Multiplex one-step RT‒qPCR assays for simultaneous detection of AMDV, MEV and CDV

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background: Aleutian mink disease, mink viral enteritis and canine distemper are known as the three most serious diseases that cause great economic loss in the mink industry. In clinical practice, aleutian mink disease virus (AMDV), mink enteritis virus (MEV) and canine distemper virus (CDV) are common mixed infections, and they have similar clinical symptoms, such as diarrhoea. Therefore, a rapid and accurate differential diagnosis method for use on mink ranches is essential for the control of these three pathogens. Here, we developed multiplex one-step real-time quantitative PCR (RT‒qPCR) assays for the simultaneous detection and quantification of AMDV, MEV and CDV by using three primers and probes based on the conserved NS1, VP2 and N genes, respectively. Results: The results showed that the established method was less likely to cross-react with other mink pathogens, with a detection sensitivity of 25 copies/μL and a coefficient of variation less than 3.51%. Moreover, the interference experiment showed that the presence of AMDV, MEV and CDV templates at different concentrations would not interfere with the detection results. Furthermore, two hundred clinical samples of mink with diarrhoea were simultaneously analysed using multiplex RT‒qPCR and single RT‒qPCR, the Kappa values were all greater than 0.921, indicating that there was a high degree of coincidence between the two detection methods. Conclusions: In conclusion, multiplex RT‒qPCR exhibited high specificity, sensitivity, and reproducibility, indicating that this method can be used as a reliable and specific tool for the differential detection and quantification of AMDV, MEV and CDV.
Full text 107,644 characters · extracted from preprint-html · click to expand
Multiplex one-step RT‒qPCR assays for simultaneous detection of AMDV, MEV and CDV | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Multiplex one-step RT‒qPCR assays for simultaneous detection of AMDV, MEV and CDV Zhi Cao, Hang Xu, Xinru Zhao, Ke Zhang, Dehua Yin, Shuai Ma, Wenling Li, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4393868/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 14 Jan, 2025 Read the published version in BMC Veterinary Research → Version 1 posted 4 You are reading this latest preprint version Abstract Background: Aleutian mink disease, mink viral enteritis and canine distemper are known as the three most serious diseases that cause great economic loss in the mink industry. In clinical practice, aleutian mink disease virus (AMDV), mink enteritis virus (MEV) and canine distemper virus (CDV) are common mixed infections, and they have similar clinical symptoms, such as diarrhoea. Therefore, a rapid and accurate differential diagnosis method for use on mink ranches is essential for the control of these three pathogens. Here, we developed multiplex one-step real-time quantitative PCR (RT‒qPCR) assays for the simultaneous detection and quantification of AMDV, MEV and CDV by using three primers and probes based on the conserved NS1, VP2 and N genes, respectively. Results: The results showed that the established method was less likely to cross-react with other mink pathogens, with a detection sensitivity of 25 copies/μL and a coefficient of variation less than 3.51%. Moreover, the interference experiment showed that the presence of AMDV, MEV and CDV templates at different concentrations would not interfere with the detection results. Furthermore, two hundred clinical samples of mink with diarrhoea were simultaneously analysed using multiplex RT‒qPCR and single RT‒qPCR, the Kappa values were all greater than 0.921, indicating that there was a high degree of coincidence between the two detection methods. Conclusions: In conclusion, multiplex RT‒qPCR exhibited high specificity, sensitivity, and reproducibility, indicating that this method can be used as a reliable and specific tool for the differential detection and quantification of AMDV, MEV and CDV. AMDV MEV CDV multiplex RT‒qPCR differential detection Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Aleutian mink disease (AMD), caused by Aleutian mink disease virus (AMDV), is reported in many mink-producing countries[ 1 ]. AMDV belongs to the genus Amdoparvovirus within the family Parvoviridae , and its single-stranded DNA genome encodes two structural proteins (VP1 and VP2) and three nonstructural proteins (NS1, NS2 and NS3)[ 2 , 3 ]. Because of the special pathogenic infection mechanism of AMD, there is currently no commercial vaccine or treatment for AMDV[ 4 ]. Thus, a relatively successful control strategy is to screen infected animals by a highly sensitive qPCR method and culling them. Mink viral enteritis, caused by Mink enteritis virus (MEV), is an acute and highly infectious disease whose symptoms include violent diarrhoea. MEV belongs to the genus Parvovirus within the family Parvoviridae . Its single-stranded DNA genome encodes two nonstructural proteins (NS1 and NS2) and the capsid proteins VP1 and VP2. The molecular diagnosis of MEV is an important measure for disease control[ 5 – 7 ]. Among them, nanoparticle-assisted PCR and loop-mediated isothermal amplification (LAMP) have been widely used for the detection of MEV through amplification of the highly conserved NS1 and VP2 genes[ 8 ]. Additionally, real-time PCR has not been used to detect MEV, but it has been used to detect other parvoviruses[ 9 – 11 ]. Canine distemper (CD) is caused by canine distemper virus (CDV), which can cause high mortality on mink farms with clinical symptoms, including conjunctivitis, diarrhoea, encephalitis, and so on[ 12 ]. CDV belongs to the genus Morbillivirus within the family Paramyxoviridae and is an enveloped negative-strand RNA genome that encodes six structural and two nonstructural proteins. There is no specific therapeutic drug for mink CD, and the best prevention method is vaccination[ 8 ]. However, immunization failure leads to an increase in the incidence of infection in immune mink. Therefore, highly sensitive and rapid detection methods are highly important for targeted control of the epidemic and spread of CD. The multiplex real-time quantitative PCR (RT‒qPCR) method has the characteristics of high specificity, high sensitivity, and high throughput and has been widely used in the diagnosis of clinical mixed infection diseases, the differentiation of different serotypes of bacteria, the identification of different virus strains, etc[ 13 – 16 ]. At present, there is no relevant literature on multiple RT‒qPCR methods for simultaneous differential detection of AMDV, MEV and CDV. Herein, specific primers and fluorescent probes were designed for the specific genes of AMDV, MEV and CDV, and multiple RT‒qPCR methods for the simultaneous identification and detection of AMDV, MEV and CDV were established; these methods provide specific, efficient, and sensitive technical means for the detection and epidemiological investigation of three important diseases in mink breeding. Results The best reaction sets The optimal reaction conditions for the different concentrations of primers and probes are shown in Fig. 2. The primer concentration and probe concentration (0.5 μM and 0.4 μM, respectively) were determined to be the optimal RT‒qPCR concentrations according to the low Ct value. Therefore, RT‒qPCR was carried out in a 25 μL reaction mixture consisting of 12.5 μL of RT‒qPCR 5G Premix, 0.5 μL of primer pair and 0.4 μL of probe containing the corresponding target fragment, 1.0 μL of the target recombinant plasmid or sample nucleic acid, and ddH 2 O. 3.2 Establishment of the standard curve for multiple RT‒qPCR Tenfold-diluted standard plasmids were prepared from 2.5 × 10 7 to 2.5 × 10 1 copies/μL and mixed with equal volumes to carry out multiple RT‒qPCRs and establish standard curves following the best reaction sets. The results showed that the Ct values and copy numbers of the standard recombinant plasmids (over the range of 2.5×10 7 copies/μL ~ 2.5×10 1 copies/μL) exhibited good linear relationships with correlation coefficients (R 2 s) of 0.9980 and Y = -3.0832X+39.886 for AMDV; R 2 s of 0.9981 and Y=-3.1852X+38.629 for MEV; and R 2 s of 0.9982 and Y=-3.2080X+40.352 for CDV (Figure 3). Specificity of the multiple RT‒qPCR method We tested the specificity of the multiple RT‒qPCR assays using three positive standard plasmids, genomic RNA from CCoV and CPIV, and DNA from PRV and CPV. All three assays amplified only AMDV, MEV and CDV without cross-reaction with any of the other viruses, indicating satisfactory specificity of the established multiple RT‒qPCR methods (Figure 4). Sensitivity of the multiple RT‒qPCR method The limit of detection (LOD) of the multiple RT‒qPCR assay was determined using equal volume mixtures of tenfold-diluted serially diluted standard plasmids of AMDV, MEV and CDV. The results showed that the LODs of the multiple RT‒qPCR assays were 25 copies/μL, 25 copies/μL and 25 copies/μL for AMDV, MEV and CDV, respectively (Figure 5). Hence, the multiple RT‒qPCR assay was found to be sensitive. Reproducibility of the multiple RT‒qPCR method The intrabatch repeatability test and the interbatch repeatability test were performed using a mixture of three positive standard plasmids at final concentrations of 7.5×10 7 copies/μL, 7.5×10 5 copies/μL and 7.5×10 3 copies/μL by multiple RT‒qPCR. The results showed that the reproducibility was excellent, and the intrabatch coefficient of variation (CV, 0.1%~3.37%) and interbatch coefficient of variation (CV, 1.3%~3.51%) were less than 4% (Table 2). Anti-interference experiment The results of the anti-interference assays showed that amplification curves and Ct values could be detected invariably with a random combination of the three standard plasmids, which indicated that multiple RT‒qPCRs could not contribute to the titres of AMDV, MEV or CDV (Figure 6). Performance of multiple RT‒qPCR methods for clinical samples compared with the single highly sensitive detection methods for AMDV, MEV and CDV To evaluate the practical performance of the established multiple RT‒qPCR methods, 200 faecal samples were analysed, and the results were compared with those of single highly sensitive detection methods for AMDV, MEV and CDV. Using multiple RT‒qPCR, the detection rates of single pathogens AMDV, MEV and CDV were 9%, 11.5% and 3%, respectively. Similarly, the detection rates of mixed infections of AMDV+CDV, AMDV+MEV, CDV+MEV, and CDV+MEV+AMDV were 1.5%, 6%, 3.5% and 2%, respectively. When using the single high-sensitivity detection method, the detection rates of the single pathogens AMDV, MEV and CDV in the sample were 8.5%, 10% and 3%, respectively. Similarly, the detection rates of mixed infections of AMDV+CDV, AMDV+MEV, CDV+MEV, and CDV+MEV+AMDV were 1.5%, 5.5%, 3% and 2%, respectively. Overall, the DSe values determined via multiple RT‒qPCR for the single or mixed pathogens tested varied from 85.7% to 100%, the DSp values varied from 100%, and the kappa values varied from 0.921 to 1.00 (Table 3). The results indicated that multiple RT‒qPCRs were more effective than single highly sensitive detection methods for AMDV, MEV and CDV. Discussion The infectious diseases AD and CD and Mink viral enteritis lead to high morbidity and mortality, causing enormous economic losses in the mink farming industry[ 4 , 17 , 18 ]. According to the results of clinical sample detection, an increasing tendency towards mixed infection caused by AMDV, MEV and CDV was found, suggesting that a detection method capable of detecting and distinguishing AMDV, MEV and CDV simultaneously is a prerequisite for the epidemiological investigation of mink infections. The multiplex real-time PCR (qPCR) method decreases detection costs, enhances efficiency and enhances accuracy, and these advantages give qPCR a primary position in disease screening and clinical settings[ 19 – 21 ]. The practical use of Taq Man qPCR has predominated for AMDV- and CDV-infected clinical samples. The limits of detection (LODs) of Taq Man qPCR for the AMDV-NS1 gene and CDV-N gene are 20 copies/µL and 100 copies/µL, respectively, and both are regarded as reference methods in this paper[ 22 , 23 ]. Taq Man qPCR targeting the MEV-VP2 gene has not been reported previously; therefore, the use of the nanoPCR method, which has an LOD of 87.5 copies/µL and was described by Wang, is the reference method. However, multiplex Taq Man qPCR methods capable of detecting AMDV, CDV and MEV simultaneously are rare. Considering the description above, we established a one-step multiplex Taq Man qPCR with an LOD of 2.5×10 1 copies/µL to detect AMDV, CDV and MEV in a single reaction system. Lower sensitivity was not achieved, which may be due to the reduced sensitivity of the multiplex fluorescence quantification method itself. Our results showed that the standard curves of AMDV, CDV and MEV had slopes of -3.208, -3.082 and − 3.1852, respectively, and R2 values of 0.9982, 0.9980 and 0.9981, respectively. No cross-reaction signals were observed for other usual pathogens of mink, with 100% specificity. In addition, stability is also a considerable index for evaluating an emerging detection assay. In our research, repeatability was measured with a CV of less than 4%, indicating that ideal repeatability was achieved. These results suggested that the one-step Taq Man qPCR assay could be a potential and reliable platform in clinical mixed infection settings. To further assess the performance of this multiplex Taq Man qPCR method, we collected 200 faecal samples and analysed the infection status of the samples; 4 mixed infection samples were detected. Similarly, single-time qPCR also detected 4 samples infected by AMDV, CDV and MEV, which is in perfect agreement with the results of single-time Taq Man qPCR. Judging from the test results, the detection rate of AMD is more than 50%, which is also being verified with clinical practice, indicating that the actual clinical infection rate of ADMV has remained high. Additionally, some “negative” samples identified by PCR were “positive” according to established one-step Taq Man qPCR, which indicated that one-step Taq Man qPCR showed better sensitivity than conventional PCR and effectively avoided misdiagnosis, especially for mixed infection samples. One potential reason underlying this observation is that one-step Taq Man qPCR can detect copies of viruses in samples via digitized results to detect false-negative negatives. Moreover, we propose a protocol for point-of-care tests on farms that includes qPCR equipment and a kit consisting of collection tubes with lysis buffer, reaction tubes with premixed solution, primers and probes for AMDV, CDV and MEV, reverse transcription enzymes and sampling swabs. In the protocol, a pipettor and centrifuge are not needed, and personnel who are poor in professionally performing the tests are also needed. DNA extraction was unnecessary, the collected samples were added to tubes using swabs, and the results were one-click derivated or printed. The test procedure is as follows: 1. The anal swabs were collected and soaked in collecting tubes for 3 min at room temperature; 2. A drop of sample solution and reaction solution were added to the reaction tubes; 3. qPCR was conducted for approximately 1 hour (Fig. 1 B). Compared to the POCT kit for CDV developed by Brown, our protocol is more convenient and easier to use[ 3 ]. Conclusions In conclusion, we established a one-step multiplex qPCR assay to detect and differentiate AMDV, CDV and MEV in a single system. The advantages of the newly developed one-step multiplex qPCR assay, that is, in terms of analytical sensitivity and specificity, support the attractive applications of this method as a reliable tool for the rapid detection of common viruses and diagnosis of this disease in mink. Materials and methods Samples, primers and probes MEV and CDV were purchased from Jilin Teyan Biotechnology Co., Ltd. The nucleic acids AMDV, canine parvovirus (CPV), pseudorabies virus (PRV), canine coronavirus (CCoV) and canine parainfluenza virus (CPIV) were preserved by the Preventive Veterinary Laboratory of Qingdao Agricultural University. Two hundred suspected samples were collected from mink herds in Shandong Province. The conserved region sequences of the NS1 gene in AMDV (KU513985.1), the VP2 gene in MEV (KT899745.1) and the N gene in CDV (HM063009.1) were retrieved from GenBank. The primers and probes used were designed with Primer Explorer V5 to amplify fragments of approximately 119 bp, 190 bp and 202 bp, and the probe characteristics of AMDV, MEV and CDV included the following reporter dyes: HEX, FAM, and ROX; and the BHQ1, BHQ1, and BHQ2 quenchers. The primers and probes used were synthesized by Shanghai Personal Biotechnology Co., Ltd. (China), and the oligonucleotide sequences of the primers and probes are shown in Table 1. Viral DNA/RNA extraction Total DNA and RNA were extracted from faecal samples and from MEV and CDV vaccines using a FastPure® Viral DNA/RNA Mini Kit (Vazyme, China) according to the manufacturer’s instructions. The extracted DNA/RNA samples were used as templates in the RT‒qPCR assays. Construction of recombinant plasmids The DNA of AMDV and MEV and the RNA of CDV were used as templates. Using primers for AMDV-AF/AR, MEV-MF/MR, and CDV-CF/CR, the genes of the corresponding viruses were amplified via PCR and subsequently cloned and inserted into the pEASY-T1 vector (TransGen Biotech, Beijing, China) (Figure 1A). Sequencing was carried out by Shanghai Personal Biotechnology Co., Ltd., to support correct construction, and the recombinant plasmids used were named pAMDV-NS1, pMEV-VP2 and pCDV-N. The concentrations of the recombinant plasmids were measured according to the following formula. Then, tenfold-diluted recombinant plasmids were prepared from 2.5 × 10 7 to 2.5 × 10 1 for RT‒qPCR. Standard curves were drawn to determine the reliability of the diluted recombinant plasmids. Optimization of the RT‒qPCR system The recombinant plasmids were subjected to RT‒qPCR to determine the optimal concentrations of the primers (0.2 μM, 0.5 μM, and 0.8 μM) and probes (0.2 μM, 0.25 μM, and 0.4 μM), which were determined via orthogonal tests according to Ct values and amplification efficacy. Amplification was carried out with a QuantStudio 5 (Thermo Fisher Scientific, United States) instrument with the following reaction conditions: 37 °C for 30 s for initial denaturation, 40 cycles of denaturation at 95 °C for 120 s and 95 °C for 10 s, and annealing at 60 °C for 30 s. Establishment of standard curves Three recombinant plasmids were tenfold-diluted (10 -1 ~ 10 -7 copies/µL) and mixed equally as templates for RT–qPCR, in which ddH 2 O was used as a negative control. Standard curves were established according to the Ct values and dilutions. Specificity assay The specificity for multiple RT‒qPCR assays was evaluated using three mixed recombinant plasmids as a positive control and other DNAs (PRV and CPV) and RNAs (CCoV and CPIV). Three independent experiments were performed for each sample, and ddH 2 O served as the negative control. Sensitivity assay The sensitivity of the multiple RT‒qPCR assays was evaluated. The recombinant plasmids of AMDV, MEV and CDV were diluted from 2.5 × 10 8 to 2.5 × 10 1 and mixed with an equal volume. Three independent experiments were performed for each sample, and ddH 2 O served as the negative control. Reproducibility assay The three recombinant plasmids (pAMDV-NS1, pMEV-VP2 and pCDV-N) were diluted, and three different concentrations were selected for use in reproducibility assays (2.5×10 7 , 2.5×10 5 , and 2.5×10 3 copies/µL). Each concentration was tested 3 times, and a one-time qPCR assay was conducted to determine the intrabatch repeatability by comparing the standard deviation (SD) and the coefficient of variation (CV). Three qPCR assays using three diluted standard plasmids were conducted to test interbatch repeatability by comparing the SD and the CV. Anti-interference assay and clinical sample detection To confirm whether the original concentrations of standard plasmids can affect the performance of multiple RT‒qPCRs, an anti-interference assay was designed. Briefly, three standard plasmids at different concentrations (10 8 and 10 3 copies/µL) were combined randomly, and multiple RT‒qPCR and single RT‒qPCR were conducted for AMDV, MEV and CDV. The diagnostic performance of multiple RT‒qPCRs was assessed by collecting and testing 200 facial samples suspected to suffer from diarrhoea from mink herds in Shandong Province, China. Moreover, retesting was performed using the highly sensitive detection method for AMDV, MEV and CDV, as previously reported. The feasibility of multiple RT‒qPCR methods was evaluated by measuring the diagnostic specificity (DSp), diagnostic sensitivity (DSe) and degree of agreement with the highly sensitive detection methods used for AMDV, MEV and CDV. Statistical analysis The calculation of DSe and DSp between the two methods was based on the following formula. DSe = TP/(TP + FN) and DSp = TN/(TN + FP), where TP means true-positive cases, FN means false-negative cases, TN means true-negative cases, and FP means false-positive cases. Precision was evaluated by obtaining the mean time-to-detection values and standard deviations (SDs) of each set of replicates at a given concentration and calculating the coefficients of variation (CVs) (SD/mean). Declarations Author contributions Z.C. and J.W. designed the experiments; Z.C., H.X. and X.Z. performed the experiments; Z.C., H.X., X.Z., K.Z., D.Y., S.M., W.L., S.L., J.R., and J.W. contributed reagents/materials/analysis tools; Z.C., H.X., and J.W. analyzed the data; Z.C. and J.W. wrote the paper. All authors read and approved the final manuscript. Funding This study was supported by the Shandong Modern Agricultural Technology & Industry System (SDAIT-21-13), and the Research Foundation for Distinguished Scholars of Qingdao Agricultural University (1120018). Availability of data and materials The datasets supporting the conclusions of this article are included within the article. Ethics approval All experiments received approval and were supervised by the Research Ethics Committee of Qingdao Agricultural University. All methods were performed in accordance with the relevant guidelines and regulations. Informed consent Not applicable. Consent to participate Not applicable. Consent for publication Not applicable. Declaration of competing interest The authors declare no conflict of interest. References Vahedi SM, Ardestani SS, Banabazi MH, Clark F. Epidemiology, pathogenesis, and diagnosis of Aleutian disease caused by Aleutian mink disease virus: A literature review with a perspective of genomic breeding for disease control in American mink (Neogale vison). Virus Res. 2023;336:14. Ryt-Hansen P, Hjulsager CK, Hagberg EE, Chriél M, Struve T, Pedersen AG, Larsen LE. Outbreak tracking of Aleutian mink disease virus (AMDV) using partial NS1 gene sequencing. Virol J. 2017;14:9. Brown AT, McAloose D, Calle PP, Auer A, Posautz A, Slavinski S, Brennan R, Walzer C, Seimon TA. Development and validation of a portable, point-of-care canine distemper virus qPCR test. PLoS ONE. 2020;15(4):22. Markarian NM, Abrahamyan L. AMDV Vaccine: Challenges and Perspectives. Viruses-Basel. 2021;13(9):19. Yang SS, Wang JG, Li ZD, Cui SJ, Liu WQ. The 5′ Untranslated Region of the Capsid Protein 2 Gene of Mink Enteritis Virus Is Essential for Its Expression. J Virol. 2018;92(18):20. Lin P, Wang JK, Song SS, Cheng YN, Yi L, Cheng SP, Wang ZJ. Development of an Immunochromatographic Strip for Rapid Detection of Mink Enteritis Virus. Front Microbiol. 2022;13:8. Qianqian Xie 1 JW. Ying Liu 1, Jun Su 1, Chenchen Gu 1, Jing Wu 1, Jun Xiao 2, Weiquan Liu 3: Transcriptional activation of Mink enteritis virus VP2 by the C-terminal of its NS1 protein %J Virus genes. 2023(No.1):100–8. Wang JK, Cheng YN, Zhang M, Zhao H, Lin P, Yi L, Tong MW, Cheng SP. Development of a nanoparticle-assisted PCR (nanoPCR) assay for detection of mink enteritis virus (MEV) and genetic characterization of the NS1 gene in four Chinese MEV strains. BMC Vet Res. 2015;11:8. Gava D, Souza CK, Schaefer R, Vincent AL, Cantao ME, Coldebella A, Ciacci-Zanella JR. A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. J Virol Methods. 2015;219:14–7. Nuñez LF, Santander-Parra SH, Chaible L, De la Torre DI, Buim MR, Murakami A, Dagli MLZ, Astolfi-Ferreira CS, Ferreira AJP. Development of a Sensitive Real-Time Fast-qPCR Based on SYBR ® Green for Detection and Quantification of Chicken Parvovirus (ChPV). Vet Sci. 2018;5(3):13. Iwantschenko AK, Roegener F, Garrels W, Dorsch M, Köhl W, Riehle C, Ghyselinck N, Féret B, Zschemisch NH, Bleich A, et al. Why serology just is not enough: Strategic parvovirus risk assessment using a novel qPCR assay. Lab Anim. 2022;56(4):380–95. da Costa VG, Saivish MV, Rodrigues RL, Silva RFD, Moreli ML, Krüger RH. Molecular and serological surveys of canine distemper virus: A meta-analysis of cross-sectional studies. PLoS ONE. 2019;14(5):19. Hawkins SFC, Guest PC. Multiplex Analyses Using Real-Time Quantitative PCR. Methods in molecular biology (Clifton, NJ) 2017, 1546:125–133. Sule WF, Oluwayelu DO. Real-time RT-PCR for COVID-19 diagnosis: challenges and prospects. Pan Afr Med J. 2020;35(Suppl 2):121. Artika IM, Dewi YP, Nainggolan IM, Siregar JE, Antonjaya U. Real-Time Polymerase Chain Reaction: Current Techniques, Applications, and Role in COVID-19 Diagnosis. Genes. 2022;13(12):21. Liu W, Lin Y, Jiang J, Zhang J, Liu Q, Hu Q. Development of a 1-step TaqMan real-time PCR method for detection of the Bovine Group A Rotavirus. Diagn Microbiol Infect Dis. 2023;107(4):116081. Jensen VF, Stockmarr A, Fertner M, Clausen J, Chríel M. Effects of health related farm-level factors on skin size and quality in commercial mink (Neovison vison) production. Prev Vet Med. 2021;192:11. Karki M, Rajak KK, Singh RP. Canine morbillivirus (CDV): a review on current status, emergence and the diagnostics. Virusdisease. 2022;33(3):309–21. Teymouri M, Mollazadeh S, Mortazavi H, Ghale-Noie ZN, Keyvani V, Aghababaei F, Hamblin MR, Abbaszadeh-Goudarzi G, Pourghadamyari H, Hashemian SMR, et al. Recent advances and challenges of RT-PCR tests for the diagnosis of COVID-19. Pathol Res Pract. 2021;221:8. Yu J, Zou J, Liu X, Pan Y, Mu Y, Li S, Wang J, Xu F, Wang Y. TaqMan-probe-based multiplex real-time RT-qPCR for simultaneous detection of GoAstV, GPV, and GoCV. Poult Sci. 2023;102(2):102396. Goto Y, Fukunari K, Suzuki T. Multiplex RT-qPCR Application in Early Detection of Bovine Respiratory Disease in Healthy Calves. Viruses-Basel. 2023;15(3):18. Elia G, Decaro N, Martella V, Cirone F, Lucente MS, Lorusso E, Di Trani L, Buonavoglia C. Detection of canine distemper virus in dogs by real-time RT-PCR. J Virol Methods. 2006;136(1–2):171–6. Virtanen J, Aaltonen K, Vapalahti O, Sironen T. Development and validation of nucleic acid tests to diagnose Aleutian mink disease virus. J Virol Methods. 2020;279:6. Tables Table 1 Primers and probes. Target virus Name Gene Length (bp) Sequence (5′-3′) MEV QF VP2 190 AACACCTATTGCAGCAGGACG QR GTTTCTCCTGTTGTGGTAGTTTTTT Probe FAM-ATCCAAGATATGCATTTGGTAGACA-BHQ1 CDV QF N 202 AAATCAACGGACCTAAATTAACTGG QR TCATCTGCCTCAGAATCCAAAC Probe ROX-ACTCTGTTTGTGGTCTTACATTTGC-BHQ2 AMDV QF NS1 119 CTTACAAATACCATCACAAACAAACC QR ACCATCCATACCTTCCTCAGTTATC Probe HEX-GCAGTAGACATGCGTGATTATACAT-BHQ1 Table 2. Multiplex Taq Man PCR Repeatability Tests for RT‒PCR Plasmid (copies/μL) Concentration Intra-assay Ct value Interassay Ct value average value x̅ standard deviation SD Coefficient CV% average value x̅ standard deviation SD Coefficient CV% pMEV-VP2 7.5×10 7 14.73 0.01 0.10 14.81 0.31 2.00 7.5×10 5 22.53 0.10 0.43 22.81 0.49 2.16 7.5×10 3 29.30 0.29 0.99 29.67 0.70 2.37 pCDV-N 7.5×10 7 15.44 0.47 3.06 15.21 0.39 2.5 7.5×10 5 22.50 0.23 1.03 22.12 0.50 2.3 7.5×10 3 29.20 0.57 1.95 29.04 0.38 1.3 pAMDV-NS1 7.5×10 7 16.04 0.54 3.37 16.09 0.56 3.51 7.5×10 5 23.30 0.69 2.94 23.06 0.60 2.60 7.5×10 3 29.63 0.80 2.70 29.80 0.69 2.31 Table 3. Comparison of the samples tested by multiple RT‒qPCR and the single highly sensitive detection methods for AMDV, MEV and CDV. Assays Pathogen Results The single highly sensitive detection method Performance Characteristics(%) Kappa P N Total DSe DSp Multiple RT‒qPCR AMDV P 99 3 102 97.1 100 0.970 N 0 98 98 MEV P 20 3 23 86.9 100 0.922 N 0 177 177 CDV P 6 0 6 100 100 1 N 0 194 194 AMDV + CDV P 3 0 3 100 100 1 N 0 197 197 AMDV + MEV P 11 1 12 91.6 100 0.954 N 0 188 188 MEV + CDV P 6 1 7 85.7 100 0.921 N 0 193 193 AMDV + CDV +MEV P 4 0 4 100 100 1 N 0 196 196 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 14 Jan, 2025 Read the published version in BMC Veterinary Research → Version 1 posted Editorial decision: Revision requested 30 May, 2024 Submission checks completed at journal 19 May, 2024 Editor assigned by journal 19 May, 2024 First submitted to journal 09 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4393868","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":307550761,"identity":"fab0cd22-100d-4520-9a0c-62c58fb71446","order_by":0,"name":"Zhi Cao","email":"","orcid":"","institution":"College of Veterinary Medicine, Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Zhi","middleName":"","lastName":"Cao","suffix":""},{"id":307550762,"identity":"e0832504-3ce9-48f4-a20b-aa7513923ccd","order_by":1,"name":"Hang Xu","email":"","orcid":"","institution":"College of Veterinary Medicine, Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hang","middleName":"","lastName":"Xu","suffix":""},{"id":307550763,"identity":"d3c34bb3-e2c5-4d07-869b-8359054b7ffe","order_by":2,"name":"Xinru Zhao","email":"","orcid":"","institution":"College of Veterinary Medicine, Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xinru","middleName":"","lastName":"Zhao","suffix":""},{"id":307550764,"identity":"0ec3a685-7313-4d2f-8f2b-beded06f466a","order_by":3,"name":"Ke Zhang","email":"","orcid":"","institution":"College of Veterinary Medicine, Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ke","middleName":"","lastName":"Zhang","suffix":""},{"id":307550765,"identity":"febfbfed-1082-4626-a0b1-999934f79dfb","order_by":4,"name":"Dehua Yin","email":"","orcid":"","institution":"College of Veterinary Medicine, Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Dehua","middleName":"","lastName":"Yin","suffix":""},{"id":307550766,"identity":"8de14187-6f28-46cf-8344-6d038ea737b7","order_by":5,"name":"Shuai Ma","email":"","orcid":"","institution":"Qingdao Animal Disease Prevention and Control Center","correspondingAuthor":false,"prefix":"","firstName":"Shuai","middleName":"","lastName":"Ma","suffix":""},{"id":307550767,"identity":"d1796431-e59b-4bee-863c-86facbf6f083","order_by":6,"name":"Wenling Li","email":"","orcid":"","institution":"College of Veterinary Medicine, Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Wenling","middleName":"","lastName":"Li","suffix":""},{"id":307550768,"identity":"b9c6a5c8-9667-4438-b7e9-342114d10162","order_by":7,"name":"Siyu Li","email":"","orcid":"","institution":"College of Veterinary Medicine, Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Siyu","middleName":"","lastName":"Li","suffix":""},{"id":307550769,"identity":"5fa83f8b-5c9c-4ae0-a44c-9629849dea23","order_by":8,"name":"Jianwei Ren","email":"","orcid":"","institution":"College of Veterinary Medicine, Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jianwei","middleName":"","lastName":"Ren","suffix":""},{"id":307550770,"identity":"3fb76cf4-e689-4ce8-b035-861b43c74d55","order_by":9,"name":"Jianxin Wen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYJACgwQgwcbAfODAhwrStLAlHpxxhjTLeIwP87YQY8Px3gMFD2ruJPZJ93w4wNvAIM8vdoCAljPnEgwSjj0zZpM5u+GA5A4Gw5mzE/BrMbuRY2CQwHZYjk0id8MBwzMMCQa3CWm5/wao5d9hHjaJnAcHEtuI0XKDx8AgsQ1kSw7DgYPEaLE/A3RYYt9hYzaJNIODDWckCPtFsv2MmeGPb4cT589Ifvz5T4WNPL80AS1AwGaAxJEgqBwEmB8QpWwUjIJRMApGLgAA/IJIrZOsHSYAAAAASUVORK5CYII=","orcid":"","institution":"College of Veterinary Medicine, Qingdao Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Jianxin","middleName":"","lastName":"Wen","suffix":""}],"badges":[],"createdAt":"2024-05-09 08:51:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4393868/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4393868/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12917-024-04349-5","type":"published","date":"2025-01-14T15:57:48+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":57390468,"identity":"32efd2ed-0781-4c11-942e-99c87a5b0acc","added_by":"auto","created_at":"2024-05-30 05:27:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3481829,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental flowchart. A: A multiplex, one-step RT‒qPCR assay was used to detect CDV, AMDV, and MEV simultaneously. B: A protocol for point-of-care testing of CDV, AMDV, and MEV.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4393868/v1/09e1aae0012f46d8a275f476.png"},{"id":57390767,"identity":"9ffe867e-6388-49bd-bc42-17c5399b95cc","added_by":"auto","created_at":"2024-05-30 05:35:35","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1697695,"visible":true,"origin":"","legend":"\u003cp\u003eOptimization results of primer probes. A: CDV, B: AEDM, C: MEV. The primer and probe concentrations from 1~9 were as follows: 0.2 μL, 0.1 μL; 0.5 μL, 0.1 μL; 0.2 μL, 0.25 μL; 0.5 μL, 0.25 μL; 0.8 μL, 0.25 μL; 0.2 μL, 0.4 μL; 0.5 μL, 0.4 μL; and 0.8 μL, 0.4 μL.4 μL.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4393868/v1/feb9c125f1c6831d68f4b42c.png"},{"id":57391048,"identity":"364cef0c-5ad4-4273-b5b7-d99e9d3c87b3","added_by":"auto","created_at":"2024-05-30 05:43:35","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2288065,"visible":true,"origin":"","legend":"\u003cp\u003eEstablishment of the standard curve for multiple RT‒qPCR. A: CDV, B: AEDM, C: MEV. 1~8: The concentrations of the mixed plasmids were 7.5×10\u003csup\u003e8\u003c/sup\u003e ~ 7.5×10\u003csup\u003e1\u003c/sup\u003e copies/μL. 9: Negative control.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4393868/v1/64bf662da802f452bf1986fd.png"},{"id":57390769,"identity":"71916e28-ee28-487d-ac4e-5afaceeb48ee","added_by":"auto","created_at":"2024-05-30 05:35:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2319020,"visible":true,"origin":"","legend":"\u003cp\u003eSpecificity of the multiple RT‒qPCR method. 1~8 are CDV, MEV, AMDV, PRV, CPV, CCoV, and the CPIV standard positive template, and 9 is the standard negative control template.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4393868/v1/91964bdba6c9d147b19fd2a3.png"},{"id":57390469,"identity":"133a0fa3-51de-4308-923d-9228aed878f2","added_by":"auto","created_at":"2024-05-30 05:27:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":4189246,"visible":true,"origin":"","legend":"\u003cp\u003eSensitivity of multiplex RT‒qPCR. 1~8: The concentrations were 7.5×10\u003csup\u003e8\u003c/sup\u003e ~ 7.5×10\u003csup\u003e1\u003c/sup\u003e copies/μL pCDV-N, respectively. 9~16: The concentration was 7.5×10\u003csup\u003e8\u003c/sup\u003e ~ 7.5×10\u003csup\u003e1\u003c/sup\u003e copies/μL of pMEV-VP2. 17~24: The concentrations were 7.5×10\u003csup\u003e8\u003c/sup\u003e ~ 7.5×10\u003csup\u003e1\u003c/sup\u003e copies/μL of pAMDV-NS1; 25: Negative control.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4393868/v1/0443a49805598b525df85373.png"},{"id":57390470,"identity":"85496f7f-aa8e-4bdd-b5f0-e2dda7557f97","added_by":"auto","created_at":"2024-05-30 05:27:36","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2693458,"visible":true,"origin":"","legend":"\u003cp\u003eAnti-interference experiment. A: The concentrations of pAMDV-NS1, pMEV-VP2, and pCDV-N were 10\u003csup\u003e8\u003c/sup\u003e copies/μL, 10\u003csup\u003e3\u003c/sup\u003e copies/μL, and 10\u003csup\u003e3\u003c/sup\u003e copies/μL, respectively. B: The concentrations of pAMDV-NS1, pMEV-VP2, and pCDV-N were 10\u003csup\u003e3\u003c/sup\u003e copies/μL, 10\u003csup\u003e8\u003c/sup\u003e copies/μL, and 10\u003csup\u003e3\u003c/sup\u003e copies/μL, respectively. C: The concentrations of pAMDV-NS1, pMEV-VP2 and pCDV-N were 10\u003csup\u003e8\u003c/sup\u003e copies/μL, 10\u003csup\u003e8\u003c/sup\u003e copies/μL and 10\u003csup\u003e3\u003c/sup\u003e copies/μL, respectively. D: The concentrations of pAMDV-NS1, pMEV-VP2 and pCDV-N were 10\u003csup\u003e8\u003c/sup\u003e copies/μL, 10\u003csup\u003e3\u003c/sup\u003e copies/μL and 10\u003csup\u003e8\u003c/sup\u003e copies/μL, respectively. E: The concentrations of pAMDV-NS1, pMEV-VP2, and pCDV-N were 10\u003csup\u003e3\u003c/sup\u003e copies/μL, 10\u003csup\u003e3\u003c/sup\u003e copies/μL, and 10\u003csup\u003e8\u003c/sup\u003e copies/μL, respectively. F: The concentrations of pAMDV-NS1, pMEV-VP2, and pCDV-N were 10\u003csup\u003e3\u003c/sup\u003e copies/μL, 10\u003csup\u003e8\u003c/sup\u003e copies/μL, and 10\u003csup\u003e8\u003c/sup\u003e copies/μL, respectively.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4393868/v1/eec7edeca3d7eabfc283ab22.png"},{"id":74284665,"identity":"a333ac74-f205-499f-96ef-c28adb577ce2","added_by":"auto","created_at":"2025-01-20 16:10:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":19478597,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4393868/v1/ad2e38ad-57a7-409d-8c65-55478e3921c1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Multiplex one-step RT‒qPCR assays for simultaneous detection of AMDV, MEV and CDV","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAleutian mink disease (AMD), caused by Aleutian mink disease virus (AMDV), is reported in many mink-producing countries[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. AMDV belongs to the genus \u003cem\u003eAmdoparvovirus\u003c/em\u003e within the family \u003cem\u003eParvoviridae\u003c/em\u003e, and its single-stranded DNA genome encodes two structural proteins (VP1 and VP2) and three nonstructural proteins (NS1, NS2 and NS3)[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Because of the special pathogenic infection mechanism of AMD, there is currently no commercial vaccine or treatment for AMDV[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Thus, a relatively successful control strategy is to screen infected animals by a highly sensitive qPCR method and culling them.\u003c/p\u003e \u003cp\u003eMink viral enteritis, caused by Mink enteritis virus (MEV), is an acute and highly infectious disease whose symptoms include violent diarrhoea. MEV belongs to the genus \u003cem\u003eParvovirus\u003c/em\u003e within the family \u003cem\u003eParvoviridae\u003c/em\u003e. Its single-stranded DNA genome encodes two nonstructural proteins (NS1 and NS2) and the capsid proteins VP1 and VP2. The molecular diagnosis of MEV is an important measure for disease control[\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Among them, nanoparticle-assisted PCR and loop-mediated isothermal amplification (LAMP) have been widely used for the detection of MEV through amplification of the highly conserved NS1 and VP2 genes[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Additionally, real-time PCR has not been used to detect MEV, but it has been used to detect other parvoviruses[\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCanine distemper (CD) is caused by canine distemper virus (CDV), which can cause high mortality on mink farms with clinical symptoms, including conjunctivitis, diarrhoea, encephalitis, and so on[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. CDV belongs to the genus \u003cem\u003eMorbillivirus\u003c/em\u003e within the family \u003cem\u003eParamyxoviridae\u003c/em\u003e and is an enveloped negative-strand RNA genome that encodes six structural and two nonstructural proteins. There is no specific therapeutic drug for mink CD, and the best prevention method is vaccination[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, immunization failure leads to an increase in the incidence of infection in immune mink. Therefore, highly sensitive and rapid detection methods are highly important for targeted control of the epidemic and spread of CD.\u003c/p\u003e \u003cp\u003eThe multiplex real-time quantitative PCR (RT‒qPCR) method has the characteristics of high specificity, high sensitivity, and high throughput and has been widely used in the diagnosis of clinical mixed infection diseases, the differentiation of different serotypes of bacteria, the identification of different virus strains, etc[\u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. At present, there is no relevant literature on multiple RT‒qPCR methods for simultaneous differential detection of AMDV, MEV and CDV. Herein, specific primers and fluorescent probes were designed for the specific genes of AMDV, MEV and CDV, and multiple RT‒qPCR methods for the simultaneous identification and detection of AMDV, MEV and CDV were established; these methods provide specific, efficient, and sensitive technical means for the detection and epidemiological investigation of three important diseases in mink breeding.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eThe best reaction sets\u003c/p\u003e\n\u003cp\u003eThe optimal reaction conditions for the different concentrations of primers and probes\u0026nbsp;are\u0026nbsp;shown in Fig. 2.\u0026nbsp;The primer concentration and probe concentration (0.5 \u0026mu;M\u0026nbsp;and 0.4 \u0026mu;M, respectively)\u0026nbsp;were determined\u0026nbsp;to\u0026nbsp;be the optimal\u0026nbsp;RT‒qPCR\u0026nbsp;concentrations according to\u0026nbsp;the\u0026nbsp;low Ct value. Therefore,\u0026nbsp;RT‒qPCR was\u0026nbsp;carried out in a 25 \u0026mu;L reaction mixture\u0026nbsp;consisting of 12.5 \u0026mu;L\u0026nbsp;of RT‒qPCR\u0026nbsp;5G Premix,\u0026nbsp;0.5 \u0026mu;L\u0026nbsp;of primer pair and 0.4 \u0026mu;L\u0026nbsp;of probe\u0026nbsp;containing the\u0026nbsp;corresponding target fragment,\u0026nbsp;1.0 \u0026mu;L\u0026nbsp;of the target recombinant plasmid or sample nucleic acid, and ddH\u003csub\u003e2\u003c/sub\u003eO.\u003c/p\u003e\n\u003cp\u003e3.2 Establishment of the standard curve for multiple\u0026nbsp;RT‒qPCR\u003c/p\u003e\n\u003cp\u003eTenfold-diluted standard plasmids were prepared from 2.5 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e to 2.5 \u0026times; 10\u003csup\u003e1\u003c/sup\u003e copies/\u0026mu;L and mixed with equal\u0026nbsp;volumes\u0026nbsp;to carry out multiple\u0026nbsp;RT‒qPCRs\u0026nbsp;and establish standard curves following the best reaction sets. The results showed that the Ct values and copy numbers of the standard recombinant\u0026nbsp;plasmids\u0026nbsp;(over the range of 2.5\u0026times;10\u003csup\u003e7\u003c/sup\u003e copies/\u0026mu;L ~ 2.5\u0026times;10\u003csup\u003e1\u003c/sup\u003e copies/\u0026mu;L)\u0026nbsp;exhibited\u0026nbsp;good\u0026nbsp;linear relationships\u0026nbsp;with correlation\u0026nbsp;coefficients (R\u003csup\u003e2\u003c/sup\u003es) of 0.9980 and Y = -3.0832X+39.886 for AMDV;\u0026nbsp;R\u003csup\u003e2\u003c/sup\u003es\u0026nbsp;of 0.9981 and Y=-3.1852X+38.629 for MEV; and\u0026nbsp;R\u003csup\u003e2\u003c/sup\u003es\u003csup\u003e\u0026nbsp;\u003c/sup\u003eof 0.9982 and Y=-3.2080X+40.352 for CDV (Figure 3).\u003c/p\u003e\n\u003cp\u003eSpecificity of the multiple\u0026nbsp;RT‒qPCR method\u003c/p\u003e\n\u003cp\u003eWe tested the specificity of the multiple\u0026nbsp;RT‒qPCR\u0026nbsp;assays using three positive standard plasmids, genomic\u0026nbsp;RNA from\u0026nbsp;CCoV and CPIV, and\u0026nbsp;DNA from\u0026nbsp;PRV and CPV. All three assays amplified\u0026nbsp;only AMDV, MEV and CDV\u0026nbsp;without\u0026nbsp;cross-reaction with any of the other viruses, indicating satisfactory specificity of the established multiple\u0026nbsp;RT‒qPCR methods\u0026nbsp;(Figure 4).\u003c/p\u003e\n\u003cp\u003eSensitivity of the multiple\u0026nbsp;RT‒qPCR method\u003c/p\u003e\n\u003cp\u003eThe limit of detection (LOD) of the multiple\u0026nbsp;RT‒qPCR\u0026nbsp;assay was determined using equal volume mixtures of tenfold-diluted serially\u0026nbsp;diluted standard plasmids of AMDV, MEV and CDV.\u0026nbsp;The results\u0026nbsp;showed\u0026nbsp;that the\u0026nbsp;LODs\u0026nbsp;of the multiple\u0026nbsp;RT‒qPCR assays were\u0026nbsp;25 copies/\u0026mu;L, 25 copies/\u0026mu;L and 25 copies/\u0026mu;L for AMDV, MEV and CDV, respectively (Figure\u0026nbsp;5). Hence, the multiple\u0026nbsp;RT‒qPCR\u0026nbsp;assay was found to be sensitive.\u003c/p\u003e\n\u003cp\u003eReproducibility of the multiple\u0026nbsp;RT‒qPCR method\u003c/p\u003e\n\u003cp\u003eThe intrabatch repeatability test and the interbatch repeatability test were\u0026nbsp;performed\u0026nbsp;using\u0026nbsp;a\u0026nbsp;mixture of three positive standard plasmids\u0026nbsp;at\u0026nbsp;final concentrations of 7.5\u0026times;10\u003csup\u003e7\u003c/sup\u003e copies/\u0026mu;L, 7.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e copies/\u0026mu;L and 7.5\u0026times;10\u003csup\u003e3\u003c/sup\u003e copies/\u0026mu;L by multiple\u0026nbsp;RT‒qPCR. The results showed that the reproducibility was excellent, and the intrabatch coefficient of variation (CV, 0.1%~3.37%) and interbatch coefficient of variation (CV, 1.3%~3.51%) were less than 4% (Table 2).\u003c/p\u003e\n\u003cp\u003eAnti-interference experiment\u003c/p\u003e\n\u003cp\u003eThe results of the\u0026nbsp;anti-interference assays showed that amplification curves and Ct values\u0026nbsp;could\u0026nbsp;be detected invariably with a random combination of\u0026nbsp;the three standard plasmids, which indicated that multiple\u0026nbsp;RT‒qPCRs could\u0026nbsp;not\u0026nbsp;contribute to the\u0026nbsp;titres of AMDV, MEV\u0026nbsp;or\u0026nbsp;CDV (Figure 6).\u003c/p\u003e\n\u003cp\u003ePerformance of multiple\u0026nbsp;RT‒qPCR methods\u0026nbsp;for clinical samples compared with the single highly sensitive detection\u0026nbsp;methods for\u0026nbsp;AMDV, MEV and CDV\u003c/p\u003e\n\u003cp\u003eTo evaluate the practical performance of\u0026nbsp;the established multiple\u0026nbsp;RT‒qPCR methods, 200 faecal samples were\u0026nbsp;analysed, and the results were\u0026nbsp;compared with\u0026nbsp;those of\u0026nbsp;single highly sensitive detection\u0026nbsp;methods for\u0026nbsp;AMDV, MEV and CDV.\u003c/p\u003e\n\u003cp\u003eUsing multiple\u0026nbsp;RT‒qPCR, the detection rates of single\u0026nbsp;pathogens\u0026nbsp;AMDV, MEV and CDV were 9%, 11.5% and 3%,\u0026nbsp;respectively. Similarly, the\u0026nbsp;detection rates of mixed\u0026nbsp;infections\u0026nbsp;of AMDV+CDV, AMDV+MEV, CDV+MEV,\u0026nbsp;and CDV+MEV+AMDV were 1.5%, 6%, 3.5% and 2%,\u0026nbsp;respectively.\u0026nbsp;When\u0026nbsp;using the single high-sensitivity detection method, the detection rates of\u0026nbsp;the single\u0026nbsp;pathogens\u0026nbsp;AMDV, MEV and CDV in the sample\u0026nbsp;were\u0026nbsp;8.5%, 10% and 3%,\u0026nbsp;respectively. Similarly, the\u0026nbsp;detection rates of mixed\u0026nbsp;infections\u0026nbsp;of AMDV+CDV, AMDV+MEV, CDV+MEV,\u0026nbsp;and CDV+MEV+AMDV were 1.5%, 5.5%, 3% and 2%,\u0026nbsp;respectively.\u003c/p\u003e\n\u003cp\u003eOverall, the DSe values determined via multiple RT‒qPCR for the single or mixed pathogens tested varied from 85.7% to 100%, the DSp values varied from 100%, and the kappa values varied from 0.921 to 1.00 (Table 3). The results indicated that multiple RT‒qPCRs were more effective than single highly sensitive detection methods for AMDV, MEV and CDV.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe infectious diseases AD and CD and Mink viral enteritis lead to high morbidity and mortality, causing enormous economic losses in the mink farming industry[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. According to the results of clinical sample detection, an increasing tendency towards mixed infection caused by AMDV, MEV and CDV was found, suggesting that a detection method capable of detecting and distinguishing AMDV, MEV and CDV simultaneously is a prerequisite for the epidemiological investigation of mink infections. The multiplex real-time PCR (qPCR) method decreases detection costs, enhances efficiency and enhances accuracy, and these advantages give qPCR a primary position in disease screening and clinical settings[\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe practical use of \u003cem\u003eTaq\u003c/em\u003eMan qPCR has predominated for AMDV- and CDV-infected clinical samples. The limits of detection (LODs) of \u003cem\u003eTaq\u003c/em\u003eMan qPCR for the AMDV-NS1 gene and CDV-N gene are 20 copies/\u0026micro;L and 100 copies/\u0026micro;L, respectively, and both are regarded as reference methods in this paper[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. \u003cem\u003eTaq\u003c/em\u003eMan qPCR targeting the MEV-VP2 gene has not been reported previously; therefore, the use of the nanoPCR method, which has an LOD of 87.5 copies/\u0026micro;L and was described by Wang, is the reference method. However, multiplex \u003cem\u003eTaq\u003c/em\u003eMan qPCR methods capable of detecting AMDV, CDV and MEV simultaneously are rare. Considering the description above, we established a one-step multiplex \u003cem\u003eTaq\u003c/em\u003eMan qPCR with an LOD of 2.5\u0026times;10\u003csup\u003e1\u003c/sup\u003e copies/\u0026micro;L to detect AMDV, CDV and MEV in a single reaction system. Lower sensitivity was not achieved, which may be due to the reduced sensitivity of the multiplex fluorescence quantification method itself. Our results showed that the standard curves of AMDV, CDV and MEV had slopes of -3.208, -3.082 and \u0026minus;\u0026thinsp;3.1852, respectively, and R2 values of 0.9982, 0.9980 and 0.9981, respectively. No cross-reaction signals were observed for other usual pathogens of mink, with 100% specificity. In addition, stability is also a considerable index for evaluating an emerging detection assay. In our research, repeatability was measured with a CV of less than 4%, indicating that ideal repeatability was achieved. These results suggested that the one-step \u003cem\u003eTaq\u003c/em\u003eMan qPCR assay could be a potential and reliable platform in clinical mixed infection settings.\u003c/p\u003e \u003cp\u003eTo further assess the performance of this multiplex \u003cem\u003eTaq\u003c/em\u003eMan qPCR method, we collected 200 faecal samples and analysed the infection status of the samples; 4 mixed infection samples were detected. Similarly, single-time qPCR also detected 4 samples infected by AMDV, CDV and MEV, which is in perfect agreement with the results of single-time \u003cem\u003eTaq\u003c/em\u003eMan qPCR. Judging from the test results, the detection rate of AMD is more than 50%, which is also being verified with clinical practice, indicating that the actual clinical infection rate of ADMV has remained high. Additionally, some \u0026ldquo;negative\u0026rdquo; samples identified by PCR were \u0026ldquo;positive\u0026rdquo; according to established one-step \u003cem\u003eTaq\u003c/em\u003eMan qPCR, which indicated that one-step \u003cem\u003eTaq\u003c/em\u003eMan qPCR showed better sensitivity than conventional PCR and effectively avoided misdiagnosis, especially for mixed infection samples. One potential reason underlying this observation is that one-step \u003cem\u003eTaq\u003c/em\u003eMan qPCR can detect copies of viruses in samples via digitized results to detect false-negative negatives.\u003c/p\u003e \u003cp\u003e Moreover, we propose a protocol for point-of-care tests on farms that includes qPCR equipment and a kit consisting of collection tubes with lysis buffer, reaction tubes with premixed solution, primers and probes for AMDV, CDV and MEV, reverse transcription enzymes and sampling swabs. In the protocol, a pipettor and centrifuge are not needed, and personnel who are poor in professionally performing the tests are also needed. DNA extraction was unnecessary, the collected samples were added to tubes using swabs, and the results were one-click derivated or printed. The test procedure is as follows: 1. The anal swabs were collected and soaked in collecting tubes for 3 min at room temperature; 2. A drop of sample solution and reaction solution were added to the reaction tubes; 3. qPCR was conducted for approximately 1 hour (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Compared to the POCT kit for CDV developed by Brown, our protocol is more convenient and easier to use[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn conclusion, we established a one-step multiplex qPCR assay to detect and differentiate AMDV, CDV and MEV in a single system. The advantages of the newly developed one-step multiplex qPCR assay, that is, in terms of analytical sensitivity and specificity, support the attractive applications of this method as a reliable tool for the rapid detection of common viruses and diagnosis of this disease in mink.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eSamples, primers and probes\u003c/p\u003e\n\u003cp\u003eMEV and CDV were purchased from Jilin Teyan Biotechnology Co., Ltd. The nucleic acids AMDV, canine parvovirus (CPV), pseudorabies virus (PRV), canine coronavirus (CCoV) and canine parainfluenza virus (CPIV)\u0026nbsp;were\u0026nbsp;preserved by the Preventive Veterinary Laboratory of Qingdao Agricultural University.\u0026nbsp;Two hundred\u0026nbsp;suspected samples were collected from mink herds in Shandong\u0026nbsp;Province.\u003c/p\u003e\n\u003cp\u003eThe conserved region sequences of\u0026nbsp;the NS1 gene in AMDV (KU513985.1),\u0026nbsp;the VP2 gene in MEV (KT899745.1) and\u0026nbsp;the N gene in CDV (HM063009.1) were retrieved from GenBank. The primers and probes\u0026nbsp;used were designed\u0026nbsp;with\u0026nbsp;Primer Explorer V5 to amplify\u0026nbsp;fragments of approximately\u0026nbsp;119 bp, 190 bp and 202 bp, and the\u0026nbsp;probe\u0026nbsp;characteristics of AMDV, MEV and CDV\u0026nbsp;included\u0026nbsp;the following reporter\u0026nbsp;dyes:\u0026nbsp;HEX, FAM,\u0026nbsp;and ROX;\u0026nbsp;and the BHQ1, BHQ1, and BHQ2 quenchers. The primers and probes\u0026nbsp;used were synthesized by Shanghai Personal Biotechnology Co., Ltd.\u0026nbsp;(China),\u0026nbsp;and the oligonucleotide sequences of the primers and probes are shown in Table 1.\u003c/p\u003e\n\u003cp\u003eViral DNA/RNA extraction\u003c/p\u003e\n\u003cp\u003eTotal DNA\u0026nbsp;and RNA\u0026nbsp;were\u0026nbsp;extracted from faecal samples and from MEV and CDV vaccines using\u0026nbsp;a FastPure\u0026reg; Viral DNA/RNA\u0026nbsp;Mini Kit\u0026nbsp;(Vazyme, China) according to the manufacturer\u0026rsquo;s instructions. The extracted DNA/RNA samples were used as templates in the\u0026nbsp;RT‒qPCR\u0026nbsp;assays.\u003c/p\u003e\n\u003cp\u003eConstruction of recombinant plasmids\u003c/p\u003e\n\u003cp\u003eThe DNA of AMDV\u0026nbsp;and MEV and\u0026nbsp;the RNA of CDV were used as templates. Using\u0026nbsp;primers for AMDV-AF/AR, MEV-MF/MR,\u0026nbsp;and CDV-CF/CR, the genes of the corresponding\u0026nbsp;viruses\u0026nbsp;were amplified\u0026nbsp;via\u0026nbsp;PCR and\u0026nbsp;subsequently cloned and inserted into the pEASY-T1 vector (TransGen Biotech, Beijing, China) (Figure 1A). Sequencing was carried out by Shanghai Personal Biotechnology Co., Ltd.,\u0026nbsp;to support\u0026nbsp;correct\u0026nbsp;construction,\u0026nbsp;and\u0026nbsp;the recombinant plasmids\u0026nbsp;used were named pAMDV-NS1, pMEV-VP2 and pCDV-N. The concentrations of\u0026nbsp;the recombinant plasmids were measured according to the following formula. Then, tenfold-diluted recombinant plasmids were prepared from 2.5 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e to 2.5 \u0026times; 10\u003csup\u003e1\u003c/sup\u003e for RT‒qPCR. Standard curves were drawn to\u0026nbsp;determine the reliability of the\u0026nbsp;diluted recombinant plasmids.\u003c/p\u003e\n\u003cp\u003eOptimization of the\u0026nbsp;RT‒qPCR\u0026nbsp;system\u003c/p\u003e\n\u003cp\u003eThe recombinant plasmids were\u0026nbsp;subjected\u0026nbsp;to\u0026nbsp;RT‒qPCR to determine\u0026nbsp;the optimal\u0026nbsp;concentrations\u0026nbsp;of\u0026nbsp;the primers (0.2 \u0026mu;M, 0.5 \u0026mu;M,\u0026nbsp;and 0.8 \u0026mu;M) and probes (0.2 \u0026mu;M, 0.25 \u0026mu;M,\u0026nbsp;and 0.4 \u0026mu;M), which were determined\u0026nbsp;via\u0026nbsp;orthogonal\u0026nbsp;tests\u0026nbsp;according to Ct values and amplification efficacy.\u0026nbsp;Amplification\u0026nbsp;was carried out\u0026nbsp;with a\u0026nbsp;QuantStudio 5 (Thermo Fisher Scientific, United States)\u0026nbsp;instrument with\u0026nbsp;the following\u0026nbsp;reaction\u0026nbsp;conditions: 37 \u0026deg;C\u0026nbsp;for 30 s for initial denaturation, 40 cycles of denaturation at\u0026nbsp;95 \u0026deg;C\u0026nbsp;for 120 s and\u0026nbsp;95 \u0026deg;C\u0026nbsp;for 10 s,\u0026nbsp;and annealing at\u0026nbsp;60 \u0026deg;C\u0026nbsp;for 30 s.\u003c/p\u003e\n\u003cp\u003eEstablishment of standard curves\u003c/p\u003e\n\u003cp\u003eThree recombinant plasmids were tenfold-diluted (10\u003csup\u003e-1\u003c/sup\u003e ~ 10\u003csup\u003e-7\u003c/sup\u003e copies/\u0026micro;L) and mixed equally as templates\u0026nbsp;for RT\u0026ndash;qPCR, in which ddH\u003csub\u003e2\u003c/sub\u003eO was used as\u0026nbsp;a negative control.\u0026nbsp;Standard\u0026nbsp;curves were established according to the Ct values and\u0026nbsp;dilutions.\u003c/p\u003e\n\u003cp\u003eSpecificity assay\u003c/p\u003e\n\u003cp\u003eThe specificity for multiple\u0026nbsp;RT‒qPCR\u0026nbsp;assays was evaluated using three mixed recombinant plasmids as\u0026nbsp;a positive control and other DNAs (PRV and CPV) and RNAs (CCoV and CPIV). Three independent experiments\u0026nbsp;were performed for each sample, and ddH\u003csub\u003e2\u003c/sub\u003eO served as the negative control.\u003c/p\u003e\n\u003cp\u003eSensitivity assay\u003c/p\u003e\n\u003cp\u003eThe sensitivity\u0026nbsp;of the\u0026nbsp;multiple\u0026nbsp;RT‒qPCR\u0026nbsp;assays was evaluated. The recombinant plasmids of AMDV, MEV and CDV were diluted from 2.5 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e to 2.5 \u0026times; 10\u003csup\u003e1\u003c/sup\u003e and mixed with\u0026nbsp;an equal volume. Three independent experiments\u0026nbsp;were performed for each sample, and ddH\u003csub\u003e2\u003c/sub\u003eO served as the negative control.\u003c/p\u003e\n\u003cp\u003eReproducibility assay\u003c/p\u003e\n\u003cp\u003eThe three recombinant\u0026nbsp;plasmids\u0026nbsp;(pAMDV-NS1, pMEV-VP2 and pCDV-N) were diluted,\u0026nbsp;and three different concentrations were selected\u0026nbsp;for use in\u0026nbsp;reproducibility\u0026nbsp;assays\u0026nbsp;(2.5\u0026times;10\u003csup\u003e7\u003c/sup\u003e, 2.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e, and 2.5\u0026times;10\u003csup\u003e3\u003c/sup\u003e copies/\u0026micro;L). Each concentration was\u0026nbsp;tested\u0026nbsp;3 times, and a one-time qPCR assay was conducted to\u0026nbsp;determine\u0026nbsp;the intrabatch repeatability by comparing the standard deviation (SD) and the coefficient of variation (CV). Three qPCR assays using three\u0026nbsp;diluted standard plasmids were conducted to\u0026nbsp;test\u0026nbsp;interbatch repeatability by comparing the SD and the CV.\u003c/p\u003e\n\u003cp\u003eAnti-interference assay and clinical sample detection\u003c/p\u003e\n\u003cp\u003eTo confirm whether the original concentrations of standard plasmids can\u0026nbsp;affect\u0026nbsp;the performance of multiple\u0026nbsp;RT‒qPCRs, an\u0026nbsp;anti-interference assay was designed. Briefly, three standard plasmids\u0026nbsp;at\u0026nbsp;different concentrations (10\u003csup\u003e8\u003c/sup\u003e and 10\u003csup\u003e3\u003c/sup\u003e copies/\u0026micro;L) were combined randomly, and multiple\u0026nbsp;RT‒qPCR\u0026nbsp;and single\u0026nbsp;RT‒qPCR were conducted\u0026nbsp;for AMDV, MEV and CDV.\u003c/p\u003e\n\u003cp\u003eThe diagnostic performance of multiple\u0026nbsp;RT‒qPCRs\u0026nbsp;was assessed by collecting and testing 200\u0026nbsp;facial\u0026nbsp;samples suspected to suffer\u0026nbsp;from\u0026nbsp;diarrhoea from mink herds in Shandong\u0026nbsp;Province, China.\u0026nbsp;Moreover, retesting\u0026nbsp;was performed using the highly sensitive detection method\u0026nbsp;for\u0026nbsp;AMDV, MEV and CDV,\u0026nbsp;as previously reported. The feasibility of multiple\u0026nbsp;RT‒qPCR methods\u0026nbsp;was evaluated by measuring the diagnostic specificity (DSp), diagnostic sensitivity (DSe) and degree of agreement with the highly sensitive detection\u0026nbsp;methods used for\u0026nbsp;AMDV, MEV and CDV.\u003c/p\u003e\n\u003cp\u003eStatistical analysis\u003c/p\u003e\n\u003cp\u003eThe calculation of DSe and DSp between the two methods was based on the following formula. DSe = TP/(TP + FN) and DSp = TN/(TN + FP), where TP means true-positive cases, FN means false-negative cases, TN means true-negative cases, and FP means false-positive cases. Precision was evaluated by obtaining the mean time-to-detection values and standard deviations (SDs) of each set of replicates at a given concentration and calculating the coefficients of variation (CVs) (SD/mean).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAuthor contributions\u003c/p\u003e\n\u003cp\u003eZ.C. and J.W. designed the experiments; Z.C., H.X. and X.Z. performed the experiments; Z.C., H.X., X.Z., K.Z., D.Y., S.M., W.L., S.L., J.R., and J.W. contributed reagents/materials/analysis tools; Z.C., H.X., and J.W. analyzed the data; Z.C. and J.W. wrote the paper. All authors read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Shandong Modern Agricultural Technology \u0026amp; Industry System (SDAIT-21-13), and the Research Foundation for Distinguished Scholars of Qingdao Agricultural University (1120018).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe datasets supporting the conclusions of this article are included within the article.\u003c/p\u003e\n\u003cp\u003eEthics approval\u003c/p\u003e\n\u003cp\u003eAll experiments received approval and were supervised by the Research Ethics Committee of Qingdao Agricultural University.\u0026nbsp;All methods were performed in accordance with the relevant guidelines and regulations.\u003c/p\u003e\n\u003cp\u003eInformed consent\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eConsent to participate\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eDeclaration of competing interest\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eVahedi SM, Ardestani SS, Banabazi MH, Clark F. Epidemiology, pathogenesis, and diagnosis of Aleutian disease caused by Aleutian mink disease virus: A literature review with a perspective of genomic breeding for disease control in American mink (Neogale vison). Virus Res. 2023;336:14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRyt-Hansen P, Hjulsager CK, Hagberg EE, Chri\u0026eacute;l M, Struve T, Pedersen AG, Larsen LE. Outbreak tracking of Aleutian mink disease virus (AMDV) using partial NS1 gene sequencing. Virol J. 2017;14:9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown AT, McAloose D, Calle PP, Auer A, Posautz A, Slavinski S, Brennan R, Walzer C, Seimon TA. Development and validation of a portable, point-of-care canine distemper virus qPCR test. PLoS ONE. 2020;15(4):22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarkarian NM, Abrahamyan L. AMDV Vaccine: Challenges and Perspectives. Viruses-Basel. 2021;13(9):19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang SS, Wang JG, Li ZD, Cui SJ, Liu WQ. The 5\u0026prime; Untranslated Region of the Capsid Protein 2 Gene of Mink Enteritis Virus Is Essential for Its Expression. J Virol. 2018;92(18):20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin P, Wang JK, Song SS, Cheng YN, Yi L, Cheng SP, Wang ZJ. Development of an Immunochromatographic Strip for Rapid Detection of Mink Enteritis Virus. Front Microbiol. 2022;13:8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQianqian Xie 1 JW. Ying Liu 1, Jun Su 1, Chenchen Gu 1, Jing Wu 1, Jun Xiao 2, Weiquan Liu 3: Transcriptional activation of Mink enteritis virus VP2 by the C-terminal of its NS1 protein %J Virus genes. 2023(No.1):100\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang JK, Cheng YN, Zhang M, Zhao H, Lin P, Yi L, Tong MW, Cheng SP. Development of a nanoparticle-assisted PCR (nanoPCR) assay for detection of mink enteritis virus (MEV) and genetic characterization of the \u003cem\u003eNS1\u003c/em\u003e gene in four Chinese MEV strains. BMC Vet Res. 2015;11:8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGava D, Souza CK, Schaefer R, Vincent AL, Cantao ME, Coldebella A, Ciacci-Zanella JR. A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. J Virol Methods. 2015;219:14\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNu\u0026ntilde;ez LF, Santander-Parra SH, Chaible L, De la Torre DI, Buim MR, Murakami A, Dagli MLZ, Astolfi-Ferreira CS, Ferreira AJP. Development of a Sensitive Real-Time Fast-qPCR Based on SYBR\u003csup\u003e\u0026reg;\u003c/sup\u003e Green for Detection and Quantification of Chicken Parvovirus (ChPV). Vet Sci. 2018;5(3):13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIwantschenko AK, Roegener F, Garrels W, Dorsch M, K\u0026ouml;hl W, Riehle C, Ghyselinck N, F\u0026eacute;ret B, Zschemisch NH, Bleich A, et al. Why serology just is not enough: Strategic parvovirus risk assessment using a novel qPCR assay. Lab Anim. 2022;56(4):380\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eda Costa VG, Saivish MV, Rodrigues RL, Silva RFD, Moreli ML, Kr\u0026uuml;ger RH. Molecular and serological surveys of canine distemper virus: A meta-analysis of cross-sectional studies. PLoS ONE. 2019;14(5):19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHawkins SFC, Guest PC. Multiplex Analyses Using Real-Time Quantitative PCR. \u003cem\u003eMethods in molecular biology (Clifton, NJ)\u003c/em\u003e 2017, 1546:125\u0026ndash;133.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSule WF, Oluwayelu DO. Real-time RT-PCR for COVID-19 diagnosis: challenges and prospects. Pan Afr Med J. 2020;35(Suppl 2):121.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArtika IM, Dewi YP, Nainggolan IM, Siregar JE, Antonjaya U. Real-Time Polymerase Chain Reaction: Current Techniques, Applications, and Role in COVID-19 Diagnosis. Genes. 2022;13(12):21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu W, Lin Y, Jiang J, Zhang J, Liu Q, Hu Q. Development of a 1-step TaqMan real-time PCR method for detection of the Bovine Group A Rotavirus. Diagn Microbiol Infect Dis. 2023;107(4):116081.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJensen VF, Stockmarr A, Fertner M, Clausen J, Chr\u0026iacute;el M. Effects of health related farm-level factors on skin size and quality in commercial mink (Neovison vison) production. Prev Vet Med. 2021;192:11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarki M, Rajak KK, Singh RP. Canine morbillivirus (CDV): a review on current status, emergence and the diagnostics. Virusdisease. 2022;33(3):309\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeymouri M, Mollazadeh S, Mortazavi H, Ghale-Noie ZN, Keyvani V, Aghababaei F, Hamblin MR, Abbaszadeh-Goudarzi G, Pourghadamyari H, Hashemian SMR, et al. Recent advances and challenges of RT-PCR tests for the diagnosis of COVID-19. Pathol Res Pract. 2021;221:8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu J, Zou J, Liu X, Pan Y, Mu Y, Li S, Wang J, Xu F, Wang Y. TaqMan-probe-based multiplex real-time RT-qPCR for simultaneous detection of GoAstV, GPV, and GoCV. Poult Sci. 2023;102(2):102396.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoto Y, Fukunari K, Suzuki T. Multiplex RT-qPCR Application in Early Detection of Bovine Respiratory Disease in Healthy Calves. Viruses-Basel. 2023;15(3):18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElia G, Decaro N, Martella V, Cirone F, Lucente MS, Lorusso E, Di Trani L, Buonavoglia C. Detection of canine distemper virus in dogs by real-time RT-PCR. J Virol Methods. 2006;136(1\u0026ndash;2):171\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVirtanen J, Aaltonen K, Vapalahti O, Sironen T. Development and validation of nucleic acid tests to diagnose Aleutian mink disease virus. J Virol Methods. 2020;279:6.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 Primers and probes.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"582\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.517241379310345%\" valign=\"top\"\u003e\n \u003cp\u003eTarget virus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.482758620689655%\" valign=\"top\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.96551724137931%\" valign=\"top\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.517241379310345%\" valign=\"top\"\u003e\n \u003cp\u003eLength (bp)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.51724137931034%\" valign=\"top\"\u003e\n \u003cp\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.517241379310345%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eMEV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.482758620689655%\" valign=\"top\"\u003e\n \u003cp\u003eQF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.96551724137931%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eVP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.517241379310345%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e190\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.51724137931034%\" valign=\"top\"\u003e\n \u003cp\u003eAACACCTATTGCAGCAGGACG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.54679802955665%\" valign=\"top\"\u003e\n \u003cp\u003eQR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"86.45320197044335%\" valign=\"top\"\u003e\n \u003cp\u003eGTTTCTCCTGTTGTGGTAGTTTTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.54679802955665%\" valign=\"top\"\u003e\n \u003cp\u003eProbe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"86.45320197044335%\" valign=\"top\"\u003e\n \u003cp\u003eFAM-ATCCAAGATATGCATTTGGTAGACA-BHQ1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.517241379310345%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eCDV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.482758620689655%\" valign=\"top\"\u003e\n \u003cp\u003eQF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.96551724137931%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.517241379310345%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e202\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.51724137931034%\" valign=\"top\"\u003e\n \u003cp\u003eAAATCAACGGACCTAAATTAACTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.54679802955665%\" valign=\"top\"\u003e\n \u003cp\u003eQR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"86.45320197044335%\" valign=\"top\"\u003e\n \u003cp\u003eTCATCTGCCTCAGAATCCAAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.54679802955665%\" valign=\"top\"\u003e\n \u003cp\u003eProbe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"86.45320197044335%\" valign=\"top\"\u003e\n \u003cp\u003eROX-ACTCTGTTTGTGGTCTTACATTTGC-BHQ2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.517241379310345%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eAMDV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.482758620689655%\" valign=\"top\"\u003e\n \u003cp\u003eQF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.96551724137931%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eNS1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.517241379310345%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e119\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.51724137931034%\" valign=\"top\"\u003e\n \u003cp\u003eCTTACAAATACCATCACAAACAAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.54679802955665%\" valign=\"top\"\u003e\n \u003cp\u003eQR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"86.45320197044335%\" valign=\"top\"\u003e\n \u003cp\u003eACCATCCATACCTTCCTCAGTTATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.54679802955665%\" valign=\"top\"\u003e\n \u003cp\u003eProbe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"86.45320197044335%\" valign=\"top\"\u003e\n \u003cp\u003eHEX-GCAGTAGACATGCGTGATTATACAT-BHQ1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2. Multiplex\u0026nbsp;\u003cem\u003eTaq\u003c/em\u003eMan PCR Repeatability Tests for RT‒PCR\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"576\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.194444444444445%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003ePlasmid\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.055555555555557%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e(copies/\u0026mu;L)\u003c/p\u003e\n \u003cp\u003eConcentration\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.375%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eIntra-assay Ct value\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.375%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eInterassay Ct value\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.582914572864322%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eaverage value\u003c/p\u003e\n \u003cp\u003ex̅\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.09547738693467%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003estandard deviation\u003c/p\u003e\n \u003cp\u003eSD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.321608040201005%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eCoefficient\u003c/p\u003e\n \u003cp\u003eCV%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.582914572864322%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eaverage value\u003c/p\u003e\n \u003cp\u003ex̅\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.09547738693467%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003estandard deviation\u003c/p\u003e\n \u003cp\u003eSD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.321608040201005%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eCoefficient\u003c/p\u003e\n \u003cp\u003eCV%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.14878892733564%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003epMEV-VP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.993079584775085%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.5\u0026times;10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.418685121107266%\" valign=\"bottom\"\u003e\n \u003cp\u003e14.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.14878892733564%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.86159169550173%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.418685121107266%\" valign=\"bottom\"\u003e\n \u003cp\u003e14.81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.14878892733564%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.86159169550173%\" valign=\"bottom\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.717131474103585%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"bottom\"\u003e\n \u003cp\u003e22.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"bottom\"\u003e\n \u003cp\u003e22.81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"bottom\"\u003e\n \u003cp\u003e2.16\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.717131474103585%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.5\u0026times;10\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"bottom\"\u003e\n \u003cp\u003e29.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"bottom\"\u003e\n \u003cp\u003e29.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"bottom\"\u003e\n \u003cp\u003e2.37\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.14878892733564%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003epCDV-N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.993079584775085%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.5\u0026times;10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.418685121107266%\" valign=\"bottom\"\u003e\n \u003cp\u003e15.44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.14878892733564%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.86159169550173%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e3.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.418685121107266%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e15.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.14878892733564%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.86159169550173%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e2.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.717131474103585%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"bottom\"\u003e\n \u003cp\u003e22.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e22.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e2.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.717131474103585%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.5\u0026times;10\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"bottom\"\u003e\n \u003cp\u003e29.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e29.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.14878892733564%\" rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003epAMDV-NS1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.993079584775085%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.5\u0026times;10\u003csup\u003e7\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.418685121107266%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e16.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.14878892733564%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.86159169550173%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e3.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.418685121107266%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e16.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.14878892733564%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.86159169550173%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e3.51\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.717131474103585%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e23.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e2.94\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e23.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e2.60\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.717131474103585%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e7.5\u0026times;10\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e29.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e2.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.147410358565738%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e29.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.139442231075698%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.354581673306773%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e2.31\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 3.\u0026nbsp;Comparison of the samples tested by multiple RT‒qPCR and the single highly sensitive detection methods for AMDV, MEV and CDV.\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.108303249097473%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eAssays\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.898916967509026%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003ePathogen\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.566787003610107%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eResults\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.700361010830324%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eThe single highly sensitive detection method\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.465703971119133%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003ePerformance Characteristics(%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.259927797833935%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eKappa\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.41522491349481%\" valign=\"top\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.301038062283737%\" valign=\"top\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.301038062283737%\" valign=\"top\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.491349480968857%\" valign=\"top\"\u003e\n \u003cp\u003eDSe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.491349480968857%\" valign=\"top\"\u003e\n \u003cp\u003eDSp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.108303249097473%\" rowspan=\"14\" valign=\"top\"\u003e\n \u003cp\u003eMultiple RT‒qPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.898916967509026%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eAMDV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.566787003610107%\" valign=\"top\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.649819494584838%\" valign=\"top\"\u003e\n \u003cp\u003e99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.025270758122744%\" valign=\"top\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.025270758122744%\" valign=\"top\"\u003e\n \u003cp\u003e102\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.732851985559567%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e97.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.732851985559567%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.259927797833935%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.970\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.830188679245282%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e98\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.461847389558233%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eMEV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.642570281124499%\" valign=\"top\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.847389558232932%\" valign=\"top\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e86.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.863453815261044%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.922\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.830188679245282%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e177\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e177\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.461847389558233%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eCDV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.642570281124499%\" valign=\"top\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.847389558232932%\" valign=\"top\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.863453815261044%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.830188679245282%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e194\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e194\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.461847389558233%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eAMDV + CDV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.642570281124499%\" valign=\"top\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.847389558232932%\" valign=\"top\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.863453815261044%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.830188679245282%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e197\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e197\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.461847389558233%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eAMDV + MEV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.642570281124499%\" valign=\"top\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.847389558232932%\" valign=\"top\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e91.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.863453815261044%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.954\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.830188679245282%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e188\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e188\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.461847389558233%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eMEV + CDV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.642570281124499%\" valign=\"top\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.847389558232932%\" valign=\"top\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e85.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.863453815261044%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.921\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.830188679245282%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e193\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e193\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.461847389558233%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eAMDV + CDV +MEV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.642570281124499%\" valign=\"top\"\u003e\n \u003cp\u003eP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.847389558232932%\" valign=\"top\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.040160642570282%\" valign=\"top\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.052208835341366%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.863453815261044%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25%\" valign=\"top\"\u003e\n \u003cp\u003eN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.830188679245282%\" valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e196\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.58490566037736%\" valign=\"top\"\u003e\n \u003cp\u003e196\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"AMDV, MEV, CDV, multiplex RT‒qPCR, differential detection","lastPublishedDoi":"10.21203/rs.3.rs-4393868/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4393868/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eAleutian mink disease, mink viral enteritis and canine distemper are known as the three most serious diseases that cause great economic loss in the mink industry. In clinical practice, aleutian mink disease virus (AMDV), mink enteritis virus (MEV) and canine distemper virus (CDV) are common mixed infections, and they have similar clinical symptoms, such as diarrhoea. Therefore, a rapid and accurate differential diagnosis method for use on mink ranches is essential for the control of these three pathogens. Here, we developed multiplex one-step real-time quantitative PCR (RT‒qPCR) assays for the simultaneous detection and quantification of AMDV, MEV and CDV by using three primers and probes based on the conserved NS1, VP2 and N genes, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eThe results showed that the established method was less likely to cross-react with other mink pathogens, with a detection sensitivity of 25 copies/μL and a coefficient of variation less than 3.51%. Moreover, the interference experiment showed that the presence of AMDV, MEV and CDV templates at different concentrations would not interfere with the detection results. Furthermore, two hundred clinical samples of mink with diarrhoea were simultaneously analysed using multiplex RT‒qPCR and single RT‒qPCR, the Kappa values were all greater than 0.921, indicating that there was a high degree of coincidence between the two detection methods.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eIn conclusion, multiplex RT‒qPCR exhibited high specificity, sensitivity, and reproducibility, indicating that this method can be used as a reliable and specific tool for the differential detection and quantification of AMDV, MEV and CDV.\u003c/p\u003e","manuscriptTitle":"Multiplex one-step RT‒qPCR assays for simultaneous detection of AMDV, MEV and CDV","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-30 05:27:31","doi":"10.21203/rs.3.rs-4393868/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-30T08:11:11+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-20T02:44:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-20T02:44:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2024-05-09T08:49:26+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d4c4dc4a-4bef-480b-8f70-1760e7d35682","owner":[],"postedDate":"May 30th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-01-20T16:03:38+00:00","versionOfRecord":{"articleIdentity":"rs-4393868","link":"https://doi.org/10.1186/s12917-024-04349-5","journal":{"identity":"bmc-veterinary-research","isVorOnly":false,"title":"BMC Veterinary Research"},"publishedOn":"2025-01-14 15:57:48","publishedOnDateReadable":"January 14th, 2025"},"versionCreatedAt":"2024-05-30 05:27:31","video":"","vorDoi":"10.1186/s12917-024-04349-5","vorDoiUrl":"https://doi.org/10.1186/s12917-024-04349-5","workflowStages":[]},"version":"v1","identity":"rs-4393868","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4393868","identity":"rs-4393868","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00