in single‐end reads using a HiSeq 2500 Sequencing System (Illumina). For each sample, the final processed reads were sequentially aligned to the reference genome, miRBase v22.1, and the non‐coding RNA database (RNAcentral release 14.0) was used to classify known miRNAs. Differentially expressed miRNAs were identified using the threshold p  < .05. The miRNA sequence data for the intrauterine EVs were deposited in the DDBJ Read Archive (accession number: PRJDB18277). Cumulus–oocyte complexes from slaughterhouse‐derived ovaries were matured in BO‐IVM (Astec, Fukuoka, Japan) at 39°C in air with 5% CO 2 and maximum humidity. After 22 h of incubation, the cumulus–oocyte complexes were fertilized with frozen–thawed semen at a concentration of 1 × 10 6 sperm/mL in BO‐IVF (ASTEC). Presumptive zygotes were recovered after 18 h, and cumulus cells were removed by vigorous vortexing and pipetting. The zygotes were subsequently cultured in 30 μL drops ( n  = 30 per drop) of BO‐IVC (ASTEC) at 39°C in 5% CO 2 , 5% O 2 , and 90% N 2 . At 72 h post‐insemination, 8‐cell stage embryos were collected and cultured in 50 μL drops ( n  = 25 per drop) of BO‐IVC under the same culture conditions described above. Hatched blastocysts were used in all experiments. EVs isolated from uterine flushing fluid were labeled using an ExoSparkler Exosome Membrane Labeling Kit‐Green (Dojindo, Kumamoto, Japan). Subsequently, 2.5 μL of fluorescently labeled EVs were added to 25 μL BO‐IVC drops containing the hatched blastocysts, followed by incubation for 6 h at 39°C in 5% CO 2 , 5% O 2 , and 90% N 2 . The experiments were conducted using hatched blastocysts cultured in 25 μL drops of BO‐IVC. The embryos were washed with PBS and transferred to a fresh 25 μL drop of BO‐IVC and then treated with 2.5 μL of fluorescently labeled EVs, followed by incubation for 6 h at 39°C in 5% CO 2 , 5% O 2 , and 90% N 2 . Embryos incubated for 6 h after the addition of only fluorescent dye for EVs were used as controls. The embryos were washed twice with PBS and observed under a fluorescence microscope (IX73P1F; Olympus, Tokyo, Japan). Oligonucleotides, including the seed target sequence of miR‐1 (sense: 5′ AAACTAGCGGCCGCTAGTAAAAAACATTCCATTGTTAAAATTT 3′, antisense: 5′ CTAGAAATTTTAACAATGGAATGTTTTTACTAGCGGCCGCTAGTTT 3′) or miR‐1 ‐mismatched sequence (sense: 5′ AAACTAGCGGCCGCTAGTAAAAACATTGGGTTGTTAAAATTT 3′, antisense: 5′ CTAGAAATTTTAACAACCCAATGTTTTTACTAGCGGCCGCTAGTTT 3′), were inserted downstream of the luciferase gene on the pmirGLO Dual‐Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) between the DraI / XbaI sites (Figure  4A ). An miR‐1 mimic (5′ TGGAATGTAAAGAAGTATGTAT 3′) was synthesized at KOKEN Co., Ltd. (Tokyo, Japan). Endometrial stromal cells were collected from bovine uteri, as previously described. 33 Transfection was conducted using bovine endometrial stromal cells (bESCs) cultured in a 96‐well plate with Lipofectamine® 3000 (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) and a selective combination of vectors and miRNA mimic. One mg/L of recombinant vector with match or mismatch sequences and 60 nM miR‐1 mimic were co‐transfected into ESCs. Then, 48 h after transfection, the luciferase activity of the cells was analyzed using the Dual‐Glo® Luciferase Assay System (Promega) and a microplate reader (Infinite® 200 PRO Configurations; Tecan, Zurich, Switzerland), following the manufacturer's instructions. Firefly luciferase activity was normalized to Renilla luciferase activity. Hatched blastocysts were cultured individually in 20 μL of BO‐IVC medium. The eight miRNAs (60 nM each) or 60 nM miRNA mimic ( mir Vana™ miRNA Mimic: Invitrogen) were diluted in BO‐IVC medium and mixed with an equal volume of Lipofectamine® 3000 for 20 min to form miRNA–lipid complexes. The hatched blastocysts were then treated with the miRNA–lipid complex and cultured for 24 h. The transfected blastocysts were collected and stored at −80°C until RNA‐seq analysis and digital PCR. Total RNA quality and concentration were examined using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Samples with RNA integrity >6.7 were used for RNA‐seq analysis. A cDNA library of miRNA‐transfected embryos was prepared using a SMART‐Seq® HT PLUS Kit (Takara Bio, Shiga, Japan) and then sequenced in paired‐end reads using a NovaSeq 6000 system (Illumina). The sequence data were filtered to remove adapter sequences, ambiguous nucleotides, and low‐quality sequences. The trimmed data were aligned to the Bos taurus genome sequence (ARS‐UCD1.2) to count sequence reads. Filtering, mapping, and subsequent analysis were performed using CLC Genomics Workbench 24.0 (Qiagen, Hilden, Germany). Gene expression was quantified as reads per kilobase of transcript per million mapped reads. Genes were considered DEGs at p  < .05. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were detected and visualized using the KEGG Mapper‐Color tool ( https://www.genome.jp/kegg/mapper/color.html ). The sequence data were uploaded to the DDBJ Read Archive (accession number: PRJDB18321). Using a ThermoScript™ RT‐PCR System (Thermo Fisher Scientific) and Oligo(dT) 20 primer, cDNA was synthesized from RNA recovered from the miRNA‐transfected embryos, according to the manufacturer's instructions. Quantification of gene expression was performed via digital PCR using Absolute Q™ DNA Digital PCR Master Mix (Thermo Fisher Scientific) and the QuantStudio™ Absolute Q™ Digital PCR System (Thermo Fisher Scientific). Digital PCR was performed according to the Life Technologies (Carlsbad, CA, USA) TaqMan gene assay instructions, using primers for activator protein 1 ( AP1 ), interferon tau ( IFNT2 ), and actin beta ( ACTB ). The assay IDs were Bt04318835_g1 for AP1 , Bt03210579_g1 for IFNT2 , and Bt03279174_g1 for ACTB . Thermocycling was performed as follows: a denaturation step at 95°C for 10 min, followed by 40 cycles at 96°C for 5 s and 60°C for 15 s. The expression of each gene was normalized to that of ACTB , which was selected as the internal control based in comparison with glyceraldehyde‐3‐phosphate dehydrogenase (assay ID, Bt03210913_g1), b2 microglobulin (assay ID, Bt03251628_m1), and phosphoglycerate kinase 1 (assay ID, Bt03225857_m1), using NormFinder ( http://moma.dk/normfinder‐software ). Luciferase activity was analyzed using one‐way ANOVA followed by the Tukey–Kramer post hoc test. Differences in the mRNA expression of AP1 and IFNT2 between the low‐fertility miRNA treatment and control were examined using Student's t‐ tests and were considered significant at p  < .05.

Table S1.