Serum miR-200c-3p and -6134 as Biomarkers for Epithelial Ovarian Cancer: A Comprehensive analsis with CA125

Serum miR-200c-3p and -6134 as Biomarkers for Epithelial Ovarian Cancer: A Comprehensive analsis with CA125 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Serum miR-200c-3p and -6134 as Biomarkers for Epithelial Ovarian Cancer: A Comprehensive analsis with CA125 Rina Kawahara, Eiji Nishio, Aya Iwata, Haruki Nishizawa, Naoki Yamamoto, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6223812/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: MicroRNAs (miRNAs) regulate gene expression in epithelial ovarian cancer (EOC). In a single-center, retrospective study, we aimed to assess serum miRNAs as EOC biomarkers, and whether combined miRNAs and cancer antigen (CA)125 discriminated EOC from benign ovarian tumors. Results: Sera were collected from patients with EOC (N=95) or benign ovarian tumors (N=115), and from healthy controls (N=40). Candidate serum miRNAs were screened by miRNA microarray and quantified by real-time reverse transcription (RT)-PCR. Serum CA125 was measured by enzyme-linked immunosorbent assay. Real-time RT-PCR revealed highly expressed miR-200c-3p and -6134 in EOC. These miRNAs and CA125 correlated with disease severity and histological classification. In EOC vs. healthy controls, miR-200c-3p and -6134 were significantly upregulated; the area under the curve (AUC)=0.693 (95% confidence interval [CI]: 0.606–0.780) and 0.818 (0.749–0.888), respectively. Levels of miR-200c-3p, -6134, and CA125 were significantly upregulated in EOC vs. benign ovarian tumors; AUC=0.848 (95% CI: 0.792–0.904), 0.933 (95% CI: 0.891–0.975), and 0.811 (95% CI: 0.752–0.871), respectively. Combined with CA125, the two miRNAs showed AUC=0.907 (95% CI: 0.855–0.959) in normal vs. EOC and 0.952 (95% CI, 0.919–0.985) in benign tumors vs. EOC. For combined miR-200c-3p and -6134, AUC=0.935 (CA125 < 35 U/mL) and 0.934 (CA125 ≥ 35 U/mL). Conclusions: For CA125 < 35 U/mL, combined miR-200c-3p and miR-6134 distinguished EOC from benign ovarian tumors with high discriminative power. Combining two miRNAs with CA125 improved diagnostic accuracy, highlighting the potential of miR-200c-3p and -6134 as ancillary markers for detecting EOC, especially in cases with normal CA125 levels. biomarker epithelial ovarian cancer miRNA serum Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Globally, ovarian cancer is the most lethal gynecological cancer in women. In 2022, approximately 324,603 new ovarian cancer cases developed that comprised 1.6% of all cancer cases( 1 ) with an estimated 206,956 deaths. The most common ovarian cancer is epithelial ovarian cancer (EOC). The prognosis of ovarian cancer is strongly dependent on the disease stage at the time of diagnosis: the 5-year survival rate for patients with stage I disease is 92%, which dramatically decreases to around 30% for those with advanced stages (stages II–IV) ( 2 ). Overall, cancer antigen (CA)125 is elevated in most cases of EOC, but in only half of early-stage EOC cases( 3 ). In addition, serum CA125 levels are related to the release of CA125 not only from cancer cells, but also from the inflamed peritoneum ( 4 ). This lack of specificity means that new biomarkers are needed to improve the identification of patients with EOC. Computed tomography and magnetic resonance imaging are effective methods for identifying tumors, but have limitations in distinguishing between benign and malignant tumors. Ultimately, without surgical excision of the tumor, the determination is difficult; however, clinically useful ancilliary diagnostic methods for distinguishing between benign and malignant tumors would be valuable if developed. While CA125 serves as a somewhat effective early biomarker for malignant tumors, invasive cancer also exists that tests negative for CA125. Therefore, new tumor markers are required that compensate for false negative CA125 results. For instance, inflammation plays many roles in the growth of ovarian cancer tumor, with the proinflammatory cytokine interleukin-6 (IL-6) established as a key immunoregulatory cytokine ( 5 , 6 ). Indeed, incorporating IL-6 alongside CA125 enhanced the potential for detecting serous ovarian cancer at earlier stages ( 7 ). Human epididymis protein 4 (HE4)is a promising biomarker for ovarian cancer, with serum levels significantly elevated in affected patients compared to healthy individuals ( 8 – 10 ). Clinical studies have demonstrated that combining HE4 with CA125 improves diagnostic specificity and aids in distinguishing malignant ovarian tumors from benign conditions ( 11 – 13 ). MicroRNAs (miRNAs), non-coding RNAs 19–25 nucleotides in length, modulate gene expression by partially pairing with the 3′ untranslated region of their target mRNAs ( 14 ). About two-thirds of human mRNAs are thought to be regulated by miRNAs ( 15 ). Approximately 2,600 human miRNAs are currently recorded in the database, miRBase ( www.mirbase.org ), and specific miRNAs can act as oncogenes or tumor suppressors ( 14 ). MicroRNA is stably present not only in tissues but also in blood, and thus can potentially be a useful biomarker. In ovarian cancer tissues, various miRNAs are differentially expressed compared with matched normal tissues. Aberrant expression of miRNAs in ovarian cancer was previously investigated ( 16 , 17 ). However, the results of these studies were not always consistent, and were inconclusive with regard to the roles of miRNAs in supporting or suppressing ovarian carcinogenesis. Here, we describe our identification of promising biomarkers for the diagnosis of EOC using serum specimens obtained from women, including patients with EOC, patients with benign ovarian tumors, and noncancerous control women. The aim of this study was to examine whether serum miRNAs and IL-6 are useful as biomarkers for EOC, and to estimate how a combination of miRNAs, CA125 and HE4 in serum can discriminate EOC from benign ovarian tumors. Furthermore, we investigated whether a relationship existed between levels of miRNAs in serum and tissue using surgical specimens and sera from the same patients. Material and Methods Study participants Serum specimens were obtained from patients, aged 19–85 (median 47.5) years, who attended the outpatient clinic at Fujita Health University Hospital, Aichi prefecture, Japan, for routine gynecological examinations from August 2014 to December 2017. All sera were taken before treatments such as surgery or chemotherapy commenced. As a reference for noncancerous control (normal), serum was collected from patients with infertility issues, but not those with other diseases. Serum specimens were obtained from patients with epithelial ovarian cancer (EOC; N = 64, median age: 60 years) and non-cancerous controls (normal; N = 40, median age: 38 years) for screening using miRNA microarray analysis and real-time reverse transcription (RT)-PCR (Fig. 1 ). Since obtaining biopsies from healthy volunteers raised ethical concerns, we recruited 40 healthy women undergoing infertility treatment as controls, defining them as "normal". Next, serum specimens from 250 patients were examined for expression of the selected candidate miRNAs, CA125, HE4 and IL-6. This N = 250 population included N = 104 used to select candidate miRNAs with complete normal (N = 40) overlap. The sera of the 95 patients with EOC (median age: 57 years) were classified as histologic subtypes: clear cell (N = 27), serous carcinoma (N = 31), mucinous carcinoma (N = 11), endometrioid carcinoma (N = 16) and other subtypes (N = 10). The staging classification for EOC were Stages I and II (N = 57) and a more severe condition (N = 38). With a median follow-up of 54 months (range 1–90 months) across studies, the recurrence rate was 36.8% and the median time to recurrence was 13 months (range 1–63 months). The number of serum samples taken from patients with a benign ovarian tumors (benign tumors) was 115 (median age: 44 years) as shown in Table 1. Fresh surgical specimens derived from patients with EOC (N = 61) and benign tumors (N = 10) were promptly immersed in RNAlater (Thermo Fisher Scientific, Waltham, MA, USA) in the operating room after tumor excision, and then frozen for preservation. From a patient cohort of 250 individuals, 104 specimens were used for extracting candidate miRNAs. The patients from whom the 71 frozen tissue specimens were derived were part of the population of 250 individuals; specimens were collected in the operating room. CA125, cancer antigen 125; EOC, epithelial ovarian cancer; HE4, human epididymis protein 4; IL-6, interleukin 6; miRNA, microRNA; RT-PCR, reverse transcription PCR Table 1 Characteristics of the patient population (N = 250) Noncancerous control (Normal) N = 40 Age, median (range) 38 (26–44) Benign ovarian tumors N = 115 Age, median (range) 44 (19–85) Histology, N (%) Teratoma 32 (27.8%) Mucinous cystadenoma 27 (23.5%) Endometriosis 27 (23.5%) Serous cystadenoma 14 (12.2%) Fibroma/Thecoma 10 (8.7%) Struma ovarii 2 (1.7%) Other subtypes 3 (2.6%) CA125, N (%) < 35 U/mL 77 (67.0%) ≥ 35 U/mL 38 (33.0%) Epithelial ovarian cancer (EOC) N = 95 Age, years, median (range) 57 (26–85) Follow-up time: months, median (range) 54 (1–90) FIGO stage, N (%) Stages I–II 57 (60%) Stages III–IV 38 (40%) Histology, N (%) Clear cell carcinoma 27 (28.4%) Endometrioid carcinoma 16 (16.8%) Serous carcinoma 31 (32.6%) Mucinous carcinoma 11 (11.6%) Other subtypes 10 (10.5%) CA125, N (%) < 35 U/mL 23 (24.2%) ≥ 35 U/mL 72 (75.8%) Prognosis Non-recurrence Recurrence N (%) 60 (63.2%) 35 (36.8%) Age, years, median (range) 55 (26–78) 61 (36–85) Follow-up time: months, median (range) 52 (23–90) 13 (1–67) Survival status Dead Alive N (%) 15 (15.8%) 80 (84.2%) Footnotes : CA125, cancer antigen 125; FIGO, International Federation of Gynecology and Obstetrics MicroRNA microarray analysis Total RNA was extracted from 300 µL of serum using 3D-Gene RNA extraction reagent (Toray, Kamakura, Japan) according to the manufacturer’s instructions. The extracted total RNA was checked by Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and labeled with a 3D-Gene miRNA labeling kit (Toray). Half volumes of labeled RNAs were hybridized onto 3D-Gene Human miRNA Oligo chips (Toray). The annotation and oligonucleotide sequences of the probes were confirmed by miRBase miRNA database Release 21 (miRbase; https://www.mirbase.org ). After stringent washing, fluorescent signals were scanned with a 3D-Gene Scanner (Toray) and analyzed using 3D-Gene Extraction software (Toray). Raw data from each spot was normalized by substitution with a mean intensity of the background signal determined by all blank spot signal intensities and 95% confidence intervals (CI). Measurements of spots with signal intensities greater than 2 standard deviations of the background signal intensity were considered to be valid. The relative expression level of a given miRNA was calculated by comparing the signal intensities of the valid spots throughout the microarray experiments. The normalized data were globally normalized per array, such that the median of the signal intensity was adjusted to 25. The value of each gene was normalized by a method such that the median of the ovarian cancer to control ratio was equalized to one. Real-time RT-PCR for miRNA quantification To normalize serum RNA extraction efficiency, a synthesized cel-miR-39 was used as a synthetic spike-in control RNA oligonucleotide (Thermo Fisher Scientific) as it has no mammalian homolog. Ten microlitres of 0.1 fmol/µL cel-miR-39 was added to each 200 µL of serum specimen. Total RNA, extracted from 200 µL of serum using an miRNeasy Mini Kit (QIAGEN GmbH, Hilden, Germany) yielded a final elution volume of 30 µL. For cDNA synthesis from 2 µL of total RNA, a TaqMan Advanced MicroRNA cDNA Synthesis Kit (Thermo Fisher Scientific) was used according to the manufacturer's instructions. Quantitative real-time RT-PCR was performed on 5.0 µL of a diluted (1:10) RT cDNA template using a 2X Fast Advanced Master Mix and 20X TaqMan Advanced miRNA Assays (both Thermo Fisher Scientific) on a QuantStudio7 (Thermo Fisher Scientific). TaqMan Advanced MicroRNA Assay probes were as follows: Homo sapiens (hsa)-miR-16-5p (Assay ID: 477860_mir); hsa-miR-200c-3p (Assay ID: 478351_mir); hsa-miR-23b-3p (Assay ID: 483150_mir); hsa-miR-6134 (Assay ID: 480842_mir); and Caenorhabditis elegans cel-miR-39-3p (Assay ID: 478293_mir). Relative fold changes were determined from Ct values using the 2 − ΔΔCt method. Data were normalized to cel-miR-39-3p to account for possible differences in the amount of starting RNA. To examine the local expression of miR-200c-3p and − 6134, which exhibited high expression in serum of EOC, frozen tissues were collected during surgery from 61 patients with EOC from whom serum and 10 patients with a benign tumors were obtained. One hundred milligrams of frozen tissue was thoroughly homogenized in 1,000 µL of QIAzol Lysis Reagent using TaKaRa Biomasher Standard (Takara, Shiga, Japan), followed by total RNA extraction using an miRNeasy Mini Kit. MicroRNA was reverse transcribed using a TaqMan miRNA Reverse Transcription Kit and then quantified by quantitative real-time PCR according to the manufacturer's instructions, employing the following TaqMan MicroRNA Assays: hsa-miR-2003-3p (002300), hsa-miR-6134 (476896_mat), RNU48 (001006), and RNU44 (001094) (Thermo Fisher Scientific). MicroRNA levels were normalized against a combination of the average signal of both RNU48 and RNU44, and presented as − ΔCt values. Measurement of CA125 and HE4 Serum CA125 and HE4 levels were measured by a chemiluminescent enzyme immunoassay (SRL, Tokyo, Japan). The cutoff value for CA125 cutoff of 35 U/mL and HE4 cutoff of 70 pmol/L for premenopausal women and 140 pmol/L for postmenopausal women. However, since the study population did not ascertain menopausal age, considering that the average menopausal age among Japanese women is 50 years, we defined those below 50 years of age as 70 pmol/L and those 50 years or older as 140 pmol/L. Enzyme-linked immunosorbent assay The concentration of serum IL-6 were determined by enzyme-linked immunosorbent assay (ELISA) using ELISA MAX™ Deluxe sets for human IL-6 (BioLegend, Inc., San Diego, CA, USA), following protocols provided by the manufacturer. MicroRNA in situ hybridization The cellular localization of miRNA was examined in 81 surgical formalin-fixed paraffin-embedded specimens of patients with EOC. Double (3′and 5′) digoxigenin-labeled miRCURY LNA detection probes (Exiqon, Vedbaek, Denmark) were used for visualization of the following miRNAs: hsa-miR-200c-3p (probe sequence: TCCATCATTACCCGGCAGTAT, Tm = 84°C), hsa-miR-6134 (probe sequence: TCTACATCCTACCACCTCA, Tm = 84°C), and U6 (CACGAATTTGCGTGTCATCCTT, Tm = 84°C) as a positive control. For in situ hybridization (ISH), 3-µm–thick sections of formalin-fixed paraffin-embedded tissues were mounted on Superfrost glass slides and deparaffinized in xylene baths, followed by serial dilutions of ethanol and phosphate buffered saline (PBS). The slides were then immersed in 0.3% H 2 O 2 for 10 min at room temperature, washed twice with PBS, digested with 20 µg/mL proteinase K (Exiqon) at 37°C for 15 min, and washed twice with PBS. The slides were pre-hybridized at 53°C for 30 min in hybridization buffer (Exiqon) and then hybridized at 53°C for 1 h with 40 nM probes for miR-6134 or 20 nM probes for U6 in hybridization buffer. After stringent saline sodium citrate washes, the slides were blocked with Protein Block Serum-free (Agilent Technologies, Santa Clara, CA, USA) and incubated with anti-digoxigenin–horse-radish peroxidase (POD), Fab fragments from sheep (Roche, Mannheim, Germany) diluted to 1:100 at 37°C for 1 h. POD signals were visualized using a Liquid DAB + Substrate Chromogen System (Agilent Technologies), and slides were stained with hematoxylin for nuclear staining. The slides were then dehydrated and mounted with a coverslip. A microscope (Power BX-51; Olympus, Tokyo, Japan) was used for observation. Statistical analysis All statistical analyses were performed using SPSS for Windows (ver. 22.0.0.0; IBM Corp, Armonk, NY, USA). Data were analyzed by two-tailed Mann–Whitney U tests. We defined p < 0.05 as significant. We used a conventional receiver operating characteristic curve (ROC) curve with a Youden index to analyze miRNA and IL-6 levels to determine the cutoff points that yielded the highest combined sensitivity and specificity with respect to distinguishing patients with cancer from those with a normal histology. The interpretation of AUC was as follows: 1.0, perfect match; 1.0–0.9, high accuracy; 0.9–0.7, moderate accuracy; 0.7–0.5, low accuracy; and 0.5, chance result. We used Akaike information criterion (AIC) to compare the goodness-of-fit of each model of combined miRNAs, and unified different markers to determine the predictive probability through logistic regression and then constructed ROC curves according to probability. Results Identification of miRNAs up-regulated in serum of patients with EOC To identify miRNAs that were up-regulated in the serum of patients with EOC compared to noncancerous control (normal) sera, we performed miRNA microarray analysis using total RNA extracted from serum samples. Four miRNAs (miR-16-5p, -23b-3p, -200c-3p and − 6134) were selected as potential biomarker candidates according to the following criteria: the absolute value of the signal intensity was more than 10; and the fold change of EOC vs. normal was more than 2 (Table 2 ). Real-time RT-PCR was used to further validate the four candidate miRNAs. two miRNAs (miR-200c-3p and − 6134) showed high expression fold changes; EOC vs. normal were 3.2 and 2.4, respectively. Accordingly, using miRNA microarray analysis and real-time RT-PCR, we identified miR-200c-3p and − 6134 as showing significant high expression in the sera of patients with EOC. Table 2 miRNA microarray analysis and real-time RT-PCR for screening miRNAs Microarray analysis Real-time RT-PCR Global normalization EOC/Normal EOC/Normal Mann-Whitney U Normal EOC Fold change Fold change p -value hsa-miR-16-5p 7.1 35.5 5 1.7 0.45 hsa-miR-23b-3p 14 35.6 2.6 1.5 0.059 hsa-miR-200c-3p 10 20.9 2.1 3.2 5.2.E-07* hsa-miR-6134 13.8 34.1 2.5 2.4 4.9.E-04* Footnotes : EOC, epithelial ovarian cancer; miRNA, microRNA; RT-PCR, real-time reverse transcription PCR; *: p < 0.05 statistically significant Association between expression of candidate biomarkers and clinical staging classification, histology, and recurrence We explored associations between expression levels of the two miRNAs, CA125, HE4 and IL-6 with disease severity, histological classification, and recurrence (Fig. 2 ). In an analysis based on clinical staging classifications, the expression level of miR-200c-3p showed a significant increase between benign tumors and EOC. The expression level of miR-6134 significantly increased with severity of disease, when comparing normal control and benign tumors to stage I–II and more advanced stages. No significant difference was found between normal and benign tumors in CA125, HE4 and in IL-6. The expression of miR-6134, CA125 and HE4 showed significant differences for all histological classifications compared to the normal control and benign tumor groups. MiR-200c-3p were also significantly different with all histological classifications when compared with benign tumors. In contrast, IL-6 showed no significant difference for the mucinous carcinoma group. When investigated for the presence of recurrence, miR-200c-3p, CA125, and IL-6 showed significantly higher values in recurrent cases; however, miR-6134 and HE4 did not show a significant difference. Clinical utility of assessing miRNA levels in combination with CA125 for the detection of EOC The diagnostic performance of the miRNAs, CA125, HE4 and IL-6 as markers for EOC in serum was compared between normal vs. EOC and benign tumor vs. EOC groups. ROC curves were constructed, and the AUC was calculated to assess diagnostic performance (Fig. 3 A, B). In a comparison of normal control and EOC groups, the AUC indicated that HE4 was the most accurate marker (AUC = 0.929), followed by CA125 (AUC = 0.870) and miR-6134 (AUC = 0.818). In contrast, for benign tumor vs. EOC groups, the AUC was highest for miR-6134 (AUC = 0.933), followed by that of HE4 (AUC = 0.882) and miR-200c-3p (AUC = 0.848). Considering the average menopausal age of Japanese women, we set the cutoff value for HE4 at 70 pmol/L for those under 50 years old and 140 pmol/L for those 50 years and over. Although HE4 showed a high AUC, its sensitivity was 0.568 for both normal vs EOC and benign tumors vs EOC. The Akaike Information Criterion (AIC) was used to determine which factors should be enrolled in the final model (Table S1 ). The combination of miR-6134, CA125, and HE4, designated as combination 1, showed the lowest AIC when discriminating normal from EOC groups. This showed an AUC of 0.961 (95% CI, 0.931–0.961). Combination 2, consisting of miR-6134, CA125, HE4, and IL-6, showed the best AUC performance providing an AUC of 0.968 (95% confidence interval, 0.942–0.995) in benign tumors vs. EOC (Fig. 3 B). Verification of the separation ability to distinguish benign tumors from EOC below the cutoff level of CA125 We evaluated the ability of candidate miRNAs to distinguish benign tumors from EOC in patients stratified by CA125 levels using a cutoff value (Fig. 4 A). Among cases with CA125 below the cutoff of 35 U/mL, miR-6134 demonstrated the highest discriminatory ability (AUC = 0.927), followed by miR-200c-3p (AUC = 0.843). The combined performance of miR-200c-3p and − 6134, designated as combination 3, when CA125 < 35 U/mL revealed AUC = 0.935 and for CA125 ≥ 35 U/mL it was 0.934 (Fig. 4 B). Even in cases where CA125 was below the cutoff, the combination of miR-200c-3p and miR-6134 discriminated EOC from benign tumors. Therefore, the AUC indicated that combined miR-200c-3p and − 6134 were accurate markers when CA125 was < 35 U/mL or ≥ 35 U/mL. Expression of miRNAs in surgical tissues Both miR-200c-3p and − 6134 showed no significant difference in expression levels between benign tumors and EOC in frozen tissues (Fig. 5 A, B). A significant difference was not also observed between stages I–II and more advanced stages, nor between recurrence and non-recurrence groups (data not shown). No correlation was observed between serum and the tissue in which miRNAs were expressed. Despite the expression of miR-200c-3p and − 6134 being examined in several cultured cell lines, including ovarian cancer, expression levels varied widely between cell types, and no trend in expression by cancer type was observed (Figure S1 ). Overall, the expression levels of miR200c-3p and − 6134 in frozen tissues and various cultured cells behaved differently from those in serum. Intense signal of miR-6134 in surgical specimens by ISH We examined the localization of expression of miRNA signals in surgical specimens by ISH (Fig. 6 ). Of 81 EOC specimens, miR-6134 was positive in the cytoplasm of 15 cases (69%) of clear cell carcinoma and of 18 cases (69%) of serous carcinoma, respectively. We attempted to detect miR-200c-3p using the same specimens but did not obtain a signal. Namely, miR-6134 was detected in a majority of EOC surgical specimens by ISH and miR-200c-3p was uninformative. Discussion Considered a promising non-invasive tumor biomarker with a moderate diagnostic value, serum CA125 was found by others to have a sensitivity of 0.80 and a specificity of 0.75 for diagnosing ovarian cancer ( 18 ). In comparison, in our study, CA125 was an excellent biomarker with a specificity of 0.875 and a sensitivity of 0.758. However, although the CA125 level was found to be elevated in the serum of patients with EOC, this marker has a low sensitivity in the early stages of EOC ( 3 ). Elevated CA125 levels have also been reported in other physiological or pathological conditions such as menstruation, pregnancy, endometriosis, and inflammatory diseases of the peritoneum ( 19 – 21 ). Therefore, the development of more accurate biomarkers is desired for patients with EOC. HE4 has been recognized as one of the most promising tests for early detection of ovarian cancer ( 8 – 10 ). When combined with CA125, its sensitivity and specificity for detecting malignancies in adnexal masses improve significantly compared to CA125 alone ( 11 – 13 ). However, despite its clinical utility, HE4 levels can be influenced by various benign and malignant diseases, and differences in cutoff values due to racial and patient background variations have prevented it from becoming a definitive diagnostic tool ( 10 , 22 – 27 ). In our study, HE4 demonstrated high diagnostic performance for distinguishing between normal controls and EOC, showing the highest AUC (0.929) among the markers analyzed. However, when comparing benign tumors with EOC, miR-6134 exhibited the highest AUC (0.933), followed by HE4 (AUC = 0.882) and miR-200c-3p (AUC = 0.848). These findings suggest that HE4 remains a highly useful biomarker for ovarian cancer detection, particularly in differentiating malignant cases from normal controls. However, its performance in distinguishing benign tumors from EOC may be surpassed by miRNA markers. Importantly, when assessing the sensitivity of HE4 using the predetermined cutoff value, the sensitivity was found to be 0.568 in both normal vs. EOC and benign tumors vs. EOC comparisons. This relatively low sensitivity underscores the limitation of HE4 as a standalone diagnostic marker, aligning with previous reports that highlight the challenges associated with defining an optimal cutoff value across different populations ( 10 , 22 – 27 ). These findings further reinforce the need to consider complementary biomarkers. Indeed, our analysis revealed that the combination of miR-6134, CA125, and HE4 (Combination 1) demonstrated the best discrimination between normal and EOC cases (AUC = 0.961, 95% CI: 0.931–0.961), while the combination of miR-6134, CA125, HE4, and IL-6 (Combination 2) achieved the highest AUC (0.968, 95% CI: 0.942–0.995) for differentiating benign tumors from EOC. Furthermore, in cases with CA125 < 35 U/mL, miR-6134 showed a sensitivity of 0.826, a specificity of 0.974, and a high accuracy of 0.94. We demonstrated combining miR200c-3p with − 6134 further improved the ability to discriminate EOC from benign tumors below the 35 U/mL cutoff value of CA125. These results highlight the potential of multi-marker panels in improving diagnostic accuracy beyond individual biomarkers. Previous studies have shown that the miR-200 family is significantly detected in ovarian cancer tissues compared to normal ( 28 , 29 ). Our study quantified the expression levels of serum miRNAs from our original microarray screening and showed that two miRNAs, miR-200c-3p and − 6134, were significantly upregulated as shown by real-time RT-PCR. Of these miRNAs, the biological behavior and cellular role of miR-6134 have not been well described to date. Also consistent with the results of previous studies( 30 – 32 ), we found that expression levels of miR-200c-3p, CA125, and IL-6 were significantly higher in cases showing a recurrence of disease compared to those without any recurrence. In contrast, expression levels of miR-6134 did not correlate with recurrence status. In our study, we investigated the correlation between pre-intervention blood sampling results and subsequent recurrence events. We were particularly interested in elucidating whether conducting longitudinal blood sampling after an intervention could predict future recurrences; this is the intended subject of future research. Abundant in circulating blood, miRNAs are bound in protein complexes or packed into extracellular vesicles, and thus exist in highly stable forms that are resistant to degradation ( 33 ). MicroRNAs have attracted the attention of researchers due to their critical role in tumor development and progression, leading to the emergence of many studies on the diagnostic value of miRNAs. However, findings are controversial because of the various study designs used. Therefore, we conducted an analysis of the utility of miRNAs as tumor markers with serum and tissues from the same patients by measuring not only miRNAs selected through our own screening, but also clinically used CA125 and more recently noted IL-6 ( 34 , 35 , 36 ). In order to confirm the validity of miRNA as a serum tumor marker, we investigated the expression of miRNA in surgically resected specimens using two methods. One was real-time RT-PCR using frozen specimens, and the other was ISH using paraffin-embedded tissues. The latter offers the advantage of analyzing local expression at the cellular level in the tumor. However, it was expected to have low detection sensitivity. Indeed, mir-6134 was detected in 58–69% of clear cell carcinoma and serous carcinoma specimens, confirming that miRNA is expressed by tumor cells. Conversely, we were unable to analyze the expression of mir-200c-3p by ISH, perhaps because of poor compatibility between the probe and tissue samples collected. Utilizing the same methodology as for serum, real-time RT-PCR offers the advantage of an easy comparison of expression levels between serum and tissue. However, since it analyzes only a portion of an excised tumor, its detection sensitivity is expected to decrease due to tumor heterogeneity. Our results revealed no correlation between expression levels in tumors and serum, and no clinically useful information was obtained from a tissue-based analysis or cultured cells. While miRNAs are expressed in the tumor, we speculate these behave differently from miRNAs in serum. We speculate that the inconsistent results in previous studies may be related to differences in the type of research specimens used, whether they were serum or tissue. The advantageous aspects of this study are as follows: Although studies on miRNA using tissue specimens have been widely reported, we conducted screening using microarray with serum obtained from our facility, and identified miR-200c-3p and − 6314 candidates through validation using real-time RT-PCR. By using normal and benign tumors samples as well as samples from patients with EOC, we were able to construct ROC curves. Additionally, we were able to investigate the expression levels of miRNA using tumors from patients who had provided serum. Several limitations exist in this study. Firstly, validation using another set of the cohort should be conducted in future to confirm its accuracy as a biomarker for EOC ( 37 , 38 ).This study suggests two potential clinical utilities. One is the potential for tumor markers to be used as a screening tool in the general population. If this is the goal, large-scale studies using specimens from the general population would be necessary to validate our finding. Another clinical utility may be in the differentiation between benign and malignant tumors when tumors are detected on imaging examinations. An assessment of samples from multiple facilities would be required to support our finding. Another limitation is that the analysis of HE4 was stratified at age 50, assuming menopausal status, which can only be definitively determined retrospectively, making clear differentiation difficult, for example, in patients aged 50 regarding their menopausal status. In conclusion, miR-6134 was newly detected in patient sera and may be a promising biomarker for identifying EOC. We found that a combination of two miRNAs; miR200c-3p and − 6134 and CA125 can more accurately diagnose EOC. The increase in miR200c-3p and − 6134 in EOC suggests a potential utility in correctly diagnosing patients, deemed normal or benign tumors due to CA125 < 35 U/mL, as instead having cancer. Conclusions We identified miR-6134 as a novel biomarker for EOC and demonstrated its diagnostic potential. The combination of miR-200c-3p and miR-6134, improved the accuracy of EOC detection, particularly in cases with CA125 < 35 U/mL. Our findings highlight the importance of using multiple biomarkers together to enhance diagnostic precision. Further validation in larger, multi-institutional cohorts is warranted to confirm the clinical utility of these biomarkers and support their potential application in EOC screening and differential diagnosis. Declarations Ethics approval and consent to participate - Approval of the research protocol by an Institutional Reviewer Board: The study protocol was approved by the Ethics Committees of Fujita Health University (HM22-516). - Informed Consent: Written informed consent was obtained from each patient. All procedures were performed in accordance with the approved guidelines and regulations. - Registry and the Registration No. of the study/trial: N/A - Animal Studies: N/A Clinical trial number not applicable. Consent for publication Not applicable Availability of data and materials Our microarray data is available in the Gene Expression Omnibus database (https://www.ncbi.nlm.nih.gov/geo/; accession numbers GSE201712). The other datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Competing interests The authors have no conflict of interest. Funding This work was partly supported by KAKENHI from the Ministry of Education, Culture, Sports, Science and Technology, Japan (Grant No. 23K08812) and a Fujita Health University Research Grant-in-Aid. Authors' Contributions R. K.: investigation, resources, writing – original draft, E. N.: resources, A. I.: investigation, data curation, formal analysis, methodology, writing – original draft, H.N.: funding acquisition, review, N. Y.: investigation, T.F.: conceptualization, data curation, resources, writing – original draft, funding acquisition, project administration Acknowledgments: We thank Ms. Nakagawa, Department of Obstetrics and Gynecology, Fujita Health University for assistance and Dr. Iwata, Department of Obstetrics and Gynecology, Keio University, School of Medicine for providing cultured cells. We thank NAI Inc. for editing the English text of a draft of this manuscript. References Ferlay J, Ervik M, Lam F, Laversanne M, Colombet M, Mery L et al. Global Cancer Observatory: Cancer Today (version 1.1) Lyon, France: International Agency for Research on Cancer; 2024 [Available from: https://gco.iarc.who.int/today Reid BM, Permuth JB, Sellers TA. Epidemiology of ovarian cancer: a review. Cancer Biol Med. 2017;14(1):9–32. Cannistra SA. Cancer of the ovary. N Engl J Med. 2004;351(24):2519–29. Simmons AR, Baggerly K, Bast RC Jr. The emerging role of HE4 in the evaluation of epithelial ovarian and endometrial carcinomas. Oncol (Williston Park). 2013;27(6):548–56. Browning L, Patel MR, Horvath EB, Tawara K, Jorcyk CL. IL-6 and ovarian cancer: inflammatory cytokines in promotion of metastasis. Cancer Manag Res. 2018;10:6685–93. Nilsson MB, Langley RR, Fidler IJ. Interleukin-6, secreted by human ovarian carcinoma cells, is a potent proangiogenic cytokine. Cancer Res. 2005;65(23):10794–800. Han C, Bellone S, Siegel ER, Altwerger G, Menderes G, Bonazzoli E, et al. A novel multiple biomarker panel for the early detection of high-grade serous ovarian carcinoma. Gynecol Oncol. 2018;149(3):585–91. Chudecka-Głaz A, Rzepka-Górska I, Wojciechowska I. Human epididymal protein 4 (HE4) is a novel biomarker and a promising prognostic factor in ovarian cancer patients. Eur J Gynaec Oncol-ISSN. 2012;33(4):2012. Angeloni A, De Vito C, Farina A, Terracciano D, Cennamo M, Passerini R et al. New Analytical Approach for the Alignment of Different HE4 Automated Immunometric Systems: An Italian Multicentric Study. J Clin Med. 2022;11(7). Yang Z, Luo Z, Li L. Clinical value of serum human epididymis protein 4 assay in the diagnosis of ovarian cancer: a meta-analysis. OncoTargets therapy. 2013:957–66. Moore RG, Brown AK, Miller MC, Skates S, Allard WJ, Verch T, et al. The use of multiple novel tumor biomarkers for the detection of ovarian carcinoma in patients with a pelvic mass. Gynecol Oncol. 2008;108(2):402–8. Moore RG, Jabre-Raughley M, Brown AK, Robison KM, Miller MC, Allard WJ, et al. Comparison of a novel multiple marker assay vs the Risk of Malignancy Index for the prediction of epithelial ovarian cancer in patients with a pelvic mass. Am J Obstet Gynecol. 2010;203(3):228. e1-. e6. Dewan R, Dewan A, Jindal M, Bhardawaj M. Diagnostic Performance of Serum Human Epididymis Protein 4 (HE4) for Prediction of Malignancy in Ovarian Masses. Asian Pac J Cancer Prev. 2019;20(4):1103–8. Esteller M. Non-coding RNAs in human disease. Nat Rev Genet. 2011;12(12):861–74. Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. miRBase: tools for microRNA genomics. Nucleic Acids Res. 2008;36(Database issue):D154–8. Yokoi A, Yoshioka Y, Hirakawa A, Yamamoto Y, Ishikawa M, Ikeda SI, et al. A combination of circulating miRNAs for the early detection of ovarian cancer. Oncotarget. 2017;8(52):89811–23. Yokoi A, Matsuzaki J, Yamamoto Y, Yoneoka Y, Takahashi K, Shimizu H, et al. Integrated extracellular microRNA profiling for ovarian cancer screening. Nat Commun. 2018;9(1):4319. Medeiros LR, Rosa DD, da Rosa MI, Bozzetti MC. Accuracy of CA 125 in the diagnosis of ovarian tumors: a quantitative systematic review. Eur J Obstet Gynecol Reprod Biol. 2009;142(2):99–105. Buamah P. Benign conditions associated with raised serum CA-125 concentration. J Surg Oncol. 2000;75(4):264–5. Hu X, Zhang J, Cao Y. Factors associated with serum CA125 level in women without ovarian cancer in the United States: a population-based study. BMC Cancer. 2022;22(1):544. Sasamoto N, DePari M, Vitonis AF, Laufer MR, Missmer SA, Shafrir AL, et al. Evaluation of CA125 in relation to pain symptoms among adolescents and young adult women with and without surgically-confirmed endometriosis. PLoS ONE. 2020;15(8):e0238043. Gentry-Maharaj A, Burnell M, Dilley J, Ryan A, Karpinskyj C, Gunu R, et al. Serum HE4 and diagnosis of ovarian cancer in postmenopausal women with adnexal masses. Am J Obstet Gynecol. 2020;222(1):56. .e1-.e17 . Hertlein L, Stieber P, Kirschenhofer A, Fürst S, Mayr D, Hofmann K, et al. Human epididymis protein 4 (HE4) in benign and malignant diseases. Clin Chem Lab Med (CCLM). 2012;50(12):2181–8. Song Z, Wang X, Fu J, Wang P, Chen X, Zhang D. Copenhagen index (CPH-I) is more favorable than CA125, HE4, and risk of ovarian malignancy algorithm (ROMA): Nomogram prediction models with clinical-ultrasonographic feature for diagnosing ovarian neoplasms. Front Surg. 2023;9. Yuan C, Li R, Yan S, Kong B. Prognostic value of HE4 in patients with ovarian cancer. Clin Chem Lab Med (CCLM). 2018;56(7):1026–34. Ferraro S, Panteghini M. Making new biomarkers a reality: the case of serum human epididymis protein 4. Clin Chem Lab Med (CCLM). 2019;57(9):1284–94. Muhammad S, Azwan RJ, Rita RS, Susanti R, Yusrawati. The Role of Interleukin 6 (IL6), Cancer Antigen—125 (CA-125), and Human Epididymis Protein 4 (HE4) to predict tumor resectability in the advanced epithelial ovarian cancer patients. PLoS ONE. 2023;18(10):e0292282. Shi C, Zhang Z. The prognostic value of the miR-200 family in ovarian cancer: a meta-analysis. Acta Obstet Gynecol Scand. 2016;95(5):505–12. Savolainen K, Scaravilli M, Ilvesmäki A, Staff S, Tolonen T, Mäenpää JU, et al. Expression of the miR-200 family in tumor tissue, plasma and urine of epithelial ovarian cancer patients in comparison to benign counterparts. BMC Res Notes. 2020;13(1):311. Sanguinete MMM, Oliveira PH, Martins-Filho A, Micheli DC, Tavares-Murta BM, Murta EFC, et al. Serum IL-6 and IL-8 Correlate with Prognostic Factors in Ovarian Cancer. Immunol Invest. 2017;46(7):677–88. Meng X, Muller V, Milde-Langosch K, Trillsch F, Pantel K, Schwarzenbach H. Diagnostic and prognostic relevance of circulating exosomal miR-373, miR-200a, miR-200b and miR-200c in patients with epithelial ovarian cancer. Oncotarget. 2016;7(13):16923–35. Piatek S, Panek G, Lewandowski Z, Bidzinski M, Piatek D, Kosinski P, et al. Rising serum CA-125 levels within the normal range is strongly associated recurrence risk and survival of ovarian cancer. J Ovarian Res. 2020;13(1):102. Arroyo JD, Chevillet JR, Kroh EM, Ruf IK, Pritchard CC, Gibson DF, et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 2011;108(12):5003–8. Ali MG, FOUAD MS, EL-Shorbagy MIERAIM. Validity of estimation of IL-6 level over cancer antigen-125 (CA-125) with sonographic criteria in the prediction of ovarian cancer in patients with adnexal mass. Al-Azhar Int Med J. 2022;3(7):70–5. Kampan NC, Madondo MT, Reynolds J, Hallo J, McNally OM, Jobling TW, et al. Pre-operative sera interleukin-6 in the diagnosis of high-grade serous ovarian cancer. Sci Rep. 2020;10(1):2213. Amer H, Kartikasari AER, Plebanski M. Elevated Interleukin-6 Levels in the Circulation and Peritoneal Fluid of Patients with Ovarian Cancer as a Potential Diagnostic Biomarker: A Systematic Review and Meta-Analysis. J Pers Med. 2021;11(12). Omer B, Genc S, Takmaz O, Dirican A, Kusku-Kiraz Z, Berkman S, et al. The diagnostic role of human epididymis protein 4 and serum amyloid-A in early-stage endometrial cancer patients. Tumour Biol. 2013;34(5):2645–50. Hertlein L, Stieber P, Kirschenhofer A, Krocker K, Nagel D, Lenhard M, et al. Human epididymis protein 4 (HE4) in benign and malignant diseases. Clin Chem Lab Med. 2012;50(12):2181–8. Additional Declarations No competing interests reported. Supplementary Files TableS1b.xlsx Table S1: Table S1.xlsx Analysis of Akaike Information Criterion with CA125 and IL-6 in the serum as screening markers and their variable combinations in patients with EOC TableS2b.xlsx Table S2: Table S2.xlsx Analysis of Akaike Information Criterion for serum miRNAs and IL-6 as their variable combinations in patients between benign tumor vs. EOC with CA125 values using a threshold of 35 units/mL. FigureS1.docx Figure S1: Figure S1.docx miRNA expression in cultured cells. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6223812","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":435921771,"identity":"4adc32b5-68dc-45bf-a07d-a4debbfcb6b8","order_by":0,"name":"Rina Kawahara","email":"","orcid":"","institution":"Fujita Health University","correspondingAuthor":false,"prefix":"","firstName":"Rina","middleName":"","lastName":"Kawahara","suffix":""},{"id":435921772,"identity":"10120e53-ee83-423b-95f5-c69f3c023782","order_by":1,"name":"Eiji Nishio","email":"","orcid":"","institution":"Fujita Health University","correspondingAuthor":false,"prefix":"","firstName":"Eiji","middleName":"","lastName":"Nishio","suffix":""},{"id":435921773,"identity":"38824394-453a-4f41-aa27-b234d3436875","order_by":2,"name":"Aya Iwata","email":"","orcid":"","institution":"Fujita Health University","correspondingAuthor":false,"prefix":"","firstName":"Aya","middleName":"","lastName":"Iwata","suffix":""},{"id":435921774,"identity":"363c202b-d812-48f7-988d-955dc4befd14","order_by":3,"name":"Haruki Nishizawa","email":"","orcid":"","institution":"Fujita Health University","correspondingAuthor":false,"prefix":"","firstName":"Haruki","middleName":"","lastName":"Nishizawa","suffix":""},{"id":435921775,"identity":"0c7a782a-d190-4d9a-9a9e-e767744ba7f9","order_by":4,"name":"Naoki Yamamoto","email":"","orcid":"","institution":"Fujita Health University","correspondingAuthor":false,"prefix":"","firstName":"Naoki","middleName":"","lastName":"Yamamoto","suffix":""},{"id":435921776,"identity":"4216ef40-c8b0-4145-a16e-de0cba9605d2","order_by":5,"name":"Takuma Fujii","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYBAC9gaGhAMJDGzM/CBeQgERWngOgLQk8LFLNoC0GBCnBaRUjt8AzCBKi0TCwwMPf5hJG59fnfjhgQGDPL/YAYJaQA5LMza78XazBNBhhjNnJ+DXYg/RcizZ7MbZDSAtCQa3CWiB2vK/fvOMs5t/kKKFjdmAv3cbkbbwPABqSWNjlrjBu80iwUCCsF942HOSP/6wAUZl/9nNN39U2MjzSxPQAtQEVSEBpiUIKQcB9gMQmv8AMapHwSgYBaNgJAIAStdGGZahkmoAAAAASUVORK5CYII=","orcid":"","institution":"Fujita Health University","correspondingAuthor":true,"prefix":"","firstName":"Takuma","middleName":"","lastName":"Fujii","suffix":""}],"badges":[],"createdAt":"2025-03-14 05:53:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6223812/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6223812/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":79658063,"identity":"2ec99655-7546-40c1-b79c-f2e9dd4a031f","added_by":"auto","created_at":"2025-04-01 09:11:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":92162,"visible":true,"origin":"","legend":"\u003cp\u003eDetails of the study design\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6223812/v1/e68192de88a41550523ed117.png"},{"id":79659994,"identity":"ba2f0a5e-fb2e-4a5b-bf35-1a29ef73438f","added_by":"auto","created_at":"2025-04-01 09:27:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":97753,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression levels of two miRNAs, CA125, HE4 and IL-6. (A) Staging classification; (B) Histology; and (C) Recurrence. Expression levels, as determined by real-time RT-PCR, were corrected for the mean expression level of the normal group and are shown on the y-axis. The median value in each group was depicted in each box-plot. (A) *: \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 vs. normal, †: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 vs. benign tumors, ‡: \u0026nbsp;\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 vs. Stages I–II. (B) * \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 vs. normal, †: \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 vs. benign tumors. (C) *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 vs. no recurrence.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6223812/v1/70f913bb7bcd2c5441c74edc.png"},{"id":79658696,"identity":"a493fff2-0c2a-4565-888b-0655aaff01f8","added_by":"auto","created_at":"2025-04-01 09:19:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":175570,"visible":true,"origin":"","legend":"\u003cp\u003eDiagnostic value of individual and combined miRNAs, CA125, HE4 and IL-6 as markers in serum. ROC analyses were used for the discrimination of EOC. (A) ROC curves of Normal vs. EOC and benign tumors vs. EOC. (B) The performance of markers to detect EOC. AUC: area under the curve, NLR: negative likelihood ratio, NPV: negative predictive value, PLR: positive likelihood ratio. PPV: positive predictive value. The cutoff point of miRNAs and IL-6 was determined by the Youden index. Combination 1: Combination of miR-6134, CA125 and HE4; Combination 2: Combination of miR-6134, CA125, HE4 and IL-6 the best AUC combination determined by AIC (Table S1).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6223812/v1/e73f2d3907c50a5d15d35ad9.png"},{"id":79658077,"identity":"731dcd78-e3bd-4a76-9fdb-d2ce1072aecd","added_by":"auto","created_at":"2025-04-01 09:11:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":154483,"visible":true,"origin":"","legend":"\u003cp\u003eROC curves for benign tumors vs. EOC with CA125 values using a threshold of 35 units/mL. (A) ROC curves of benign tumors vs. EOC for CA125 ＜35 U/mL and CA125 ≧35 U/mL. (B) The performance of miRNAs to detect EOC. Combination 3: Combination of miR-200c-3p and -6134.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6223812/v1/05a0b350dfac22d8b773d2f8.png"},{"id":79658067,"identity":"70eaf2ff-8b1d-4a8d-8641-26a76771657d","added_by":"auto","created_at":"2025-04-01 09:11:34","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":69644,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression levels of miR-200c-3p and -6134 in frozen tissues. Box plots show the relative expression levels of (A) miR-200c-3p and (B) miR-6134, normalized to the mean expression level in benign tumors, which was set to 1.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6223812/v1/d528ba08c2b6bcb1726d4a7b.png"},{"id":79658076,"identity":"d9952ed8-1bb2-41e5-979c-35623911e4c4","added_by":"auto","created_at":"2025-04-01 09:11:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":536322,"visible":true,"origin":"","legend":"\u003cp\u003eThe cytoplasm of cancer cells was stained with an miR-6134 probe by ISH at ×20 objective. To confirm expression in tissues of cases in which miR-6134 is highly expressed in serum, ISH with a specific miR-6134 targeting nucleic acid probe was performed on formalin-fixed paraffin-embedded surgical specimens. Intense miR-6134 ISH signal was detected in the cytoplasmic region, predominantly in epithelial cancer cell. (A) Clear cell carcinoma with a negative signal. (B) Clear cell carcinoma with a positive signal. (C) High grade serous carcinoma with a negative signal. (D) High grade serous carcinoma with a positive signal. EOC, epithelial ovarian cancer; ISH, \u003cem\u003ein situ hybridization;\u003c/em\u003e miRNA, microRNA\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6223812/v1/4377e09e9ac9946b93e3b78d.png"},{"id":83470019,"identity":"67e5bc0e-b8d9-4faa-bc82-b02e87a18128","added_by":"auto","created_at":"2025-05-27 01:01:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2035633,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6223812/v1/96b03f38-a4fa-4742-999c-d07f0ddbae22.pdf"},{"id":79658068,"identity":"c240f625-7cec-4b15-b328-69e60d6d0d51","added_by":"auto","created_at":"2025-04-01 09:11:34","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":11688,"visible":true,"origin":"","legend":"\u003cp\u003eTable S1: Table S1.xlsx\u003c/p\u003e\n\u003cp\u003eAnalysis of Akaike Information Criterion with CA125 and IL-6 in the serum as screening markers and their variable combinations in patients with EOC\u003c/p\u003e","description":"","filename":"TableS1b.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6223812/v1/c7338ec5781ad64ecba06dc2.xlsx"},{"id":79658066,"identity":"53777abf-ac83-45c1-a717-879d29d80ad2","added_by":"auto","created_at":"2025-04-01 09:11:34","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":10266,"visible":true,"origin":"","legend":"\u003cp\u003eTable S2: Table S2.xlsx\u003c/p\u003e\n\u003cp\u003eAnalysis of Akaike Information Criterion for serum miRNAs and IL-6 as their variable combinations in patients between benign tumor vs. EOC with CA125 values using a threshold of 35 units/mL.\u003c/p\u003e","description":"","filename":"TableS2b.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6223812/v1/230388b2b8077aa6304d3cf7.xlsx"},{"id":79658070,"identity":"dd7d6a16-5065-4733-aaa2-8744f6c9ade4","added_by":"auto","created_at":"2025-04-01 09:11:34","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":282282,"visible":true,"origin":"","legend":"\u003cp\u003eFigure S1: Figure S1.docx\u003c/p\u003e\n\u003cp\u003emiRNA expression in cultured cells.\u003c/p\u003e","description":"","filename":"FigureS1.docx","url":"https://assets-eu.researchsquare.com/files/rs-6223812/v1/f060dddddc04eeab95c1bcb5.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Serum miR-200c-3p and -6134 as Biomarkers for Epithelial Ovarian Cancer: A Comprehensive analsis with CA125","fulltext":[{"header":"Background","content":"\u003cp\u003eGlobally, ovarian cancer is the most lethal gynecological cancer in women. In 2022, approximately 324,603 new ovarian cancer cases developed that comprised 1.6% of all cancer cases(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) with an estimated 206,956 deaths. The most common ovarian cancer is epithelial ovarian cancer (EOC). The prognosis of ovarian cancer is strongly dependent on the disease stage at the time of diagnosis: the 5-year survival rate for patients with stage I disease is 92%, which dramatically decreases to around 30% for those with advanced stages (stages II\u0026ndash;IV) (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Overall, cancer antigen (CA)125 is elevated in most cases of EOC, but in only half of early-stage EOC cases(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). In addition, serum CA125 levels are related to the release of CA125 not only from cancer cells, but also from the inflamed peritoneum (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). This lack of specificity means that new biomarkers are needed to improve the identification of patients with EOC. Computed tomography and magnetic resonance imaging are effective methods for identifying tumors, but have limitations in distinguishing between benign and malignant tumors. Ultimately, without surgical excision of the tumor, the determination is difficult; however, clinically useful ancilliary diagnostic methods for distinguishing between benign and malignant tumors would be valuable if developed. While CA125 serves as a somewhat effective early biomarker for malignant tumors, invasive cancer also exists that tests negative for CA125. Therefore, new tumor markers are required that compensate for false negative CA125 results. For instance, inflammation plays many roles in the growth of ovarian cancer tumor, with the proinflammatory cytokine interleukin-6 (IL-6) established as a key immunoregulatory cytokine (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Indeed, incorporating IL-6 alongside CA125 enhanced the potential for detecting serous ovarian cancer at earlier stages (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHuman epididymis protein 4 (HE4)is a promising biomarker for ovarian cancer, with serum levels significantly elevated in affected patients compared to healthy individuals (\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Clinical studies have demonstrated that combining HE4 with CA125 improves diagnostic specificity and aids in distinguishing malignant ovarian tumors from benign conditions (\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs), non-coding RNAs 19\u0026ndash;25 nucleotides in length, modulate gene expression by partially pairing with the 3\u0026prime; untranslated region of their target mRNAs (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). About two-thirds of human mRNAs are thought to be regulated by miRNAs (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Approximately 2,600 human miRNAs are currently recorded in the database, miRBase (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"http://www.mirbase.org\" target=\"_blank\"\u003ewww.mirbase.org\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.mirbase.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and specific miRNAs can act as oncogenes or tumor suppressors (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). MicroRNA is stably present not only in tissues but also in blood, and thus can potentially be a useful biomarker. In ovarian cancer tissues, various miRNAs are differentially expressed compared with matched normal tissues. Aberrant expression of miRNAs in ovarian cancer was previously investigated (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). However, the results of these studies were not always consistent, and were inconclusive with regard to the roles of miRNAs in supporting or suppressing ovarian carcinogenesis.\u003c/p\u003e \u003cp\u003eHere, we describe our identification of promising biomarkers for the diagnosis of EOC using serum specimens obtained from women, including patients with EOC, patients with benign ovarian tumors, and noncancerous control women.\u003c/p\u003e \u003cp\u003eThe aim of this study was to examine whether serum miRNAs and IL-6 are useful as biomarkers for EOC, and to estimate how a combination of miRNAs, CA125 and HE4 in serum can discriminate EOC from benign ovarian tumors. Furthermore, we investigated whether a relationship existed between levels of miRNAs in serum and tissue using surgical specimens and sera from the same patients.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy participants\u003c/h2\u003e \u003cp\u003eSerum specimens were obtained from patients, aged 19\u0026ndash;85 (median 47.5) years, who attended the outpatient clinic at Fujita Health University Hospital, Aichi prefecture, Japan, for routine gynecological examinations from August 2014 to December 2017. All sera were taken before treatments such as surgery or chemotherapy commenced. As a reference for noncancerous control (normal), serum was collected from patients with infertility issues, but not those with other diseases.\u003c/p\u003e \u003cp\u003eSerum specimens were obtained from patients with epithelial ovarian cancer (EOC; N\u0026thinsp;=\u0026thinsp;64, median age: 60 years) and non-cancerous controls (normal; N\u0026thinsp;=\u0026thinsp;40, median age: 38 years) for screening using miRNA microarray analysis and real-time reverse transcription (RT)-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Since obtaining biopsies from healthy volunteers raised ethical concerns, we recruited 40 healthy women undergoing infertility treatment as controls, defining them as \"normal\". Next, serum specimens from 250 patients were examined for expression of the selected candidate miRNAs, CA125, HE4 and IL-6. This N\u0026thinsp;=\u0026thinsp;250 population included N\u0026thinsp;=\u0026thinsp;104 used to select candidate miRNAs with complete normal (N\u0026thinsp;=\u0026thinsp;40) overlap. The sera of the 95 patients with EOC (median age: 57 years) were classified as histologic subtypes: clear cell (N\u0026thinsp;=\u0026thinsp;27), serous carcinoma (N\u0026thinsp;=\u0026thinsp;31), mucinous carcinoma (N\u0026thinsp;=\u0026thinsp;11), endometrioid carcinoma (N\u0026thinsp;=\u0026thinsp;16) and other subtypes (N\u0026thinsp;=\u0026thinsp;10). The staging classification for EOC were Stages I and II (N\u0026thinsp;=\u0026thinsp;57) and a more severe condition (N\u0026thinsp;=\u0026thinsp;38). With a median follow-up of 54 months (range 1\u0026ndash;90 months) across studies, the recurrence rate was 36.8% and the median time to recurrence was 13 months (range 1\u0026ndash;63 months). The number of serum samples taken from patients with a benign ovarian tumors (benign tumors) was 115 (median age: 44 years) as shown in Table\u0026nbsp;1.\u003c/p\u003e \u003cp\u003eFresh surgical specimens derived from patients with EOC (N\u0026thinsp;=\u0026thinsp;61) and benign tumors (N\u0026thinsp;=\u0026thinsp;10) were promptly immersed in RNAlater (Thermo Fisher Scientific, Waltham, MA, USA) in the operating room after tumor excision, and then frozen for preservation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFrom a patient cohort of 250 individuals, 104 specimens were used for extracting candidate miRNAs. The patients from whom the 71 frozen tissue specimens were derived were part of the population of 250 individuals; specimens were collected in the operating room. CA125, cancer antigen 125; EOC, epithelial ovarian cancer; HE4, human epididymis protein 4; IL-6, interleukin 6; miRNA, microRNA; RT-PCR, reverse transcription PCR\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eTable\u0026nbsp;1 Characteristics of the patient population (N\u0026thinsp;=\u0026thinsp;250)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNoncancerous control (Normal)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u0026thinsp;=\u0026thinsp;40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge, median (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e38 (26\u0026ndash;44)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBenign ovarian tumors\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u0026thinsp;=\u0026thinsp;115\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge, median (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e44 (19\u0026ndash;85)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHistology, N (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTeratoma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e32 (27.8%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMucinous cystadenoma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27 (23.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEndometriosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27 (23.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSerous cystadenoma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14 (12.2%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFibroma/Thecoma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 (8.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStruma ovarii\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2 (1.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOther subtypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3 (2.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCA125, N (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;35 U/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e77 (67.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;35 U/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e38 (33.0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eEpithelial ovarian cancer (EOC)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u0026thinsp;=\u0026thinsp;95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge, years, median (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e57 (26\u0026ndash;85)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFollow-up time: months, median (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e54 (1\u0026ndash;90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFIGO stage, N (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStages I\u0026ndash;II\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e57 (60%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStages III\u0026ndash;IV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e38 (40%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHistology, N (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClear cell carcinoma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27 (28.4%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEndometrioid carcinoma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16 (16.8%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSerous carcinoma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e31 (32.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMucinous carcinoma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11 (11.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOther subtypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 (10.5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCA125, N (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;35 U/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e23 (24.2%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;35 U/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e72 (75.8%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrognosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNon-recurrence\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRecurrence\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60 (63.2%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e35 (36.8%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge, years, median (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e55 (26\u0026ndash;78)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e61 (36\u0026ndash;85)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFollow-up time: months, median (range)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e52 (23\u0026ndash;90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13 (1\u0026ndash;67)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSurvival status\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDead\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAlive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15 (15.8%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e80 (84.2%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003cem\u003eFootnotes\u003c/em\u003e: CA125, cancer antigen 125; FIGO, International Federation of Gynecology and Obstetrics\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMicroRNA microarray analysis\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from 300 \u0026micro;L of serum using 3D-Gene RNA extraction reagent (Toray, Kamakura, Japan) according to the manufacturer\u0026rsquo;s instructions. The extracted total RNA was checked by Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and labeled with a 3D-Gene miRNA labeling kit (Toray). Half volumes of labeled RNAs were hybridized onto 3D-Gene Human miRNA Oligo chips (Toray). The annotation and oligonucleotide sequences of the probes were confirmed by miRBase miRNA database Release 21 (miRbase; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mirbase.org\u003c/span\u003e\u003cspan address=\"https://www.mirbase.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). After stringent washing, fluorescent signals were scanned with a 3D-Gene Scanner (Toray) and analyzed using 3D-Gene Extraction software (Toray). Raw data from each spot was normalized by substitution with a mean intensity of the background signal determined by all blank spot signal intensities and 95% confidence intervals (CI). Measurements of spots with signal intensities greater than 2 standard deviations of the background signal intensity were considered to be valid. The relative expression level of a given miRNA was calculated by comparing the signal intensities of the valid spots throughout the microarray experiments. The normalized data were globally normalized per array, such that the median of the signal intensity was adjusted to 25. The value of each gene was normalized by a method such that the median of the ovarian cancer to control ratio was equalized to one.\u003c/p\u003e\n\u003ch3\u003eReal-time RT-PCR for miRNA quantification\u003c/h3\u003e\n\u003cp\u003eTo normalize serum RNA extraction efficiency, a synthesized cel-miR-39 was used as a synthetic spike-in control RNA oligonucleotide (Thermo Fisher Scientific) as it has no mammalian homolog. Ten microlitres of 0.1 fmol/\u0026micro;L cel-miR-39 was added to each 200 \u0026micro;L of serum specimen. Total RNA, extracted from 200 \u0026micro;L of serum using an miRNeasy Mini Kit (QIAGEN GmbH, Hilden, Germany) yielded a final elution volume of 30 \u0026micro;L. For cDNA synthesis from 2 \u0026micro;L of total RNA, a TaqMan Advanced MicroRNA cDNA Synthesis Kit (Thermo Fisher Scientific) was used according to the manufacturer's instructions. Quantitative real-time RT-PCR was performed on 5.0 \u0026micro;L of a diluted (1:10) RT cDNA template using a 2X Fast Advanced Master Mix and 20X TaqMan Advanced miRNA Assays (both Thermo Fisher Scientific) on a QuantStudio7 (Thermo Fisher Scientific). TaqMan Advanced MicroRNA Assay probes were as follows: \u003cem\u003eHomo sapiens\u003c/em\u003e (hsa)-miR-16-5p (Assay ID: 477860_mir); hsa-miR-200c-3p (Assay ID: 478351_mir); hsa-miR-23b-3p (Assay ID: 483150_mir); hsa-miR-6134 (Assay ID: 480842_mir); and \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e cel-miR-39-3p (Assay ID: 478293_mir). Relative fold changes were determined from Ct values using the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCt method. Data were normalized to cel-miR-39-3p to account for possible differences in the amount of starting RNA.\u003c/p\u003e \u003cp\u003eTo examine the local expression of miR-200c-3p and \u0026minus;\u0026thinsp;6134, which exhibited high expression in serum of EOC, frozen tissues were collected during surgery from 61 patients with EOC from whom serum and 10 patients with a benign tumors were obtained. One hundred milligrams of frozen tissue was thoroughly homogenized in 1,000 \u0026micro;L of QIAzol Lysis Reagent using TaKaRa Biomasher Standard (Takara, Shiga, Japan), followed by total RNA extraction using an miRNeasy Mini Kit. MicroRNA was reverse transcribed using a TaqMan miRNA Reverse Transcription Kit and then quantified by quantitative real-time PCR according to the manufacturer's instructions, employing the following TaqMan MicroRNA Assays: hsa-miR-2003-3p (002300), hsa-miR-6134 (476896_mat), RNU48 (001006), and RNU44 (001094) (Thermo Fisher Scientific). MicroRNA levels were normalized against a combination of the average signal of both RNU48 and RNU44, and presented as\u0026thinsp;\u0026minus;\u0026thinsp;ΔCt values.\u003c/p\u003e\n\u003ch3\u003eMeasurement of CA125 and HE4\u003c/h3\u003e\n\u003cp\u003eSerum CA125 and HE4 levels were measured by a chemiluminescent enzyme immunoassay (SRL, Tokyo, Japan). The cutoff value for CA125 cutoff of 35 U/mL and HE4 cutoff of 70 pmol/L for premenopausal women and 140 pmol/L for postmenopausal women. However, since the study population did not ascertain menopausal age, considering that the average menopausal age among Japanese women is 50 years, we defined those below 50 years of age as 70 pmol/L and those 50 years or older as 140 pmol/L.\u003c/p\u003e\n\u003ch3\u003eEnzyme-linked immunosorbent assay\u003c/h3\u003e\n\u003cp\u003eThe concentration of serum IL-6 were determined by enzyme-linked immunosorbent assay (ELISA) using ELISA MAX\u0026trade; Deluxe sets for human IL-6 (BioLegend, Inc., San Diego, CA, USA), following protocols provided by the manufacturer.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMicroRNA in situ hybridization\u003c/h2\u003e \u003cp\u003eThe cellular localization of miRNA was examined in 81 surgical formalin-fixed paraffin-embedded specimens of patients with EOC. Double (3\u0026prime;and 5\u0026prime;) digoxigenin-labeled miRCURY LNA detection probes (Exiqon, Vedbaek, Denmark) were used for visualization of the following miRNAs: hsa-miR-200c-3p (probe sequence: TCCATCATTACCCGGCAGTAT, Tm\u0026thinsp;=\u0026thinsp;84\u0026deg;C), hsa-miR-6134 (probe sequence: TCTACATCCTACCACCTCA, Tm\u0026thinsp;=\u0026thinsp;84\u0026deg;C), and U6 (CACGAATTTGCGTGTCATCCTT, Tm\u0026thinsp;=\u0026thinsp;84\u0026deg;C) as a positive control. For \u003cem\u003ein situ hybridization\u003c/em\u003e (ISH), 3-\u0026micro;m\u0026ndash;thick sections of formalin-fixed paraffin-embedded tissues were mounted on Superfrost glass slides and deparaffinized in xylene baths, followed by serial dilutions of ethanol and phosphate buffered saline (PBS). The slides were then immersed in 0.3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 10 min at room temperature, washed twice with PBS, digested with 20 \u0026micro;g/mL proteinase K (Exiqon) at 37\u0026deg;C for 15 min, and washed twice with PBS. The slides were pre-hybridized at 53\u0026deg;C for 30 min in hybridization buffer (Exiqon) and then hybridized at 53\u0026deg;C for 1 h with 40 nM probes for miR-6134 or 20 nM probes for U6 in hybridization buffer. After stringent saline sodium citrate washes, the slides were blocked with Protein Block Serum-free (Agilent Technologies, Santa Clara, CA, USA) and incubated with anti-digoxigenin\u0026ndash;horse-radish peroxidase (POD), Fab fragments from sheep (Roche, Mannheim, Germany) diluted to 1:100 at 37\u0026deg;C for 1 h. POD signals were visualized using a Liquid DAB\u0026thinsp;+\u0026thinsp;Substrate Chromogen System (Agilent Technologies), and slides were stained with hematoxylin for nuclear staining. The slides were then dehydrated and mounted with a coverslip. A microscope (Power BX-51; Olympus, Tokyo, Japan) was used for observation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were performed using SPSS for Windows (ver. 22.0.0.0; IBM Corp, Armonk, NY, USA). Data were analyzed by two-tailed Mann\u0026ndash;Whitney \u003cem\u003eU\u003c/em\u003e tests. We defined \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 as significant. We used a conventional receiver operating characteristic curve (ROC) curve with a Youden index to analyze miRNA and IL-6 levels to determine the cutoff points that yielded the highest combined sensitivity and specificity with respect to distinguishing patients with cancer from those with a normal histology. The interpretation of AUC was as follows: 1.0, perfect match; 1.0\u0026ndash;0.9, high accuracy; 0.9\u0026ndash;0.7, moderate accuracy; 0.7\u0026ndash;0.5, low accuracy; and 0.5, chance result. We used Akaike information criterion (AIC) to compare the goodness-of-fit of each model of combined miRNAs, and unified different markers to determine the predictive probability through logistic regression and then constructed ROC curves according to probability.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of miRNAs up-regulated in serum of patients with EOC\u003c/h2\u003e \u003cp\u003eTo identify miRNAs that were up-regulated in the serum of patients with EOC compared to noncancerous control (normal) sera, we performed miRNA microarray analysis using total RNA extracted from serum samples. Four miRNAs (miR-16-5p, -23b-3p, -200c-3p and \u0026minus;\u0026thinsp;6134) were selected as potential biomarker candidates according to the following criteria: the absolute value of the signal intensity was more than 10; and the fold change of EOC vs. normal was more than 2 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Real-time RT-PCR was used to further validate the four candidate miRNAs. two miRNAs (miR-200c-3p and \u0026minus;\u0026thinsp;6134) showed high expression fold changes; EOC vs. normal were 3.2 and 2.4, respectively. Accordingly, using miRNA microarray analysis and real-time RT-PCR, we identified miR-200c-3p and \u0026minus;\u0026thinsp;6134 as showing significant high expression in the sera of patients with EOC.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003emiRNA microarray analysis and real-time RT-PCR for screening\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003emiRNAs\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eMicroarray analysis\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eReal-time RT-PCR\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eGlobal normalization\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eEOC/Normal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEOC/Normal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMann-Whitney \u003cem\u003eU\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEOC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFold change\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFold change\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehsa-miR-16-5p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e35.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehsa-miR-23b-3p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e35.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.059\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehsa-miR-200c-3p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5.2.E-07*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ehsa-miR-6134\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.9.E-04*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"6\" nameend=\"c6\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFootnotes\u003c/em\u003e: EOC, epithelial ovarian cancer; miRNA, microRNA; RT-PCR, real-time reverse transcription PCR; *: \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 statistically significant\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAssociation between expression of candidate biomarkers and clinical staging classification, histology, and recurrence\u003c/h2\u003e \u003cp\u003eWe explored associations between expression levels of the two miRNAs, CA125, HE4 and IL-6 with disease severity, histological classification, and recurrence (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In an analysis based on clinical staging classifications, the expression level of miR-200c-3p showed a significant increase between benign tumors and EOC. The expression level of miR-6134 significantly increased with severity of disease, when comparing normal control and benign tumors to stage I\u0026ndash;II and more advanced stages. No significant difference was found between normal and benign tumors in CA125, HE4 and in IL-6. The expression of miR-6134, CA125 and HE4 showed significant differences for all histological classifications compared to the normal control and benign tumor groups. MiR-200c-3p were also significantly different with all histological classifications when compared with benign tumors. In contrast, IL-6 showed no significant difference for the mucinous carcinoma group. When investigated for the presence of recurrence, miR-200c-3p, CA125, and IL-6 showed significantly higher values in recurrent cases; however, miR-6134 and HE4 did not show a significant difference.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eClinical utility of assessing miRNA levels in combination with CA125 for the detection of EOC\u003c/h2\u003e \u003cp\u003eThe diagnostic performance of the miRNAs, CA125, HE4 and IL-6 as markers for EOC in serum was compared between normal vs. EOC and benign tumor vs. EOC groups. ROC curves were constructed, and the AUC was calculated to assess diagnostic performance (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). In a comparison of normal control and EOC groups, the AUC indicated that HE4 was the most accurate marker (AUC\u0026thinsp;=\u0026thinsp;0.929), followed by CA125 (AUC\u0026thinsp;=\u0026thinsp;0.870) and miR-6134 (AUC\u0026thinsp;=\u0026thinsp;0.818). In contrast, for benign tumor vs. EOC groups, the AUC was highest for miR-6134 (AUC\u0026thinsp;=\u0026thinsp;0.933), followed by that of HE4 (AUC\u0026thinsp;=\u0026thinsp;0.882) and miR-200c-3p (AUC\u0026thinsp;=\u0026thinsp;0.848).\u003c/p\u003e \u003cp\u003eConsidering the average menopausal age of Japanese women, we set the cutoff value for HE4 at 70 pmol/L for those under 50 years old and 140 pmol/L for those 50 years and over. Although HE4 showed a high AUC, its sensitivity was 0.568 for both normal vs EOC and benign tumors vs EOC.\u003c/p\u003e \u003cp\u003eThe Akaike Information Criterion (AIC) was used to determine which factors should be enrolled in the final model (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The combination of miR-6134, CA125, and HE4, designated as combination 1, showed the lowest AIC when discriminating normal from EOC groups. This showed an AUC of 0.961 (95% CI, 0.931\u0026ndash;0.961). Combination 2, consisting of miR-6134, CA125, HE4, and IL-6, showed the best AUC performance providing an AUC of 0.968 (95% confidence interval, 0.942\u0026ndash;0.995) in benign tumors vs. EOC (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eVerification of the separation ability to distinguish benign tumors from EOC below the cutoff level of CA125\u003c/em\u003e \u003c/p\u003e \u003cp\u003eWe evaluated the ability of candidate miRNAs to distinguish benign tumors from EOC in patients stratified by CA125 levels using a cutoff value (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Among cases with CA125 below the cutoff of 35 U/mL, miR-6134 demonstrated the highest discriminatory ability (AUC\u0026thinsp;=\u0026thinsp;0.927), followed by miR-200c-3p (AUC\u0026thinsp;=\u0026thinsp;0.843). The combined performance of miR-200c-3p and \u0026minus;\u0026thinsp;6134, designated as combination 3, when CA125\u0026thinsp;\u0026lt;\u0026thinsp;35 U/mL revealed AUC\u0026thinsp;=\u0026thinsp;0.935 and for CA125\u0026thinsp;\u0026ge;\u0026thinsp;35 U/mL it was 0.934 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Even in cases where CA125 was below the cutoff, the combination of miR-200c-3p and miR-6134 discriminated EOC from benign tumors. Therefore, the AUC indicated that combined miR-200c-3p and \u0026minus;\u0026thinsp;6134 were accurate markers when CA125 was \u0026lt;\u0026thinsp;35 U/mL or \u0026ge;\u0026thinsp;35 U/mL.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eExpression of miRNAs in surgical tissues\u003c/h2\u003e \u003cp\u003eBoth miR-200c-3p and \u0026minus;\u0026thinsp;6134 showed no significant difference in expression levels between benign tumors and EOC in frozen tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B). A significant difference was not also observed between stages I\u0026ndash;II and more advanced stages, nor between recurrence and non-recurrence groups (data not shown). No correlation was observed between serum and the tissue in which miRNAs were expressed. Despite the expression of miR-200c-3p and \u0026minus;\u0026thinsp;6134 being examined in several cultured cell lines, including ovarian cancer, expression levels varied widely between cell types, and no trend in expression by cancer type was observed (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Overall, the expression levels of miR200c-3p and \u0026minus;\u0026thinsp;6134 in frozen tissues and various cultured cells behaved differently from those in serum.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eIntense signal of miR-6134 in surgical specimens by ISH\u003c/h2\u003e \u003cp\u003eWe examined the localization of expression of miRNA signals in surgical specimens by ISH (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Of 81 EOC specimens, miR-6134 was positive in the cytoplasm of 15 cases (69%) of clear cell carcinoma and of 18 cases (69%) of serous carcinoma, respectively. We attempted to detect miR-200c-3p using the same specimens but did not obtain a signal. Namely, miR-6134 was detected in a majority of EOC surgical specimens by ISH and miR-200c-3p was uninformative.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eConsidered a promising non-invasive tumor biomarker with a moderate diagnostic value, serum CA125 was found by others to have a sensitivity of 0.80 and a specificity of 0.75 for diagnosing ovarian cancer (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). In comparison, in our study, CA125 was an excellent biomarker with a specificity of 0.875 and a sensitivity of 0.758. However, although the CA125 level was found to be elevated in the serum of patients with EOC, this marker has a low sensitivity in the early stages of EOC (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Elevated CA125 levels have also been reported in other physiological or pathological conditions such as menstruation, pregnancy, endometriosis, and inflammatory diseases of the peritoneum (\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Therefore, the development of more accurate biomarkers is desired for patients with EOC.\u003c/p\u003e \u003cp\u003eHE4 has been recognized as one of the most promising tests for early detection of ovarian cancer (\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). When combined with CA125, its sensitivity and specificity for detecting malignancies in adnexal masses improve significantly compared to CA125 alone (\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). However, despite its clinical utility, HE4 levels can be influenced by various benign and malignant diseases, and differences in cutoff values due to racial and patient background variations have prevented it from becoming a definitive diagnostic tool (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan additionalcitationids=\"CR23 CR24 CR25 CR26\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). In our study, HE4 demonstrated high diagnostic performance for distinguishing between normal controls and EOC, showing the highest AUC (0.929) among the markers analyzed. However, when comparing benign tumors with EOC, miR-6134 exhibited the highest AUC (0.933), followed by HE4 (AUC\u0026thinsp;=\u0026thinsp;0.882) and miR-200c-3p (AUC\u0026thinsp;=\u0026thinsp;0.848). These findings suggest that HE4 remains a highly useful biomarker for ovarian cancer detection, particularly in differentiating malignant cases from normal controls. However, its performance in distinguishing benign tumors from EOC may be surpassed by miRNA markers. Importantly, when assessing the sensitivity of HE4 using the predetermined cutoff value, the sensitivity was found to be 0.568 in both normal vs. EOC and benign tumors vs. EOC comparisons. This relatively low sensitivity underscores the limitation of HE4 as a standalone diagnostic marker, aligning with previous reports that highlight the challenges associated with defining an optimal cutoff value across different populations (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan additionalcitationids=\"CR23 CR24 CR25 CR26\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). These findings further reinforce the need to consider complementary biomarkers. Indeed, our analysis revealed that the combination of miR-6134, CA125, and HE4 (Combination 1) demonstrated the best discrimination between normal and EOC cases (AUC\u0026thinsp;=\u0026thinsp;0.961, 95% CI: 0.931\u0026ndash;0.961), while the combination of miR-6134, CA125, HE4, and IL-6 (Combination 2) achieved the highest AUC (0.968, 95% CI: 0.942\u0026ndash;0.995) for differentiating benign tumors from EOC.\u003c/p\u003e \u003cp\u003eFurthermore, in cases with CA125\u0026thinsp;\u0026lt;\u0026thinsp;35 U/mL, miR-6134 showed a sensitivity of 0.826, a specificity of 0.974, and a high accuracy of 0.94. We demonstrated combining miR200c-3p with \u0026minus;\u0026thinsp;6134 further improved the ability to discriminate EOC from benign tumors below the 35 U/mL cutoff value of CA125.\u003c/p\u003e \u003cp\u003eThese results highlight the potential of multi-marker panels in improving diagnostic accuracy beyond individual biomarkers. Previous studies have shown that the miR-200 family is significantly detected in ovarian cancer tissues compared to normal (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). Our study quantified the expression levels of serum miRNAs from our original microarray screening and showed that two miRNAs, miR-200c-3p and \u0026minus;\u0026thinsp;6134, were significantly upregulated as shown by real-time RT-PCR. Of these miRNAs, the biological behavior and cellular role of miR-6134 have not been well described to date. Also consistent with the results of previous studies(\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e), we found that expression levels of miR-200c-3p, CA125, and IL-6 were significantly higher in cases showing a recurrence of disease compared to those without any recurrence. In contrast, expression levels of miR-6134 did not correlate with recurrence status. In our study, we investigated the correlation between pre-intervention blood sampling results and subsequent recurrence events. We were particularly interested in elucidating whether conducting longitudinal blood sampling after an intervention could predict future recurrences; this is the intended subject of future research.\u003c/p\u003e \u003cp\u003eAbundant in circulating blood, miRNAs are bound in protein complexes or packed into extracellular vesicles, and thus exist in highly stable forms that are resistant to degradation (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). MicroRNAs have attracted the attention of researchers due to their critical role in tumor development and progression, leading to the emergence of many studies on the diagnostic value of miRNAs. However, findings are controversial because of the various study designs used. Therefore, we conducted an analysis of the utility of miRNAs as tumor markers with serum and tissues from the same patients by measuring not only miRNAs selected through our own screening, but also clinically used CA125 and more recently noted IL-6 (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn order to confirm the validity of miRNA as a serum tumor marker, we investigated the expression of miRNA in surgically resected specimens using two methods. One was real-time RT-PCR using frozen specimens, and the other was ISH using paraffin-embedded tissues. The latter offers the advantage of analyzing local expression at the cellular level in the tumor. However, it was expected to have low detection sensitivity. Indeed, mir-6134 was detected in 58\u0026ndash;69% of clear cell carcinoma and serous carcinoma specimens, confirming that miRNA is expressed by tumor cells. Conversely, we were unable to analyze the expression of mir-200c-3p by ISH, perhaps because of poor compatibility between the probe and tissue samples collected. Utilizing the same methodology as for serum, real-time RT-PCR offers the advantage of an easy comparison of expression levels between serum and tissue. However, since it analyzes only a portion of an excised tumor, its detection sensitivity is expected to decrease due to tumor heterogeneity. Our results revealed no correlation between expression levels in tumors and serum, and no clinically useful information was obtained from a tissue-based analysis or cultured cells. While miRNAs are expressed in the tumor, we speculate these behave differently from miRNAs in serum. We speculate that the inconsistent results in previous studies may be related to differences in the type of research specimens used, whether they were serum or tissue.\u003c/p\u003e \u003cp\u003eThe advantageous aspects of this study are as follows: Although studies on miRNA using tissue specimens have been widely reported, we conducted screening using microarray with serum obtained from our facility, and identified miR-200c-3p and \u0026minus;\u0026thinsp;6314 candidates through validation using real-time RT-PCR. By using normal and benign tumors samples as well as samples from patients with EOC, we were able to construct ROC curves. Additionally, we were able to investigate the expression levels of miRNA using tumors from patients who had provided serum.\u003c/p\u003e \u003cp\u003eSeveral limitations exist in this study. Firstly, validation using another set of the cohort should be conducted in future to confirm its accuracy as a biomarker for EOC (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e).This study suggests two potential clinical utilities. One is the potential for tumor markers to be used as a screening tool in the general population. If this is the goal, large-scale studies using specimens from the general population would be necessary to validate our finding. Another clinical utility may be in the differentiation between benign and malignant tumors when tumors are detected on imaging examinations. An assessment of samples from multiple facilities would be required to support our finding. Another limitation is that the analysis of HE4 was stratified at age 50, assuming menopausal status, which can only be definitively determined retrospectively, making clear differentiation difficult, for example, in patients aged 50 regarding their menopausal status.\u003c/p\u003e \u003cp\u003eIn conclusion, miR-6134 was newly detected in patient sera and may be a promising biomarker for identifying EOC. We found that a combination of two miRNAs; miR200c-3p and \u0026minus;\u0026thinsp;6134 and CA125 can more accurately diagnose EOC. The increase in miR200c-3p and \u0026minus;\u0026thinsp;6134 in EOC suggests a potential utility in correctly diagnosing patients, deemed normal or benign tumors due to CA125\u0026thinsp;\u0026lt;\u0026thinsp;35 U/mL, as instead having cancer.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eWe identified miR-6134 as a novel biomarker for EOC and demonstrated its diagnostic potential. The combination of miR-200c-3p and miR-6134, improved the accuracy of EOC detection, particularly in cases with CA125\u0026thinsp;\u0026lt;\u0026thinsp;35 U/mL. Our findings highlight the importance of using multiple biomarkers together to enhance diagnostic precision. Further validation in larger, multi-institutional cohorts is warranted to confirm the clinical utility of these biomarkers and support their potential application in EOC screening and differential diagnosis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e- Approval of the research protocol by an Institutional Reviewer Board: The study protocol was approved by the Ethics Committees of Fujita Health University (HM22-516).\u003c/p\u003e\n\u003cp\u003e- Informed Consent: Written informed consent was obtained from each patient. All procedures were performed in accordance with the approved guidelines and regulations.\u003c/p\u003e\n\u003cp\u003e- Registry and the Registration No. of the study/trial: N/A\u003c/p\u003e\n\u003cp\u003e- Animal Studies: N/A\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003enot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur microarray data is available in the Gene Expression Omnibus database (https://www.ncbi.nlm.nih.gov/geo/; accession numbers GSE201712). The other datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was partly supported by KAKENHI from the Ministry of Education, Culture, Sports, Science and Technology, Japan (Grant No. 23K08812) and a Fujita Health University Research Grant-in-Aid.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eR. K.: investigation, resources, writing \u0026ndash; original draft, E. N.: resources, A. I.: investigation, data curation, formal analysis, methodology, writing \u0026ndash; original draft, H.N.: funding acquisition, review, N. Y.: investigation, T.F.: conceptualization, data curation, resources, writing \u0026ndash; original draft, funding acquisition, project administration\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Ms. Nakagawa, Department of Obstetrics and Gynecology, Fujita Health University for assistance and Dr. Iwata, Department of Obstetrics and Gynecology, Keio University, School of Medicine for providing cultured cells. We thank NAI Inc. for editing the English text of a draft of this manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eFerlay J, Ervik M, Lam F, Laversanne M, Colombet M, Mery L et al. Global Cancer Observatory: Cancer Today (version 1.1) Lyon, France: International Agency for Research on Cancer; 2024 [Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://gco.iarc.who.int/today\u003c/span\u003e\u003cspan address=\"https://gco.iarc.who.int/today\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReid BM, Permuth JB, Sellers TA. Epidemiology of ovarian cancer: a review. Cancer Biol Med. 2017;14(1):9\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCannistra SA. Cancer of the ovary. N Engl J Med. 2004;351(24):2519\u0026ndash;29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimmons AR, Baggerly K, Bast RC Jr. The emerging role of HE4 in the evaluation of epithelial ovarian and endometrial carcinomas. Oncol (Williston Park). 2013;27(6):548\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrowning L, Patel MR, Horvath EB, Tawara K, Jorcyk CL. IL-6 and ovarian cancer: inflammatory cytokines in promotion of metastasis. Cancer Manag Res. 2018;10:6685\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNilsson MB, Langley RR, Fidler IJ. Interleukin-6, secreted by human ovarian carcinoma cells, is a potent proangiogenic cytokine. Cancer Res. 2005;65(23):10794\u0026ndash;800.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan C, Bellone S, Siegel ER, Altwerger G, Menderes G, Bonazzoli E, et al. A novel multiple biomarker panel for the early detection of high-grade serous ovarian carcinoma. Gynecol Oncol. 2018;149(3):585\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChudecka-Głaz A, Rzepka-G\u0026oacute;rska I, Wojciechowska I. Human epididymal protein 4 (HE4) is a novel biomarker and a promising prognostic factor in ovarian cancer patients. Eur J Gynaec Oncol-ISSN. 2012;33(4):2012.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAngeloni A, De Vito C, Farina A, Terracciano D, Cennamo M, Passerini R et al. New Analytical Approach for the Alignment of Different HE4 Automated Immunometric Systems: An Italian Multicentric Study. J Clin Med. 2022;11(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Z, Luo Z, Li L. Clinical value of serum human epididymis protein 4 assay in the diagnosis of ovarian cancer: a meta-analysis. OncoTargets therapy. 2013:957\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoore RG, Brown AK, Miller MC, Skates S, Allard WJ, Verch T, et al. The use of multiple novel tumor biomarkers for the detection of ovarian carcinoma in patients with a pelvic mass. Gynecol Oncol. 2008;108(2):402\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoore RG, Jabre-Raughley M, Brown AK, Robison KM, Miller MC, Allard WJ, et al. Comparison of a novel multiple marker assay vs the Risk of Malignancy Index for the prediction of epithelial ovarian cancer in patients with a pelvic mass. Am J Obstet Gynecol. 2010;203(3):228. e1-. e6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDewan R, Dewan A, Jindal M, Bhardawaj M. Diagnostic Performance of Serum Human Epididymis Protein 4 (HE4) for Prediction of Malignancy in Ovarian Masses. Asian Pac J Cancer Prev. 2019;20(4):1103\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsteller M. Non-coding RNAs in human disease. Nat Rev Genet. 2011;12(12):861\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGriffiths-Jones S, Saini HK, van Dongen S, Enright AJ. miRBase: tools for microRNA genomics. Nucleic Acids Res. 2008;36(Database issue):D154\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYokoi A, Yoshioka Y, Hirakawa A, Yamamoto Y, Ishikawa M, Ikeda SI, et al. A combination of circulating miRNAs for the early detection of ovarian cancer. Oncotarget. 2017;8(52):89811\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYokoi A, Matsuzaki J, Yamamoto Y, Yoneoka Y, Takahashi K, Shimizu H, et al. Integrated extracellular microRNA profiling for ovarian cancer screening. Nat Commun. 2018;9(1):4319.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMedeiros LR, Rosa DD, da Rosa MI, Bozzetti MC. Accuracy of CA 125 in the diagnosis of ovarian tumors: a quantitative systematic review. Eur J Obstet Gynecol Reprod Biol. 2009;142(2):99\u0026ndash;105.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuamah P. Benign conditions associated with raised serum CA-125 concentration. J Surg Oncol. 2000;75(4):264\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu X, Zhang J, Cao Y. Factors associated with serum CA125 level in women without ovarian cancer in the United States: a population-based study. BMC Cancer. 2022;22(1):544.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSasamoto N, DePari M, Vitonis AF, Laufer MR, Missmer SA, Shafrir AL, et al. Evaluation of CA125 in relation to pain symptoms among adolescents and young adult women with and without surgically-confirmed endometriosis. PLoS ONE. 2020;15(8):e0238043.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGentry-Maharaj A, Burnell M, Dilley J, Ryan A, Karpinskyj C, Gunu R, et al. Serum HE4 and diagnosis of ovarian cancer in postmenopausal women with adnexal masses. Am J Obstet Gynecol. 2020;222(1):56. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.e1-.e17\u003c/span\u003e\u003cspan address=\"http://.e1-.e17\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHertlein L, Stieber P, Kirschenhofer A, F\u0026uuml;rst S, Mayr D, Hofmann K, et al. Human epididymis protein 4 (HE4) in benign and malignant diseases. Clin Chem Lab Med (CCLM). 2012;50(12):2181\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong Z, Wang X, Fu J, Wang P, Chen X, Zhang D. Copenhagen index (CPH-I) is more favorable than CA125, HE4, and risk of ovarian malignancy algorithm (ROMA): Nomogram prediction models with clinical-ultrasonographic feature for diagnosing ovarian neoplasms. Front Surg. 2023;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan C, Li R, Yan S, Kong B. Prognostic value of HE4 in patients with ovarian cancer. Clin Chem Lab Med (CCLM). 2018;56(7):1026\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerraro S, Panteghini M. Making new biomarkers a reality: the case of serum human epididymis protein 4. Clin Chem Lab Med (CCLM). 2019;57(9):1284\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuhammad S, Azwan RJ, Rita RS, Susanti R, Yusrawati. The Role of Interleukin 6 (IL6), Cancer Antigen\u0026mdash;125 (CA-125), and Human Epididymis Protein 4 (HE4) to predict tumor resectability in the advanced epithelial ovarian cancer patients. PLoS ONE. 2023;18(10):e0292282.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi C, Zhang Z. The prognostic value of the miR-200 family in ovarian cancer: a meta-analysis. Acta Obstet Gynecol Scand. 2016;95(5):505\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSavolainen K, Scaravilli M, Ilvesm\u0026auml;ki A, Staff S, Tolonen T, M\u0026auml;enp\u0026auml;\u0026auml; JU, et al. Expression of the miR-200 family in tumor tissue, plasma and urine of epithelial ovarian cancer patients in comparison to benign counterparts. BMC Res Notes. 2020;13(1):311.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanguinete MMM, Oliveira PH, Martins-Filho A, Micheli DC, Tavares-Murta BM, Murta EFC, et al. Serum IL-6 and IL-8 Correlate with Prognostic Factors in Ovarian Cancer. Immunol Invest. 2017;46(7):677\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeng X, Muller V, Milde-Langosch K, Trillsch F, Pantel K, Schwarzenbach H. Diagnostic and prognostic relevance of circulating exosomal miR-373, miR-200a, miR-200b and miR-200c in patients with epithelial ovarian cancer. Oncotarget. 2016;7(13):16923\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiatek S, Panek G, Lewandowski Z, Bidzinski M, Piatek D, Kosinski P, et al. Rising serum CA-125 levels within the normal range is strongly associated recurrence risk and survival of ovarian cancer. J Ovarian Res. 2020;13(1):102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArroyo JD, Chevillet JR, Kroh EM, Ruf IK, Pritchard CC, Gibson DF, et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A. 2011;108(12):5003\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAli MG, FOUAD MS, EL-Shorbagy MIERAIM. Validity of estimation of IL-6 level over cancer antigen-125 (CA-125) with sonographic criteria in the prediction of ovarian cancer in patients with adnexal mass. Al-Azhar Int Med J. 2022;3(7):70\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKampan NC, Madondo MT, Reynolds J, Hallo J, McNally OM, Jobling TW, et al. Pre-operative sera interleukin-6 in the diagnosis of high-grade serous ovarian cancer. Sci Rep. 2020;10(1):2213.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmer H, Kartikasari AER, Plebanski M. Elevated Interleukin-6 Levels in the Circulation and Peritoneal Fluid of Patients with Ovarian Cancer as a Potential Diagnostic Biomarker: A Systematic Review and Meta-Analysis. J Pers Med. 2021;11(12).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOmer B, Genc S, Takmaz O, Dirican A, Kusku-Kiraz Z, Berkman S, et al. The diagnostic role of human epididymis protein 4 and serum amyloid-A in early-stage endometrial cancer patients. Tumour Biol. 2013;34(5):2645\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHertlein L, Stieber P, Kirschenhofer A, Krocker K, Nagel D, Lenhard M, et al. Human epididymis protein 4 (HE4) in benign and malignant diseases. Clin Chem Lab Med. 2012;50(12):2181\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"biomarker, epithelial ovarian cancer, miRNA, serum","lastPublishedDoi":"10.21203/rs.3.rs-6223812/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6223812/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eMicroRNAs (miRNAs) regulate gene expression in epithelial ovarian cancer (EOC). In a single-center, retrospective study, we aimed to assess serum miRNAs as EOC biomarkers, and whether combined miRNAs and cancer antigen (CA)125 discriminated EOC from benign ovarian tumors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eSera were collected from patients with EOC (N=95) or benign ovarian tumors (N=115), and from healthy controls (N=40). Candidate serum miRNAs were screened by miRNA microarray and quantified by real-time reverse transcription (RT)-PCR. Serum CA125 was measured by enzyme-linked immunosorbent assay.\u003c/p\u003e\n\u003cp\u003eReal-time RT-PCR revealed highly expressed miR-200c-3p and -6134 in EOC. These miRNAs and CA125 correlated with disease severity and histological classification. In EOC vs. healthy controls, miR-200c-3p and -6134 were significantly upregulated; the area under the curve (AUC)=0.693 (95% confidence interval [CI]: 0.606–0.780) and 0.818 (0.749–0.888), respectively. Levels of miR-200c-3p, -6134, and CA125 were significantly upregulated in EOC vs. benign ovarian tumors; AUC=0.848 (95% CI: 0.792–0.904), 0.933 (95% CI: 0.891–0.975), and 0.811 (95% CI: 0.752–0.871), respectively. Combined with CA125, the two miRNAs showed AUC=0.907 (95% CI: 0.855–0.959) in normal vs. EOC and 0.952 (95% CI, 0.919–0.985) in benign tumors vs. EOC. For combined miR-200c-3p and -6134, AUC=0.935 (CA125 \u0026lt; 35 U/mL) and 0.934 (CA125 ≥ 35 U/mL).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eFor CA125 \u0026lt; 35 U/mL, combined miR-200c-3p and miR-6134 distinguished EOC from benign ovarian tumors with high discriminative power. Combining two miRNAs with CA125 improved diagnostic accuracy, highlighting the potential of miR-200c-3p and -6134 as ancillary markers for detecting EOC, especially in cases with normal CA125 levels.\u003c/p\u003e","manuscriptTitle":"Serum miR-200c-3p and -6134 as Biomarkers for Epithelial Ovarian Cancer: A Comprehensive analsis with CA125","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-01 09:11:29","doi":"10.21203/rs.3.rs-6223812/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7c259c73-153b-4979-84fe-92da8273bcc6","owner":[],"postedDate":"April 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-05-27T00:53:29+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-01 09:11:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6223812","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6223812","identity":"rs-6223812","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}